Cappable-Seq and Direct RNA Sequencing Reveals Novel insights into the Transcriptome of Listeria monocytogenes

Cappable-Seq and Direct RNA Sequencing Reveals Novel insights into the Transcriptome of Listeria monocytogenes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cappable-Seq and Direct RNA Sequencing Reveals Novel insights into the Transcriptome of Listeria monocytogenes Ilhan Cem Duru, Anne Ylinen, Leontina Grigore-Gurgu, Christian U. Riedel, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3996292/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Listeria monocytogenes is a foodborne pathogen that can survive various stresses. To inactivate Listeria monocytogenes , food processing facilities use high energy methods, such as high-pressure processing (HPP). In this study, we explored the transcriptional units of barotolerant L. monocytogenes RO15 using Cappable-seq and direct RNA sequencing, two novel techniques. Results We detected 1641 transcription start sites (TSSs) in L. monocytogenes RO15, including six HPP-specific TSSs, showing that HPP influences the TSS selection. In addition, we predicted small RNAs (sRNAs) candidates and examined promoter motifs, which revealed new regulatory elements that control gene expression. By integrating short and long RNA-seq reads, we predicted the operon structure of L. monocytogenes RO15 and found 658 operons, comprising 71% of all the genes. The largest operons were mainly located in prophage regions. Moreover, we identified A-to-I RNA editing events in L. monocytogenes for the first time. HPP treatment statistically significantly (p < 0.05) increased the A-to-I editing of several genes including hpf and mdxE suggesting a role in the stress response. We predicted m6A RNA modifications in L. monocytogenes RO15 using direct RNA sequencing reads. This is the first report of m6A RNA modifications in L. monocytogenes by using direct RNA sequencing. Conclusions This study provides novel insights into the transcriptome complexity and diversity, stress response strategies, and post-transcriptional modifications of L. monocytogenes . Our results uncover the genomic mechanisms of adaptation of L. monocytogenes to HPP and indicate potential targets for developing new strategies to control this pathogen. However, further studies are needed to validate the functional roles of the identified sRNAs, RNA editing events, and RNA modifications in L. monocytogenes . RNA editing transcription start site high pressure processing pathogen direct RNA sequencing long sequencing reads operon Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Pathogens in food cause hardship for societies by increasing waste, carbon footprint, and economic losses [ 1 ]. Listeria monocytogenes , a major contributor to these losses [ 2 ], causes listeriosis [ 3 ], a deadly infection that affects people with weak immunity [ 4 ]. Listeriosis has been linked to outbreaks caused by contaminated milk, fish, cheese, ready-to-eat foods, vegetables, and meat [ 5 , 6 ]. L. monocytogenes survives in various stress conditions, such as low temperatures, high pressures, and acidity, challenging the food industry [ 3 , 7 ]. Thus, food products should be treated carefully to prevent L. monocytogenes contamination or survival. High pressure processing (HPP) is a non-thermal method to inactivate pathogenic microbes, including Listeria sp. [ 8 ]. Previously, we have studied the effect of HPP on L. monocytogenes , in particular its recovery after HPP stress [ 9 – 13 ]. We have previously shown that genes related to ribosome hibernation, protein folding, the phosphotransferase system (PTS), prophages, and cobalamin biosynthesis play a role in HPP stress and recovery in L. monocytogenes [ 13 ]. In addition to recent efforts, here we wanted to deepen the L. monocytogenes genomic knowledge with a new perspective around whole transcriptome units, transcription start site (TSS), gene structure, RNA modification, and RNA editing. In bacteria, RNA polymerase (RNAP) initiates transcription by recognizing and binding to specific sequence elements on the DNA. The first DNA nucleotide position that is transcribed into RNA by the RNAP complex is defined as the TSS. Identification of TSS can be done with specific RNA-seq protocols (differential RNA-seq and Cappable-seq), both of which enrich the 5′ end of transcripts [ 14 , 15 ]. Previous studies have shown that identification of TSS is useful for investigating RNAP binding sites, finding novel genes and small RNAs (sRNAs), and identifying global transcriptional units in several bacterial species [ 16 – 20 ]. In L. monocytogenes specifically, TSS identification was previously done on the reference strain (EGD-e) [ 19 ]. Here, we have used a different strain (RO15) and a different method to expand TSS identification in L. monocytogenes ; moreover, we performed a comparative analysis to test if there is a TSS difference between HPP-treated and control samples. Adenosine-to-inosine (A-to-I) RNA editing is a post-transcriptional modification that occurs in both eukaryotes and bacteria [ 21 ]. In bacteria, A-to-I editing is catalyzed by the TadA enzyme. TadA deaminates adenosine (A) to inosine (I) [ 22 , 23 ]. A-to-I RNA editing is thought to play a role in a variety of biological processes in bacteria. For example, in Escherichia coli , A-to-I editing regulates toxicity and toxin activity [ 22 ]. In Pseudomonas putida , A-to-I editing regulates stress adaptation and pathogenicity [ 23 ]. Moreover, the GACG motif has been shown to be the binding target for the tadA gene in mRNAs [ 23 ]. A-to-I RNA editing, to our knowledge, has not been demonstrated in L. monocytogenes thus far. Thus, in this study we re-analyzed our previous public Illumina RNA-seq data [ 13 ] with the hypothesis of whether A-to-I RNA editing plays a role in the HPP injury stress adaptation and recovery. RNA molecules have been studied by short read sequencing methods like Illumina in the past [ 13 , 24 , 25 ]. However, direct RNA sequencing of long continuous RNA molecules is possible with Oxford Nanopore Technology (ONT) [ 26 ]. ONT direct RNA sequencing is a PCR-free method that directly sequences native RNA molecules. Therefore, the method can identify RNA modifications directly from the assayed molecules [ 26 ]. ONT direct RNA-seq has been shown to correctly detect rRNA base modifications in E. coli [ 27 ]. In this study, we used direct RNA-seq for the first time on two different L. monocytogenes strains. We have been working on the L. monocytogenes response to HPP, aiming to improve inactivation of these bacteria. Our studies were performed at the level of comparing genomes and gene expression using DNA sequencing and RNA-seq approaches combined with bioinformatics [ 11 – 13 ]. In general, there are only limited datasets available on organisation of the transcriptional units of L. monocytogenes [ 19 ]. To address the gaps in our understanding of L. monocytogenes genes, transcriptional unit structure, and regulation, we performed two novel sequencing methods: Cappable-seq and direct RNA-seq. These methods helped us to predict transcription start sites (TSSs), operon structures, promoter motifs, and N6-methyladenosine (m6A) RNA modification, as well as the effect of HPP on transcriptional units. Moreover, we re-analyzed our existing Illumina RNA-seq data [ 13 ] from a RNA-editing perspective, which showed potential usage of A-to-I RNA editing in HPP response in L. monocytogenes . These findings can open up new avenues for research and innovation in food safety and genomics. Methods Experimental setup, sampling, RNA extraction For this study we used the same RNA extracts that we have obtained in our previous study [ 13 ]. Briefly, in our previous study [ 13 ], we used two L. monocytogenes strains: strain RO15 (Genbank: GCA_902827145.1) and strain ScottA (GenBank: CM001159.1). Both strains were cultivated in BHI broth (350 ml) at 37°C for 24 hours, to the early stationary phase. Further, the cell cultures were transferred to 2 mL tubes and cooled at 4°C for 1 h. The samples were treated at 200 MPa and 400 MPa, 8°C, for 8 min in multi-vessel high-pressure equipment. The samples were kept at 8°C for recovery at atmospheric pressure. They were sampled at 0, 5, 10, 30, 45, and 60 minutes, and at 6, 24, and 48 hours (T1 to T9) after HPP. Control samples were also stored at 8°C with no pressure and sampled at the same time points as HPP treated samples. RNA was extracted from samples using the NucleoSpin RNA kit [ 13 ]. Previously, 216 samples were subjected to RNA-seq using Illumina [ 13 ]. In this study, we chose six strain RO15 samples from previously obtained RNA extracts to perform additional Cappable-seq. The selected strain RO15 samples for Cappable-seq were: R017 (200 MPa HPP, 0 min time point), R101 (400 MPa HPP, 0 min time point), R173 (400 MPa HPP, 24 hours time point), R179 (control, 0 min time point), R250 (control 0 min time point), R312 (control 24 hours time point). For the direct RNA-seq, we chose two strain RO15 samples, and two strain ScottA samples. Selected strain RO15 samples for direct RNA-seq were: R173 (400 MPa HPP, 24 hours time point) and R312 (control 24 hours time point). Selected strain ScottA samples were: R158 (400 MPa HPP, 24 hours time point) and R317 (control 24 hours time point) (Table S1 ). Cappable-seq library processing and sequencing To capture of the 5′ end of primary transcripts we used the Cappable-seq method [ 15 ] and the protocol published by New England Biolabs ( https://international.neb.com/protocols/2018/01/19/cappable-seq-for-prokaryotic-transcription-start-site-determination ). Before Cappable-seq library preparation, 15 µl of decapped RNA was vacuum-dried in DNA Speed Vac DNA110 (Savant) at a low drying rate for about 40 min and then suspended in 2.5 µl of ultra-pure water. Cappable-seq libraries were prepared with TruSeq Small RNA Library Prep (Illumina) using half of the kit’s volumes according to the manufacturer’s instructions. Libraries (half of the reaction volume) were pooled and concentrated using Amicon Ultra-0.5 100K filter device (Millipore) (Table S2 ). Fragments of a size of 140–250 bases fusing BluePippin and 3% agarose gel cassette (Sage Science). NextSeq 500 (Illumina) was used to sequence the Cappable-seq libraries with single-end 75 bases long reads. Read processing and mapping for TSS The same preprocessing was performed for Cappable-seq reads as described previously for Illumina RNA-seq reads [ 13 ], except using “TGGAATTCTCGGGTGCCAAGG” as an adapter during the adapter filtering step. Both Illumina RNA-seq and Cappable-seq reads were mapped to the strain RO15 genome (Genbank: GCA_902827145.1) using the READemption v0.5.0 pipeline [ 28 ] with default options. Briefly, the pipeline uses Segemehl v0.2 [ 29 ] with minimal accuracy of 95%. Coverage and normalization of coverage was calculated using READemption v0.5.0 “coverage” function. The coverage was normalized by the total number of aligned reads and multiplied by the lowest number of aligned reads of all input libraries. Identification of TSSs in RO15 To get the whole TSS set, we combined all six Cappable-seq reads files into one, and the same was done for corresponding six Illumina RNA-seq read files as well. TSS identification was done by comparing the relative coverage of reads between Cappable-seq reads and Illumina RNA-seq reads. For this purpose, we used ANNOgesic v1.0.16 pipeline [ 30 ] with TSSpredator v1.06 [ 31 ]. To get the optimal parameters, we first manually annotated the first 50 kbp region. Manually annotated file was employed to obtain the optimal parameters using ‘annogesic optimize_tss_ps’. Then, “annogesic tss_ps” command was run using ‘-c normPercentile = 0.8, texNormPercentile = 0.2, allowedCompareShift = 4, allowedRepCompareShift = 4’. We predicted HPP-specific transcription start sites (TSSs) by comparing TSS region Cappable-seq read counts from HPP-treated and control samples. We used featureCounts v2.0.3 [ 32 ] to obtain TSS region Cappable-seq read counts from all six sequenced samples. Since we had three HPP-treated samples and three control samples, we ran DESeq2 to compare TSS region read counts between the two conditions. We normalized the counts and defined a TSS as HPP-specific if it met the following two criterias: The log2 fold change between the HPP-treated and control samples was greater than or equal to |4|. The total read count for the opposite condition was less than 10 (in total for triplicates). Identification of UTR and sRNA in RO15 We used ANNOgesic v1.0.16 pipeline [ 30 ] to predict additional sRNA and UTR “annogesic utr” with default options was used for UTR length prediction. “annogesic srna” with ‘--tex_notex 1’ were used for sRNA prediction. EGD-e TSS lift over to RO15 The genome sequences of EGD-e and RO15 were aligned using LASTZ v1.04.15 [ 33 ] with “--chain --format = axt” options. We then chained the “axt” alignment files using axtChain [ 34 ] and generated chain format output. Chain format output was used to lift EGD-e TSS gff to RO15 genome using CrossMap v0.5.4 [ 35 ]. Variant calling We used the Illumina RNA-seq data obtained in our HPP experiment study [ 13 ]. Illumina RNA-seq preprocessing was described previously [ 13 ]. Illumina RNA-seq reads were mapped to the reference genome using Bowtie2 v2.3.4.3 [ 36 ] default options. The output was sorted and converted to BAM format using Samtools v1.9 [ 37 ]. Bcftools v1.9 [ 38 ] “mpileup” function with default options was used to generate genotype likelihoods. Bcftools v1.9 “call” function with “-mv -Ob” options was used for variant calling. Direct RNA-seq Four RNA samples were additionally analysed with direct RNA-seq. Since the protocol assumes mRNAs to have poly-A tails, they were first added by treating 14.5 µl of total RNA (3-7.8 µg) with 7.5 units of E. coli poly(A) polymerase (New England Biolabs) and 2 mM ATP in 1x reaction buffer at 37°C for 30 min. To enrich the yield of mRNA reads, the reaction included a mix of nine rRNA blocking oligos (total concentration: 2.4 µM) (Table S2 ). Blocking of the 3’ ends of 16S, 23S, and 5S rRNA leads to preferential addition of poly-A tails to mRNA molecules [ 39 ]. The reactions were purified with 1.8 vol RNA Clean XP beads and eluted in RNase free water. The rRNA-depleted RNAs with poly-A tails were then used as starting material for the Direct RNA-seq protocol SQK-RNA002 (Oxford Nanopore Technologies) according to the manufacturer’s instructions, except for RNA Control Strand (RCS), which was diluted 1:20 prior to use (Fig. 1 ). About 190 ng of the reverse-transcribed and adapted original RNA molecules were sequenced with FLO-MIN106 flow cells using MinKNOW software v19.06.8 or 21.06.0 (Oxford Nanopore Technologies). The number of reads obtained for the four samples ranged from 314,044 to 1,613,144. The percentage of reads that mapped the reference genome was between 43.61% and 93.04% of the total reads. The aligned reads consisted of 10.25–25.31% mRNA reads. m6A RNA modification prediction using direct RNA-seq To identify m6A RNA modifications, we used ModPhred v3.6.1 [ 40 ] in conjunction with an m6A modification-aware basecalling model [ 41 ]. Each of the four samples (two RO15 and two ScottA samples) was individually assessed using their direct RNA-seq reads to determine the locations of m6A RNA modifications. The prediction was made using the default threshold, which requires at least 25 read coverage and at least 5% modification frequency. Annotation of operons Operon structure was predicted using COSMO v0.1.0 [ 42 ] with default options. COSMO was run with all RNA-seq reads (both Illumina RNA-seq and direct RNA-seq). Results TSS identification in L. monocytogenes strain RO15 Based on the comparison of the relative coverage of reads between Cappable-seq and Illumina RNA-seq with ANNOgesic tool, 1641 TSSs were identified across the genome of L. monocytogenes RO15 (Table S3 ). Among all TSS, 1233 had highest coverage within 300 bp upstream of an open reading frame (ORF) and were classified as primary TSS. Secondary TSSs (i.e. TSSs with lower coverage within 300 bp upstream of an ORF) were detected for 90 genes. The number of TSSs located within the coding sequence of a gene (i.e. internal TSSs) was 233. Moreover, 199 TSSs located on the antisense strand of a protein coding gene (antisense TSSs) and 55 orphan TSSs not assigned to any coding DNA sequence (CDS) were detected. To facilitate visual inspection of these results, we created a public online genome viewer page ( https://icemduru.github.io/listeria_ro15_transcript/ ). The TSSs of L. monocytogenes strain EGD-e have been previously identified, and strain EGD-e was shown to contain 1576 TSSs [ 19 ]. To compare our TSS prediction in RO15 and EGD-e TSSs, [ 19 ] we mapped the EGD-e TSSs to the RO15 genome. Almost all EGD-e TSSs (1531 of 1576) were successfully mapped to the RO15 genome and the following analysis revealed that 876 of 1531 lifted TSS positions were the same as the TSS positions that we predicted in RO15 (Table S3 ). By comparing the Cappable-seq reads of the HPP-treated samples to those of the control samples, we were able to predict TSSs that were specific to the HPP treatment. In total six TSS were predicted to be specific to HPP-treated samples. The six TSSs specific to HPP-treated samples were associated with five genes and one tRNA (Table 1 ). Table 1 Predicted transcription start sites (TSS) specific to HPP-treated samples. The first column shows the TSS identifier (TSS ID), which consists of the genomic position and the strand orientation (forward or reverse) of the TSS. The second column shows the gene identifier (gene ID) of the gene that is transcribed from the TSS. The third column shows the gene annotation, which describes the putative function of the gene product. The fourth column shows the TSS type, which indicates whether the TSS is located at the 5’ end of a gene (primary), within a gene (internal), or opposite to a gene (antisense). The fifth column shows the average number of Cappable-seq reads for all three HPP treated samples. The sixth column shows the average number of Cappable-seq reads for all three control samples. The seventh column shows the log 2 fold change of the average Cappable-seq reads between the HPP and control samples. TSS ID Associated gene Associated gene annotation TSS type Avg. Cappable-seq reads (HPP) Avg. Cappable-seq reads (Control) Log 2 fold change TSS:2221338_f OCPFDLNE_02235 Phage terminase subunit antisense 11 0 8.43 TSS:398878_f OCPFDLNE_00383 Ferrous iron permease EfeU primary 15.3 2 7.24 TSS:2273494_r OCPFDLNE_02283 Probable transcriptional regulator YvdE internal 16 0 4.80 TSS:76604_f OCPFDLNE_00071 hypothetical protein internal 19.6 4 4.34 TSS:630711_r OCPFDLNE_00601 Homoserine O-acetyltransferase internal 12.3 0 6.32 TSS:246761_f OCPFDLNE_00242 tRNA-Arg primary 11 0 6.50 TSS of prophages Our previous studies investigating the genome of RO15 strain [ 12 ] and gene expression in response to HPP stress [ 13 ] revealed that prophages were associated with the phenotypic characteristics of the strain. Notably, we observed upregulation of phage genes during HPP stress, suggesting induction of prophages during HPP stress [ 13 ]. This led us to further explore phage TSSs, which previously have received limited attention in L. monocytogenes strains. Previously we identified five distinct prophage regions in the RO15 genome, ranging in size from 10.7 kb (prophage 1) to 41.3 kb (prophage 5) [ 12 ]. Prophage 5 was further observed as a circular form, suggesting a free virus genome version [ 12 ]. Among these regions, prophage 5 harboured the highest number of TSSs, with a significantly higher proportion of antisense TSSs compared to the other prophages (Table 2 ). Table 2 Prophage regions in RO15 and the number of TSS . Prophage Region Number of genes Primary TSS Internal TSS Antisense TSS Orphan TSS Total Prophage 1 (125824–136550 bp) 17 1 1 0 0 2 Prophage 2 (673631–706883 bp) 44 1 4 1 0 6 Prophage 3 (2175980–2223958 bp) 79 7 4 3 1 15 Prophage 4 (2559206–2601984 bp) 64 7 0 3 2 12 Prophage 5 (2729417–2770759 bp) 67 10 1 7 0 18 Interestingly, one of the HPP-specific TSS (TSS:2221338_f) was located in the prophage 3 region. This TSS, which is antisense to the gene OCPFDLNE_02235 (encoding phage terminase large subunit protein), was specifically induced in response to HPP stress. Cappable-seq analysis revealed the presence of TSS signals at this location in all HPP-treated samples, while no such signal was detected in control samples. Additionally, short Illumina RNA-seq reads indicated the presence of opposite-strand reads in the OCPFDLNE_02235 gene region, supporting the potential involvement of antisense RNA in this gene. However, no sRNA was predicted on this region in our sRNA prediction workflow Prediction of sRNAs in L. monocytogenes strain RO15 The ANNOgesic tool was used to predict sRNAs in L. monocytogenes RO15, resulting in 81 identified candidates (Table S4 ). The majority (53 of 81) were classified as intergenic sRNAs. A total of 20 sRNAs were found to originate from untranslated regions (UTRs), with four derived from 3'UTRs and 16 from 5'UTRs. Six of the predicted sRNAs were identified as antisense sRNAs (asRNAs), and two were classified as InterCDS sRNAs (located within coding sequences). To investigate asRNAs and gene expression patterns during high-pressure processing (HPP) treatment, gene counts were performed. However, no anticorrelation was observed between fold changes in asRNAs and their corresponding genes (Figure S1 ). In a previous study, nine antisense RNAs (asRNAs) were experimentally validated (by Northern blot) in Listeria monocytogenes strain EGD-e [ 19 ]. To investigate these asRNAs in strain RO15, we mapped them to the genome of strain RO15. We then examined our TSS prediction data for RO15 and found that two of these nine validated asRNAs had corresponding TSSs in RO15. Interestingly, only one of our predicted sRNA was in the same genomic location as a validated asRNAs in EGD-e. However, our prediction classified this sRNA as intergenic in RO15 because the adjacent gene was not found in RO15. Prediction of promoters, and UTR length in L. monocytogenes strain RO15 We analyzed the upstream regions of all predicted TSSs (-50 bp to 1 bp) using the MEME suite to identify promoter motifs in L. monocytogenes . Our findings revealed that there is only one well-conserved region in the promoter regions, with a -10 position “TATAAT”-like motif. This motif is present in all three types of TSSs. Additionally, we observed that the − 10 position motif is slightly different in secondary TSS promoter regions compared with other types of TSS regions. This suggests that there may be some subtle differences in the regulation of secondary TSSs compared with other types of TSSs (Fig. 2 ). We investigated the length distribution of 5' UTRs in L. monocytogenes RO15 using TSSs and calculating UTR lengths. Our analysis revealed that most of the 5' UTRs were shorter than 100 bases (Figure S2 ). We observed that the median length of 5' UTRs using primary TSSs was 33 bases. When secondary TSSs were also considered, the median UTR length increased to 34 bases (Figure S2 ). Operon prediction in L. monocytogenes strain RO15 By using a combination of Illumina short and ONT direct long RNA-seq reads, we analyzed the operon structure of the L. monocytogenes RO15 genome. Our predictions revealed that 71% (2210 genes) of the genes were organized into operons (Table S5 ). A total of 658 operons were identified, with an average of 3.35 genes per operon (median = 2 genes). The largest predicted operons were predominantly found within the prophage regions. Large operons were also seen in the L. monocytogenes RO15 genome, such as the cobalamin biosynthesis operon, comprising 19 genes (OCPFDLNE_01235 - OCPFDLNE_01253), emerged as one of the largest operons within the entire genome. Furthermore, we visually examined our predictions and observed strong support from both Cappable-seq and direct RNA sequencing reads. For instance, the manXYZ operon (OCPFDLNE_00834 - OCPFDLNE_00837) was predicted by our workflow, and both Cappable-seq and direct RNA sequencing reads helped us visually confirm the operon prediction (Fig. 3 ). A-to-I RNA editing in L. monocytogenes strain RO15 and strain ScottA During the TSS analysis, we carefully examined the previously published Illumina RNA-seq data from RO15 and ScottA strains [ 13 ]. Our analysis revealed several sequence variants that were not attributed to sequencing errors and were not detected in the gDNA-based PacBio or Illumina data [ 12 ]. These variants, consisting of A to G (T to C for reverse strand) transitions, are indicative of A-to-I RNA editing, a post-transcriptional modification that has been previously studied in other bacteria [ 22 , 23 ]. The presence of A-to-I RNA editing variants was higher in HPP-treated samples for several genes (Table 3 , Table 4 , Table S6 ). A subset of these variants was specifically observed in HPP-treated samples, suggesting their potential role in HPP response mechanisms. A-to-I RNA editing within genes spoVG, pbpX, mdxE, patB, hpf , and pepC was particularly common in both strains under HPP stress. While the majority of observed A-to-I RNA editing variants were confined to HPP-treated samples, a subset of these variants were also detected in control samples. These variants, found within genes pflA , mdxE , secA , and kdpD in strain RO15, and actA , ldh , dhaS , LMOSA_26480, and mdxE in strain ScottA. Notably, most of these variants were observed as partial variants, indicating that approximately half of the RNA-seq reads contained the variant base in the transcript. Table 3 Summary of A > G (T > C on reverse strand) variant positions and the corresponding gene in strain RO15. The table shows the positions of A > G variants in RNA of RO15, and the locus tag, gene name, number of samples with the variant in treated and control groups, reference and variant amino acids of the corresponding gene, respectively. The p-values between treated and control samples were calculated using Fisher’s exact test. For the sake of clarity, only variants detected in more than 7 samples are presented. The complete list of variants is available in the supplementary Table S6 . Variant Pos. Locus Tag Gene Name # variants treated (n = 51) # variants control (n = 52) ref. aa var. aa p-value 2269171 OCPFDLNE_02280 mdxE 37 10 Y C 4.90E-08 2649787 OCPFDLNE_02685 hpf 21 1 L L 3.47E-07 497744 OCPFDLNE_00478 dhaS 12 0 T A 9.18E-05 1768810 OCPFDLNE_01761 yfhP 10 0 L L 4.90E-04 1544500 OCPFDLNE_01549 9 0 Y C 1.11E-03 429958 OCPFDLNE_00419 mngB 8 0 Y C 2.47E-03 204136 OCPFDLNE_00200 spoVG 9 1 Y C 7.41E-03 2428075 OCPFDLNE_02434 pepC 8 1 M V 1.50E-02 2288303 sRNA_92 rli47 8 1 - - 1.50E-02 2646986 OCPFDLNE_02684 secA 26 14 L L 1.52E-02 1451307 OCPFDLNE_01455 pflA 51 47 L L 2.70E-02 1213571 OCPFDLNE_01217 pdtaS 9 3 L L 6.98E-02 Table 4 Summary of A > G (T > C on reverse strand) variant positions and the corresponding gene in strain ScottA. The table shows the positions of A > G variants in RNA of RO15, and the locus tag, gene name, number of samples with the variant in treated and control groups, reference and variant amino acids of the corresponding gene, respectively. The p-values between treated and control samples were calculated using Fisher’s exact test. For the sake of clarity, only variants detected in more than 7 samples are presented. The complete list of variants is available in the supplementary Table S6 . Variant Pos. Locus Tag Gene Name # variants treated (n = 53) # variants control (n = 54) ref. aa var. aa p-value 2675586 LMOSA_4770 hpf 21 0 L L 3.21E-08 1717344 LMOSA_25410 pepV 15 1 Y C 8.61E-05 242871 LMOSA_10890 spoVG 12 0 Y C 1.08E-04 2324765 LMOSA_1570 gloA 12 0 Y C 1.08E-04 720351 intergenic_region 10 0 - - 5.55E-04 1775078 LMOSA_25880 - 10 0 T A 5.55E-04 2520887 LMOSA_3290 patB 10 0 T A 5.55E-04 2481510 LMOSA_2970 pepC 11 1 M V 1.91E-03 s252859 LMOSA_10970 actA 39 26 T T 9.89E-03 2281668 LMOSA_1140 mdxE 14 4 Y C 1.01E-02 2715706 LMOSA_5200 - 9 2 T A 2.85E-02 1282535 LMOSA_21080 - 11 4 F L 5.54E-02 568103 LMOSA_13830 dhaS 13 21 T A 1.46E-01 1843087 LMOSA_26480 - 53 52 G G 4.95E-01 257308 LMOSA_11030 ldh 53 54 I V 1.00E + 00 Interestingly, we observed a gradual increase in the editing percentage with increasing HPP treatment time (Figure S3 , Figure S4 ). However, the expression patterns of the genes harbouring these A-to-I RNA editing variants were not consistently altered. Both upregulation and downregulation were observed for these genes (Figure S5 ). We examined the distribution of the RNA edited sites (Fig. 4 ). Our findings revealed distinct preferences for modified sites between the RO15 and Scott A strains. Notably, while the predicted consensus motif differed between the two strains, two four-base motifs (TACG and GTAA) emerged as the most prevalent edited motifs in both strains (Fig. 4 ). RNA m6A modification prediction in L. monocytogenes strain RO15 and strain ScottA In the RO15 HPP-treated sample, we predicted 23 sites with m6A modifications, while only three positions were identified as m6A modified in the RO15 control sample. m6A modifications targeting the dnaD and arsC genes were observed in both treated and control samples (Table S7 ). Notably, carbohydrate transmembrane transporter activity-related genes such as manX (encoding a mannose transporter), mntB (encoding a manganese transporter), and mdxE (encoding a Maltodextrin-binding protein) were frequently targeted by m6A modifications in the HPP-treated sample (Table S7 ). In contrast to RO15, fewer m6A RNA modifications were observed in HPP treated samples of ScottA. In the treated sample, four positions were predicted as m6A modified, while in the control sample, 11 positions were predicted as m6A modified. The modifications that target the gadB gene were seen in both samples. In addition to the gadB gene, m6A modification was observed in the inlA gene (encoding an Internalin-A protein) (Table S7 ). Discussion We used Cappable-seq, a novel method for directly enriching the 5' end of primary transcripts in prokaryotes [ 15 ], to comprehensively identify the TSSs of L. monocytogenes RO15. Our analysis revealed 1,641 TSSs in the strain RO15. To compare our TSS prediction in RO15 with the previously reported TSSs in strain EGD-e [ 19 ], we mapped the EGD-e TSSs to the RO15 genome using a lift-over (mapping) approach. We found that only 57% of the mapped EGD-e TSSs (876/1531) matched the TSSs that we predicted in RO15 using Cappable-seq. The remaining 43% of the lifted EGD-e TSSs (655/1531) either did not have a corresponding TSS in RO15 or had a different TSS position. This discrepancy could be attributed to several factors, such as the strain variation, the sequencing depth, the mapping algorithm, and the TSS prediction methods and criteria [ 43 ]. For instance, RO15 and EGD-e belong to different clonal complexes (CC155 and CC9, respectively) and multilocus sequence types (ST155 and ST35, respectively) [ 12 ], which could result in genomic rearrangements and mutations that affect the TSS locations. Previous studies on TSS conservation within Shewanella species reported a 63% conservation rate [ 44 ], aligning with our findings for the RO15 and EGD-e comparison. We found that six TSSs in L. monocytogenes RO15 were activated by HPP. These TSSs corresponded to five genes and one tRNA, indicating that HPP might alter the TSS selection in L. monocytogenes . This could help us understand how L. monocytogenes responds to stress and how to prevent its growth and survival in food products. The genes associated with these TSSs are potential targets for future research. Previous studies have reported a large number of condition-specific TSSs in E. coli under different growth conditions [ 45 ]. However, we detected only six condition-specific TSSs in L. monocytogenes RO15, out of 1,641 total TSSs. This is partly because we used a different and more stringent method to identify TSSs based on differential Cappable-seq signals between HPP-treated and control samples. Our method required almost no Cappable-seq signal in all control samples to call a TSS as HPP-specific. We previously showed that HPP stress induces phages in L. monocytogenes species and upregulates phage genes [ 12 , 13 ]. To better understand the transcriptional regulation of phage genes, we analyzed the TSSs of phages in detail. We found that phage regions had fewer TSSs than the rest of the genome. The L. monocytogenes RO15 genome had 3,107 genes and 1,641 TSSs, resulting in a 53% gene/TSS ratio. In contrast, the average gene/TSS ratio for the five phages was 18%. Our operon prediction also indicated that the largest operons were mainly located in the prophage regions, suggesting that phage genes are co-regulated. This is consistent with previous reports of long transcriptional units in Herelleviridae bacteriophages [ 46 ]. Interestingly, we identified a HPP-specific TSS in the prophage 3 region, which was antisense to the OCPFDLNE_02235 gene encoding a phage terminase large subunit protein. This observation raises the possibility that alternative TSSs and antisense RNAs may play a role in regulating phage gene expression under stress conditions. In Listeria , sRNAs play a role in several processes including pathogenicity and host interaction [ 47 ]. In this study, we predicted 81 sRNAs in L. monocytogenes RO15. We compared our sRNA predictions with those reported in L. monocytogenes EGD-e and other strains, and found that only two of the nine experimentally validated asRNAs in EGD-e had corresponding TSSs in RO15. This suggests that sRNA diversity and conservation may vary among different strains and species of L. monocytogenes . We also investigated the expression patterns of the predicted asRNAs and their target genes under HPP treatment, but did not observe any anticorrelation between them. This could be due to the complex and dynamic regulation of asRNAs in bacteria, which may depend on various factors such as transcription, translation, stability, and interaction of the RNA molecules [ 48 ]. The predicted sRNAs may play important roles in modulating gene expression and influencing the physiology and pathogenicity of L. monocytogenes RO15. However, the functions and mechanisms of the sRNAs remain largely unknown and require further experimental validation and characterization. Future studies should also explore how the sRNAs respond to different environmental and host signals, and how they interact with other regulatory elements in L. monocytogenes RO15. The 5’ UTR of L. monocytogenes RO15 has a median length of 33 bases, which agrees with previous predictions for L. monocytogenes EGD-e and L. innocua BUG499 [ 19 ]. This implies that 5’ UTR length regulation may be conserved among different Listeria species. Other species, such as E. coli and Klebsiella pneumoniae , have similar 5’ UTR length distributions to Listeria [ 49 ]. However, some bacteria have longer or shorter median 5’ UTR lengths, such as Prochlorococcus MED4 (27 nucleotides) [ 50 ] and Synechocystis sp. PCC6803 (42 nucleotides) [ 51 ]. These variations may reflect the adaptation of different bacteria to their environmental conditions. Prokaryotic promoter regions generally include − 35 and − 10 elements, which affect promoter activity [ 52 ]. By promoter motif analysis, we found a clear TATAAT-like − 10 element in L. monocytogenes RO15, but the − 35 element had a weak motif signal and was not well-defined. E. coli also had a weak − 35 element motif in a similar analysis [ 43 ]. We hypothesized that L. monocytogenes RO15 had many promoters without a -35 element or with a poorly conserved one. Moreover, we found extended − 10 elements, such as the “TG” motif (or -15 element) [ 53 ], in many promoter regions in L. monocytogenes RO15. These extended − 10 elements could replace the missing − 35 element and enhance transcription initiation. In this study, we used a combination of Illumina short RNA-seq reads and ONT long direct RNA-seq reads to predict the operon structure of L. monocytogenes RO15. Long RNA-seq reads, with the potential to capture entire operons within a single read, are particularly valuable for operon prediction, as they provide direct evidence of transcriptional units. Our analysis revealed that 71% of the genes in the RO15 genome were organized into operons. This observation aligns with previous findings in other pathogenic bacteria, such as Mycobacterium tuberculosis , where 75% of genes were predicted to be operon-associated using the same computational approach [ 42 ]. In contrast, a lower percentage of operons (60%) were identified in L. monocytogenes EGD-e using a different prediction method [ 54 ]. This discrepancy likely reflects the sensitivity and specificity of different prediction tools. To our knowledge, this study represents the first application of long direct RNA-seq reads for operon prediction in L. monocytogenes . Manual inspection of the long reads supported the operon structures we predicted. For instance, the manXYZ operon previously identified in E. coli [ 55 ], were also predicted in our analysis. These observations demonstrate the validity and accuracy of our operon predictions. Thus, our findings provide a valuable reference for future studies investigating operon organization in L. monocytogenes . Our analysis on published RNA-seq data [ 13 ] revealed that several genes in both RO15 and ScottA strains of L. monocytogenes had A-to-I RNA variants, especially after HPP. Previous studies have shown that A-to-I RNA editing can modulate the toxicity of E. coli [ 22 ] and the oxidative stress tolerance of P. putida [ 23 ] by altering the transcripts of hokB and fliC , respectively. We therefore hypothesized that A-to-I RNA editing might be a mechanism of HPP stress adaptation in L. monocytogenes . We found that genes spoVG , pbpX , mdxE , patB , hpf , and pepC were frequently edited in both strains under HPP stress, indicating that these genes might be involved in the HPP stress response. Among them, the gene hpf , which encodes a ribosome hibernation-promoting factor, was of particular interest, as the editing frequency increased over time in the treated samples. The gene hpf plays a crucial role in Listeria survival under stress conditions, by converting active 70S ribosomes into inactive 100S ribosomes [ 56 ]. We speculated that L. monocytogenes might enhance the ribosome hibernation efficiency by editing the hpf transcript during HPP recovery. Interestingly, some of the A-to-I RNA editing variants were also present in the control samples, implying that A-to-I RNA editing is not only a stress-specific phenomenon, but also a dynamic process that might occur under normal growth conditions in certain genes. N6-methyladenosine (m6A) is a common RNA modification that modulates the structure and function of RNA molecules [ 57 ]. In bacteria, m6A is involved in various cellular processes, such as gene expression and stress response [ 57 ]. It is known that m6A responds to various environmental factors, such as temperature, oxidative stress, and antibiotic exposure, and that it influences bacterial adaptation [ 57 ]. In this study, we used a novel model [ 41 ] to detect m6A RNA modifications in direct RNA-seq reads without requiring IVT or knockout controls [ 41 ]. Our analysis revealed that HPP treatment had opposite impacts on the m6A levels of two L. monocytogenes strains: RO15 and ScottA. While RO15 showed more m6A sites after HPP treatment, ScottA showed fewer. This indicates that HPP treatment can alter the m6A landscape of L. monocytogenes RNA in a strain-dependent manner. The m6A modification may be involved in the regulation of genes related to carbohydrate transport and stress response in L. monocytogenes . For example, we found that HPP treatment increased the m6A modification of genes encoding mannose, manganese, and maltodextrin transporters in RO15, which may enhance the uptake of these nutrients and promote bacterial growth and survival. These findings indicate that m6A modification may play a role in the adaptation of L. monocytogenes to HPP treatment and other environmental stresses. However, we only used one treated and one control sample per strain in this study. More samples with statistical analysis are needed to confirm and generalize our results. Nevertheless, our study provides a useful guide for future research on the m6A modification of bacterial RNA. Conclusions Collectively, our findings shed light on the complex transcriptional landscape, stress response mechanisms, and post-transcriptional modifications in L. monocytogenes . This knowledge deepens our understanding of L. monocytogenes and opens avenues for future research exploring the functional consequences of A-to-I editing and m6A modifications in L. monocytogenes stress adaptation. This understanding can contribute to the development of improved strategies for food safety and control of Listeria . We encourage further research to validate the functional significance of these discoveries, potentially opening new avenues for understanding and combating L. monocytogenes -related challenges. Abbreviations small RNA (sRNA), antisense sRNA (asRNA), high pressure processing (HPP), transcription start site (TSS), Oxford Nanopore Technology (ONT), untranslated region (UTR), open reading frame (ORF), coding DNA sequence (CDS) Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and material The data for this study have been deposited in the European Nucleotide Archive (ENA) at EMBL-EBI under accession number PRJEB51821 (https://www.ebi.ac.uk/ena/browser/view/PRJEB51821). The data can be also directly downloaded using https://zenodo.org/record/6463240 (DOI: 10.5281/zenodo.6463240) Competing interests The authors have no competing interests to declare. Funding This study was supported by grants from the Academy of Finland to PA (311717, 307856, and 323576). Authors' contributions PA conceived and designed the study. AY performed Cappable-seq and direct RNA-seq preparations. LP organized NGS assays. ICD performed the bioinformatics analyses. LGG was involved in the preparation of the samples. PA and ICD drafted the manuscript. LGG and CUR performed a critical review of the manuscript. All authors have read, commented on, and approved the final manuscript. Acknowledgements We thank Eeva-Marja Turkki for performing the NGS procedures for this project. We acknowledge the CSC – IT Center for Science, Finland, for computational resources. Daniela Borda and Anca Ioana Nicolau are thanked for useful comments, and the University of Helsinki Language Services for English language revision. References Bondi M, Messi P, Halami PM, Papadopoulou C, de Niederhausern S. Emerging microbial concerns in food safety and new control measures. BioMed Res Int. 2014;2014:251512. Pigłowski M. Food hazards on the European Union market: The data analysis of the Rapid Alert System for Food and Feed. Food Sci Nutr. 2020;8:1603–27. Bucur FI, Grigore-Gurgu L, Crauwels P, Riedel CU, Nicolau AI. Resistance of Listeria monocytogenes to Stress Conditions Encountered in Food and Food Processing Environments. Front Microbiol. 2018;9:2700. Nyarko EB, Donnelly CW. Listeria monocytogenes : Strain Heterogeneity, Methods, and Challenges of Subtyping. J Food Sci. 2015;80:M2868–2878. Kurpas M, Wieczorek K, Osek J. Ready-to-eat Meat Products As a Source of Listeria Monocytogenes . J Vet Res. 2018;62:49–55. Buchanan RL, Gorris LGM, Hayman MM, Jackson TC, Whiting RC. A review of Listeria monocytogenes : An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control. 2017;75:1–13. Chan YC, Wiedmann M. Physiology and genetics of Listeria monocytogenes survival and growth at cold temperatures. Crit Rev Food Sci Nutr. 2009;49:237–53. Yamamoto K. Food processing by high hydrostatic pressure. Biosci Biotechnol Biochem. 2017;81:672–9. Nikparvar B, Subires A, Capellas M, Hernandez-Herrero M, Crauwels P, Riedel CU, et al. A Diffusion Model to Quantify Membrane Repair Process in Listeria monocytogenes Exposed to High Pressure Processing Based on Fluorescence Microscopy Data. Front Microbiol. 2021;12:598739. Nikparvar B, Andreevskaya M, Duru IC, Bucur FI, Grigore-Gurgu L, Borda D, et al. Analysis of temporal gene regulation of Listeria monocytogenes revealed distinct regulatory response modes after exposure to high pressure processing. BMC Genomics. 2021;22:266. Duru IC, Bucur FI, Andreevskaya M, Ylinen A, Crauwels P, Grigore-Gurgu L, et al. The complete genome sequence of Listeria monocytogenes strain S2542 and expression of selected genes under high-pressure processing. BMC Res Notes. 2021;14:137. Duru IC, Andreevskaya M, Laine P, Rode TM, Ylinen A, Løvdal T, et al. Genomic characterization of the most barotolerant Listeria monocytogenes RO15 strain compared to reference strains used to evaluate food high pressure processing. BMC Genomics. 2020;21:455. Duru IC, Bucur FI, Andreevskaya M, Nikparvar B, Ylinen A, Grigore-Gurgu L, et al. High-pressure processing-induced transcriptome response during recovery of Listeria monocytogenes . BMC Genomics. 2021;22:117. Sharma CM, Vogel J. Differential RNA-seq: the approach behind and the biological insight gained. Curr Opin Microbiol. 2014;19:97–105. Ettwiller L, Buswell J, Yigit E, Schildkraut I. A novel enrichment strategy reveals unprecedented number of novel transcription start sites at single base resolution in a model prokaryote and the gut microbiome. BMC Genomics. 2016;17:199. Ryan D, Jenniches L, Reichardt S, Barquist L, Westermann AJ. A high-resolution transcriptome map identifies small RNA regulation of metabolism in the gut microbe Bacteroides thetaiotaomicron . Nat Commun. 2020;11:3557. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, et al. An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Proc Natl Acad Sci U S A. 2021;118:e2103579118. Bischler T, Tan HS, Nieselt K, Sharma CM. Differential RNA-seq (dRNA-seq) for annotation of transcriptional start sites and small RNAs in Helicobacter pylori . Methods San Diego Calif. 2015;86:89–101. Wurtzel O, Sesto N, Mellin JR, Karunker I, Edelheit S, Bécavin C, et al. Comparative transcriptomics of pathogenic and non-pathogenic Listeria species. Mol Syst Biol. 2012;8:583. Sass AM, Van Acker H, Förstner KU, Van Nieuwerburgh F, Deforce D, Vogel J et al. Genome-wide transcription start site profiling in biofilm-grown Burkholderia cenocepacia J2315. BMC Genomics. 2015;16:775. Knoop V. When you can’t trust the DNA: RNA editing changes transcript sequences. Cell Mol Life Sci CMLS. 2011;68:567–86. Bar-Yaacov D, Mordret E, Towers R, Biniashvili T, Soyris C, Schwartz S, et al. RNA editing in bacteria recodes multiple proteins and regulates an evolutionarily conserved toxin-antitoxin system. Genome Res. 2017;27:1696–703. Nie W, Wang S, He R, Xu Q, Wang P, Wu Y, et al. A-to-I RNA editing in bacteria increases pathogenicity and tolerance to oxidative stress. PLoS Pathog. 2020;16:e1008740. Andreevskaya M, Johansson P, Jääskeläinen E, Rämö T, Ritari J, Paulin L, et al. Lactobacillus oligofermentans glucose, ribose and xylose transcriptomes show higher similarity between glucose and xylose catabolism-induced responses in the early exponential growth phase. BMC Genomics. 2016;17:539. Duru IC, Ylinen A, Belanov S, Pulido AA, Paulin L, Auvinen P. Transcriptomic time-series analysis of cold- and heat-shock response in psychrotrophic lactic acid bacteria. BMC Genomics. 2021;22:28. Leger A, Amaral PP, Pandolfini L, Capitanchik C, Capraro F, Miano V, et al. RNA modifications detection by comparative Nanopore direct RNA sequencing. Nat Commun. 2021;12:7198. Fleming AM, Bommisetti P, Xiao S, Bandarian V, Burrows CJ. Direct Nanopore Sequencing for the 17 RNA Modification Types in 36 Locations in the E. coli Ribosome Enables Monitoring of Stress-Dependent Changes. ACS Chem Biol. 2023;18:2211–23. Förstner KU, Vogel J, Sharma CM. READemption-a tool for the computational analysis of deep-sequencing-based transcriptome data. Bioinforma Oxf Engl. 2014;30:3421–3. Hoffmann S, Otto C, Kurtz S, Sharma CM, Khaitovich P, Vogel J, et al. Fast mapping of short sequences with mismatches, insertions and deletions using index structures. PLoS Comput Biol. 2009;5:e1000502. Yu S-H, Vogel J, Förstner KU. ANNOgesic: a Swiss army knife for the RNA-seq based annotation of bacterial/archaeal genomes. GigaScience. 2018;7:giy096. Dugar G, Herbig A, Förstner KU, Heidrich N, Reinhardt R, Nieselt K, et al. High-resolution transcriptome maps reveal strain-specific regulatory features of multiple Campylobacter jejuni isolates. PLoS Genet. 2013;9:e1003495. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinforma Oxf Engl. 2014;30:923–30. Harris RS. Improved pairwise alignment of genomic DNA. PhD Thesis. Pennsylvania State University; 2007. Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution’s cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003;100:11484–9. Zhao H, Sun Z, Wang J, Huang H, Kocher J-P, Wang L. CrossMap: a versatile tool for coordinate conversion between genome assemblies. Bioinformatics. 2014;30:1006–7. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–9. Li H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics. 2011;27:2987–93. Wangsanuwat C, Heom KA, Liu E, O’Malley MA, Dey SS. Efficient and cost-effective bacterial mRNA sequencing from low input samples through ribosomal RNA depletion. BMC Genomics. 2020;21. Pryszcz LP, Novoa EM. ModPhred: an integrative toolkit for the analysis and storage of nanopore sequencing DNA and RNA modification data. Bioinforma Oxf Engl. 2021;38:257–60. Cruciani S, Delgado-Tejedor A, Pryszcz LP, Medina R, Llovera L, Novoa EM. De novo basecalling of m6A modifications at single molecule and single nucleotide resolution. 2023;:2023.11.13.566801. Condition-Specific Mapping of Operons. (COSMO) using dynamic and static genome data | bioRxiv. https://www.biorxiv.org/content/ 10.1101/2022.06.14.496048v1.full . Accessed 14 Feb 2024. Zehentner B, Scherer S, Neuhaus K. Non-canonical transcriptional start sites in E. coli O157:H7 EDL933 are regulated and appear in surprisingly high numbers. BMC Microbiol. 2023;23:243. Shao W, Price MN, Deutschbauer AM, Romine MF, Arkin AP. Conservation of Transcription Start Sites within Genes across a Bacterial Genus. mBio. 2014;5:e01398–14. Thomason MK, Bischler T, Eisenbart SK, Förstner KU, Zhang A, Herbig A, et al. Global Transcriptional Start Site Mapping Using Differential RNA Sequencing Reveals Novel Antisense RNAs in Escherichia coli . J Bacteriol. 2015;197:18–28. Kornienko M, Bespiatykh D, Gorodnichev R, Abdraimova N, Shitikov E. Transcriptional Landscapes of Herelleviridae Bacteriophages and Staphylococcus aureus during Phage Infection: An Overview. Viruses. 2023;15:1427. Cerutti F, Mallet L, Painset A, Hoede C, Moisan A, Bécavin C, et al. Unraveling the evolution and coevolution of small regulatory RNAs and coding genes in Listeria. BMC Genomics. 2017;18:882. Lejars M, Hajnsdorf E. The world of asRNAs in Gram-negative and Gram-positive bacteria. Biochim Biophys Acta Gene Regul Mech. 2020;1863:194489. Kim D, Hong JS-J, Qiu Y, Nagarajan H, Seo J-H, Cho B-K, et al. Comparative analysis of regulatory elements between Escherichia coli and Klebsiella pneumoniae by genome-wide transcription start site profiling. PLoS Genet. 2012;8:e1002867. Voigt K, Sharma CM, Mitschke J, Lambrecht SJ, Voß B, Hess WR, et al. Comparative transcriptomics of two environmentally relevant cyanobacteria reveals unexpected transcriptome diversity. ISME J. 2014;8:2056–68. Mitschke J, Georg J, Scholz I, Sharma CM, Dienst D, Bantscheff J, et al. An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803. Proc Natl Acad Sci U S A. 2011;108:2124–9. Gourse RL, Ross W, Gaal T. UPs and downs in bacterial transcription initiation: the role of the alpha subunit of RNA polymerase in promoter recognition. Mol Microbiol. 2000;37:687–95. Djordjevic M. Redefining Escherichia coli σ(70) promoter elements: -15 motif as a complement of the – 10 motif. J Bacteriol. 2011;193:6305–14. Toledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, Balestrino D, et al. The Listeria transcriptional landscape from saprophytism to virulence. Nature. 2009;459:950–6. Saris PEJ, Palva ET. The ptsL, pel/ptsM (manXYZ) locus consists of three genes involved in mannose uptake in Escherichia coli K12. FEMS Microbiol Lett. 1987;44:371–6. Kline BC, McKay SL, Tang WW, Portnoy DA. The Listeria monocytogenes hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis. J Bacteriol. 2015;197:581–91. Deng X, Chen K, Luo G-Z, Weng X, Ji Q, Zhou T, et al. Widespread occurrence of N6-methyladenosine in bacterial mRNA. Nucleic Acids Res. 2015;43:6557–67. Additional Declarations No competing interests reported. Supplementary Files FigureS1andS2.pdf FigureS3.pdf FigureS4.pdf FigureS5.pdf TableS1.xlsx TableS2.xlsx TableS3.xlsx TableS4.xlsx TableS5.xlsx TableS6.xlsx TableS7.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3996292","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":278374961,"identity":"c62934a5-c0eb-44cb-984b-0456cf8f4eeb","order_by":0,"name":"Ilhan Cem Duru","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIie3PsQrCMBCA4ZNCXU5nJYqvcFKoSAefpQh2qdCxU6mTi+4ZfA5dIwWniqvgoktnQRBBB1MVBcF0dcgPIdOXywHodH+YWcb8MvKzAggAAUsxhKQgxpuYAwB6kVRB4EPQzom85UkVompUlqcAHHfB/fP+SFGjg0kMIlB9rNpnHDx3th0u2pwS7E5Hkqh3IYaQuLw2nDMkgbQpxcZRTazrk/gZu1H0IEVT7NcU32RAcui6+GO2g+RZHDO7PpG7ULqMhYq0xhNrh6HT5OV+VruEUY9S77AXt9/k2febogjodDqdTt0dDNNFzOTZ3JwAAAAASUVORK5CYII=","orcid":"","institution":"University of Helsinki","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ilhan","middleName":"Cem","lastName":"Duru","suffix":""},{"id":278374962,"identity":"4dbaa682-9051-480e-ad1c-4950ae5e056b","order_by":1,"name":"Anne Ylinen","email":"","orcid":"","institution":"University of Helsinki","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anne","middleName":"","lastName":"Ylinen","suffix":""},{"id":278374963,"identity":"57822877-9c93-4fc1-a09f-9e278a0d54ca","order_by":2,"name":"Leontina Grigore-Gurgu","email":"","orcid":"","institution":"Dunarea de Jos University of Galati","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Leontina","middleName":"","lastName":"Grigore-Gurgu","suffix":""},{"id":278374964,"identity":"4219d8b7-98c2-40ed-acca-505c7a355e71","order_by":3,"name":"Christian U. Riedel","email":"","orcid":"","institution":"Ulm University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Christian","middleName":"U.","lastName":"Riedel","suffix":""},{"id":278374965,"identity":"aa093cb8-ba76-4835-80ea-e9362aa6e1bd","order_by":4,"name":"Lars Paulin","email":"","orcid":"","institution":"University of Helsinki","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lars","middleName":"","lastName":"Paulin","suffix":""},{"id":278374966,"identity":"eec8fd9d-92be-47aa-bc4f-1ddf4bdfb390","order_by":5,"name":"Petri Auvinen","email":"","orcid":"","institution":"University of Helsinki","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Petri","middleName":"","lastName":"Auvinen","suffix":""}],"badges":[],"createdAt":"2024-02-28 09:47:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3996292/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3996292/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52522542,"identity":"578fa1f9-f5c6-4f2f-8bff-fb0fdb04a5d5","added_by":"auto","created_at":"2024-03-12 14:59:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30345,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCustomized direct RNA-seq protocol to sequence bacterial RNA reads by adding polyA tail.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure174.png","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/f59ab97672d298726ab2a9ce.png"},{"id":52522302,"identity":"cb2f770d-33a6-446e-ac94-1f08154248ec","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":41827,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence motifs of different TSS types.\u003c/strong\u003e The logos show the most significant motifs found by a MEME suite tool in a -50 bp window around the TSS. The position relative to the TSS is shown on the X axis. The logos are arranged from top to bottom according to the TSS type: primary, internal, secondary, antisense, and orphan. The statistical significance (E-value) and the number of sequences used to create each logo are shown on the top right corner.\u003c/p\u003e","description":"","filename":"Figure265.png","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/a1e43b282fa1678c3562b57a.png"},{"id":52522300,"identity":"edac19d7-13c9-45a9-b3d3-46ecee16f2d4","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":46894,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVisualization of sequencing reads supporting the manXYZ operon prediction in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eL. monocytogenes\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e RO15.\u003c/strong\u003e Figure shows three sets of sequencing reads aligned to the manXYZ operon region (OCPFDLNE_00834 - OCPFDLNE_00837) in the \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 genome: long direct RNA-seq reads (from sample R173), Cappable-seq reads (all samples merged), and Illumina RNA-seq reads (all samples merged). The bottom three rows show the gene annotations, predicted operon structure, and predicted transcription start site (TSS) indicated by green arrows.\u003c/p\u003e","description":"","filename":"Figure342.png","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/8510baf2d1bfb2b03112ed98.png"},{"id":52522958,"identity":"c83036e3-fa4b-45e7-9f93-5a59852fa211","added_by":"auto","created_at":"2024-03-12 15:07:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":91797,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence motif around RNA editing sites. \u003c/strong\u003eEnriched motif sequence around editing sites predicted by MEME was shown for both a) RO15 and c) ScottA. The count of four mer around all editing sites was shown by bar plot for b) RO15 and d) ScottA.\u003c/p\u003e","description":"","filename":"Figure436.png","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/8dcc0e38c40ed9dabc38f975.png"},{"id":54356019,"identity":"3449d7bb-49a1-4d70-b88f-b1f0d1e0ec98","added_by":"auto","created_at":"2024-04-09 09:56:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1393734,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/51b4fd9a-76a9-40f5-abca-7772ba22ca58.pdf"},{"id":52522543,"identity":"a43d2949-bfd9-45f7-a46d-33885c00ee1b","added_by":"auto","created_at":"2024-03-12 14:59:19","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":199414,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1andS2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/85b3cb13bc082b5df737142f.pdf"},{"id":52522308,"identity":"81323374-c354-4064-91e7-1679c190e7cc","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":200445,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/c58a94f7bbbb36e6d286a27d.pdf"},{"id":52522546,"identity":"6e8f5f9e-24fc-4095-8518-b381d697da4a","added_by":"auto","created_at":"2024-03-12 14:59:19","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":199026,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/269f03ffe82885ca5431c05b.pdf"},{"id":52522547,"identity":"2ebb5b6b-2cf0-430e-ad6b-aad6a14f0dc4","added_by":"auto","created_at":"2024-03-12 14:59:19","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":147470,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/0a410bc2465c2ec5cc5b57f3.pdf"},{"id":52522309,"identity":"b5b697e8-a029-4d5a-86d2-bf36eca8d4e0","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":14717,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/bc4974386120471761412b8b.xlsx"},{"id":52522303,"identity":"079b2d54-4863-40ef-b6b3-592c42775d30","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":11744,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/4349c2685b02c7d793717765.xlsx"},{"id":52522311,"identity":"de528c92-6649-4970-9050-758773bebe81","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":240293,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/c2cd08fbe97ff4b4f3a8eb9e.xlsx"},{"id":52522313,"identity":"de20125b-d840-41d2-877b-166ea33d5505","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":18768,"visible":true,"origin":"","legend":"","description":"","filename":"TableS4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/baa9ffd95f65a84962bbdd28.xlsx"},{"id":52522545,"identity":"3317ab6d-00cd-42c6-ba24-88d0b57cde7e","added_by":"auto","created_at":"2024-03-12 14:59:19","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":80177,"visible":true,"origin":"","legend":"","description":"","filename":"TableS5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/51dd8d2fa09330d393f87631.xlsx"},{"id":52522314,"identity":"f6b75531-6f97-47fe-af24-b36373bf00e6","added_by":"auto","created_at":"2024-03-12 14:51:20","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":138971,"visible":true,"origin":"","legend":"","description":"","filename":"TableS6.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/e13559fddca5d26bc58ab065.xlsx"},{"id":52522306,"identity":"668a3738-687e-48cb-8705-9425e867916a","added_by":"auto","created_at":"2024-03-12 14:51:19","extension":"xlsx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":25363,"visible":true,"origin":"","legend":"","description":"","filename":"TableS7.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3996292/v1/a21208c7eedac7f14dd4c0fb.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cappable-Seq and Direct RNA Sequencing Reveals Novel insights into the Transcriptome of Listeria monocytogenes","fulltext":[{"header":"Background","content":"\u003cp\u003ePathogens in food cause hardship for societies by increasing waste, carbon footprint, and economic losses [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. \u003cem\u003eListeria monocytogenes\u003c/em\u003e, a major contributor to these losses [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], causes listeriosis [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], a deadly infection that affects people with weak immunity [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Listeriosis has been linked to outbreaks caused by contaminated milk, fish, cheese, ready-to-eat foods, vegetables, and meat [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eL. monocytogenes\u003c/em\u003e survives in various stress conditions, such as low temperatures, high pressures, and acidity, challenging the food industry [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Thus, food products should be treated carefully to prevent \u003cem\u003eL. monocytogenes\u003c/em\u003e contamination or survival.\u003c/p\u003e \u003cp\u003eHigh pressure processing (HPP) is a non-thermal method to inactivate pathogenic microbes, including \u003cem\u003eListeria\u003c/em\u003e sp. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Previously, we have studied the effect of HPP on \u003cem\u003eL. monocytogenes\u003c/em\u003e, in particular its recovery after HPP stress [\u003cspan additionalcitationids=\"CR10 CR11 CR12\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. We have previously shown that genes related to ribosome hibernation, protein folding, the phosphotransferase system (PTS), prophages, and cobalamin biosynthesis play a role in HPP stress and recovery in \u003cem\u003eL. monocytogenes\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition to recent efforts, here we wanted to deepen the \u003cem\u003eL. monocytogenes\u003c/em\u003e genomic knowledge with a new perspective around whole transcriptome units, transcription start site (TSS), gene structure, RNA modification, and RNA editing.\u003c/p\u003e \u003cp\u003eIn bacteria, RNA polymerase (RNAP) initiates transcription by recognizing and binding to specific sequence elements on the DNA. The first DNA nucleotide position that is transcribed into RNA by the RNAP complex is defined as the TSS. Identification of TSS can be done with specific RNA-seq protocols (differential RNA-seq and Cappable-seq), both of which enrich the 5\u0026prime; end of transcripts [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Previous studies have shown that identification of TSS is useful for investigating RNAP binding sites, finding novel genes and small RNAs (sRNAs), and identifying global transcriptional units in several bacterial species [\u003cspan additionalcitationids=\"CR17 CR18 CR19\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In \u003cem\u003eL. monocytogenes\u003c/em\u003e specifically, TSS identification was previously done on the reference strain (EGD-e) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Here, we have used a different strain (RO15) and a different method to expand TSS identification in \u003cem\u003eL. monocytogenes\u003c/em\u003e; moreover, we performed a comparative analysis to test if there is a TSS difference between HPP-treated and control samples.\u003c/p\u003e \u003cp\u003eAdenosine-to-inosine (A-to-I) RNA editing is a post-transcriptional modification that occurs in both eukaryotes and bacteria [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In bacteria, A-to-I editing is catalyzed by the TadA enzyme. TadA deaminates adenosine (A) to inosine (I) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A-to-I RNA editing is thought to play a role in a variety of biological processes in bacteria. For example, in \u003cem\u003eEscherichia coli\u003c/em\u003e, A-to-I editing regulates toxicity and toxin activity [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In \u003cem\u003ePseudomonas putida\u003c/em\u003e, A-to-I editing regulates stress adaptation and pathogenicity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, the GACG motif has been shown to be the binding target for the \u003cem\u003etadA\u003c/em\u003e gene in mRNAs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A-to-I RNA editing, to our knowledge, has not been demonstrated in \u003cem\u003eL. monocytogenes\u003c/em\u003e thus far. Thus, in this study we re-analyzed our previous public Illumina RNA-seq data [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] with the hypothesis of whether A-to-I RNA editing plays a role in the HPP injury stress adaptation and recovery.\u003c/p\u003e \u003cp\u003eRNA molecules have been studied by short read sequencing methods like Illumina in the past [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, direct RNA sequencing of long continuous RNA molecules is possible with Oxford Nanopore Technology (ONT) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. ONT direct RNA sequencing is a PCR-free method that directly sequences native RNA molecules. Therefore, the method can identify RNA modifications directly from the assayed molecules [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. ONT direct RNA-seq has been shown to correctly detect rRNA base modifications in \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In this study, we used direct RNA-seq for the first time on two different \u003cem\u003eL. monocytogenes\u003c/em\u003e strains.\u003c/p\u003e \u003cp\u003eWe have been working on the \u003cem\u003eL. monocytogenes\u003c/em\u003e response to HPP, aiming to improve inactivation of these bacteria. Our studies were performed at the level of comparing genomes and gene expression using DNA sequencing and RNA-seq approaches combined with bioinformatics [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In general, there are only limited datasets available on organisation of the transcriptional units of \u003cem\u003eL. monocytogenes\u003c/em\u003e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. To address the gaps in our understanding of \u003cem\u003eL. monocytogenes\u003c/em\u003e genes, transcriptional unit structure, and regulation, we performed two novel sequencing methods: Cappable-seq and direct RNA-seq.\u0026nbsp;These methods helped us to predict transcription start sites (TSSs), operon structures, promoter motifs, and N6-methyladenosine (m6A) RNA modification, as well as the effect of HPP on transcriptional units. Moreover, we re-analyzed our existing Illumina RNA-seq data [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] from a RNA-editing perspective, which showed potential usage of A-to-I RNA editing in HPP response in \u003cem\u003eL. monocytogenes\u003c/em\u003e. These findings can open up new avenues for research and innovation in food safety and genomics.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental setup, sampling, RNA extraction\u003c/h2\u003e \u003cp\u003eFor this study we used the same RNA extracts that we have obtained in our previous study [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Briefly, in our previous study [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], we used two \u003cem\u003eL. monocytogenes\u003c/em\u003e strains: strain RO15 (Genbank: GCA_902827145.1) and strain ScottA (GenBank: CM001159.1). Both strains were cultivated in BHI broth (350 ml) at 37\u0026deg;C for 24 hours, to the early stationary phase. Further, the cell cultures were transferred to 2 mL tubes and cooled at 4\u0026deg;C for 1 h. The samples were treated at 200 MPa and 400 MPa, 8\u0026deg;C, for 8 min in multi-vessel high-pressure equipment. The samples were kept at 8\u0026deg;C for recovery at atmospheric pressure. They were sampled at 0, 5, 10, 30, 45, and 60 minutes, and at 6, 24, and 48 hours (T1 to T9) after HPP. Control samples were also stored at 8\u0026deg;C with no pressure and sampled at the same time points as HPP treated samples. RNA was extracted from samples using the NucleoSpin RNA kit [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePreviously, 216 samples were subjected to RNA-seq using Illumina [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this study, we chose six strain RO15 samples from previously obtained RNA extracts to perform additional Cappable-seq.\u0026nbsp;The selected strain RO15 samples for Cappable-seq were: R017 (200 MPa HPP, 0 min time point), R101 (400 MPa HPP, 0 min time point), R173 (400 MPa HPP, 24 hours time point), R179 (control, 0 min time point), R250 (control 0 min time point), R312 (control 24 hours time point).\u003c/p\u003e \u003cp\u003eFor the direct RNA-seq, we chose two strain RO15 samples, and two strain ScottA samples. Selected strain RO15 samples for direct RNA-seq were: R173 (400 MPa HPP, 24 hours time point) and R312 (control 24 hours time point). Selected strain ScottA samples were: R158 (400 MPa HPP, 24 hours time point) and R317 (control 24 hours time point) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCappable-seq library processing and sequencing\u003c/h2\u003e \u003cp\u003eTo capture of the 5\u0026prime; end of primary transcripts we used the Cappable-seq method [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and the protocol published by New England Biolabs (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://international.neb.com/protocols/2018/01/19/cappable-seq-for-prokaryotic-transcription-start-site-determination\u003c/span\u003e\u003cspan address=\"https://international.neb.com/protocols/2018/01/19/cappable-seq-for-prokaryotic-transcription-start-site-determination\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Before Cappable-seq library preparation, 15 \u0026micro;l of decapped RNA was vacuum-dried in DNA Speed Vac DNA110 (Savant) at a low drying rate for about 40 min and then suspended in 2.5 \u0026micro;l of ultra-pure water. Cappable-seq libraries were prepared with TruSeq Small RNA Library Prep (Illumina) using half of the kit\u0026rsquo;s volumes according to the manufacturer\u0026rsquo;s instructions. Libraries (half of the reaction volume) were pooled and concentrated using Amicon Ultra-0.5 100K filter device (Millipore) (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Fragments of a size of 140\u0026ndash;250 bases fusing BluePippin and 3% agarose gel cassette (Sage Science). NextSeq 500 (Illumina) was used to sequence the Cappable-seq libraries with single-end 75 bases long reads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRead processing and mapping for TSS\u003c/h2\u003e \u003cp\u003eThe same preprocessing was performed for Cappable-seq reads as described previously for Illumina RNA-seq reads [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], except using \u0026ldquo;TGGAATTCTCGGGTGCCAAGG\u0026rdquo; as an adapter during the adapter filtering step. Both Illumina RNA-seq and Cappable-seq reads were mapped to the strain RO15 genome (Genbank: GCA_902827145.1) using the READemption v0.5.0 pipeline [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] with default options. Briefly, the pipeline uses Segemehl v0.2 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] with minimal accuracy of 95%. Coverage and normalization of coverage was calculated using READemption v0.5.0 \u0026ldquo;coverage\u0026rdquo; function. The coverage was normalized by the total number of aligned reads and multiplied by the lowest number of aligned reads of all input libraries.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of TSSs in RO15\u003c/h2\u003e \u003cp\u003eTo get the whole TSS set, we combined all six Cappable-seq reads files into one, and the same was done for corresponding six Illumina RNA-seq read files as well. TSS identification was done by comparing the relative coverage of reads between Cappable-seq reads and Illumina RNA-seq reads. For this purpose, we used ANNOgesic v1.0.16 pipeline [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] with TSSpredator v1.06 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To get the optimal parameters, we first manually annotated the first 50 kbp region. Manually annotated file was employed to obtain the optimal parameters using \u0026lsquo;annogesic optimize_tss_ps\u0026rsquo;. Then, \u0026ldquo;annogesic tss_ps\u0026rdquo; command was run using \u0026lsquo;-c normPercentile\u0026thinsp;=\u0026thinsp;0.8, texNormPercentile\u0026thinsp;=\u0026thinsp;0.2, allowedCompareShift\u0026thinsp;=\u0026thinsp;4, allowedRepCompareShift\u0026thinsp;=\u0026thinsp;4\u0026rsquo;.\u003c/p\u003e \u003cp\u003eWe predicted HPP-specific transcription start sites (TSSs) by comparing TSS region Cappable-seq read counts from HPP-treated and control samples. We used featureCounts v2.0.3 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] to obtain TSS region Cappable-seq read counts from all six sequenced samples. Since we had three HPP-treated samples and three control samples, we ran DESeq2 to compare TSS region read counts between the two conditions. We normalized the counts and defined a TSS as HPP-specific if it met the following two criterias: The log2 fold change between the HPP-treated and control samples was greater than or equal to |4|. The total read count for the opposite condition was less than 10 (in total for triplicates).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of UTR and sRNA in RO15\u003c/h2\u003e \u003cp\u003eWe used ANNOgesic v1.0.16 pipeline [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] to predict additional sRNA and UTR \u0026ldquo;annogesic utr\u0026rdquo; with default options was used for UTR length prediction. \u0026ldquo;annogesic srna\u0026rdquo; with \u0026lsquo;--tex_notex 1\u0026rsquo; were used for sRNA prediction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEGD-e TSS lift over to RO15\u003c/h2\u003e \u003cp\u003eThe genome sequences of EGD-e and RO15 were aligned using LASTZ v1.04.15 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] with \u0026ldquo;--chain --format\u0026thinsp;=\u0026thinsp;axt\u0026rdquo; options. We then chained the \u0026ldquo;axt\u0026rdquo; alignment files using axtChain [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and generated chain format output. Chain format output was used to lift EGD-e TSS gff to RO15 genome using CrossMap v0.5.4 [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eVariant calling\u003c/h2\u003e \u003cp\u003eWe used the Illumina RNA-seq data obtained in our HPP experiment study [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Illumina RNA-seq preprocessing was described previously [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Illumina RNA-seq reads were mapped to the reference genome using Bowtie2 v2.3.4.3 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] default options. The output was sorted and converted to BAM format using Samtools v1.9 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Bcftools v1.9 [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] \u0026ldquo;mpileup\u0026rdquo; function with default options was used to generate genotype likelihoods. Bcftools v1.9 \u0026ldquo;call\u0026rdquo; function with \u0026ldquo;-mv -Ob\u0026rdquo; options was used for variant calling.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eDirect RNA-seq\u003c/h2\u003e \u003cp\u003eFour RNA samples were additionally analysed with direct RNA-seq.\u0026nbsp;Since the protocol assumes mRNAs to have poly-A tails, they were first added by treating 14.5 \u0026micro;l of total RNA (3-7.8 \u0026micro;g) with 7.5 units of \u003cem\u003eE. coli\u003c/em\u003e poly(A) polymerase (New England Biolabs) and 2 mM ATP in 1x reaction buffer at 37\u0026deg;C for 30 min. To enrich the yield of mRNA reads, the reaction included a mix of nine rRNA blocking oligos (total concentration: 2.4 \u0026micro;M) (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Blocking of the 3\u0026rsquo; ends of 16S, 23S, and 5S rRNA leads to preferential addition of poly-A tails to mRNA molecules [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The reactions were purified with 1.8 vol RNA Clean XP beads and eluted in RNase free water. The rRNA-depleted RNAs with poly-A tails were then used as starting material for the Direct RNA-seq protocol SQK-RNA002 (Oxford Nanopore Technologies) according to the manufacturer\u0026rsquo;s instructions, except for RNA Control Strand (RCS), which was diluted 1:20 prior to use (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). About 190 ng of the reverse-transcribed and adapted original RNA molecules were sequenced with FLO-MIN106 flow cells using MinKNOW software v19.06.8 or 21.06.0 (Oxford Nanopore Technologies). The number of reads obtained for the four samples ranged from 314,044 to 1,613,144. The percentage of reads that mapped the reference genome was between 43.61% and 93.04% of the total reads. The aligned reads consisted of 10.25\u0026ndash;25.31% mRNA reads.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003em6A RNA modification prediction using direct RNA-seq\u003c/h2\u003e \u003cp\u003eTo identify m6A RNA modifications, we used ModPhred v3.6.1 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] in conjunction with an m6A modification-aware basecalling model [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Each of the four samples (two RO15 and two ScottA samples) was individually assessed using their direct RNA-seq reads to determine the locations of m6A RNA modifications. The prediction was made using the default threshold, which requires at least 25 read coverage and at least 5% modification frequency.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnnotation of operons\u003c/h2\u003e \u003cp\u003eOperon structure was predicted using COSMO v0.1.0 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] with default options. COSMO was run with all RNA-seq reads (both Illumina RNA-seq and direct RNA-seq).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eTSS identification in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBased on the comparison of the relative coverage of reads between Cappable-seq and Illumina RNA-seq with ANNOgesic tool, 1641 TSSs were identified across the genome of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). Among all TSS, 1233 had highest coverage within 300 bp upstream of an open reading frame (ORF) and were classified as primary TSS. Secondary TSSs (i.e. TSSs with lower coverage within 300 bp upstream of an ORF) were detected for 90 genes. The number of TSSs located within the coding sequence of a gene (i.e. internal TSSs) was 233. Moreover, 199 TSSs located on the antisense strand of a protein coding gene (antisense TSSs) and 55 orphan TSSs not assigned to any coding DNA sequence (CDS) were detected. To facilitate visual inspection of these results, we created a public online genome viewer page (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://icemduru.github.io/listeria_ro15_transcript/\u003c/span\u003e\u003cspan address=\"https://icemduru.github.io/listeria_ro15_transcript/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe TSSs of \u003cem\u003eL. monocytogenes\u003c/em\u003e strain EGD-e have been previously identified, and strain EGD-e was shown to contain 1576 TSSs [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. To compare our TSS prediction in RO15 and EGD-e TSSs, [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] we mapped the EGD-e TSSs to the RO15 genome. Almost all EGD-e TSSs (1531 of 1576) were successfully mapped to the RO15 genome and the following analysis revealed that 876 of 1531 lifted TSS positions were the same as the TSS positions that we predicted in RO15 (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBy comparing the Cappable-seq reads of the HPP-treated samples to those of the control samples, we were able to predict TSSs that were specific to the HPP treatment. In total six TSS were predicted to be specific to HPP-treated samples. The six TSSs specific to HPP-treated samples were associated with five genes and one tRNA (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003ePredicted transcription start sites (TSS) specific to HPP-treated samples.\u003c/b\u003e The first column shows the TSS identifier (TSS ID), which consists of the genomic position and the strand orientation (forward or reverse) of the TSS. The second column shows the gene identifier (gene ID) of the gene that is transcribed from the TSS. The third column shows the gene annotation, which describes the putative function of the gene product. The fourth column shows the TSS type, which indicates whether the TSS is located at the 5\u0026rsquo; end of a gene (primary), within a gene (internal), or opposite to a gene (antisense). The fifth column shows the average number of Cappable-seq reads for all three HPP treated samples. The sixth column shows the average number of Cappable-seq reads for all three control samples. The seventh column shows the log\u003csub\u003e2\u003c/sub\u003e fold change of the average Cappable-seq reads between the HPP and control samples.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAssociated gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAssociated gene annotation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTSS type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAvg. Cappable-seq reads (HPP)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAvg. Cappable-seq reads (Control)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eLog\u003csub\u003e2\u003c/sub\u003e fold change\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:2221338_f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhage terminase subunit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8.43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:398878_f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00383\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFerrous iron permease EfeU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eprimary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e7.24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:2273494_r\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02283\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProbable transcriptional regulator YvdE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003einternal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e4.80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:76604_f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00071\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ehypothetical protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003einternal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e4.34\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:630711_r\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00601\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomoserine O-acetyltransferase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003einternal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTSS:246761_f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00242\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etRNA-Arg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eprimary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTSS of prophages\u003c/h2\u003e \u003cp\u003eOur previous studies investigating the genome of RO15 strain [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and gene expression in response to HPP stress [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] revealed that prophages were associated with the phenotypic characteristics of the strain. Notably, we observed upregulation of phage genes during HPP stress, suggesting induction of prophages during HPP stress [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. This led us to further explore phage TSSs, which previously have received limited attention in \u003cem\u003eL. monocytogenes\u003c/em\u003e strains.\u003c/p\u003e \u003cp\u003ePreviously we identified five distinct prophage regions in the RO15 genome, ranging in size from 10.7 kb (prophage 1) to 41.3 kb (prophage 5) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Prophage 5 was further observed as a circular form, suggesting a free virus genome version [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Among these regions, prophage 5 harboured the highest number of TSSs, with a significantly higher proportion of antisense TSSs compared to the other prophages (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eProphage regions in RO15 and the number of TSS\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage Region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber of genes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimary TSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eInternal TSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAntisense TSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eOrphan TSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage 1\u003c/p\u003e \u003cp\u003e(125824\u0026ndash;136550 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage 2\u003c/p\u003e \u003cp\u003e(673631\u0026ndash;706883 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage 3 (2175980\u0026ndash;2223958 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage 4 (2559206\u0026ndash;2601984 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProphage 5 (2729417\u0026ndash;2770759 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eInterestingly, one of the HPP-specific TSS (TSS:2221338_f) was located in the prophage 3 region. This TSS, which is antisense to the gene OCPFDLNE_02235 (encoding phage terminase large subunit protein), was specifically induced in response to HPP stress. Cappable-seq analysis revealed the presence of TSS signals at this location in all HPP-treated samples, while no such signal was detected in control samples. Additionally, short Illumina RNA-seq reads indicated the presence of opposite-strand reads in the OCPFDLNE_02235 gene region, supporting the potential involvement of antisense RNA in this gene. However, no sRNA was predicted on this region in our sRNA prediction workflow\u003c/p\u003e \u003cp\u003e \u003cb\u003ePrediction of sRNAs in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe ANNOgesic tool was used to predict sRNAs in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15, resulting in 81 identified candidates (Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). The majority (53 of 81) were classified as intergenic sRNAs. A total of 20 sRNAs were found to originate from untranslated regions (UTRs), with four derived from 3'UTRs and 16 from 5'UTRs. Six of the predicted sRNAs were identified as antisense sRNAs (asRNAs), and two were classified as InterCDS sRNAs (located within coding sequences).\u003c/p\u003e \u003cp\u003eTo investigate asRNAs and gene expression patterns during high-pressure processing (HPP) treatment, gene counts were performed. However, no anticorrelation was observed between fold changes in asRNAs and their corresponding genes (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn a previous study, nine antisense RNAs (asRNAs) were experimentally validated (by Northern blot) in \u003cem\u003eListeria monocytogenes\u003c/em\u003e strain EGD-e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. To investigate these asRNAs in strain RO15, we mapped them to the genome of strain RO15. We then examined our TSS prediction data for RO15 and found that two of these nine validated asRNAs had corresponding TSSs in RO15. Interestingly, only one of our predicted sRNA was in the same genomic location as a validated asRNAs in EGD-e. However, our prediction classified this sRNA as intergenic in RO15 because the adjacent gene was not found in RO15.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePrediction of promoters, and UTR length in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe analyzed the upstream regions of all predicted TSSs (-50 bp to 1 bp) using the MEME suite to identify promoter motifs in \u003cem\u003eL. monocytogenes\u003c/em\u003e. Our findings revealed that there is only one well-conserved region in the promoter regions, with a -10 position \u0026ldquo;TATAAT\u0026rdquo;-like motif. This motif is present in all three types of TSSs. Additionally, we observed that the \u0026minus;\u0026thinsp;10 position motif is slightly different in secondary TSS promoter regions compared with other types of TSS regions. This suggests that there may be some subtle differences in the regulation of secondary TSSs compared with other types of TSSs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe investigated the length distribution of 5' UTRs in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 using TSSs and calculating UTR lengths. Our analysis revealed that most of the 5' UTRs were shorter than 100 bases (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). We observed that the median length of 5' UTRs using primary TSSs was 33 bases. When secondary TSSs were also considered, the median UTR length increased to 34 bases (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eOperon prediction in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBy using a combination of Illumina short and ONT direct long RNA-seq reads, we analyzed the operon structure of the \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 genome. Our predictions revealed that 71% (2210 genes) of the genes were organized into operons (Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e). A total of 658 operons were identified, with an average of 3.35 genes per operon (median\u0026thinsp;=\u0026thinsp;2 genes). The largest predicted operons were predominantly found within the prophage regions. Large operons were also seen in the \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 genome, such as the cobalamin biosynthesis operon, comprising 19 genes (OCPFDLNE_01235 - OCPFDLNE_01253), emerged as one of the largest operons within the entire genome.\u003c/p\u003e \u003cp\u003eFurthermore, we visually examined our predictions and observed strong support from both Cappable-seq and direct RNA sequencing reads. For instance, the manXYZ operon (OCPFDLNE_00834 - OCPFDLNE_00837) was predicted by our workflow, and both Cappable-seq and direct RNA sequencing reads helped us visually confirm the operon prediction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eA-to-I RNA editing in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15 and strain ScottA\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDuring the TSS analysis, we carefully examined the previously published Illumina RNA-seq data from RO15 and ScottA strains [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Our analysis revealed several sequence variants that were not attributed to sequencing errors and were not detected in the gDNA-based PacBio or Illumina data [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. These variants, consisting of A to G (T to C for reverse strand) transitions, are indicative of A-to-I RNA editing, a post-transcriptional modification that has been previously studied in other bacteria [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe presence of A-to-I RNA editing variants was higher in HPP-treated samples for several genes (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e). A subset of these variants was specifically observed in HPP-treated samples, suggesting their potential role in HPP response mechanisms. A-to-I RNA editing within genes \u003cem\u003espoVG, pbpX, mdxE, patB, hpf\u003c/em\u003e, and \u003cem\u003epepC\u003c/em\u003e was particularly common in both strains under HPP stress. While the majority of observed A-to-I RNA editing variants were confined to HPP-treated samples, a subset of these variants were also detected in control samples. These variants, found within genes \u003cem\u003epflA\u003c/em\u003e, \u003cem\u003emdxE\u003c/em\u003e, \u003cem\u003esecA\u003c/em\u003e, and \u003cem\u003ekdpD\u003c/em\u003e in strain RO15, and \u003cem\u003eactA\u003c/em\u003e, \u003cem\u003eldh\u003c/em\u003e, \u003cem\u003edhaS\u003c/em\u003e, LMOSA_26480, and \u003cem\u003emdxE\u003c/em\u003e in strain ScottA. Notably, most of these variants were observed as partial variants, indicating that approximately half of the RNA-seq reads contained the variant base in the transcript.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e \u003cb\u003eSummary of A\u0026thinsp;\u0026gt;\u0026thinsp;G (T\u0026thinsp;\u0026gt;\u0026thinsp;C on reverse strand) variant positions and the corresponding gene in strain RO15.\u003c/b\u003e The table shows the positions of A\u0026thinsp;\u0026gt;\u0026thinsp;G variants in RNA of RO15, and the locus tag, gene name, number of samples with the variant in treated and control groups, reference and variant amino acids of the corresponding gene, respectively. The p-values between treated and control samples were calculated using Fisher\u0026rsquo;s exact test. For the sake of clarity, only variants detected in more than 7 samples are presented. The complete list of variants is available in the supplementary Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant Pos.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLocus Tag\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e# variants treated (n\u0026thinsp;=\u0026thinsp;51)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e# variants control (n\u0026thinsp;=\u0026thinsp;52)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eref. aa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003evar. aa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2269171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02280\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emdxE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.90E-08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2649787\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02685\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ehpf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3.47E-07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e497744\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00478\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edhaS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e9.18E-05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1768810\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_01761\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eyfhP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.90E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1544500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_01549\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.11E-03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e429958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00419\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emngB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.47E-03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e204136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_00200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003espoVG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7.41E-03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2428075\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02434\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epepC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.50E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2288303\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003esRNA_92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003erli47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.50E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2646986\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_02684\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esecA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.52E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1451307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_01455\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epflA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.70E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1213571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOCPFDLNE_01217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epdtaS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.98E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e \u003cb\u003eSummary of A\u0026thinsp;\u0026gt;\u0026thinsp;G (T\u0026thinsp;\u0026gt;\u0026thinsp;C on reverse strand) variant positions and the corresponding gene in strain ScottA.\u003c/b\u003e The table shows the positions of A\u0026thinsp;\u0026gt;\u0026thinsp;G variants in RNA of RO15, and the locus tag, gene name, number of samples with the variant in treated and control groups, reference and variant amino acids of the corresponding gene, respectively. The p-values between treated and control samples were calculated using Fisher\u0026rsquo;s exact test. For the sake of clarity, only variants detected in more than 7 samples are presented. The complete list of variants is available in the supplementary Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant Pos.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLocus Tag\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e# variants treated (n\u0026thinsp;=\u0026thinsp;53)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e# variants control (n\u0026thinsp;=\u0026thinsp;54)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eref. aa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003evar. aa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2675586\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_4770\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ehpf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3.21E-08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1717344\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_25410\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epepV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8.61E-05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e242871\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_10890\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003espoVG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.08E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2324765\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_1570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egloA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.08E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e720351\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintergenic_region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.55E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1775078\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_25880\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.55E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2520887\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_3290\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epatB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.55E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2481510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_2970\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epepC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.91E-03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003es252859\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_10970\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eactA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e9.89E-03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2281668\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_1140\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emdxE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.01E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2715706\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_5200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.85E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1282535\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_21080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.54E-02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e568103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_13830\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edhaS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.46E-01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1843087\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_26480\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.95E-01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e257308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLMOSA_11030\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eldh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.00E\u0026thinsp;+\u0026thinsp;00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eInterestingly, we observed a gradual increase in the editing percentage with increasing HPP treatment time (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e, Figure \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). However, the expression patterns of the genes harbouring these A-to-I RNA editing variants were not consistently altered. Both upregulation and downregulation were observed for these genes (Figure \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe examined the distribution of the RNA edited sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Our findings revealed distinct preferences for modified sites between the RO15 and Scott A strains. Notably, while the predicted consensus motif differed between the two strains, two four-base motifs (TACG and GTAA) emerged as the most prevalent edited motifs in both strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA m6A modification prediction in\u003c/b\u003e \u003cb\u003eL. monocytogenes\u003c/b\u003e \u003cb\u003estrain RO15 and strain ScottA\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn the RO15 HPP-treated sample, we predicted 23 sites with m6A modifications, while only three positions were identified as m6A modified in the RO15 control sample. m6A modifications targeting the \u003cem\u003ednaD\u003c/em\u003e and \u003cem\u003earsC\u003c/em\u003e genes were observed in both treated and control samples (Table \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e). Notably, carbohydrate transmembrane transporter activity-related genes such as \u003cem\u003emanX\u003c/em\u003e (encoding a mannose transporter), \u003cem\u003emntB\u003c/em\u003e (encoding a manganese transporter), and \u003cem\u003emdxE\u003c/em\u003e (encoding a Maltodextrin-binding protein) were frequently targeted by m6A modifications in the HPP-treated sample (Table \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn contrast to RO15, fewer m6A RNA modifications were observed in HPP treated samples of ScottA. In the treated sample, four positions were predicted as m6A modified, while in the control sample, 11 positions were predicted as m6A modified. The modifications that target the \u003cem\u003egadB\u003c/em\u003e gene were seen in both samples. In addition to the \u003cem\u003egadB\u003c/em\u003e gene, m6A modification was observed in the \u003cem\u003einlA\u003c/em\u003e gene (encoding an Internalin-A protein) (Table \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe used Cappable-seq, a novel method for directly enriching the 5' end of primary transcripts in prokaryotes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], to comprehensively identify the TSSs of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15. Our analysis revealed 1,641 TSSs in the strain RO15. To compare our TSS prediction in RO15 with the previously reported TSSs in strain EGD-e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], we mapped the EGD-e TSSs to the RO15 genome using a lift-over (mapping) approach. We found that only 57% of the mapped EGD-e TSSs (876/1531) matched the TSSs that we predicted in RO15 using Cappable-seq.\u0026nbsp;The remaining 43% of the lifted EGD-e TSSs (655/1531) either did not have a corresponding TSS in RO15 or had a different TSS position. This discrepancy could be attributed to several factors, such as the strain variation, the sequencing depth, the mapping algorithm, and the TSS prediction methods and criteria [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. For instance, RO15 and EGD-e belong to different clonal complexes (CC155 and CC9, respectively) and multilocus sequence types (ST155 and ST35, respectively) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which could result in genomic rearrangements and mutations that affect the TSS locations. Previous studies on TSS conservation within \u003cem\u003eShewanella\u003c/em\u003e species reported a 63% conservation rate [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], aligning with our findings for the RO15 and EGD-e comparison.\u003c/p\u003e \u003cp\u003eWe found that six TSSs in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 were activated by HPP. These TSSs corresponded to five genes and one tRNA, indicating that HPP might alter the TSS selection in \u003cem\u003eL. monocytogenes\u003c/em\u003e. This could help us understand how \u003cem\u003eL. monocytogenes\u003c/em\u003e responds to stress and how to prevent its growth and survival in food products. The genes associated with these TSSs are potential targets for future research. Previous studies have reported a large number of condition-specific TSSs in \u003cem\u003eE. coli\u003c/em\u003e under different growth conditions [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. However, we detected only six condition-specific TSSs in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15, out of 1,641 total TSSs. This is partly because we used a different and more stringent method to identify TSSs based on differential Cappable-seq signals between HPP-treated and control samples. Our method required almost no Cappable-seq signal in all control samples to call a TSS as HPP-specific.\u003c/p\u003e \u003cp\u003eWe previously showed that HPP stress induces phages in \u003cem\u003eL. monocytogenes\u003c/em\u003e species and upregulates phage genes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. To better understand the transcriptional regulation of phage genes, we analyzed the TSSs of phages in detail. We found that phage regions had fewer TSSs than the rest of the genome. The \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 genome had 3,107 genes and 1,641 TSSs, resulting in a 53% gene/TSS ratio. In contrast, the average gene/TSS ratio for the five phages was 18%. Our operon prediction also indicated that the largest operons were mainly located in the prophage regions, suggesting that phage genes are co-regulated. This is consistent with previous reports of long transcriptional units in \u003cem\u003eHerelleviridae\u003c/em\u003e bacteriophages [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Interestingly, we identified a HPP-specific TSS in the prophage 3 region, which was antisense to the OCPFDLNE_02235 gene encoding a phage terminase large subunit protein. This observation raises the possibility that alternative TSSs and antisense RNAs may play a role in regulating phage gene expression under stress conditions.\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eListeria\u003c/em\u003e, sRNAs play a role in several processes including pathogenicity and host interaction [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In this study, we predicted 81 sRNAs in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15. We compared our sRNA predictions with those reported in \u003cem\u003eL. monocytogenes\u003c/em\u003e EGD-e and other strains, and found that only two of the nine experimentally validated asRNAs in EGD-e had corresponding TSSs in RO15. This suggests that sRNA diversity and conservation may vary among different strains and species of \u003cem\u003eL. monocytogenes\u003c/em\u003e. We also investigated the expression patterns of the predicted asRNAs and their target genes under HPP treatment, but did not observe any anticorrelation between them. This could be due to the complex and dynamic regulation of asRNAs in bacteria, which may depend on various factors such as transcription, translation, stability, and interaction of the RNA molecules [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The predicted sRNAs may play important roles in modulating gene expression and influencing the physiology and pathogenicity of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15. However, the functions and mechanisms of the sRNAs remain largely unknown and require further experimental validation and characterization. Future studies should also explore how the sRNAs respond to different environmental and host signals, and how they interact with other regulatory elements in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15.\u003c/p\u003e \u003cp\u003eThe 5\u0026rsquo; UTR of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 has a median length of 33 bases, which agrees with previous predictions for \u003cem\u003eL. monocytogenes\u003c/em\u003e EGD-e and \u003cem\u003eL. innocua\u003c/em\u003e BUG499 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This implies that 5\u0026rsquo; UTR length regulation may be conserved among different \u003cem\u003eListeria\u003c/em\u003e species. Other species, such as \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, have similar 5\u0026rsquo; UTR length distributions to \u003cem\u003eListeria\u003c/em\u003e [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. However, some bacteria have longer or shorter median 5\u0026rsquo; UTR lengths, such as \u003cem\u003eProchlorococcus\u003c/em\u003e MED4 (27 nucleotides) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and \u003cem\u003eSynechocystis\u003c/em\u003e sp. PCC6803 (42 nucleotides) [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. These variations may reflect the adaptation of different bacteria to their environmental conditions.\u003c/p\u003e \u003cp\u003eProkaryotic promoter regions generally include \u0026minus;\u0026thinsp;35 and \u0026minus;\u0026thinsp;10 elements, which affect promoter activity [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. By promoter motif analysis, we found a clear TATAAT-like \u0026minus;\u0026thinsp;10 element in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15, but the \u0026minus;\u0026thinsp;35 element had a weak motif signal and was not well-defined. \u003cem\u003eE. coli\u003c/em\u003e also had a weak \u0026minus;\u0026thinsp;35 element motif in a similar analysis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. We hypothesized that \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 had many promoters without a -35 element or with a poorly conserved one. Moreover, we found extended \u0026minus;\u0026thinsp;10 elements, such as the \u0026ldquo;TG\u0026rdquo; motif (or -15 element) [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], in many promoter regions in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15. These extended \u0026minus;\u0026thinsp;10 elements could replace the missing \u0026minus;\u0026thinsp;35 element and enhance transcription initiation.\u003c/p\u003e \u003cp\u003eIn this study, we used a combination of Illumina short RNA-seq reads and ONT long direct RNA-seq reads to predict the operon structure of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15. Long RNA-seq reads, with the potential to capture entire operons within a single read, are particularly valuable for operon prediction, as they provide direct evidence of transcriptional units. Our analysis revealed that 71% of the genes in the RO15 genome were organized into operons. This observation aligns with previous findings in other pathogenic bacteria, such as \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e, where 75% of genes were predicted to be operon-associated using the same computational approach [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In contrast, a lower percentage of operons (60%) were identified in \u003cem\u003eL. monocytogenes\u003c/em\u003e EGD-e using a different prediction method [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. This discrepancy likely reflects the sensitivity and specificity of different prediction tools. To our knowledge, this study represents the first application of long direct RNA-seq reads for operon prediction in \u003cem\u003eL. monocytogenes\u003c/em\u003e. Manual inspection of the long reads supported the operon structures we predicted. For instance, the manXYZ operon previously identified in \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], were also predicted in our analysis. These observations demonstrate the validity and accuracy of our operon predictions. Thus, our findings provide a valuable reference for future studies investigating operon organization in \u003cem\u003eL. monocytogenes\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eOur analysis on published RNA-seq data [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] revealed that several genes in both RO15 and ScottA strains of \u003cem\u003eL. monocytogenes\u003c/em\u003e had A-to-I RNA variants, especially after HPP. Previous studies have shown that A-to-I RNA editing can modulate the toxicity of \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and the oxidative stress tolerance of \u003cem\u003eP. putida\u003c/em\u003e [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] by altering the transcripts of \u003cem\u003ehokB\u003c/em\u003e and \u003cem\u003efliC\u003c/em\u003e, respectively. We therefore hypothesized that A-to-I RNA editing might be a mechanism of HPP stress adaptation in \u003cem\u003eL. monocytogenes\u003c/em\u003e. We found that genes \u003cem\u003espoVG\u003c/em\u003e, \u003cem\u003epbpX\u003c/em\u003e, \u003cem\u003emdxE\u003c/em\u003e, \u003cem\u003epatB\u003c/em\u003e, \u003cem\u003ehpf\u003c/em\u003e, and \u003cem\u003epepC\u003c/em\u003e were frequently edited in both strains under HPP stress, indicating that these genes might be involved in the HPP stress response. Among them, the gene \u003cem\u003ehpf\u003c/em\u003e, which encodes a ribosome hibernation-promoting factor, was of particular interest, as the editing frequency increased over time in the treated samples. The gene \u003cem\u003ehpf\u003c/em\u003e plays a crucial role in \u003cem\u003eListeria\u003c/em\u003e survival under stress conditions, by converting active 70S ribosomes into inactive 100S ribosomes [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. We speculated that \u003cem\u003eL. monocytogenes\u003c/em\u003e might enhance the ribosome hibernation efficiency by editing the \u003cem\u003ehpf\u003c/em\u003e transcript during HPP recovery. Interestingly, some of the A-to-I RNA editing variants were also present in the control samples, implying that A-to-I RNA editing is not only a stress-specific phenomenon, but also a dynamic process that might occur under normal growth conditions in certain genes.\u003c/p\u003e \u003cp\u003eN6-methyladenosine (m6A) is a common RNA modification that modulates the structure and function of RNA molecules [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In bacteria, m6A is involved in various cellular processes, such as gene expression and stress response [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. It is known that m6A responds to various environmental factors, such as temperature, oxidative stress, and antibiotic exposure, and that it influences bacterial adaptation [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In this study, we used a novel model [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] to detect m6A RNA modifications in direct RNA-seq reads without requiring IVT or knockout controls [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Our analysis revealed that HPP treatment had opposite impacts on the m6A levels of two \u003cem\u003eL. monocytogenes\u003c/em\u003e strains: RO15 and ScottA. While RO15 showed more m6A sites after HPP treatment, ScottA showed fewer. This indicates that HPP treatment can alter the m6A landscape of \u003cem\u003eL. monocytogenes\u003c/em\u003e RNA in a strain-dependent manner. The m6A modification may be involved in the regulation of genes related to carbohydrate transport and stress response in \u003cem\u003eL. monocytogenes\u003c/em\u003e. For example, we found that HPP treatment increased the m6A modification of genes encoding mannose, manganese, and maltodextrin transporters in RO15, which may enhance the uptake of these nutrients and promote bacterial growth and survival. These findings indicate that m6A modification may play a role in the adaptation of \u003cem\u003eL. monocytogenes\u003c/em\u003e to HPP treatment and other environmental stresses. However, we only used one treated and one control sample per strain in this study. More samples with statistical analysis are needed to confirm and generalize our results. Nevertheless, our study provides a useful guide for future research on the m6A modification of bacterial RNA.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eCollectively, our findings shed light on the complex transcriptional landscape, stress response mechanisms, and post-transcriptional modifications in \u003cem\u003eL. monocytogenes\u003c/em\u003e. This knowledge deepens our understanding of \u003cem\u003eL. monocytogenes\u003c/em\u003e and opens avenues for future research exploring the functional consequences of A-to-I editing and m6A modifications in \u003cem\u003eL. monocytogenes\u003c/em\u003e stress adaptation. This understanding can contribute to the development of improved strategies for food safety and control of \u003cem\u003eListeria\u003c/em\u003e. We encourage further research to validate the functional significance of these discoveries, potentially opening new avenues for understanding and combating \u003cem\u003eL. monocytogenes\u003c/em\u003e-related challenges.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003e \u003cp\u003esmall RNA (sRNA), antisense sRNA (asRNA), high pressure processing (HPP), transcription start site (TSS), Oxford Nanopore Technology (ONT), untranslated region (UTR), open reading frame (ORF), coding DNA sequence (CDS)\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eAvailability of data and material\u003c/h2\u003e\n\u003cp\u003eThe data for this study have been deposited in the European Nucleotide Archive (ENA) at EMBL-EBI under accession number PRJEB51821 (https://www.ebi.ac.uk/ena/browser/view/PRJEB51821). The data can be also directly downloaded using https://zenodo.org/record/6463240 (DOI: 10.5281/zenodo.6463240)\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors have no competing interests to declare.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis study was supported by grants from the Academy of Finland to PA (311717, 307856, and 323576).\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026apos; contributions\u003c/h2\u003e\n\u003cp\u003ePA conceived and designed the study. AY performed Cappable-seq and direct RNA-seq preparations. LP organized NGS assays. ICD performed the bioinformatics analyses. LGG was involved in the preparation of the samples. PA and ICD drafted the manuscript. LGG and CUR performed a critical review of the manuscript. All authors have read, commented on, and approved the final manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eWe thank Eeva-Marja Turkki for performing the NGS procedures for this project. We acknowledge the CSC \u0026ndash; IT Center for Science, Finland, for computational resources. Daniela Borda and Anca Ioana Nicolau are thanked for useful comments, and the University of Helsinki Language Services for English language revision.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBondi M, Messi P, Halami PM, Papadopoulou C, de Niederhausern S. Emerging microbial concerns in food safety and new control measures. BioMed Res Int. 2014;2014:251512.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePigłowski M. Food hazards on the European Union market: The data analysis of the Rapid Alert System for Food and Feed. Food Sci Nutr. 2020;8:1603\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBucur FI, Grigore-Gurgu L, Crauwels P, Riedel CU, Nicolau AI. Resistance of \u003cem\u003eListeria monocytogenes\u003c/em\u003e to Stress Conditions Encountered in Food and Food Processing Environments. Front Microbiol. 2018;9:2700.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNyarko EB, Donnelly CW. \u003cem\u003eListeria monocytogenes\u003c/em\u003e: Strain Heterogeneity, Methods, and Challenges of Subtyping. J Food Sci. 2015;80:M2868\u0026ndash;2878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurpas M, Wieczorek K, Osek J. Ready-to-eat Meat Products As a Source of \u003cem\u003eListeria Monocytogenes\u003c/em\u003e. J Vet Res. 2018;62:49\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuchanan RL, Gorris LGM, Hayman MM, Jackson TC, Whiting RC. A review of \u003cem\u003eListeria monocytogenes\u003c/em\u003e: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control. 2017;75:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan YC, Wiedmann M. Physiology and genetics of \u003cem\u003eListeria monocytogenes\u003c/em\u003e survival and growth at cold temperatures. Crit Rev Food Sci Nutr. 2009;49:237\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamamoto K. Food processing by high hydrostatic pressure. Biosci Biotechnol Biochem. 2017;81:672\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikparvar B, Subires A, Capellas M, Hernandez-Herrero M, Crauwels P, Riedel CU, et al. A Diffusion Model to Quantify Membrane Repair Process in \u003cem\u003eListeria monocytogenes\u003c/em\u003e Exposed to High Pressure Processing Based on Fluorescence Microscopy Data. Front Microbiol. 2021;12:598739.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikparvar B, Andreevskaya M, Duru IC, Bucur FI, Grigore-Gurgu L, Borda D, et al. Analysis of temporal gene regulation of \u003cem\u003eListeria monocytogenes\u003c/em\u003e revealed distinct regulatory response modes after exposure to high pressure processing. BMC Genomics. 2021;22:266.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuru IC, Bucur FI, Andreevskaya M, Ylinen A, Crauwels P, Grigore-Gurgu L, et al. The complete genome sequence of \u003cem\u003eListeria monocytogenes\u003c/em\u003e strain S2542 and expression of selected genes under high-pressure processing. BMC Res Notes. 2021;14:137.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuru IC, Andreevskaya M, Laine P, Rode TM, Ylinen A, L\u0026oslash;vdal T, et al. Genomic characterization of the most barotolerant \u003cem\u003eListeria monocytogenes\u003c/em\u003e RO15 strain compared to reference strains used to evaluate food high pressure processing. BMC Genomics. 2020;21:455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuru IC, Bucur FI, Andreevskaya M, Nikparvar B, Ylinen A, Grigore-Gurgu L, et al. High-pressure processing-induced transcriptome response during recovery of \u003cem\u003eListeria monocytogenes\u003c/em\u003e. BMC Genomics. 2021;22:117.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma CM, Vogel J. Differential RNA-seq: the approach behind and the biological insight gained. Curr Opin Microbiol. 2014;19:97\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEttwiller L, Buswell J, Yigit E, Schildkraut I. A novel enrichment strategy reveals unprecedented number of novel transcription start sites at single base resolution in a model prokaryote and the gut microbiome. BMC Genomics. 2016;17:199.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyan D, Jenniches L, Reichardt S, Barquist L, Westermann AJ. A high-resolution transcriptome map identifies small RNA regulation of metabolism in the gut microbe \u003cem\u003eBacteroides thetaiotaomicron\u003c/em\u003e. Nat Commun. 2020;11:3557.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, et al. An RNA-centric global view of \u003cem\u003eClostridioides difficile\u003c/em\u003e reveals broad activity of Hfq in a clinically important gram-positive bacterium. Proc Natl Acad Sci U S A. 2021;118:e2103579118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBischler T, Tan HS, Nieselt K, Sharma CM. Differential RNA-seq (dRNA-seq) for annotation of transcriptional start sites and small RNAs in \u003cem\u003eHelicobacter pylori\u003c/em\u003e. Methods San Diego Calif. 2015;86:89\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWurtzel O, Sesto N, Mellin JR, Karunker I, Edelheit S, B\u0026eacute;cavin C, et al. Comparative transcriptomics of pathogenic and non-pathogenic \u003cem\u003eListeria\u003c/em\u003e species. Mol Syst Biol. 2012;8:583.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSass AM, Van Acker H, F\u0026ouml;rstner KU, Van Nieuwerburgh F, Deforce D, Vogel J et al. Genome-wide transcription start site profiling in biofilm-grown \u003cem\u003eBurkholderia cenocepacia\u003c/em\u003e J2315. BMC Genomics. 2015;16:775.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnoop V. When you can\u0026rsquo;t trust the DNA: RNA editing changes transcript sequences. Cell Mol Life Sci CMLS. 2011;68:567\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBar-Yaacov D, Mordret E, Towers R, Biniashvili T, Soyris C, Schwartz S, et al. RNA editing in bacteria recodes multiple proteins and regulates an evolutionarily conserved toxin-antitoxin system. Genome Res. 2017;27:1696\u0026ndash;703.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNie W, Wang S, He R, Xu Q, Wang P, Wu Y, et al. A-to-I RNA editing in bacteria increases pathogenicity and tolerance to oxidative stress. PLoS Pathog. 2020;16:e1008740.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndreevskaya M, Johansson P, J\u0026auml;\u0026auml;skel\u0026auml;inen E, R\u0026auml;m\u0026ouml; T, Ritari J, Paulin L, et al. \u003cem\u003eLactobacillus oligofermentans\u003c/em\u003e glucose, ribose and xylose transcriptomes show higher similarity between glucose and xylose catabolism-induced responses in the early exponential growth phase. BMC Genomics. 2016;17:539.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuru IC, Ylinen A, Belanov S, Pulido AA, Paulin L, Auvinen P. Transcriptomic time-series analysis of cold- and heat-shock response in psychrotrophic lactic acid bacteria. BMC Genomics. 2021;22:28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeger A, Amaral PP, Pandolfini L, Capitanchik C, Capraro F, Miano V, et al. RNA modifications detection by comparative Nanopore direct RNA sequencing. Nat Commun. 2021;12:7198.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFleming AM, Bommisetti P, Xiao S, Bandarian V, Burrows CJ. Direct Nanopore Sequencing for the 17 RNA Modification Types in 36 Locations in the \u003cem\u003eE. coli\u003c/em\u003e Ribosome Enables Monitoring of Stress-Dependent Changes. ACS Chem Biol. 2023;18:2211\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF\u0026ouml;rstner KU, Vogel J, Sharma CM. READemption-a tool for the computational analysis of deep-sequencing-based transcriptome data. Bioinforma Oxf Engl. 2014;30:3421\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann S, Otto C, Kurtz S, Sharma CM, Khaitovich P, Vogel J, et al. Fast mapping of short sequences with mismatches, insertions and deletions using index structures. PLoS Comput Biol. 2009;5:e1000502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu S-H, Vogel J, F\u0026ouml;rstner KU. ANNOgesic: a Swiss army knife for the RNA-seq based annotation of bacterial/archaeal genomes. GigaScience. 2018;7:giy096.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDugar G, Herbig A, F\u0026ouml;rstner KU, Heidrich N, Reinhardt R, Nieselt K, et al. High-resolution transcriptome maps reveal strain-specific regulatory features of multiple \u003cem\u003eCampylobacter jejuni\u003c/em\u003e isolates. PLoS Genet. 2013;9:e1003495.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinforma Oxf Engl. 2014;30:923\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris RS. Improved pairwise alignment of genomic DNA. PhD Thesis. Pennsylvania State University; 2007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution\u0026rsquo;s cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003;100:11484\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Sun Z, Wang J, Huang H, Kocher J-P, Wang L. CrossMap: a versatile tool for coordinate conversion between genome assemblies. Bioinformatics. 2014;30:1006\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics. 2011;27:2987\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWangsanuwat C, Heom KA, Liu E, O\u0026rsquo;Malley MA, Dey SS. Efficient and cost-effective bacterial mRNA sequencing from low input samples through ribosomal RNA depletion. BMC Genomics. 2020;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePryszcz LP, Novoa EM. ModPhred: an integrative toolkit for the analysis and storage of nanopore sequencing DNA and RNA modification data. Bioinforma Oxf Engl. 2021;38:257\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruciani S, Delgado-Tejedor A, Pryszcz LP, Medina R, Llovera L, Novoa EM. De novo basecalling of m6A modifications at single molecule and single nucleotide resolution. 2023;:2023.11.13.566801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCondition-Specific Mapping of Operons. (COSMO) using dynamic and static genome data | bioRxiv. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.biorxiv.org/content/\u003c/span\u003e\u003cspan address=\"https://www.biorxiv.org/content/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2022.06.14.496048v1.full\u003c/span\u003e\u003cspan address=\"10.1101/2022.06.14.496048v1.full\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 14 Feb 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZehentner B, Scherer S, Neuhaus K. Non-canonical transcriptional start sites in \u003cem\u003eE. coli\u003c/em\u003e O157:H7 EDL933 are regulated and appear in surprisingly high numbers. BMC Microbiol. 2023;23:243.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao W, Price MN, Deutschbauer AM, Romine MF, Arkin AP. Conservation of Transcription Start Sites within Genes across a Bacterial Genus. mBio. 2014;5:e01398\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomason MK, Bischler T, Eisenbart SK, F\u0026ouml;rstner KU, Zhang A, Herbig A, et al. Global Transcriptional Start Site Mapping Using Differential RNA Sequencing Reveals Novel Antisense RNAs in \u003cem\u003eEscherichia coli\u003c/em\u003e. J Bacteriol. 2015;197:18\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKornienko M, Bespiatykh D, Gorodnichev R, Abdraimova N, Shitikov E. Transcriptional Landscapes of \u003cem\u003eHerelleviridae\u003c/em\u003e Bacteriophages and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e during Phage Infection: An Overview. Viruses. 2023;15:1427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerutti F, Mallet L, Painset A, Hoede C, Moisan A, B\u0026eacute;cavin C, et al. Unraveling the evolution and coevolution of small regulatory RNAs and coding genes in Listeria. BMC Genomics. 2017;18:882.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLejars M, Hajnsdorf E. The world of asRNAs in Gram-negative and Gram-positive bacteria. Biochim Biophys Acta Gene Regul Mech. 2020;1863:194489.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim D, Hong JS-J, Qiu Y, Nagarajan H, Seo J-H, Cho B-K, et al. Comparative analysis of regulatory elements between \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e by genome-wide transcription start site profiling. PLoS Genet. 2012;8:e1002867.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVoigt K, Sharma CM, Mitschke J, Lambrecht SJ, Vo\u0026szlig; B, Hess WR, et al. Comparative transcriptomics of two environmentally relevant \u003cem\u003ecyanobacteria\u003c/em\u003e reveals unexpected transcriptome diversity. ISME J. 2014;8:2056\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMitschke J, Georg J, Scholz I, Sharma CM, Dienst D, Bantscheff J, et al. An experimentally anchored map of transcriptional start sites in the model \u003cem\u003ecyanobacterium Synechocystis\u003c/em\u003e sp. PCC6803. Proc Natl Acad Sci U S A. 2011;108:2124\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGourse RL, Ross W, Gaal T. UPs and downs in bacterial transcription initiation: the role of the alpha subunit of RNA polymerase in promoter recognition. Mol Microbiol. 2000;37:687\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDjordjevic M. Redefining \u003cem\u003eEscherichia coli\u003c/em\u003e σ(70) promoter elements: -15 motif as a complement of the \u0026ndash;\u0026thinsp;10 motif. J Bacteriol. 2011;193:6305\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, Balestrino D, et al. The \u003cem\u003eListeria\u003c/em\u003e transcriptional landscape from saprophytism to virulence. Nature. 2009;459:950\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaris PEJ, Palva ET. The ptsL, pel/ptsM (manXYZ) locus consists of three genes involved in mannose uptake in \u003cem\u003eEscherichia coli\u003c/em\u003e K12. FEMS Microbiol Lett. 1987;44:371\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKline BC, McKay SL, Tang WW, Portnoy DA. The \u003cem\u003eListeria monocytogenes\u003c/em\u003e hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis. J Bacteriol. 2015;197:581\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng X, Chen K, Luo G-Z, Weng X, Ji Q, Zhou T, et al. Widespread occurrence of N6-methyladenosine in bacterial mRNA. Nucleic Acids Res. 2015;43:6557\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"RNA editing, transcription start site, high pressure processing, pathogen, direct RNA sequencing, long sequencing reads, operon","lastPublishedDoi":"10.21203/rs.3.rs-3996292/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3996292/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eListeria monocytogenes\u003c/em\u003e is a foodborne pathogen that can survive various stresses. To inactivate \u003cem\u003eListeria monocytogenes\u003c/em\u003e, food processing facilities use high energy methods, such as high-pressure processing (HPP). In this study, we explored the transcriptional units of barotolerant \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 using Cappable-seq and direct RNA sequencing, two novel techniques.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe detected 1641 transcription start sites (TSSs) in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15, including six HPP-specific TSSs, showing that HPP influences the TSS selection. In addition, we predicted small RNAs (sRNAs) candidates and examined promoter motifs, which revealed new regulatory elements that control gene expression. By integrating short and long RNA-seq reads, we predicted the operon structure of \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 and found 658 operons, comprising 71% of all the genes. The largest operons were mainly located in prophage regions. Moreover, we identified A-to-I RNA editing events in \u003cem\u003eL. monocytogenes\u003c/em\u003e for the first time. HPP treatment statistically significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased the A-to-I editing of several genes including \u003cem\u003ehpf\u003c/em\u003e and \u003cem\u003emdxE\u003c/em\u003e suggesting a role in the stress response. We predicted m6A RNA modifications in \u003cem\u003eL. monocytogenes\u003c/em\u003e RO15 using direct RNA sequencing reads. This is the first report of m6A RNA modifications in \u003cem\u003eL. monocytogenes\u003c/em\u003e by using direct RNA sequencing.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study provides novel insights into the transcriptome complexity and diversity, stress response strategies, and post-transcriptional modifications of \u003cem\u003eL. monocytogenes\u003c/em\u003e. Our results uncover the genomic mechanisms of adaptation of \u003cem\u003eL. monocytogenes\u003c/em\u003e to HPP and indicate potential targets for developing new strategies to control this pathogen. However, further studies are needed to validate the functional roles of the identified sRNAs, RNA editing events, and RNA modifications in \u003cem\u003eL. monocytogenes\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Cappable-Seq and Direct RNA Sequencing Reveals Novel insights into the Transcriptome of Listeria monocytogenes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-12 14:51:14","doi":"10.21203/rs.3.rs-3996292/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11576f0a-3355-4caa-98df-7f063dcdb281","owner":[],"postedDate":"March 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-09T09:47:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-12 14:51:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3996292","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3996292","identity":"rs-3996292","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}