Microbiological quality of ready-to-eat vegetable salads served at meat restaurants under the COVID 19 pandemic induced food demand: an example from Eastern Turkey | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Microbiological quality of ready-to-eat vegetable salads served at meat restaurants under the COVID 19 pandemic induced food demand: an example from Eastern Turkey Alper Baran, Mehmet Cemal Adigüzel, Hakan Aydin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1736848/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Oct, 2022 Read the published version in Revista Científica de la Facultad de Ciencias Veterinarias → Version 1 posted You are reading this latest preprint version Abstract Ready-to-eat (RTE) salads service and utilize with pide/lahmacun, kebab types, and tantuni in meat restaurants in Turkish cuisine. Hence, the vegetable salads served with meat-based RTE foods are a risk factor for public health. In this study, we report the microbiological properties, antimicrobial resistance of foodborne pathogens including E. coli and S. aureus , and the presence of important enteric viruses in eastern Turkey. The total aerobic bacteria (TAB) ranged from < 1 to 6.40 log CFU g − 1 in the RTE salads (n = 42), whereas yeast and molds was ranged from < 1 to 6.26 log CFU g − 1 . The coliform bacteria and the Staphylococcus and Micrococcus spp. count were determined < 1-5.82 log CFU g − 1 and < 1-5.66 log CFU g − 1 in all REVS samples, respectively. None of the RTE vegetable salads (REVS) tested in this study contained Salmonella spp., whereas E. coli and S. aureus were isolated in 38.1% (16/42) and 2.4% (1/42), respectively. S. aureus was resistant to gentamicin, kanamycin, aztreonam, and ciprofloxacin in the disc diffusion assay, however, it was not harboring the mecA gene. E. coli strains (n = 16) were resistant (100%) to aminoglycoside antibiotics (gentamicin and kanamycin) and 35.7% (6/16) of the isolates were ESBL producing. Bla TEM and bla CTXM8/25 were detected in two isolates, whereas one isolate carried bla CTXM−1 and bla TEM together by PCR. Of the REVS, two were evaluated as positive for rotavirus (4.8%), and six for hepatitis A (14.3%) and hepatitis E virus (14.3%). These results indicate the high microorganism load, presence of ESBL E. coli , and viral enteric pathogens in REVS, hence it is important to perform routine hygiene practices. Food Science & Technology microbial Esbl E. coli viruses ready-to-eat salad Figures Figure 1 Introduction Ready-to-eat (RTE) foods are foods that are consumed without any additional processing or preparation, which may be industrially and/or conventionally processed, packaged or unpackaged (Makinde et al., 2020 ). Dietary preferences of individuals due to rapid urbanization and socio-economic transformations of their current lifestyles have shifted towards ready-made meals (Sarkar et al., 2018 ). ResearchandMarkets ( 2021 ) data showed that the demand for RTE foods has increased rapidly, especially among consumers who do not like to cook during the COVID-19 pandemic. In addition, it was stated that, in connection with the increasing coronavirus cases, restaurants forced consumers to cook at home, causing an increase in the consumption of ready-made meals in the medium term. On the other hand, the increasing consumption of RTE foods globally has been significantly associated with various outbreaks of food infections and poisoning. Especially RTE vegetable salads (REVS) can be primarily contaminated by animals, soil, irrigation water, fertilizers, etc. Moreover, cutting and slicing raw vegetables in restaurants can cause the nutrients in the plants to be released and thus accelerate microbial development (Mir et al., 2018 ). Also, cross-contamination from staff working in restaurants, tools/equipment used, contaminated water, as well as storage in inappropriate conditions are important risk factors affecting the final microbiological quality of the product. Therefore, REVS may carry microbial risks under the influence of more than one unsuitable factors (Bencardino et al., 2018 ; Kim et al., 2004 ). This situation can lead to the emergence of pathogens such as Staphylococcus aureus ( S. aureus ), Salmonella spp., Escherichia coli ( E. coli ), Campylobacter jejuni ( C. jejuni ), Clostridium perfringens ( C. perfringens ), and Listeria monocytogenes ( L. monocytogenes) as well as an increased in total aerobic and spoilage bacteria, yeasts, and molds in REVS (Abakari et al., 2018 ). On the other hand, a high microorganism load can be contained multi-resistant bacteria, which is an important public health problem nowadays (Rodríguez-Lázaro et al., 2022 ). The increasing presence of ESBL-producing bacteria from RTE foods, which is among the challenges of antibiotic resistance, is another important risk for human health due to its epidemiological importance (Giri et al., 2021 ). In addition, it has been reported that REVS are reservoirs not only for bacterial pathogens, but also for enteric viruses such as norovirus (NoV), hepatitis A (HAV), hepatitis E (HEV), and rotavirus (RV) that may lead to an epidemic (Terio et al., 2017 ). The increasing interest in the demand for RTE foods in Turkey has been in parallel with the developments in the world, especially during the COVID 19 pandemic. RTE foods in which meat is used as raw material such as pide/lahmacun, kebab types, and tantuni are notably in high demand (Ipsos, 2020 ). The demand to reach hygienic foods by consumers is also for RTE foods, just like all other foods. In some studies, conducted in Turkey, the microbiological quality of RTE foods was investigated and it was reported that presence of some foodborne pathogens including L. monocytogenes , Salmonella spp. and Norovirus (Abay et al., 2017 ; Gurler et al., 2015 ; Şanlıbaba et al., 2018 ; Terzi et al., 2015 ; Yilmaz et al., 2011 ). However, it is noteworthy that in these studies, there was no comprehensive perspective on vegetable salads served with RTE foods in meat restaurants. Therefore, it is thought that ignoring the microbiological quality of the vegetable salads served with meat-based RTE foods may be an important risk in terms of public health. Moreover, to the best of our knowledge, there is no adequate data on the microbiological quality of REVS from eastern Turkey. Thus, this study aimed to investigate some microbiological properties, antimicrobial resistance of foodborne pathogens including E. coli and S. aureus and the presence of enteric viruses in REVS in the east of Turkey. Material And Methods Samples In this study, REVS samples were taken aseptically from 42 meat restaurants operating in Erzurum region in eastern Turkey. The samples were transferred to the laboratory in a thermal bag under the cold chain. Samples were analyzed as soon as they reached the laboratory. For virological analysis, samples were stored at -80°C until analysis. Table 1 presents information about the characteristics of REVS and restaurants. Information on the conditions under which most of the vegetable salads used in the study were stored was not given by the restaurant staff. Since all vegetable salads collected as a sample were washed, grated, and ready for direct consumption, it was named RTE. Table 1 Characteristics of collected REVS and restaurants Symbol Ingredients of Vegetable Origin Packaging Method Restaurant type E1 Carrot and lettuce Polyethylene Döner kebab (Chicken) E2 Parsley, salad, and tomatoes Polystyrene (PS) foam Pide-Lahmacun E3 Carrot, parsley, and tomatoes Polyethylene Döner kebab (Chicken and beef) E4 Carrot and lettuce Polystyrene (PS) foam Döner kebab (Chicken and beef) E5 Carrot, lettuce, and purple cabbage Polyethylene Döner kebab (Chicken and beef) E6 Carrot, lettuce, purple cabbage, and tomatoes Polystyrene (PS) foam Shish kebab E7 Lettuce and tomatoes Polyethylene Döner kebab (Chicken) E8 Lettuce and tomatoes Polyethylene Döner kebab (Chicken and beef) E9 Carrot, lettuce, and purple cabbage Polystyrene (PS) foam Pide-Lahmacun and Döner kebab (Beef) E10 Lettuce Polyethylene Tantuni E11 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun E12 Carrot, lettuce, and purple cabbage Polyethylene Döner kebab (Chicken) E13 Lettuce and tomatoes Polyethylene Döner kebab (Chicken) E14 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun E15 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun, Shish kebab, Döner kebab (Beef) E16 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun, Shish kebab E17 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun E18 Lettuce and tomatoes Polyethylene Döner kebab (Chicken) E19 Lettuce and tomatoes Polyethylene Döner kebab (Chicken) E20 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun, Shish kebab, Döner kebab (Beef) E21 Carrot and lettuce Plastic bag Döner kebab (Chicken) E22 Carrot and lettuce Polyethylene Döner kebab (Chicken) E23 Carrot Polyethylene Döner kebab (Chicken) E24 Carrot, lettuce, and purple cabbage Polyethylene Döner kebab (Chicken and beef) E25 Carrot, lettuce, and tomatoes Polyethylene Döner kebab (Chicken and beef) E26 Carrot and lettuce Polyethylene Döner kebab (Chicken) E27 Carrot and lettuce Polyethylene Döner kebab (Chicken) E28 Carrot, lettuce, and tomatoes Polystyrene (PS) foam Shish kebab E29 Carrot and lettuce Polystyrene (PS) foam Döner kebab (Chicken) E30 Lettuce Polyethylene Döner kebab (Chicken) E31 Lettuce Polystyrene (PS) foam Döner kebab (Chicken and beef) E32 Lettuce Polyethylene Döner kebab (Chicken) E33 Lettuce Plastic bag Döner kebab (Chicken) E34 Carrot, lettuce, and purple cabbage Polyethylene Pide-Lahmacun, Shish kebab E35 Carrot, lettuce, and purple cabbage Cardboard bag Pide-Lahmacun, Shish kebab, Döner kebab (Beef) E36 Carrot, lettuce, and purple cabbage Polyethylene Döner kebab (Chicken) E37 Lettuce, salad, and tomatoes Polystyrene (PS) foam Giblet shish kebab E38 Carrot, lettuce, purple cabbage, and tomatoes Polyethylene Tantuni E39 Carrot, lettuce, purple cabbage, and tomatoes Polyethylene Pide-Lahmacun, Shish kebab, Döner kebab (Beef) E40 Lettuce and tomatoes Plastic bag Döner kebab (Chicken and beef) E41 Lettuce and tomatoes Polyethylene Döner kebab (Chicken and beef) E42 Carrot, parsley, and purple cabbage Polystyrene (PS) foam Döner kebab (Chicken) Microbiological analysis A 10 g sample was transferred to a filtered stomacher bag and 90 mL of sterile physiological saline solution (0.85% NaCI) was added. The mixture was homogenized in a Stomacher for 1 min. From this homogenate, 10-fold serial dilutions were prepared with sterile physiological saline solution, and 0.1 mL various dilution levels were spread-plated onto appropriate media and incubated at appropriate condition (Table 2 ). The bacterial colonies were counted and converted in colony forming units (CFU). CFU was calculated following formula: \(CFU/g=Number of colonies x \frac{Total dilution}{Volume actually plated}\) . All counts were reported as log 10 CFU/g. Table 2 Media and incubation conditions used for the enumeration of microorganisms Microorganisms Incubation Culture media Time (h) Temp (℃) Total aerobic mesophilic bacteria 72 37 Plate Count Agar (PCA) Coliforms 48 32 Violet Red Bile Agar (VRBA) Staphylococcus / Micrococcus spp. 48 37 Baird Parker Agar (BPA) (supplemented with egg yolk tellurite emulsion) Yeast and Mold 168 25 Rose Bengal Chloramphenicol (RBC) Agar The samples were analyzed for the presence of foodborne pathogens commonly isolated from REVS, i.e., E. coli , Salmonella spp., and S. aureus . To isolate E. coli , Salmonella spp., and S. aureus 25 g of each sample were aseptically weighed, transferred to sterile filtered plastic bags, and homogenized using masticator with 225 mL buffered peptone water (BPW) (Merck, Germany) for 2 min. Then this homogenate kept for 60 min at room temperature (Andrews and Hammack, 2007 ). For Salmonella spp. isolation, the homogenate was incubated for 24 ± 2 h at 35°C followed by a 0.1 mL mixture transferred to 10 mL Rappaport-Vassiliadis (RV) medium and another 1 mL mixture to 10 mL Muller-Kauffmann Tetrathionate-Novobiocin Broth (MKTTN) and they were incubated at 37 ℃ for 24 h. A loop-full culture of from each broth was streaked onto Xylose Lysine Desoxycholate (XLD) agar and Xylose Lysine Tergitol 4 (XLT4) agar and incubated at 37 ℃ for 24 h. Two or more colonies of showing typical Salmonella colony morphology were picked from each selective agar plate after incubation (Baran et al., 2019 ). To E. coli isolation, a loop-full of pre-enriched sample was streaked onto Tryptone Bile X-glucuronide (TBX) agar and incubated at 37 ℃ for 24 h. The blue-green colored suspicious E. coli colonies grown in TBX were subpassaged on the Mueller Hinton agar (MHA) (HiMedia, Mumbai, India) plate for biochemical and molecular analysis (Baran et al., 2020 ). A loop-full of homogenate was passaged on BP Agar supplemented with egg yolk tellurite emulsion to isolate S. aureus and incubated at 37 ℃ for 24 h. The typical transparent zone around the colony as a result of lipolysis/proteolysis, black colonies due to the reduction of tellurite to tellurium were evaluated as suspicious S. aureus , and subpassaged for further analysis as mentioned for E. coli above (Hall, 2013). Antimicrobial Susceptibility Testing Kirby-Bauer disk diffusion technique on MHA (HiMedia) was used for antimicrobial susceptibility testing against to using 12 different commercially available antibiotic disks (HiMedia, Mumbai, India) including meropenem (10 µg), chloramphenicol (30 µg), gentamicin (10 µg), kanamycin (30 µg), tetracycline (30 µg), ciprofloxacin (5 µg), sulfamethoxazole/trimethoprim (25 µg), cefepime (30 µg), cefpodoxime (10 µg), cefoxitin (30 µg), and aztreonam (30 µg). The inhibition zones were measured and interpreted as sensitive or resistant as recommended by the guidelines of Laboratory and Institute ( 2019 ). Resistance to at least one agent in three or more antimicrobial groups was defined as multi-drug resistance. Phenotypic and Genotypic Detection of ESBL E. coli and Methicillin-Resistant S. aureus The presence of ESBL phenotype was determined by the double-disc synergy test (DDST) using cefotaxime and ceftazidime alone and in combination with clavulanic acid as recommended by the Laboratory and Institute ( 2019 ). For this purpose, CAZ (30 µg), CTX (30 µg), ceftazidime-clavulanic acid (30/10 µg), and cefotaxime-clavulanic acid (30/10 µg) discs were placed on MHA. After 16–18 hours of incubation at 35 ºC, ≥ 5 mm increase in zone diameter of ceftazidime/clavulanic acid disc and ceftazidime disc alone, and/or ≥ 5 mm increase in the zone diameter of cefotaxime/clavulanic acid disc and cefotaxime disc alone were considered as ESBL positive. The genotypic assay was made by using genomic DNA obtained from phenotypic ESBL positive isolates by boiling method as a template. Briefly, 100 µL of Tris-EDTA buffer solution (pH, 8.00) containing a few colonies was boiled for 10 min. At the end of the boiling, the samples were cooled on ice and centrifuged at 10.000 xg for 15 s. The supernatant was used template in PCR (Baran et al., 2020 ) components were provided by Vivantis Technologies (Subang Jaya, Malaysia). Primers used in this study were obtained from Metabion International AG (Planegg-Martinsried, Germany). The isolates that were ESBL-positive by DDST were subjected to amplification by PCR method using TEM, SHV, CTX-M-1, CTX-M-2, CTX-M-8/25, and CTX-M-9 group primers, as previously reported by Le et al. ( 2015 ). Oxacillin disc (1µg; Oxoid, Cambridge, UK) diffusion assay was performed for evaluation of methicillin-resistant S. aureus (MRSA) following CLSI guidelines for interpretation of the results and using S. aureus ATCC 29213 as a negative control (Laboratory and Institute, 2019 ). PCR was performed for the confirmation of S. aureus isolates with femA gene and presence of methicillin-resistant gene mecA (Findik et al., 2009 ). Phylo-typing analysis Phylo-typing groups were determined using the quadruplex phylogroup assignment method for E. coli isolates, previously described by Clermont et al. ( 2013 ). PCRs were carried out using thermal cycler (BioRad, USA) in a total volume of 25 µl containing 10 pmol of each three pair of primers (Sigma, USA), 25 µmol of dNTPs, 5 µl of template DNA, 2.5 µl of 10Χ Taq buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.3)], 2 mM MgCl 2 , and 2.5 U of Taq polymerase (Fermentas, USA). The PCR product bands were separated by electrophoresis through 1.2% agarose gel in 1× TAE buffer. DNA fragments were visualized by ethidium bromide staining and photographed under ultraviolet light illumination. Viral RNA detection PCR analysis was performed to investigate Rotavirus, Hepatitis E virus, Hepatitis A virus, and Norovirus that could be transmitted by the fecal-oral route (Table 3 ). Each of the RTE salad samples was put 2 grams in the tube and diluted with 1.5 mL of phosphate-buffered saline (PBS). After vertexing, it was centrifuged at 2500 rpm at + 4°C for 5 min and 500 µl of supernatant from this suspension was used for isolation of viral nucleic acid. Viral nucleic acid was extracted from RTE salad samples by using the GF-1 viral nucleic acid extraction kit (Vivantis, Malaysia) according to the manufacturer's instructions. A nucleic acid concentration was measured using a NanoDrop spectrophotometer (Thermo Scientific, DE). The amplicons obtained from PCR were visualized by gel-electrophoresis and positive results on the gel were recorded for each virus. Positive control samples are viruses that have been previously confirmed by sequence analysis (Aktaş et al., 2019 ; Aydin et al., 2016 ). Table 3 Rotavirus, Hepatitis E virus, Hepatitis A virus and Norovirus PCR primer sequence used in this study Primer Sequence 5'-3' Length (bp) Reference Rotavirus VP6 F VP6 R GACGGVGCRACTACATGGT GTCCAATTCATNCCTGGTGG 379 (Aydin et al.) Hepatitis A Virus VP1/P2B F1 VP1/P2B R1 VP1/P2B F2 VP1/P2B R2 GACAGATTCTACATTTGGATTGGT CCATTTCAAGAGTCCACACACT CTATTCAGATTGCAAATACAAT AACTTCATTATTTCATGCTCCT 512 394 (Rachida et al.) Hepatitis E Virus 3156 F 3157 R AATTATGCC(T)CAGTAC(T)CGG(A)GTTG CCCTTA(G)TCC(T)TGCTGA(C)GCATTCTC 731 (Huang et al. 2002) Norovirus JV12 F JV13 R ATACCACTATGATGCAGATTA TCATCATCACCATAGAAAGAG 327 (Timurkan et al.) Statistical analysis The descriptive statistics were calculated for each parameter using SPSS Software (IBM SPSS statistics 20). Results And Discussion Of a total of forty-two REVS samples were collected from meat restaurants operating in the Erzurum region in eastern Turkey to investigate the foodborne pathogens including bacteria and viruses for their microbiological properties and antimicrobial resistance. The total aerobic bacteria (TAB) in the tested salads ranged from < 1 to 6.40 log CFU g − 1 (with an average of 4.72 log CFU g − 1 ) (Table 4 ). Although the lowest TAB count was detected in the samples #E14 and #E16, the highest value was in the #24 (Table 4 ). In addition, the highest yeasts and molds (5.00 log CFU g − 1 ), coliform (5.79 log CFU g − 1 ), and staphylococcal/micrococcal bacteria (5.66 log CFU g − 1 ) have been also detected in the sample #24. The count of bacteria in the salad samples tested in this study results showed an overall similar trend to each other. For example, when the TAB count was detected as high, other parameters showed a high trend as much as TAB (Table 4 ). A very few of the samples 3 out of 42 (7.14%) had a TAB count > 6 log CFU g − 1 , which categorizes them as borderline, according to Health Protection Agency (HPA) guidelines (Gilbert et al., 2000 ). It has been reported that TAB was ranged from 4.1 log cfu/g to 8.3 log cfu/g in mixed fresh-cut salads in Mashhad, Iran (Najafi et al. ( 2012 ), however, it was between 5.12 and 9.75 log CFU g − 1 (with an average of 7.73 log CFU g − 1 ) in REVS in Cyprus (Xylia et al., 2019 ). In addition, a high level of TAB (6.43 log CFU g − 1 -mean (3.50–8.39)) was reported in raw salad vegetables sold in Lebanon (Faour-Klingbeil et al., 2016 ). Of note, these findings were found to be considerably higher than our study. On the other hand, the presence of high numbers of yeast and molds (ranged between < 1-6.26 log CFU g − 1 ) determined in the REVS samples in the current study. In the previous studies, which were consistent with the current study results, the yeast and mold were reported 10 4 -10 7 log CFU g − 1 and 1.63 and 6.68 log CFU g − 1 from India and Mexica, respectively (Pingulkar et al. ( 2001 ) In this context, coliform bacteria (CO) were detected at levels ranging from < 1-5.82 log CFU g − 1 in all REVS samples. Regardless of the sources, the number of CO was detected in all salads served in Mexican restaurants with limits ranging from 5.4×10 3 to 1.7×10 8 log CFU g − 1 1 (Gómez-Aldapa et al., 2013 ). The high coliform bacteria count identified in the current study may be associated with poor hygiene practices during the preparation of REVS. Apart from CO, the Staphylococcus and Micrococcus spp. count (STA/MICR) was determined between < 1 and 5.66 log CFU g − 1 in the current study, indicating a possible transmission of the food handlers. Risk factors that play a role in the contamination of vegetables, such as unsafe water sources for irrigation, inappropriate fertilizers or manures, access to livestock wild animals in the field, and unhygienic post-harvest handling (unhygienic utensil, labor, handling, packaging material, and improper/inadequate storage conditions) were indicated by investigators in the previous studies (Chau et al., 2017 ; Mercanoglu Taban and Halkman, 2011 ; Mir et al., 2018 ; Rahman et al., 2021 ). These results showed a relatively high contamination rate detected in the salad samples tested in this study, indicating that RTE salad serving in the meat restaurant is a risk factor for the transmission of food-borne diseases in humans (Bautista-De León et al., 2013 ). Table 4 Microbiological quality of REVS Microbial Count (log CFU g − 1 ) Presence (+/-) Symbol TAB YM CO STA/MICR STA SAL EC HEV RV HEA NoV E1 4.60 3.30 3.83 1.30 - - + - - - - E2 4.48 3.53 2.48 1.85 - - - - - - - E3 5.51 6.26 5.06 1.30 - - - - - - - E4 4.78 4.23 4.65 1.48 - - + - - - - E5 4.90 5.06 4.40 2.20 - - + - - - - E6 5.20 5.43 5.25 1.00 - - + - - - - E7 5.04 4.46 4.74 1.30 - - - - - - - E8 5.97 5.45 4.88 1.30 - - - - - - - E9 5.45 5.08 5.03 1.00 - - - - - + - E10 5.00 4.88 4.83 1.48 - - - - - - - E11 4.81 3.18 4.46 < 1 - - - + - - - E12 5.81 5.59 5.46 1.70 - - - - - - - E13 4.90 4.86 4.89 1.30 - - - - - - - E14 < 1 3.48 3.70 < 1 - - + - - - - E15 5.00 5.09 5.06 1.48 - - - - - - - E16 < 1 3.00 < 1 < 1 - - + - - - - E17 6.34 5.34 5.82 2.81 - - - - - - - E18 4.00 4.82 4.11 1.48 - - + - - - - E19 4.00 < 1 3.30 < 1 - - - - - - - E20 4.48 3.70 3.60 2.64 - - - - - - - E21 4.60 5.05 4.00 2.51 - - + - + + - E22 5.81 5.09 4.58 2.82 - - + - - - - E23 4.00 3.48 3.78 < 1 - - - - - - - E24 6.40 5.00 5.79 5.66 - - + - - + - E25 4.30 4.40 3.78 < 1 - - - - - - - E26 4.60 3.90 4.78 2.04 - - - - - - - E27 5.20 3.60 4.98 2.04 - - - - - - - E28 5.32 5.00 4.68 1.90 - - - - - - - E29 4.30 4.00 4.20 < 1 - - - - - - - E30 4.70 3.48 4.38 2.92 - - - - - + - E31 4.30 4.58 3.78 1.70 - - + - - - - E32 5.76 4.54 4.68 < 1 - - - - - - - E33 4.00 3.30 3.60 1.00 - - + - - - - E34 4.00 4.11 5.10 1.78 - - + - - - - E35 5.15 3.60 4.93 2.00 - - - - - + - E36 5.04 4.61 4.67 1.60 - - - - - - - E37 5.11 4.57 4.80 2.92 - - - + - - - E38 4.78 3.48 4.40 2.53 - - - - - - - E39 6.39 4.11 4.00 1.70 - - + + - + - E40 4.95 4.08 4.78 2.38 + - - + - - - E41 4.95 4.30 4.80 2.23 - - + + - - - E42 4.30 4.23 4.08 2.70 - - + + + - - MinV < 1 < 1 < 1 < 1 MaxV 6.40 6.26 5.82 5.66 Variance 1.56 1.04 0.93 1.25 SD 1.25 1.02 0.96 1.12 SE 0.19 0.16 0.15 0.17 Mean 4.72 4.27 4.38 1.62 Table 5 Antibiotic susceptibility pattern (Sensitive and Resistance) of E. coli isolates. Antibiotic (µg) Antibiotic susceptibility pattern Sensitive Resistance Meropenem (10 µg) 16 (100%) 0 Chloramphenicol (30 µg) 15 (93.75%) 1 (6.25%) Gentamicin (10 µg) 0 16 (100%) Kanamycin (30 µg) 0 16 (100%) Tetracycline (30 µg) 13 (81.25%) 3 (18.75%) Ciprofloxacin (5 µg) 12 (75.00%) 4 (25.00%) Sulfamethoxazole/Trimethoprim (25 µg) 11 (68.75%) 5 (31.25%) Cefepime (30 µg) 14 (87.5%) 2 (12.50%) Cefpodoxime (10 µg) 9 (56.25%) 7 (43.75%) Cefoxitin (30 µg) 12 (75.00%) 4 (25.00%) Aztreonam (30 µg) 15 (93.75%) 1 (6.25) Although the HPA guidelines indicated ≥ 10 2 for E. coli , ≥10 4 for S. aureus , and presence in 25 g for Salmonella spp. are evaluated as an unsatisfactory product (Gilbert et al., 2000 ), Turkish Food Codex (2011) has ruled that RTE foods should not be contained E. coli (< 10 1 ), Salmonella spp., L. monocytogenes , and staphylococcal enterotoxins. None of the REVS tested in this study contained Salmonella spp., whereas E. coli and S. aureus were isolated in 38.1% (16/42) and 2.4% (1/42), respectively, however, not using the colony counting method. Hence, it is impossible to evaluate the current study results according to HPA guidelines and/or the Turkish Food Codex. Considered by food vendors as an indicator of fecal contamination and improper hygiene practices, E. coli can cause gastroenteritis and diarrhea in humans when taken with contaminated food (Abakari et al., 2018 ). The prevalence of E. coli was found to be 38.10% (16/32) in the salad samples analyzed in this study. This result was lower than in studies done in other countries: 96.7% in Ghana (Abakari et al., 2018 ); 94% in Cote d'ivoire (Coulibaly-Kalpy et al., 2017 ); 83.2% in Mexico (Gómez-Aldapa et al., 2013 ); 64% in Argentina (Pellicer et al., 2002 ). But it was higher than some countries: 20% in United Arab Emirates (Almualla et al., 2010 ) and 16.7% in Spain. The prevalence of E. coli contamination has displayed a significant variation between developed and developing countries (Rahman et al., 2021 ). For example, studies in low-income countries such as Pakistan, Bangladesh, and India reported the prevalence of E. coli in raw vegetable samples sold in retail markets ranged from 34–60% (Ahmed et al., 2019 ; Saksena et al., 2020 ; Shah et al., 2015 ) whereas it was 3.1% and 4.1% in the USA and Germany, respectively (Liu and Kilonzo-Nthenge, 2017 ; Schwaiger et al., 2011 ). Phylo-typing of E. coli strains using quadruplex PCR displayed six isolates in group A, four isolates in groups B 1 and C, and one isolate in groups E and F (Table 6 ). Although most of E. coli isolates were detected in the group with commensal strains (group A and B1) in the current study, only one isolate was detected in the virulent group (F). Table 6 Phylogenetic groups and ESBL presence of E. coli isolates from RTE vegetable salad samples Isolate ID Phylogeny ESBL ESBL Genotype E1 B1 - E4 B1 - E5 A - E6 B1 - E14 A - E16 B1 + CTX-M-1, TEM E18 C - E21 A - E22 A - E24 C + - E31 C - E33 A - E34 A + CTXM8/25 E39 E + - E41 C + TEM E42 F + - Total 16/42 6/16 Despite the high STA/MICR count, S. aureus could only be detected in one sample in the current study. As it is known, S. aureus is one of the most important foodborne pathogens worldwide, some strains of which can produce one or more toxins, mainly enterotoxin (Xing et al., 2014 ). The prevalence of S. aureus in REVS observed in the present study is comparable to similar studies (Faour-Klingbeil et al., 2016 ; Najafi et al., 2012 ; Seo et al., 2010 ). The sources of contamination of Salmonella could be animal feces as fertilizer, cultivation of the plants with wastewater, and personal hygiene (Machado et al., 2006 ; Salleh et al., 2003 ; Sapkota et al., 2019 ; Taban et al., 2013 ). Salmonella spp. was also isolated in fresh vegetables by investigators in the previous studies (Evelyne et al., 2022 ; Sapkota et al., 2019 ; Yang et al., 2020 ) in contrast to our study findings. On the other hand, in line with our current study, Campos et al. ( 2013 ) reported that they did not detect Salmonella spp. in 45 REVS sold in Portugal. Only one S. aureus was isolated and confirmed by PCR (with femA gene) in the current study, and the isolate was resistant to gentamicin, kanamycin, aztreonam, and ciprofloxacin in the disc diffusion assay. In addition, the PCR analysis conducted for detection of the mecA gene showed that the S. aureus strain isolated in the current study was not harboring the mecA gene. On the other hand, all E. coli strains (n = 16) were resistant (100%) against aminoglycoside antibiotics (gentamicin and kanamycin) tested in this study, even though they were susceptible to meropenem in the disc diffusion assay. The isolates displayed a low level of resistance against chloramphenicol (6.25%), tetracycline (18.75%), and ciprofloxacin (25.00%). These data indicated that antimicrobial-resistant E. coli strains from REVS salad samples in the current study still remain moderately low-level resistant to anti-Gram-negative drugs of importance for human medicine, suggesting that these antibiotics could be non-effective in the future due to the rising antimicrobial resistance. The double-disc synergy test used for the detection of the phenotypic resistant ESBL producing strains in the current study displayed that 35.7% (6/16) of the isolates were ESBL producing. Molecular analysis of ESBL producing strains showed that one strain harbored two different genes ( bla CTXM−1 and bla TEM ), whereas two isolates carried one gene ( bla TEM and bla CTXM8/25 ). To the best of our knowledge, this is the first report of the presence of ESBL producing E. coli in REVS in Turkey. The outbreaks due to the multi-drug resistant bacteria on fresh vegetable products have been reported around the world by researchers in previous studies (Freitag et al., 2018 ; Janalíková et al., 2018 ; Liu and Kilonzo-Nthenge, 2017 ; Sapkota et al., 2019 ). A study in Japan indicated that fresh vegetables served as an important route of transmission of ESBL producer bacteria to humans (Usui et al., 2019 ). In terms of public health, antimicrobial resistant zoonotic pathogens in foods pose a direct risk. Foods can be contaminated with bacteria harboring antimicrobial resistance genes, antibiotics using agricultural production, resistance genes of microorganisms used as starters during food processing, and cross contamination. Since raw foods are consumed without undergoing any other processing, they carry a significant risk of transferring antimicrobial resistance to humans. Ultimately, transfer of antimicrobial resistance genes between bacteria can also occur after ingestion by humans (Verraes et al., 2013 ). Moreover, poor processing and preservation conditions lead to the continued presence of damaged or stressed cells in food, increasing the risk of bacteria carrying antimicrobial resistance genes transmission (Lammie and Hughes, 2016 ). The presence of hepatitis E virus (HEV), rotavirus (RV), hepatitis A virus (HAV), and norovirus (NoV) was investigated in the current study to reveal important viral infections to public health in the REVS samples. Viral nucleic acid was detected in fourteen salad samples tested in the current study by PCR. Of these, two were evaluated as positive for RV (4.8%), and six for HAV (14.3%) and HEV (14.3%). Nov couldn’t be found in any of the samples in the current study. Gel-electrophorese images of viral nucleic acids and control groups determined positive by PCR analysis are given in Fig. 1 . HEV, HAV, RV, and NoV are transmitted to humans by food and environmental routes depending on the virus genotype, environmental conditions, hygienic conditions, and the types of food consumed (Van der Poel, 2014 ). In a study showed that in the total of 911 REVS samples including mixed salads, carrots, valerian arugula, spinach, iceberg, and romaine lettuce from supermarkets in Italy, the total prevalence of HAV and HEV was 1.9% (18/911) and 0.6% (6/911), respectively, even though NoV could not be detected in any of the samples (Terio et al., 2017 ). Although the prevalence of HAV and HEV was detected high level, similarly NoV did not determine in the samples tested in the current study. In contrast to our study data, a low level of NoV (2.90–3.75%) was reported in vegetables and fruits by the other researchers in published studies (Parada-Fabián et al., 2016 ), indicating the less frequent detection of NoV in REVS products. Hence, salads are less frequently involved in foodborne viral outbreaks than other foods; however, they may be contaminated with unsanitary food workers or raw materials that have been contaminated (Cheng et al., 2018 ). Khan et al. ( 2014 ) reported that 29 samples including cauliflower, tomato, ridge gourd, brinjal, pumpkin, mint, bitter gourd, okra, pepper, cucumber collected from 13 different locations of district Mardan in Pakistan, 1 were positive for HAV. Shin et al. ( 2019 )) reported that 1 sample were positive for HAV in fresh vegetables and fruits including Chinese cabbage, cucumber, lettuce, strawberry. Fresh and frozen vegetable and fruit samples including spinach, parsley, purslane, cherry and strawberry from supermarkets in Mexico, 7/80 were positive for HAV (Parada-Fabián et al. 2016 ). In another study, of the 70 vegetable samples including 51 first range raw vegetables and one fourth range REVS from markets in Sicily, 1.4% for HEV((Purpari et al., 2019 )). The prevalence of RV was found variable in vegetables: 13.75% (11/80) in Mexico (Parada-Fabián et al. 2016 ); 22% (23/101) in Argentina (Emilse et al. 2021). To the best of our knowledge, this is the first report from Turkey for HEV, HAV, and RV positivity in REVS, suggesting REVS can be a reservoir for the important viral pathogens and to be considered before consumption. Viral contamination can occur at several points in the food production chain. Because they do not have a chance to growth outside of living cells, their presence in food can be explained by pre-harvest contamination of vegetables or post-harvest contamination from food processors. On the other hand, the fact that the food handlers in the field where the vegetables are harvested and the water quality used in agricultural irrigation can affect the microbiological properties of vegetables can also explain the high level of viral contamination (Terio et al., 2017 ). Conclusion The assessment of microbiological contamination status in REVS contributes to the identification of risks for government authorities as well as to the assessment of consumer exposure. This is the first report of the presence of ESBL producing E. coli , hepatitis E, hepatitis A and rotavirus for REVS from Turkey. On the other hand, it can be predicted that the high microorganism load detected in REVS samples and the antimicrobial resistance of isolates may pose a threat to public health. Considering that the lack of an effective surveillance system led to the inability to identify the possible source of the epidemic, it was thought that REVS could be a reservoir in this sense. Elimination or at least mitigation of this current potential risk requires increasing the good agricultural and manufacturing practices throughout the vegetable production process from the farm to the retailer and restaurants. Moreover, hazard analysis and critical control point (HACCP) strategies need to be implemented and effectively supervised, especially at the restaurant level. Declarations Ethics approval This article does not contain any studies with human participants or animals performed by any of the authors. Consent to participate This article does not contain any studies with human participants or animals performed by any of the authors. Consent for publication This article does not contain any studies with human participants or animals performed by any of the authors. Conflict of interest The authors declare no competing interests. References Abakari G, Cobbina SJ, Yeleliere E (2018) Microbial quality of ready-to-eat vegetable salads vended in the central business district of Tamale, Ghana. Int J Food Contam 5: 3. Abay S, Irkin R, Aydin F et al (2017) The prevalence of major foodborne pathogens in ready-to-eat chicken meat samples sold in retail markets in Turkey and the molecular characterization of the recovered isolates. Lebensm Wiss Technol 81: 202–209. Ahmed S, Siddique MA, Rahman M et al (2019) A study on the prevalence of heavy metals, pesticides, and microbial contaminants and antibiotics resistance pathogens in raw salad vegetables sold in Dhaka, Bangladesh. Heliyon 5: e01205. Aktaş O, Aydin H, Timurkan MO (2019) A molecular study on the prevalence and coinfections of Rotavirus, Norovirus, Astrovirus and Adenovirus in children with gastroenteritis. Minerva Pediatr 71: 431–437. Almualla NA, Laleye LC, Abushelaibi AA et al (2010) Aspects of the microbiological quality and safety of ready-to-eat foods in Sharjah supermarkets in the United Arab Emirates. J Food Prot 73: 1328–1331. Andrews W, Hammack T (2007). Chapter 5: Salmonella. US Food and Drug Administration (FDA) Bacteriological Analytical Manual (BAM) Online. Aydin H, Uyanik MH, Karamese M et al (2016) Seroprevalence of hepatitis e virus in animal workers in nonporcine consumption region of Turkey. Future Virol 11: 691–697. Baran A, Adıgüzel MC, Yüksel M (2020) Prevalence of antibiotic-resistant and extended-spectrum beta-lactamase-producing Escherichia coli in chicken meat from eastern Turkey. Pak Vet J 40: 355–359. Baran A, Erdoğan A, Kavaz A et al (2019) Some specific microbiological parameters and prevalence of Salmonella spp. in retail chicken meat from Erzurum province, Turkey and characterization of antibiotic resistance of isolates. Biosci J 35: 878–891. Bautista-De León H, Gómez‐Aldapa C, Rangel‐Vargas E et al (2013) Frequency of indicator bacteria, S almonella and diarrhoeagenic E scherichia coli pathotypes on ready‐to‐eat cooked vegetable salads from M exican restaurants. Lett Appl Microbiol 56: 414–420. Bencardino D, Vitali LA, Petrelli D (2018) Microbiological evaluation of ready-to-eat iceberg lettuce during shelf-life and effectiveness of household washing methods. Ital J Food Saf 7: 50–54. Campos J, Mourão J, Pestana N et al (2013) Microbiological quality of ready-to-eat salads: An underestimated vehicle of bacteria and clinically relevant antibiotic resistance genes. Int J Food Microbiol 166: 464–470. Chau ML, Aung KT, Hapuarachchi HC et al (2017) Microbial survey of ready-to-eat salad ingredients sold at retail reveals the occurrence and the persistence of Listeria monocytogenes Sequence Types 2 and 87 in pre-packed smoked salmon. BMC Microbiol 17: 1–13. Cheng D, Zou S, Liao N et al (2018) Evaluation of an Extraction Method for the Detection of GI and GII Noroviruses in Fruit and Vegetable Salads. J Food Sci 83: 393–400. Clermont O, Christenson JK, Denamur E et al (2013) The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo‐groups. Environmental microbiology reports 5: 58–65. Coulibaly-Kalpy J, Agbo EA, Dadie TA et al (2017) Microbiological quality of raw vegetables and ready to eat products sold in Abidjan (Cte dIvoire) markets. Afr J Microbiol Res 11: 204–210. Evelyne T, Attien P, Moroh AJ-L et al (2022) Prevalence and characterization of Salmonella isolated from vegetables salads and ready to eat raw mixed vegetable salads in Abidjan, Cte dIvoire. J Microbiol Antimicrob 14: 15–25. Faour-Klingbeil D, Murtada M, Kuri V et al (2016) Understanding the routes of contamination of ready-to-eat vegetables in the Middle East. Food Control 62: 125–133. Findik A, Akan N, Onuk EE et al (2009) Methicillin resistance profile and molecular typing of Staphylococcus aureus strains isolated from noses of the healthy dogs. Kafkas Univ Vet Fak Derg 15: 925–930. Freitag C, Michael G, Li J et al (2018) Occurrence and characterisation of ESBL-encoding plasmids among Escherichia coli isolates from fresh vegetables. Vet Microbiol 219: 63–69. Gilbert R, De Louvois J, Donovan T et al (2000) Guidelines for the microbiological quality of some ready-to-eat foods sampled at the point of sale. PHLS Advisory Committee for Food and Dairy Products. Commun Dis Public Health 3: 163–167. Giri S, Kudva V, Shetty K et al (2021) Prevalence and Characterization of Extended-Spectrum β-Lactamase-Producing Antibiotic-Resistant Escherichia coli and Klebsiella pneumoniae in Ready-to-Eat Street Foods. Antibiotics 10: 850–850. Gómez-Aldapa CA, Rangel-Vargas E, Castro-Rosas J (2013) Frequency and Correlation of Some Enteric Indicator Bacteria and Salmonella in Ready-to-Eat Raw Vegetable Salads from Mexican Restaurants. J Food Sci 78: M1201-M1207. Gurler Z, Pamuk S, Yildirim Y et al (2015) The microbiological quality of ready-to-eat salads in Turkey: A focus on Salmonella spp. and Listeria monocytogenes. Int J Food Microbiol 196: 79–83. Hall GS (2013) Bailey & Scott’s Diagnostic Microbiology, 13th Edn. Lab Med 44:e138-e139. Ipsos (2020). Beverage products drew attention in the purchase of fast moving consumer goods in the household. Janalíková M, Pleva P, Pavlíčková S et al (2018) Characterization of Escherichia coli strains isolated from raw vegetables. Potravinarstvo Slovak Journal of Food Sciences 12: 304–312. Khan W, Irshad M, Rehman G et al (2014) HAV in fresh vegetables: a hidden health risk in district Mardan, Pakistan. SpringerPlus 3: 675. Kim JS, Bang OK, Chang HC (2004) Examination of microbiological contamination of ready-to-eat vegetable salad. J Food Hyg Saf 19: 60–65. Laboratory C, Institute S (2019). Performance standards for antimicrobial susceptibility testing. (Clinical Laboratory and Standards Institute Wayne, PA). Lammie SL, Hughes JM (2016) Antimicrobial resistance, food safety, and one health: the need for convergence. Annu Rev Food Sci Technol 7: 287–312. Le QP, Ueda S, Nguyen TNH et al (2015) Characteristics of extended-spectrum β-lactamase–producing Escherichia coli in retail meats and shrimp at a local market in Vietnam. Foodborne Pathog Dis 12: 719–725. Liu S, Kilonzo-Nthenge A (2017) Prevalence of multidrug-resistant bacteria from US-grown and imported fresh produce retailed in chain supermarkets and ethnic stores of Davidson County, Tennessee. Journal of food protection 80: 506–514. Machado DC, Maia CM, Carvalho ID et al (2006) Microbiological quality of organic vegetables produced in soil treated with different types of manure and mineral fertilizer. Braz J Microbiol 37: 538–544. Makinde OM, Ayeni KI, Sulyok M et al (2020) Microbiological safety of ready-to‐eat foods in low‐and middle‐income countries: A comprehensive 10‐year (2009 to 2018) review. Compr Rev Food Sci 19: 703–732. Mercanoglu Taban B, Halkman AK (2011) Do leafy green vegetables and their ready-to-eat [RTE] salads carry a risk of foodborne pathogens? Anaerobe 17: 286–287. Mir SA, Shah MA, Mir MM et al (2018) Microbiological contamination of ready-to-eat vegetable salads in developing countries and potential solutions in the supply chain to control microbial pathogens. Food Control 85: 235–244. Najafi H, Mohammad B, Bahreini M (2012). Microbiological quality of mixed fresh-cut vegetable salads and mixed ready-to-eat fresh herbs in Mashhad, Iran. In InInternational Conference on Nutrition and Food Sciences IPCBEE,(39) (Citeseer), pp. 62–66. Parada-Fabián JC, Juárez-García P, Natividad-Bonifacio I et al (2016) Identification of Enteric Viruses in Foods from Mexico City. Food Environ Virol 8: 215–220. Pellicer K, Copes J, Malvestiti L et al (2002) Ready to eat salads: an analysis of health and safety conditions. Analecta Vet 22: 4–6. Pingulkar K, Kamat A, Bongirwar D (2001) Microbiological quality of fresh leafy vegetables, salad components and ready-to-eat salads: an evidence of inhibition of Listeria monocytogenes in tomatoes. Int. J Food Sci Nutr 52: 15–23. Purpari G, Macaluso G, Di Bella S et al (2019) Molecular characterization of human enteric viruses in food, water samples, and surface swabs in Sicily. Int J Infect Dis 80: 66–72. Rahman M, Alam M-U, Luies SK et al (2021) Contamination of fresh produce with antibiotic-resistant bacteria and associated risks to human health: A scoping review. Int J Environ Res Public Health 19: 360. ResearchandMarkets (2021). Ready-to-Eat Food Market - Growth, Trends, COVID-19 Impact, and Forecasts (2021–2026). (Research and Markets). Rodríguez-Lázaro D, Łepecka A, Zielí nska D et al (2022) Assessment of the Microbiological Quality of Ready-to-Eat Salads—Are There Any Reasons for Concern about Public Health? Int J Environ Res Public Health 19: 1582–1582. Saksena R, Malik M, Gaind R (2020) Bacterial contamination and prevalence of antimicrobial resistance phenotypes in raw fruits and vegetables sold in Delhi, India. Journal of Food Safety 40: e12739. Salleh NA, Rusul G, Hassan Z et al (2003) Incidence of Salmonella spp. in raw vegetables in Selangor, Malaysia. Food Control 14: 475–479. Şanlıbaba P, Tezel BU, Çakmak GA (2018) Prevalence and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat foods in Turkey. J Food Qual 2018: Sapkota S, Adhikari S, Pandey A et al (2019) Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal. BMC Res Notes 12: 1–6. Sarkar C, Webster C, Gallacher J (2018) Are exposures to ready-to-eat food environments associated with type 2 diabetes? A cross-sectional study of 347 551 UK Biobank adult participants. Lancet Planet Health 2: e438-e450. Schwaiger K, Helmke K, Hölzel CS et al (2011) Antibiotic resistance in bacteria isolated from vegetables with regards to the marketing stage (farm vs. supermarket). Int J Food Microbiol 148: 191–196. Seo Y-H, Jang J-H, Moon K-DJFS (2010) Occurrence and characterization of enterotoxigenic Staphylococcus aureus isolated from minimally processed vegetables and sprouts in Korea. Food Sci Biotechnol 19: 313–319. Shah MS, Eppinger M, Ahmed S et al (2015) Multidrug-resistant diarrheagenic E. coli pathotypes are associated with ready-to-eat salad and vegetables in Pakistan. J Korean Soc Appl Biol Chem 58: 267–273. Shin H, Park H, Seo DJ et al (2019) Foodborne Viruses Detected Sporadically in the Fresh Produce and Its Production Environment in South Korea. Foodborne Pathog Dis 16: 411–420. Taban BM, Aytac SA, Akkoc N et al (2013) Characterization of antibiotic resistance in Salmonella enterica isolates determined from ready-to-eat (RTE) salad vegetables. Braz J Microbiol 44: 385–391. Terio V, Bottaro M, Pavoni E et al (2017) Occurrence of hepatitis A and E and norovirus GI and GII in ready-to-eat vegetables in Italy. Int J Food Microbiol 249: 61–65. Terzi G, Gücükoğlu A, Çadirci Ö et al (2015) Serotyping and antibiotic susceptibility of Listeria monocytogenes isolated from ready-to-eat foods in Samsun, Turkey. Turkish J Vet Anim Sci 39: 211–217. Usui M, Ozeki K, Komatsu T et al (2019) Prevalence of extended-spectrum β-lactamase–producing bacteria on fresh vegetables in Japan. J Food Prot 82: 1663–1666. Van der Poel WHM (2014) Food and environmental routes of Hepatitis E virus transmission. Curr Opin Virol 4: 91–96. Verraes C, Van Boxstael S, Van Meervenne E et al (2013) Antimicrobial resistance in the food chain: a review. Int J Environ Res Public Health 10: 2643–2669. Xing X, Li G, Zhang W et al (2014) Prevalence, Antimicrobial Susceptibility, and Enterotoxin Gene Detection of Staphylococcus aureus Isolates in Ready-to-Eat Foods in Shaanxi, People's Republic of China. J Food Prot 77: 331–334. Xylia P, Botsaris G, Chrysargyris A et al (2019) Variation of microbial load and biochemical activity of ready-to-eat salads in Cyprus as affected by vegetable type, season, and producer. Food microbiology 83: 200–210. Yang J, Zhang Z, Zhou X et al (2020) Prevalence and characterization of antimicrobial resistance in Salmonella enterica isolates from retail foods in Shanghai, China. Foodborne Pathog Dis 17: 35–43. Yilmaz A, Bostan K, Altan E et al (2011) Investigations on the frequency of norovirus contamination of ready-to-eat food items in Istanbul, Turkey, by using real-time reverse transcription PCR. J Food Prot 75: 840–843. Supplementary Files Sunu1.jpg Graphical abstract Cite Share Download PDF Status: Published Journal Publication published 14 Oct, 2022 Read the published version in Revista Científica de la Facultad de Ciencias Veterinarias → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1736848","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":111968671,"identity":"0d2f92bb-d827-4c08-8f4e-442178bd82d3","order_by":0,"name":"Alper Baran","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYDACdjB5AEQwPgCzmYGYB58WZoQWZgOGBIQWCWK0sEmAtTAQ0MLfzHvwcQXDHXnz9rPHKn7+sEvczg504ds2hjrzBuxaJA7zJRueYXhmOOdMXtrNnoTkxJ3NDMyGc9sYJGQO4LDmMI+ZZAPDYcYZDDlmN3gSmBM3HGZgk+YFasHlMvnDPOY/gVrsZ/C/MSv8k1AP0sL+G58WA6AtjEAtiTMkcsyYeRIOg21hxqfFEOgXyQaDZ8kzJN4YS8ukHTfecJixWXLOOQnJGTi0yB3vPfixoeKO7Qz+HMOPb2yqZTecP3zww5syG37cEQOKaAMUEaBD8cUkgbQxCkbBKBgFowAIAHH8U2ZIqlafAAAAAElFTkSuQmCC","orcid":"","institution":"Ataturk University","correspondingAuthor":true,"prefix":"","firstName":"Alper","middleName":"","lastName":"Baran","suffix":""},{"id":111968672,"identity":"d67c0ca0-264c-41b2-9be7-184830eccc85","order_by":1,"name":"Mehmet Cemal Adigüzel","email":"","orcid":"","institution":"Ataturk University","correspondingAuthor":false,"prefix":"","firstName":"Mehmet","middleName":"Cemal","lastName":"Adigüzel","suffix":""},{"id":111968673,"identity":"6bb61b13-6f6e-4d20-88bf-cf8d8624b5bc","order_by":2,"name":"Hakan Aydin","email":"","orcid":"","institution":"Ataturk University","correspondingAuthor":false,"prefix":"","firstName":"Hakan","middleName":"","lastName":"Aydin","suffix":""}],"badges":[],"createdAt":"2022-06-08 07:07:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1736848/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1736848/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.52973/rcfcv-e32171","type":"published","date":"2022-10-15T00:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":22422869,"identity":"6585dcdb-0264-4745-97d6-918bba7c67f0","added_by":"auto","created_at":"2022-06-08 16:57:37","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":376778,"visible":true,"origin":"","legend":"\u003cp\u003eRotavirus, Hepatitis E virus and Hepatitis A virus positive PCR amplicons\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1736848/v1/32d76b9789eb0f2f9e159637.jpg"},{"id":28007624,"identity":"ccc277bf-af22-4129-a11e-8d37847fadca","added_by":"auto","created_at":"2022-10-19 18:29:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":482292,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1736848/v1/62dc0d76-cd2e-485c-8ea2-434cc30c9fba.pdf"},{"id":22422870,"identity":"378dd358-6de4-4eee-860a-32d8ff491379","added_by":"auto","created_at":"2022-06-08 16:57:37","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":753202,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract\u003c/p\u003e","description":"","filename":"Sunu1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1736848/v1/e71bb3e2ecf833a56a84ff2d.jpg"}],"financialInterests":"","formattedTitle":"\u003cp\u003eMicrobiological quality of ready-to-eat vegetable salads served at meat restaurants under the COVID 19 pandemic induced food demand: an example from Eastern Turkey\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eReady-to-eat (RTE) foods are foods that are consumed without any additional processing or preparation, which may be industrially and/or conventionally processed, packaged or unpackaged (Makinde et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Dietary preferences of individuals due to rapid urbanization and socio-economic transformations of their current lifestyles have shifted towards ready-made meals (Sarkar et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). ResearchandMarkets (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) data showed that the demand for RTE foods has increased rapidly, especially among consumers who do not like to cook during the COVID-19 pandemic. In addition, it was stated that, in connection with the increasing coronavirus cases, restaurants forced consumers to cook at home, causing an increase in the consumption of ready-made meals in the medium term. On the other hand, the increasing consumption of RTE foods globally has been significantly associated with various outbreaks of food infections and poisoning. Especially RTE vegetable salads (REVS) can be primarily contaminated by animals, soil, irrigation water, fertilizers, etc. Moreover, cutting and slicing raw vegetables in restaurants can cause the nutrients in the plants to be released and thus accelerate microbial development (Mir et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Also, cross-contamination from staff working in restaurants, tools/equipment used, contaminated water, as well as storage in inappropriate conditions are important risk factors affecting the final microbiological quality of the product. Therefore, REVS may carry microbial risks under the influence of more than one unsuitable factors (Bencardino et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kim et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). This situation can lead to the emergence of pathogens such as \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS. aureus\u003c/em\u003e), \u003cem\u003eSalmonella\u003c/em\u003e spp., \u003cem\u003eEscherichia coli\u003c/em\u003e (\u003cem\u003eE. coli\u003c/em\u003e), \u003cem\u003eCampylobacter jejuni\u003c/em\u003e (\u003cem\u003eC. jejuni\u003c/em\u003e), \u003cem\u003eClostridium perfringens\u003c/em\u003e (\u003cem\u003eC. perfringens\u003c/em\u003e), and \u003cem\u003eListeria monocytogenes\u003c/em\u003e (\u003cem\u003eL. monocytogenes)\u003c/em\u003e as well as an increased in total aerobic and spoilage bacteria, yeasts, and molds in REVS (Abakari et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). On the other hand, a high microorganism load can be contained multi-resistant bacteria, which is an important public health problem nowadays (Rodr\u0026iacute;guez-L\u0026aacute;zaro et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The increasing presence of ESBL-producing bacteria from RTE foods, which is among the challenges of antibiotic resistance, is another important risk for human health due to its epidemiological importance (Giri et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, it has been reported that REVS are reservoirs not only for bacterial pathogens, but also for enteric viruses such as norovirus (NoV), hepatitis A (HAV), hepatitis E (HEV), and rotavirus (RV) that may lead to an epidemic (Terio et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe increasing interest in the demand for RTE foods in Turkey has been in parallel with the developments in the world, especially during the COVID 19 pandemic. RTE foods in which meat is used as raw material such as pide/lahmacun, kebab types, and tantuni are notably in high demand (Ipsos, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The demand to reach hygienic foods by consumers is also for RTE foods, just like all other foods. In some studies, conducted in Turkey, the microbiological quality of RTE foods was investigated and it was reported that presence of some foodborne pathogens including \u003cem\u003eL. monocytogenes\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e spp. and Norovirus (Abay et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Gurler et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Şanlıbaba et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Terzi et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yilmaz et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, it is noteworthy that in these studies, there was no comprehensive perspective on vegetable salads served with RTE foods in meat restaurants. Therefore, it is thought that ignoring the microbiological quality of the vegetable salads served with meat-based RTE foods may be an important risk in terms of public health. Moreover, to the best of our knowledge, there is no adequate data on the microbiological quality of REVS from eastern Turkey. Thus, this study aimed to investigate some microbiological properties, antimicrobial resistance of foodborne pathogens including \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e and the presence of enteric viruses in REVS in the east of Turkey.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSamples\u003c/h2\u003e \u003cp\u003eIn this study, REVS samples were taken aseptically from 42 meat restaurants operating in Erzurum region in eastern Turkey. The samples were transferred to the laboratory in a thermal bag under the cold chain. Samples were analyzed as soon as they reached the laboratory. For virological analysis, samples were stored at -80\u0026deg;C until analysis. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e presents information about the characteristics of REVS and restaurants. Information on the conditions under which most of the vegetable salads used in the study were stored was not given by the restaurant staff. Since all vegetable salads collected as a sample were washed, grated, and ready for direct consumption, it was named RTE.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of collected REVS and restaurants\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSymbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIngredients of Vegetable Origin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePackaging Method\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRestaurant type\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eParsley, salad, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, parsley, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, purple cabbage, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eShish kebab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun and D\u0026ouml;ner kebab (Beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTantuni\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab, D\u0026ouml;ner kebab (Beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab, D\u0026ouml;ner kebab (Beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlastic bag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eShish kebab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot and lettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlastic bag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCardboard bag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab, D\u0026ouml;ner kebab (Beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce, salad, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGiblet shish kebab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, purple cabbage, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTantuni\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, lettuce, purple cabbage, and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePide-Lahmacun, Shish kebab, D\u0026ouml;ner kebab (Beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlastic bag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLettuce and tomatoes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolyethylene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken and beef)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarrot, parsley, and purple cabbage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePolystyrene (PS) foam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u0026ouml;ner kebab (Chicken)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMicrobiological analysis\u003c/h2\u003e \u003cp\u003eA 10 g sample was transferred to a filtered stomacher bag and 90 mL of sterile physiological saline solution (0.85% NaCI) was added. The mixture was homogenized in a Stomacher for 1 min. From this homogenate, 10-fold serial dilutions were prepared with sterile physiological saline solution, and 0.1 mL various dilution levels were spread-plated onto appropriate media and incubated at appropriate condition (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The bacterial colonies were counted and converted in colony forming units (CFU). CFU was calculated following formula: \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(CFU/g=Number of colonies x \\frac{Total dilution}{Volume actually plated}\\)\u003c/span\u003e\u003c/span\u003e. All counts were reported as log\u003csub\u003e10\u003c/sub\u003e CFU/g.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMedia and incubation conditions used for the enumeration of microorganisms\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMicroorganisms\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eIncubation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCulture media\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTime (h)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eTemp (℃)\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal aerobic mesophilic bacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePlate Count Agar (PCA)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eColiforms\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eViolet Red Bile Agar (VRBA)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eStaphylococcus\u003c/em\u003e/\u003cem\u003eMicrococcus\u003c/em\u003e spp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBaird Parker Agar (BPA) (supplemented with egg yolk tellurite emulsion)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYeast and Mold\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRose Bengal Chloramphenicol (RBC) Agar\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe samples were analyzed for the presence of foodborne pathogens commonly isolated from REVS, i.e., \u003cem\u003eE. coli\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e spp., and \u003cem\u003eS. aureus\u003c/em\u003e. To isolate \u003cem\u003eE. coli\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e spp., and \u003cem\u003eS. aureus\u003c/em\u003e 25 g of each sample were aseptically weighed, transferred to sterile filtered plastic bags, and homogenized using masticator with 225 mL buffered peptone water (BPW) (Merck, Germany) for 2 min. Then this homogenate kept for 60 min at room temperature (Andrews and Hammack, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). For \u003cem\u003eSalmonella\u003c/em\u003e spp. isolation, the homogenate was incubated for 24\u0026thinsp;\u0026plusmn;\u0026thinsp;2 h at 35\u0026deg;C followed by a 0.1 mL mixture transferred to 10 mL Rappaport-Vassiliadis (RV) medium and another 1 mL mixture to 10 mL Muller-Kauffmann Tetrathionate-Novobiocin Broth (MKTTN) and they were incubated at 37 ℃ for 24 h. A loop-full culture of from each broth was streaked onto Xylose Lysine Desoxycholate (XLD) agar and Xylose Lysine Tergitol 4 (XLT4) agar and incubated at 37 ℃ for 24 h. Two or more colonies of showing typical \u003cem\u003eSalmonella\u003c/em\u003e colony morphology were picked from each selective agar plate after incubation (Baran et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). To \u003cem\u003eE. coli\u003c/em\u003e isolation, a loop-full of pre-enriched sample was streaked onto Tryptone Bile X-glucuronide (TBX) agar and incubated at 37 ℃ for 24 h. The blue-green colored suspicious \u003cem\u003eE. coli\u003c/em\u003e colonies grown in TBX were subpassaged on the Mueller Hinton agar (MHA) (HiMedia, Mumbai, India) plate for biochemical and molecular analysis (Baran et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). A loop-full of homogenate was passaged on BP Agar supplemented with egg yolk tellurite emulsion to isolate \u003cem\u003eS. aureus\u003c/em\u003e and incubated at 37 ℃ for 24 h. The typical transparent zone around the colony as a result of lipolysis/proteolysis, black colonies due to the reduction of tellurite to tellurium were evaluated as suspicious \u003cem\u003eS. aureus\u003c/em\u003e, and subpassaged for further analysis as mentioned for \u003cem\u003eE. coli\u003c/em\u003e above (Hall, 2013).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial Susceptibility Testing\u003c/h2\u003e \u003cp\u003eKirby-Bauer disk diffusion technique on MHA (HiMedia) was used for antimicrobial susceptibility testing against to using 12 different commercially available antibiotic disks (HiMedia, Mumbai, India) including meropenem (10 \u0026micro;g), chloramphenicol (30 \u0026micro;g), gentamicin (10 \u0026micro;g), kanamycin (30 \u0026micro;g), tetracycline (30 \u0026micro;g), ciprofloxacin (5 \u0026micro;g), sulfamethoxazole/trimethoprim (25 \u0026micro;g), cefepime (30 \u0026micro;g), cefpodoxime (10 \u0026micro;g), cefoxitin (30 \u0026micro;g), and aztreonam (30 \u0026micro;g). The inhibition zones were measured and interpreted as sensitive or resistant as recommended by the guidelines of Laboratory and Institute (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Resistance to at least one agent in three or more antimicrobial groups was defined as multi-drug resistance.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhenotypic and Genotypic Detection of ESBL\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e \u003cb\u003eand Methicillin-Resistant\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eS. aureus\u003c/span\u003e The presence of ESBL phenotype was determined by the double-disc synergy test (DDST) using cefotaxime and ceftazidime alone and in combination with clavulanic acid as recommended by the Laboratory and Institute (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). For this purpose, CAZ (30 \u0026micro;g), CTX (30 \u0026micro;g), ceftazidime-clavulanic acid (30/10 \u0026micro;g), and cefotaxime-clavulanic acid (30/10 \u0026micro;g) discs were placed on MHA. After 16\u0026ndash;18 hours of incubation at 35 \u0026ordm;C, \u0026ge;\u0026thinsp;5 mm increase in zone diameter of ceftazidime/clavulanic acid disc and ceftazidime disc alone, and/or \u0026ge;\u0026thinsp;5 mm increase in the zone diameter of cefotaxime/clavulanic acid disc and cefotaxime disc alone were considered as ESBL positive. The genotypic assay was made by using genomic DNA obtained from phenotypic ESBL positive isolates by boiling method as a template. Briefly, 100 \u0026micro;L of Tris-EDTA buffer solution (pH, 8.00) containing a few colonies was boiled for 10 min. At the end of the boiling, the samples were cooled on ice and centrifuged at 10.000 xg for 15 s. The supernatant was used template in PCR (Baran et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) components were provided by Vivantis Technologies (Subang Jaya, Malaysia). Primers used in this study were obtained from Metabion International AG (Planegg-Martinsried, Germany). The isolates that were ESBL-positive by DDST were subjected to amplification by PCR method using TEM, SHV, CTX-M-1, CTX-M-2, CTX-M-8/25, and CTX-M-9 group primers, as previously reported by Le et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOxacillin disc (1\u0026micro;g; Oxoid, Cambridge, UK) diffusion assay was performed for evaluation of methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e (MRSA) following CLSI guidelines for interpretation of the results and using \u003cem\u003eS. aureus\u003c/em\u003e ATCC 29213 as a negative control (Laboratory and Institute, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). PCR was performed for the confirmation of \u003cem\u003eS. aureus\u003c/em\u003e isolates with \u003cem\u003efemA\u003c/em\u003e gene and presence of methicillin-resistant gene \u003cem\u003emecA\u003c/em\u003e (Findik et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePhylo-typing analysis\u003c/h2\u003e \u003cp\u003ePhylo-typing groups were determined using the quadruplex phylogroup assignment method for \u003cem\u003eE. coli\u003c/em\u003e isolates, previously described by Clermont et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). PCRs were carried out using thermal cycler (BioRad, USA) in a total volume of 25 \u0026micro;l containing 10 pmol of each three pair of primers (Sigma, USA), 25 \u0026micro;mol of dNTPs, 5 \u0026micro;l of template DNA, 2.5 \u0026micro;l of 10Χ Taq buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.3)], 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 2.5 U of Taq polymerase (Fermentas, USA). The PCR product bands were separated by electrophoresis through 1.2% agarose gel in 1\u0026times; TAE buffer. DNA fragments were visualized by ethidium bromide staining and photographed under ultraviolet light illumination.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eViral RNA detection\u003c/h2\u003e \u003cp\u003ePCR analysis was performed to investigate Rotavirus, Hepatitis E virus, Hepatitis A virus, and Norovirus that could be transmitted by the fecal-oral route (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Each of the RTE salad samples was put 2 grams in the tube and diluted with 1.5 mL of phosphate-buffered saline (PBS). After vertexing, it was centrifuged at 2500 rpm at +\u0026thinsp;4\u0026deg;C for 5 min and 500 \u0026micro;l of supernatant from this suspension was used for isolation of viral nucleic acid. Viral nucleic acid was extracted from RTE salad samples by using the GF-1 viral nucleic acid extraction kit (Vivantis, Malaysia) according to the manufacturer's instructions. A nucleic acid concentration was measured using a NanoDrop spectrophotometer (Thermo Scientific, DE). The amplicons obtained from PCR were visualized by gel-electrophoresis and positive results on the gel were recorded for each virus. Positive control samples are viruses that have been previously confirmed by sequence analysis (Aktaş et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Aydin et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRotavirus, Hepatitis E virus, Hepatitis A virus and Norovirus PCR primer sequence used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence 5'-3'\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLength (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRotavirus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eVP6 F\u003c/p\u003e \u003cp\u003eVP6 R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGGVGCRACTACATGGT\u003c/p\u003e \u003cp\u003eGTCCAATTCATNCCTGGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e379\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e(Aydin et al.)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHepatitis A Virus\u003c/b\u003e VP1/P2B F1\u003c/p\u003e \u003cp\u003eVP1/P2B R1\u003c/p\u003e \u003cp\u003eVP1/P2B F2\u003c/p\u003e \u003cp\u003eVP1/P2B R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAGATTCTACATTTGGATTGGT\u003c/p\u003e \u003cp\u003eCCATTTCAAGAGTCCACACACT\u003c/p\u003e \u003cp\u003eCTATTCAGATTGCAAATACAAT\u003c/p\u003e \u003cp\u003eAACTTCATTATTTCATGCTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003cp\u003e394\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e(Rachida et al.)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHepatitis E Virus\u003c/b\u003e\u003c/p\u003e \u003cp\u003e3156 F\u003c/p\u003e \u003cp\u003e3157 R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTATGCC(T)CAGTAC(T)CGG(A)GTTG\u003c/p\u003e \u003cp\u003eCCCTTA(G)TCC(T)TGCTGA(C)GCATTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e731\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e(Huang et al. 2002)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNorovirus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eJV12 F\u003c/p\u003e \u003cp\u003eJV13 R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATACCACTATGATGCAGATTA\u003c/p\u003e \u003cp\u003eTCATCATCACCATAGAAAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e327\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e(Timurkan et al.)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe descriptive statistics were calculated for each parameter using SPSS Software (IBM SPSS statistics 20).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results And Discussion","content":"\u003cp\u003eOf a total of forty-two REVS samples were collected from meat restaurants operating in the Erzurum region in eastern Turkey to investigate the foodborne pathogens including bacteria and viruses for their microbiological properties and antimicrobial resistance. The total aerobic bacteria (TAB) in the tested salads ranged from \u0026lt;\u0026thinsp;1 to 6.40 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (with an average of 4.72 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Although the lowest TAB count was detected in the samples #E14 and #E16, the highest value was in the #24 (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In addition, the highest yeasts and molds (5.00 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), coliform (5.79 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), and staphylococcal/micrococcal bacteria (5.66 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) have been also detected in the sample #24. The count of bacteria in the salad samples tested in this study results showed an overall similar trend to each other. For example, when the TAB count was detected as high, other parameters showed a high trend as much as TAB (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). A very few of the samples 3 out of 42 (7.14%) had a TAB count\u0026thinsp;\u0026gt;\u0026thinsp;6 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, which categorizes them as borderline, according to Health Protection Agency (HPA) guidelines (Gilbert et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). It has been reported that TAB was ranged from 4.1 log cfu/g to 8.3 log cfu/g in mixed fresh-cut salads in Mashhad, Iran (Najafi et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), however, it was between 5.12 and 9.75 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (with an average of 7.73 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) in REVS in Cyprus (Xylia et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In addition, a high level of TAB (6.43 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e-mean (3.50\u0026ndash;8.39)) was reported in raw salad vegetables sold in Lebanon (Faour-Klingbeil et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Of note, these findings were found to be considerably higher than our study. On the other hand, the presence of high numbers of yeast and molds (ranged between \u0026lt;\u0026thinsp;1-6.26 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) determined in the REVS samples in the current study. In the previous studies, which were consistent with the current study results, the yeast and mold were reported 10\u003csup\u003e4\u003c/sup\u003e-10\u003csup\u003e7\u003c/sup\u003e log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 1.63 and 6.68 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e from India and Mexica, respectively (Pingulkar et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) In this context, coliform bacteria (CO) were detected at levels ranging from \u0026lt;\u0026thinsp;1-5.82 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in all REVS samples. Regardless of the sources, the number of CO was detected in all salads served in Mexican restaurants with limits ranging from 5.4\u0026times;10\u003csup\u003e3\u003c/sup\u003e to 1.7\u0026times;10\u003csup\u003e8\u003c/sup\u003e log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1 1\u003c/sup\u003e (G\u0026oacute;mez-Aldapa et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The high coliform bacteria count identified in the current study may be associated with poor hygiene practices during the preparation of REVS. Apart from CO, the \u003cem\u003eStaphylococcus\u003c/em\u003e and \u003cem\u003eMicrococcus\u003c/em\u003e spp. count (STA/MICR) was determined between \u0026lt;\u0026thinsp;1 and 5.66 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in the current study, indicating a possible transmission of the food handlers. Risk factors that play a role in the contamination of vegetables, such as unsafe water sources for irrigation, inappropriate fertilizers or manures, access to livestock wild animals in the field, and unhygienic post-harvest handling (unhygienic utensil, labor, handling, packaging material, and improper/inadequate storage conditions) were indicated by investigators in the previous studies (Chau et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Mercanoglu Taban and Halkman, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Mir et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Rahman et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These results showed a relatively high contamination rate detected in the salad samples tested in this study, indicating that RTE salad serving in the meat restaurant is a risk factor for the transmission of food-borne diseases in humans (Bautista-De Le\u0026oacute;n et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMicrobiological quality of REVS\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"12\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eMicrobial Count (log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c12\" namest=\"c6\"\u003e \u003cp\u003ePresence (+/-)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSymbol\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTAB\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eYM\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eCO\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eSTA/MICR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eSTA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eSAL\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003eEC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003eHEV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003eRV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003eHEA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003eNoV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMinV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMaxV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVariance\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSD\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSE\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMean\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c12\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibiotic susceptibility pattern (Sensitive and Resistance) of \u003cem\u003eE. coli\u003c/em\u003e isolates.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAntibiotic (\u0026micro;g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eAntibiotic susceptibility pattern\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eSensitive\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eResistance\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMeropenem (10 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16 (100%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChloramphenicol (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15 (93.75%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (6.25%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGentamicin (10 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16 (100%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKanamycin (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16 (100%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTetracycline (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13 (81.25%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 (18.75%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCiprofloxacin (5 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12 (75.00%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4 (25.00%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSulfamethoxazole/Trimethoprim (25 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11 (68.75%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 (31.25%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCefepime (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14 (87.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (12.50%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCefpodoxime (10 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9 (56.25%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7 (43.75%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCefoxitin (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12 (75.00%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4 (25.00%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAztreonam (30 \u0026micro;g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15 (93.75%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (6.25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAlthough the HPA guidelines indicated\u0026thinsp;\u0026ge;\u0026thinsp;10\u003csup\u003e2\u003c/sup\u003e for \u003cem\u003eE. coli\u003c/em\u003e, \u0026ge;10\u003csup\u003e4\u003c/sup\u003e for \u003cem\u003eS. aureus\u003c/em\u003e, and presence in 25 g for \u003cem\u003eSalmonella\u003c/em\u003e spp. are evaluated as an unsatisfactory product (Gilbert et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), Turkish Food Codex (2011) has ruled that RTE foods should not be contained \u003cem\u003eE. coli\u003c/em\u003e (\u0026lt;\u0026thinsp;10\u003csup\u003e1\u003c/sup\u003e), \u003cem\u003eSalmonella\u003c/em\u003e spp., \u003cem\u003eL. monocytogenes\u003c/em\u003e, and staphylococcal enterotoxins. None of the REVS tested in this study contained \u003cem\u003eSalmonella\u003c/em\u003e spp., whereas \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e were isolated in 38.1% (16/42) and 2.4% (1/42), respectively, however, not using the colony counting method. Hence, it is impossible to evaluate the current study results according to HPA guidelines and/or the Turkish Food Codex.\u003c/p\u003e \u003cp\u003eConsidered by food vendors as an indicator of fecal contamination and improper hygiene practices, \u003cem\u003eE. coli\u003c/em\u003e can cause gastroenteritis and diarrhea in humans when taken with contaminated food (Abakari et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The prevalence of \u003cem\u003eE. coli\u003c/em\u003e was found to be 38.10% (16/32) in the salad samples analyzed in this study. This result was lower than in studies done in other countries: 96.7% in Ghana (Abakari et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e); 94% in Cote d'ivoire (Coulibaly-Kalpy et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2017\u003c/span\u003e); 83.2% in Mexico (G\u0026oacute;mez-Aldapa et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e); 64% in Argentina (Pellicer et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). But it was higher than some countries: 20% in United Arab Emirates (Almualla et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and 16.7% in Spain. The prevalence of \u003cem\u003eE. coli\u003c/em\u003e contamination has displayed a significant variation between developed and developing countries (Rahman et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). For example, studies in low-income countries such as Pakistan, Bangladesh, and India reported the prevalence of \u003cem\u003eE. coli\u003c/em\u003e in raw vegetable samples sold in retail markets ranged from 34\u0026ndash;60% (Ahmed et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Saksena et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Shah et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) whereas it was 3.1% and 4.1% in the USA and Germany, respectively (Liu and Kilonzo-Nthenge, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Schwaiger et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Phylo-typing of \u003cem\u003eE. coli\u003c/em\u003e strains using quadruplex PCR displayed six isolates in group A, four isolates in groups B\u003csub\u003e1\u003c/sub\u003e and C, and one isolate in groups E and F (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Although most of \u003cem\u003eE. coli\u003c/em\u003e isolates were detected in the group with commensal strains (group A and B1) in the current study, only one isolate was detected in the virulent group (F).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhylogenetic groups and ESBL presence of \u003cem\u003eE. coli\u003c/em\u003e isolates from RTE vegetable salad samples\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIsolate ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhylogeny\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eESBL\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eESBL Genotype\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"4\" rowspan=\"5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCTX-M-1, TEM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCTXM8/25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTEM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16/42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6/16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eDespite the high STA/MICR count, \u003cem\u003eS. aureus\u003c/em\u003e could only be detected in one sample in the current study. As it is known, \u003cem\u003eS. aureus\u003c/em\u003e is one of the most important foodborne pathogens worldwide, some strains of which can produce one or more toxins, mainly enterotoxin (Xing et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The prevalence of \u003cem\u003eS. aureus\u003c/em\u003e in REVS observed in the present study is comparable to similar studies (Faour-Klingbeil et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Najafi et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Seo et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe sources of contamination of \u003cem\u003eSalmonella\u003c/em\u003e could be animal feces as fertilizer, cultivation of the plants with wastewater, and personal hygiene (Machado et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Salleh et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Sapkota et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Taban et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). \u003cem\u003eSalmonella\u003c/em\u003e spp. was also isolated in fresh vegetables by investigators in the previous studies (Evelyne et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Sapkota et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) in contrast to our study findings. On the other hand, in line with our current study, Campos et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported that they did not detect \u003cem\u003eSalmonella\u003c/em\u003e spp. in 45 REVS sold in Portugal.\u003c/p\u003e \u003cp\u003eOnly one \u003cem\u003eS. aureus\u003c/em\u003e was isolated and confirmed by PCR (with \u003cem\u003efemA\u003c/em\u003e gene) in the current study, and the isolate was resistant to gentamicin, kanamycin, aztreonam, and ciprofloxacin in the disc diffusion assay. In addition, the PCR analysis conducted for detection of the \u003cem\u003emecA\u003c/em\u003e gene showed that the \u003cem\u003eS. aureus\u003c/em\u003e strain isolated in the current study was not harboring the \u003cem\u003emecA\u003c/em\u003e gene. On the other hand, all \u003cem\u003eE. coli\u003c/em\u003e strains (n\u0026thinsp;=\u0026thinsp;16) were resistant (100%) against aminoglycoside antibiotics (gentamicin and kanamycin) tested in this study, even though they were susceptible to meropenem in the disc diffusion assay. The isolates displayed a low level of resistance against chloramphenicol (6.25%), tetracycline (18.75%), and ciprofloxacin (25.00%). These data indicated that antimicrobial-resistant \u003cem\u003eE. coli\u003c/em\u003e strains from REVS salad samples in the current study still remain moderately low-level resistant to anti-Gram-negative drugs of importance for human medicine, suggesting that these antibiotics could be non-effective in the future due to the rising antimicrobial resistance. The double-disc synergy test used for the detection of the phenotypic resistant ESBL producing strains in the current study displayed that 35.7% (6/16) of the isolates were ESBL producing. Molecular analysis of ESBL producing strains showed that one strain harbored two different genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTXM\u0026minus;1\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e), whereas two isolates carried one gene (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTXM8/25\u003c/sub\u003e). To the best of our knowledge, this is the first report of the presence of ESBL producing \u003cem\u003eE. coli\u003c/em\u003e in REVS in Turkey. The outbreaks due to the multi-drug resistant bacteria on fresh vegetable products have been reported around the world by researchers in previous studies (Freitag et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Janal\u0026iacute;kov\u0026aacute; et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liu and Kilonzo-Nthenge, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sapkota et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A study in Japan indicated that fresh vegetables served as an important route of transmission of ESBL producer bacteria to humans (Usui et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In terms of public health, antimicrobial resistant zoonotic pathogens in foods pose a direct risk. Foods can be contaminated with bacteria harboring antimicrobial resistance genes, antibiotics using agricultural production, resistance genes of microorganisms used as starters during food processing, and cross contamination. Since raw foods are consumed without undergoing any other processing, they carry a significant risk of transferring antimicrobial resistance to humans. Ultimately, transfer of antimicrobial resistance genes between bacteria can also occur after ingestion by humans (Verraes et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Moreover, poor processing and preservation conditions lead to the continued presence of damaged or stressed cells in food, increasing the risk of bacteria carrying antimicrobial resistance genes transmission (Lammie and Hughes, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe presence of hepatitis E virus (HEV), rotavirus (RV), hepatitis A virus (HAV), and norovirus (NoV) was investigated in the current study to reveal important viral infections to public health in the REVS samples. Viral nucleic acid was detected in fourteen salad samples tested in the current study by PCR. Of these, two were evaluated as positive for RV (4.8%), and six for HAV (14.3%) and HEV (14.3%). Nov couldn\u0026rsquo;t be found in any of the samples in the current study. Gel-electrophorese images of viral nucleic acids and control groups determined positive by PCR analysis are given in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. HEV, HAV, RV, and NoV are transmitted to humans by food and environmental routes depending on the virus genotype, environmental conditions, hygienic conditions, and the types of food consumed (Van der Poel, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In a study showed that in the total of 911 REVS samples including mixed salads, carrots, valerian arugula, spinach, iceberg, and romaine lettuce from supermarkets in Italy, the total prevalence of HAV and HEV was 1.9% (18/911) and 0.6% (6/911), respectively, even though NoV could not be detected in any of the samples (Terio et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Although the prevalence of HAV and HEV was detected high level, similarly NoV did not determine in the samples tested in the current study. In contrast to our study data, a low level of NoV (2.90\u0026ndash;3.75%) was reported in vegetables and fruits by the other researchers in published studies (Parada-Fabi\u0026aacute;n et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), indicating the less frequent detection of NoV in REVS products. Hence, salads are less frequently involved in foodborne viral outbreaks than other foods; however, they may be contaminated with unsanitary food workers or raw materials that have been contaminated (Cheng et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Khan et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that 29 samples including cauliflower, tomato, ridge gourd, brinjal, pumpkin, mint, bitter gourd, okra, pepper, cucumber collected from 13 different locations of district Mardan in Pakistan, 1 were positive for HAV. Shin et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2019\u003c/span\u003e)) reported that 1 sample were positive for HAV in fresh vegetables and fruits including Chinese cabbage, cucumber, lettuce, strawberry. Fresh and frozen vegetable and fruit samples including spinach, parsley, purslane, cherry and strawberry from supermarkets in Mexico, 7/80 were positive for HAV (Parada-Fabi\u0026aacute;n et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In another study, of the 70 vegetable samples including 51 first range raw vegetables and one fourth range REVS from markets in Sicily, 1.4% for HEV((Purpari et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e)). The prevalence of RV was found variable in vegetables: 13.75% (11/80) in Mexico (Parada-Fabi\u0026aacute;n et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e); 22% (23/101) in Argentina (Emilse et al. 2021). To the best of our knowledge, this is the first report from Turkey for HEV, HAV, and RV positivity in REVS, suggesting REVS can be a reservoir for the important viral pathogens and to be considered before consumption.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eViral contamination can occur at several points in the food production chain. Because they do not have a chance to growth outside of living cells, their presence in food can be explained by pre-harvest contamination of vegetables or post-harvest contamination from food processors. On the other hand, the fact that the food handlers in the field where the vegetables are harvested and the water quality used in agricultural irrigation can affect the microbiological properties of vegetables can also explain the high level of viral contamination (Terio et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe assessment of microbiological contamination status in REVS contributes to the identification of risks for government authorities as well as to the assessment of consumer exposure. This is the first report of the presence of ESBL producing \u003cem\u003eE. coli\u003c/em\u003e, hepatitis E, hepatitis A and rotavirus for REVS from Turkey. On the other hand, it can be predicted that the high microorganism load detected in REVS samples and the antimicrobial resistance of isolates may pose a threat to public health. Considering that the lack of an effective surveillance system led to the inability to identify the possible source of the epidemic, it was thought that REVS could be a reservoir in this sense. Elimination or at least mitigation of this current potential risk requires increasing the good agricultural and manufacturing practices throughout the vegetable production process from the farm to the retailer and restaurants. Moreover, hazard analysis and critical control point (HACCP) strategies need to be implemented and effectively supervised, especially at the restaurant level.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e This article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e This article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e This article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbakari G, Cobbina SJ, Yeleliere E (2018) Microbial quality of ready-to-eat vegetable salads vended in the central business district of Tamale, Ghana. Int J Food Contam 5: 3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbay S, Irkin R, Aydin F et al (2017) The prevalence of major foodborne pathogens in ready-to-eat chicken meat samples sold in retail markets in Turkey and the molecular characterization of the recovered isolates. Lebensm Wiss Technol 81: 202\u0026ndash;209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed S, Siddique MA, Rahman M et al (2019) A study on the prevalence of heavy metals, pesticides, and microbial contaminants and antibiotics resistance pathogens in raw salad vegetables sold in Dhaka, Bangladesh. Heliyon 5: e01205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAktaş O, Aydin H, Timurkan MO (2019) A molecular study on the prevalence and coinfections of Rotavirus, Norovirus, Astrovirus and Adenovirus in children with gastroenteritis. Minerva Pediatr 71: 431\u0026ndash;437.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmualla NA, Laleye LC, Abushelaibi AA et al (2010) Aspects of the microbiological quality and safety of ready-to-eat foods in Sharjah supermarkets in the United Arab Emirates. J Food Prot 73: 1328\u0026ndash;1331.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrews W, Hammack T (2007). Chapter 5: Salmonella. US Food and Drug Administration (FDA) Bacteriological Analytical Manual (BAM) Online.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAydin H, Uyanik MH, Karamese M et al (2016) Seroprevalence of hepatitis e virus in animal workers in nonporcine consumption region of Turkey. Future Virol 11: 691\u0026ndash;697.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaran A, Adıg\u0026uuml;zel MC, Y\u0026uuml;ksel M (2020) Prevalence of antibiotic-resistant and extended-spectrum beta-lactamase-producing Escherichia coli in chicken meat from eastern Turkey. Pak Vet J 40: 355\u0026ndash;359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaran A, Erdoğan A, Kavaz A et al (2019) Some specific microbiological parameters and prevalence of Salmonella spp. in retail chicken meat from Erzurum province, Turkey and characterization of antibiotic resistance of isolates. Biosci J 35: 878\u0026ndash;891.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBautista-De Le\u0026oacute;n H, G\u0026oacute;mez‐Aldapa C, Rangel‐Vargas E et al (2013) Frequency of indicator bacteria, S almonella and diarrhoeagenic E scherichia coli pathotypes on ready‐to‐eat cooked vegetable salads from M exican restaurants. Lett Appl Microbiol 56: 414\u0026ndash;420.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBencardino D, Vitali LA, Petrelli D (2018) Microbiological evaluation of ready-to-eat iceberg lettuce during shelf-life and effectiveness of household washing methods. Ital J Food Saf 7: 50\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampos J, Mour\u0026atilde;o J, Pestana N et al (2013) Microbiological quality of ready-to-eat salads: An underestimated vehicle of bacteria and clinically relevant antibiotic resistance genes. Int J Food Microbiol 166: 464\u0026ndash;470.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChau ML, Aung KT, Hapuarachchi HC et al (2017) Microbial survey of ready-to-eat salad ingredients sold at retail reveals the occurrence and the persistence of Listeria monocytogenes Sequence Types 2 and 87 in pre-packed smoked salmon. BMC Microbiol 17: 1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng D, Zou S, Liao N et al (2018) Evaluation of an Extraction Method for the Detection of GI and GII Noroviruses in Fruit and Vegetable Salads. J Food Sci 83: 393\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClermont O, Christenson JK, Denamur E et al (2013) The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo‐groups. Environmental microbiology reports 5: 58\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoulibaly-Kalpy J, Agbo EA, Dadie TA et al (2017) Microbiological quality of raw vegetables and ready to eat products sold in Abidjan (Cte dIvoire) markets. Afr J Microbiol Res 11: 204\u0026ndash;210.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvelyne T, Attien P, Moroh AJ-L et al (2022) Prevalence and characterization of Salmonella isolated from vegetables salads and ready to eat raw mixed vegetable salads in Abidjan, Cte dIvoire. J Microbiol Antimicrob 14: 15\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaour-Klingbeil D, Murtada M, Kuri V et al (2016) Understanding the routes of contamination of ready-to-eat vegetables in the Middle East. Food Control 62: 125\u0026ndash;133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFindik A, Akan N, Onuk EE et al (2009) Methicillin resistance profile and molecular typing of Staphylococcus aureus strains isolated from noses of the healthy dogs. Kafkas Univ Vet Fak Derg 15: 925\u0026ndash;930.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreitag C, Michael G, Li J et al (2018) Occurrence and characterisation of ESBL-encoding plasmids among Escherichia coli isolates from fresh vegetables. Vet Microbiol 219: 63\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilbert R, De Louvois J, Donovan T et al (2000) Guidelines for the microbiological quality of some ready-to-eat foods sampled at the point of sale. PHLS Advisory Committee for Food and Dairy Products. Commun Dis Public Health 3: 163\u0026ndash;167.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiri S, Kudva V, Shetty K et al (2021) Prevalence and Characterization of Extended-Spectrum β-Lactamase-Producing Antibiotic-Resistant Escherichia coli and Klebsiella pneumoniae in Ready-to-Eat Street Foods. Antibiotics 10: 850\u0026ndash;850.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026oacute;mez-Aldapa CA, Rangel-Vargas E, Castro-Rosas J (2013) Frequency and Correlation of Some Enteric Indicator Bacteria and Salmonella in Ready-to-Eat Raw Vegetable Salads from Mexican Restaurants. J Food Sci 78: M1201-M1207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGurler Z, Pamuk S, Yildirim Y et al (2015) The microbiological quality of ready-to-eat salads in Turkey: A focus on Salmonella spp. and Listeria monocytogenes. Int J Food Microbiol 196: 79\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall GS (2013) Bailey \u0026amp; Scott\u0026rsquo;s Diagnostic Microbiology, 13th Edn. Lab Med 44:e138-e139.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIpsos (2020). Beverage products drew attention in the purchase of fast moving consumer goods in the household.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanal\u0026iacute;kov\u0026aacute; M, Pleva P, Pavl\u0026iacute;čkov\u0026aacute; S et al (2018) Characterization of Escherichia coli strains isolated from raw vegetables. Potravinarstvo Slovak Journal of Food Sciences 12: 304\u0026ndash;312.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan W, Irshad M, Rehman G et al (2014) HAV in fresh vegetables: a hidden health risk in district Mardan, Pakistan. SpringerPlus 3: 675.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JS, Bang OK, Chang HC (2004) Examination of microbiological contamination of ready-to-eat vegetable salad. J Food Hyg Saf 19: 60\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaboratory C, Institute S (2019). Performance standards for antimicrobial susceptibility testing. (Clinical Laboratory and Standards Institute Wayne, PA).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLammie SL, Hughes JM (2016) Antimicrobial resistance, food safety, and one health: the need for convergence. Annu Rev Food Sci Technol 7: 287\u0026ndash;312.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe QP, Ueda S, Nguyen TNH et al (2015) Characteristics of extended-spectrum β-lactamase\u0026ndash;producing Escherichia coli in retail meats and shrimp at a local market in Vietnam. Foodborne Pathog Dis 12: 719\u0026ndash;725.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu S, Kilonzo-Nthenge A (2017) Prevalence of multidrug-resistant bacteria from US-grown and imported fresh produce retailed in chain supermarkets and ethnic stores of Davidson County, Tennessee. Journal of food protection 80: 506\u0026ndash;514.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMachado DC, Maia CM, Carvalho ID et al (2006) Microbiological quality of organic vegetables produced in soil treated with different types of manure and mineral fertilizer. Braz J Microbiol 37: 538\u0026ndash;544.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakinde OM, Ayeni KI, Sulyok M et al (2020) Microbiological safety of ready-to‐eat foods in low‐and middle‐income countries: A comprehensive 10‐year (2009 to 2018) review. Compr Rev Food Sci 19: 703\u0026ndash;732.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMercanoglu Taban B, Halkman AK (2011) Do leafy green vegetables and their ready-to-eat [RTE] salads carry a risk of foodborne pathogens? Anaerobe 17: 286\u0026ndash;287.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMir SA, Shah MA, Mir MM et al (2018) Microbiological contamination of ready-to-eat vegetable salads in developing countries and potential solutions in the supply chain to control microbial pathogens. Food Control 85: 235\u0026ndash;244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNajafi H, Mohammad B, Bahreini M (2012). Microbiological quality of mixed fresh-cut vegetable salads and mixed ready-to-eat fresh herbs in Mashhad, Iran. In InInternational Conference on Nutrition and Food Sciences IPCBEE,(39) (Citeseer), pp.\u0026nbsp;62\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParada-Fabi\u0026aacute;n JC, Ju\u0026aacute;rez-Garc\u0026iacute;a P, Natividad-Bonifacio I et al (2016) Identification of Enteric Viruses in Foods from Mexico City. Food Environ Virol 8: 215\u0026ndash;220.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePellicer K, Copes J, Malvestiti L et al (2002) Ready to eat salads: an analysis of health and safety conditions. Analecta Vet 22: 4\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePingulkar K, Kamat A, Bongirwar D (2001) Microbiological quality of fresh leafy vegetables, salad components and ready-to-eat salads: an evidence of inhibition of Listeria monocytogenes in tomatoes. Int. J Food Sci Nutr 52: 15\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePurpari G, Macaluso G, Di Bella S et al (2019) Molecular characterization of human enteric viruses in food, water samples, and surface swabs in Sicily. Int J Infect Dis 80: 66\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman M, Alam M-U, Luies SK et al (2021) Contamination of fresh produce with antibiotic-resistant bacteria and associated risks to human health: A scoping review. Int J Environ Res Public Health 19: 360.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eResearchandMarkets (2021). Ready-to-Eat Food Market - Growth, Trends, COVID-19 Impact, and Forecasts (2021\u0026ndash;2026). (Research and Markets).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez-L\u0026aacute;zaro D, Łepecka A, Ziel\u0026iacute; nska D et al (2022) Assessment of the Microbiological Quality of Ready-to-Eat Salads\u0026mdash;Are There Any Reasons for Concern about Public Health? Int J Environ Res Public Health 19: 1582\u0026ndash;1582.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaksena R, Malik M, Gaind R (2020) Bacterial contamination and prevalence of antimicrobial resistance phenotypes in raw fruits and vegetables sold in Delhi, India. Journal of Food Safety 40: e12739.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalleh NA, Rusul G, Hassan Z et al (2003) Incidence of Salmonella spp. in raw vegetables in Selangor, Malaysia. Food Control 14: 475\u0026ndash;479.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŞanlıbaba P, Tezel BU, \u0026Ccedil;akmak GA (2018) Prevalence and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat foods in Turkey. J Food Qual 2018:\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSapkota S, Adhikari S, Pandey A et al (2019) Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal. BMC Res Notes 12: 1\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar C, Webster C, Gallacher J (2018) Are exposures to ready-to-eat food environments associated with type 2 diabetes? A cross-sectional study of 347 551 UK Biobank adult participants. Lancet Planet Health 2: e438-e450.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwaiger K, Helmke K, H\u0026ouml;lzel CS et al (2011) Antibiotic resistance in bacteria isolated from vegetables with regards to the marketing stage (farm vs. supermarket). Int J Food Microbiol 148: 191\u0026ndash;196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo Y-H, Jang J-H, Moon K-DJFS (2010) Occurrence and characterization of enterotoxigenic Staphylococcus aureus isolated from minimally processed vegetables and sprouts in Korea. Food Sci Biotechnol 19: 313\u0026ndash;319.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShah MS, Eppinger M, Ahmed S et al (2015) Multidrug-resistant diarrheagenic E. coli pathotypes are associated with ready-to-eat salad and vegetables in Pakistan. J Korean Soc Appl Biol Chem 58: 267\u0026ndash;273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShin H, Park H, Seo DJ et al (2019) Foodborne Viruses Detected Sporadically in the Fresh Produce and Its Production Environment in South Korea. Foodborne Pathog Dis 16: 411\u0026ndash;420.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaban BM, Aytac SA, Akkoc N et al (2013) Characterization of antibiotic resistance in Salmonella enterica isolates determined from ready-to-eat (RTE) salad vegetables. Braz J Microbiol 44: 385\u0026ndash;391.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerio V, Bottaro M, Pavoni E et al (2017) Occurrence of hepatitis A and E and norovirus GI and GII in ready-to-eat vegetables in Italy. Int J Food Microbiol 249: 61\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerzi G, G\u0026uuml;c\u0026uuml;koğlu A, \u0026Ccedil;adirci \u0026Ouml; et al (2015) Serotyping and antibiotic susceptibility of Listeria monocytogenes isolated from ready-to-eat foods in Samsun, Turkey. Turkish J Vet Anim Sci 39: 211\u0026ndash;217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUsui M, Ozeki K, Komatsu T et al (2019) Prevalence of extended-spectrum β-lactamase\u0026ndash;producing bacteria on fresh vegetables in Japan. J Food Prot 82: 1663\u0026ndash;1666.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan der Poel WHM (2014) Food and environmental routes of Hepatitis E virus transmission. Curr Opin Virol 4: 91\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerraes C, Van Boxstael S, Van Meervenne E et al (2013) Antimicrobial resistance in the food chain: a review. Int J Environ Res Public Health 10: 2643\u0026ndash;2669.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing X, Li G, Zhang W et al (2014) Prevalence, Antimicrobial Susceptibility, and Enterotoxin Gene Detection of Staphylococcus aureus Isolates in Ready-to-Eat Foods in Shaanxi, People's Republic of China. J Food Prot 77: 331\u0026ndash;334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXylia P, Botsaris G, Chrysargyris A et al (2019) Variation of microbial load and biochemical activity of ready-to-eat salads in Cyprus as affected by vegetable type, season, and producer. Food microbiology 83: 200\u0026ndash;210.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J, Zhang Z, Zhou X et al (2020) Prevalence and characterization of antimicrobial resistance in Salmonella enterica isolates from retail foods in Shanghai, China. Foodborne Pathog Dis 17: 35\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYilmaz A, Bostan K, Altan E et al (2011) Investigations on the frequency of norovirus contamination of ready-to-eat food items in Istanbul, Turkey, by using real-time reverse transcription PCR. J Food Prot 75: 840\u0026ndash;843.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"Atatürk University","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"microbial, Esbl, E. coli, viruses, ready-to-eat salad","lastPublishedDoi":"10.21203/rs.3.rs-1736848/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1736848/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eReady-to-eat (RTE) salads service and utilize with pide/lahmacun, kebab types, and tantuni in meat restaurants in Turkish cuisine. Hence, the vegetable salads served with meat-based RTE foods are a risk factor for public health. In this study, we report the microbiological properties, antimicrobial resistance of foodborne pathogens including \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e, and the presence of important enteric viruses in eastern Turkey. The total aerobic bacteria (TAB) ranged from \u0026lt;\u0026thinsp;1 to 6.40 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in the RTE salads (n\u0026thinsp;=\u0026thinsp;42), whereas yeast and molds was ranged from \u0026lt;\u0026thinsp;1 to 6.26 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The coliform bacteria and the \u003cem\u003eStaphylococcus\u003c/em\u003e and \u003cem\u003eMicrococcus\u003c/em\u003e spp. count were determined\u0026thinsp;\u0026lt;\u0026thinsp;1-5.82 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and \u0026lt;\u0026thinsp;1-5.66 log CFU g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in all REVS samples, respectively. None of the RTE vegetable salads (REVS) tested in this study contained \u003cem\u003eSalmonella\u003c/em\u003e spp., whereas \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e were isolated in 38.1% (16/42) and 2.4% (1/42), respectively. \u003cem\u003eS. aureus\u003c/em\u003e was resistant to gentamicin, kanamycin, aztreonam, and ciprofloxacin in the disc diffusion assay, however, it was not harboring the \u003cem\u003emecA\u003c/em\u003e gene. \u003cem\u003eE. coli\u003c/em\u003e strains (n\u0026thinsp;=\u0026thinsp;16) were resistant (100%) to aminoglycoside antibiotics (gentamicin and kanamycin) and 35.7% (6/16) of the isolates were ESBL producing. \u003cem\u003eBla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTXM8/25\u003c/sub\u003e were detected in two isolates, whereas one isolate carried \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTXM\u0026minus;1\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e together by PCR. Of the REVS, two were evaluated as positive for rotavirus (4.8%), and six for hepatitis A (14.3%) and hepatitis E virus (14.3%). These results indicate the high microorganism load, presence of ESBL \u003cem\u003eE. coli\u003c/em\u003e, and viral enteric pathogens in REVS, hence it is important to perform routine hygiene practices.\u003c/p\u003e","manuscriptTitle":"Microbiological quality of ready-to-eat vegetable salads served at meat restaurants under the COVID 19 pandemic induced food demand: an example from Eastern Turkey","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-06-08 16:57:35","doi":"10.21203/rs.3.rs-1736848/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dc2f1c0e-95f5-49de-a499-c74c421820cf","owner":[],"postedDate":"June 8th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":13123043,"name":"Food Science \u0026 Technology"}],"tags":[],"updatedAt":"2022-10-19T18:29:02+00:00","versionOfRecord":{"articleIdentity":"rs-1736848","link":"https://doi.org/10.52973/rcfcv-e32171","journal":{"identity":"revista-cientifica-de-la-facultad-de-ciencias-veterinarias","isVorOnly":true,"title":"Revista Científica de la Facultad de Ciencias Veterinarias"},"publishedOn":"2022-10-15 00:00:00","publishedOnDateReadable":"October 15th, 2022"},"versionCreatedAt":"2022-06-08 16:57:35","video":"","vorDoi":"10.52973/rcfcv-e32171","vorDoiUrl":"https://doi.org/10.52973/rcfcv-e32171","workflowStages":[]},"version":"v1","identity":"rs-1736848","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1736848","identity":"rs-1736848","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.