“Enkephalinergic Neurons Gate Sex-Specific Control of Voluntary Micturition”

“Enkephalinergic Neurons in Barrington’s Nucleus Gate Sex-Biased Control of Micturition” | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results “Enkephalinergic Neurons in Barrington’s Nucleus Gate Sex-Biased Control of Micturition” View ORCID Profile Nataliya Klymko , Andrea M. Sartori , Mihoko Leon , Cassandra N. Seifert , Richard Lee , John C. Mathai , Anne M.J. Verstegen doi: https://doi.org/10.1101/2025.05.16.654570 Nataliya Klymko 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nataliya Klymko Andrea M. Sartori 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mihoko Leon 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Cassandra N. Seifert 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA 2 University of Maryland School of Medicine , Baltimore, MD 21201, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Richard Lee 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site John C. Mathai 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anne M.J. Verstegen 1 Division of Nephrology, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School , Boston, MA 02215, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: aversteg{at}bidmc.harvard.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary Lower urinary tract (LUT) control is a vital physiological function governed by a complex interplay between neural circuits and muscle activity. This regulation depends on brainstem circuits, with Barrington’s nucleus (Bar) acting as a central hub. Here, we construct a transcriptional atlas of Bar, uncovering its neuronal diversity and extensively characterize a distinct excitatory population expressing proenkephalin (Bar Penk ). Using in vivo calcium imaging and optogenetics, we demonstrate that Bar Penk neurons selectively activate during voiding and specifically facilitate external urethral sphincter (EUS) relaxation. Chemogenetic activation of these neurons elicits an aberrant micturition phenotype in male but not female mice, whereas conditional ablation impairs voluntary scent-marking behavior. Moreover, anatomical tracing reveals that Bar Penk neurons project to spinal regions critical for LUT control and receive convergent input from areas involved in visceromotor regulation and behavioral state processing. These findings position Bar Penk as a specialized brainstem population that integrates internal states and environmental cues to orchestrate context-dependent urinary behaviors in a sex-specific manner. Introduction Few bodily functions are as tightly choreographed by brain-body interplay as urination which depends on continuous communication between the lower urinary tract (LUT) and the brain [ 1 ]. Barrington’s nucleus (Bar), situated in the pontine tegmentum, provides innervation to several visceral organs, including the bladder, urethra, urethral sphincters, colon, and reproductive organs [ 2 – 5 ]. The LUT relies on neural input from Bar to coordinate the muscles that control bladder function, which enables the socially appropriate and safe elimination of urine [ 6 , 7 ]. When Bar is bilaterally lesioned, cats and rodents retain urine indefinitely [ 8 , 9 ]. In humans, the LUT’s reliance on supraspinal control is evident from its vulnerability to neurogenic injuries, including stroke, neurodegenerative disorders, spinal cord injury, and aging [ 10 – 14 ]. However, despite the high prevalence and quality-of-life impact of LUT disorders, the neural control of LUT function remains underexplored. On the ascending limb of the micturition reflex pathway, sensory information from bladder afferents is relayed via spinal interneurons in the lumbosacral cord to the midbrain periaqueductal gray (PAG), where it is further integrated. PAG neurons, in turn, project directly to Bar [ 15 , 16 ]. In the descending pathway, Bar neurons send projections to spinal preganglionic motor neurons, which ultimately innervate the bladder, and interneurons that control somatic external urethral sphincter (EUS) motor neurons [ 17 – 21 ]. Upon the transition from storage to voiding, activation of Bar neurons drives detrusor contraction while simultaneously relaxing the urethral sphincters, facilitating urine release [ 19 , 20 ]. The micturition reflex is under voluntary control, allowing humans and rodents, among other animals, to regulate the timing of urination based on context. This voluntary regulation is further exemplified by rodents’ use of urine marking for social communication [ 22 – 25 ]. Bar is predominantly glutamatergic [ 26 ]. Bar Vglut2 neurons drive micturition, and their loss leads to severe urinary retention [ 27 ]. Neurons expressing corticotropin-releasing hormone ( Crh ) have long served as a proxy for Bar neurons overall [ 26 , 28 , 29 ], and their activation can induce both voiding and non-voiding bladder contractions depending on the phase of the micturition cycle [ 24 , 25 , 27 , 30 ]. Estrogen receptor alpha ( Esr1 ) is also abundantly expressed in Bar [ 31 ]; optogenetic stimulation of Bar Esr1 neurons triggers EUS bursting and promotes urination, whereas their inhibition prevents EUS relaxation and interrupts ongoing voiding [ 25 ]. Recently, it was shown that distinct subpopulations of Bar Esr1 exist, with respective projections via the pelvic nerve to control bladder-urethra activity and via the pudendal nerve to regulate EUS function [ 32 ]. Despite decades of research, the neuronal composition of Bar remains elusive, limiting our understanding of the functional roles of specific groups within this key brainstem nucleus for LUT control. Here, we characterize a distinct population of glutamatergic Bar neurons marked by proenkephalin (Penk, Bar Penk ) expression. These neurons exhibit a sexually dimorphic influence on urinary behaviors, selectively promote EUS relaxation, and are essential for voluntary scent-marking in male mice. Our findings establish Bar Penk neurons as a specialized functional entity within Bar, providing new insights into the neural mechanisms underlying both reflexive and voluntary micturition. Results Resolving neuronal diversity in Barrington’s nucleus through single-nucleus transcriptional profiling Despite its critical role in LUT regulation, a comprehensive molecular atlas of Bar is lacking. Recent transcriptomic efforts, such as the atlas of the murine pontine tegmentum by Nardone et al. (2024) [ 33 ], include Bar within the broader brainstem region. However, they do not resolve its cellular heterogeneity, likely due to the nucleus small size relative to the large area captured. To identify the neuronal populations within Bar potentially involved in LUT control, we analyzed a Bar-enriched subset of the published single-nucleus RNA sequencing (snRNA-seq) dataset (GEO GSE226809 ) [ 33 ]. After pre-processing and quality controls, we performed preliminary clustering, removed clusters containing low-quality cells or doublets, and obtained a final dataset comprising 60,135 nuclei. Our analysis identified 39 clusters representing nine major cell types based on the expression of known marker genes ( Fig. 1a ). These included: ependymal cells ( Cfap43, Dnah12, Ccdc153 ), fibroblasts ( Dcn, Cped1, Col3a1 ), microglia ( Ctss, P2ry12, Csf1r ), endothelial cells ( Flt1, Slco1c1, Ly6c1 ), astrocytes ( Ntsr2, Slco1c1, Ly6c1 ), oligodendrocyte precursor cells (OPCs, Pdgfra, Cspg4, Tnr ), oligodendrocyte progenitors (Oligo Prog, Ust, Enpp6, Mag ), oligodendrocytes ( Mag, Plp1, Mog ), and neurons ( Snap25, Map2, Syt1 ) ( Fig. 1b ). Download figure Open in new tab Figure 1. Resolving neuronal diversity in Barrington’s nucleus through single-nucleus transcriptional profiling. a . t-SNE plot of 60,135 nuclei from the Bar region. Each of the 39 clusters represents a distinct population of cells based on transcriptional profiles, grouped into 9 major cell types. b. Dot plot of canonical marker genes for major cell types. c. t-SNE plot displaying sub-clustering of glutamatergic neurons from ( a ), comprising 13,076 nuclei. d. Dot plot showing the top three most unique and/or highly expressed marker genes for each glutamatergic cluster. In ( b , d ), the color intensity represents average gene expression per cluster; the dot diameter reflects the percentage of nuclei expressing the gene. Abbreviations: LC, locus coeruleus; LDT, laterodorsal tegmental nucleus; Me5, mesencephalic nucleus of the trigeminal nerve; Oligo Prog, Oligodendrocyte progenitors; OPCs, oligodendrocyte precursor cells; sn-RNA-seq, single-nucleus RNA sequencing. See also ED Fig. 1 and Supp. Table S1 . The 27 neuronal clusters were further classified into eight subgroups based on gene expression profiles and anatomical location: GABAergic ( Vgat; Slc32a1) ; glutamatergic neurons ( Vglut2; Slc17a6 ); mixed clusters (containing both Vgat+ and Vglut2+ cells); cerebellar neurons ( Gabra6, Neurod1, Cnpy1) ; laterodorsal tegmentum cholinergic neurons ( Slc5a7, Chat, Nos1 ); a serotonergic population likely originating from the raphe nuclei rostral to Bar ( Slc6a4, Tph2, Slc18a2 ); catecholaminergic neurons, associated with the locus coeruleus (LC; Slc18a2, Th, Dbh ); and Me5 neurons, characterized by expression of Prph, Piezo2 , and Anxa2 ( Fig. 1b ). Identification of glutamatergic neuronal subtypes in Bar To reveal the excitatory neuronal subpopulations of Bar that may contribute to LUT control, we reclustered neurons from clusters in which ≥10% of cells expressed the glutamatergic marker Slc17a6 ( Vglut2 ). We excluded non-neuronal cells, GABAergic clusters, and populations identified by markers of neighboring structures, including LC, cerebellar, cholinergic, and Me5 neurons. Mixed clusters co-expressing Vgat and Vglut2 were retained to capture potential hybrid populations. Clustering of the resulting dataset (13,076 nuclei) yielded 22 distinct neuronal subgroups ( Fig. 1c, d ; Extended data (ED) Fig. 1a, b ). The neuronal populations were then mapped to their spatial location using RNAscope in situ hybridization (ISH), and gene expression patterns were cross-referenced with the Allen Mouse Brain Atlas [ 34 ] to identify genes that could be used for targeting the different neuron groups ( Supp. Table 1 ). This approach revealed six glutamatergic neuronal populations residing in or near Bar: “3_Prlr-Otof”, “6_Tac1-Slc17a8”, “9_Crh-Reln”, “10_Penk-Chst9”, “12_Fgf10-Calcr”, and “13_Foxp2-Nps”. While the analysis identified the well-characterized Crh -expressing population in Bar [ 27 , 30 , 33 ], it did not detect a distinct Esr1 -expressing cluster; rather, Esr1 was detected across multiple Bar clusters, with highest expression detected in cluster “9_Crh-Reln” ( ED Fig. 1c ). In contrast to previous reports, we observed high levels of Esr1 expression in and around Bar, with substantial overlap between Crh and Esr1 -positive neurons ( ED Fig. 1d, e ; 88%, n = 3 ). Extensive labeling in the Esr1-Cre mouse line following injection of a Cre-dependent AAV into Bar ( ED Fig. 1f ; n = 2) further confirmed abundant Esr1 expression in the region. Spinally projecting neuronal populations in Barrington’s nucleus Identification of the neuronal populations within and immediately adjacent to Bar lays the groundwork for investigating their potential roles in LUT regulation. To this end, we traced descending projections from each population to spinal regions critical for bladder and EUS control, specifically, the intermediolateral cell column (IML) and dorsal gray commissure (DGC) in the lumbosacral spinal cord, where motor neurons and interneurons innervating the LUT are located [ 3 , 4 ] ( Fig. 2a, b ). First, we confirmed that glutamatergic, but not GABAergic, neurons in Bar send descending projections to the spinal cord. Robust axonal labeling from Vglut2+ pan-Bar neurons was observed in the L6-S3 spinal segments ( ED Fig. 2c ), whereas no axons from Vgat+ neurons were detected in the lumbosacral spinal cord ( ED Fig. 2d ). Thus, glutamatergic Bar neurons provide the primary descending input to spinal circuits controlling LUT function, while adjacent inhibitory populations [ 33 ] do not contribute direct projections. Download figure Open in new tab Figure 2. Spinally projecting neuronal populations of Bar and their role in micturition control. a . Schematic of Bar region showing spinally projecting glutamatergic populations based on marker gene expression. b. Illustration of the spinal cord displaying a transverse section (black line) through DGC and IML at the lumbosacral level. c-f. DIO-mCherry labeling (red) in Bar of Cre-driver mice, representing neuronal populations (left); neuronal cell bodies are counterstained with Nissl (teal blue). Corresponding axonal projections to lumbosacral levels of the spinal cord (right); cholinergic neurons stained for ChAT (green) and nuclei for DAPI (blue). Ipsilateral (ipsi) and contralateral (contra) projections are indicated; dashed line marks L6/S1 spinal cord level. g . Schematic of bilateral DIO-hM3Dq injections into Bar. h. Micturition Video Thermography (MVT) examples, with thresholded images of void spots displayed on the right. i. Averaged micturition frequency for Bar Penk ( n = 6, *p = 0.031 ), Bar Tac1 ( n = 8, p = 0.22 ), and Bar Fgf10 ( n = 5, p = 0.38 ) from 2h MVT trials with saline or hM3Dq agonist; mean ± SEM, Wilcoxon matched-pairs signed rank test across all panels . Scale bars : 200 μm. Abbreviations : 4V, 4th ventricle; Bar, Barrington’s nucleus; ChAT, choline acetyltransferase; DGC, dorsal gray commissure; IML, intermediolateral column; LC, locus coeruleus; preLC, pre-locus coeruleus. See also ED Fig. 2 , Supp.Table 5 . Using the Crh marker to target the ‘ Crh-Reln ’ population, we found Crh -expressing neurons to be distributed throughout the entire rostral-caudal extent of Bar. Axons from Bar Crh neurons descend ipsilaterally, heavily innervating the ipsilateral sacral IML; there, the fibers cross over to the DGC and extend to the contralateral IML at spinal segments L6, S1, and S2. ( Fig. 2c ). We then utilized the Penk-IRES2-Cre and Tac1-IRES2-Cre mouse lines to target cells of the ‘ Penk-Chst9’ and ‘Tac1-Slc17a8’ populations ( Fig. 2d, e ). Penk+ neurons were predominantly localized in the dorsomedial aspect of Bar, with additional presence along the ventromedial border of the Nissl-defined oval Bar nucleus ( Fig. 2a ). Descending projections from the Bar Penk neurons were concentrated at spinal levels L6-S2, where they reached segments with ChAT+ bladder motor neurons in the ipsilateral and contralateral IML and DGC ( Fig. 2d ). Tac1 + reporter-labeled neurons were located in the ventral portion of Bar and along its ventromedial border ( Fig. 2a ). Projections from these neurons were also observed, but appeared more diffuse and less anatomically confined, with axons extending rostrally and caudally, reaching as far as S3/S4 spinal segments ( Fig. 2e ). To target the ‘ Fgf10-Calcr ’ population, we used the Fgf10-IRES-Cre mouse line ( ED Fig. 2a ). Fgf10 + neurons were distributed in the dorsal aspect of Bar and in the pre-LC ( Fig. 2a ) [ 35 ]. Sparse axonal projections reached the sacral IML, likely reflecting the limited number of Fgf10 + cells within the core of Bar ( Fig. 2f ). Finally, Foxp2+ neurons, corresponding to the ‘Foxp2-Nps’ population, were labeled dorsolateral to Bar in the pre-LC [ 26 , 36 – 38 ], and at the caudal extent of Bar. These Foxp2 + neurons did not project to the lumbosacral spinal cord, suggesting they do not exert direct control over the LUT motor neurons ( ED Fig. 2e ). While we confirmed using the Prlr-P2A-Cre mouse line that Prlr -expressing neurons project to the spinal cord ( ED Fig. 2b, f ), further analysis of GFP expression in Prlr-P2A-Cre::L10-GFP mice revealed a large number of labeled neurons distributed throughout the pontine tegmentum ( ED Fig. 2h ). This coincides with the high number of Cre-expressing neurons observed following DIO-mCherry injections in this transgenic line ( ED Fig. 2f ). Additionally, we found a high degree of colocalization of Crh and Penk mRNA expression with Prlr-GFP neurons in Bar ( ED Fig. 2i ). These results suggest that expression of Prlr is not exclusive to a single cell type or confined to the Bar nucleus, but rather that prolactin receptors are present across multiple subpopulations, with varying levels of expression. Consistent with Esr1 marking a broad Bar population, Esr1-Cre mice showed robust reporter labeling in Bar and dense axonal projections to both the IML and DGC, comparable to that observed in Vglut2-IRES-Cre mice ( ED Fig. 2c, g ). Functional screening of Bar populations for their role in micturition behavior To evaluate the role of spinally projecting Bar subpopulations in LUT control, we selectively activated different neuronal populations using excitatory DREADDs (Designer Receptors Exclusively Activated by Designer Drugs; hM3Dq), delivered bilaterally into Bar of the respective Cre-driver mice ( Fig. 2g, h ). The Bar Crh population was not included, as we previously showed its activation with DREADDs to markedly increase voiding frequency (from 2.3 to 8.8 voids; n = 6) [ 27 ]. Activation of Bar Penk neurons resulted in aberrant voiding behavior, with a striking increase in the number of void spots ( Fig. 2i , left panel). No significant changes in voiding frequency were observed when Bar Tac1 and Bar Fgf10 populations were chemogenetically stimulated ( Fig. 2i , middle and right panels). Lastly, stimulation of Prlr+ neurons in Bar produced a strong increase in micturition frequency, as would be expected when targeting multiple functional populations in Bar ( ED Fig. 2j ). Penk expression marks a novel neuronal population in Bar Given the distinct behavioral effects observed with Bar Penk activation, we sought to further characterize this neuronal population. First, we examined their anatomical organization relative to the more extensively studied Bar Crh neurons ( Fig. 3a, b ). Along the anterior-posterior axis of Bar, Crh+ neurons are distributed uniformly across the entire extent of the nucleus (Bregma –5.35 to –5.65 mm). In contrast, Penk+ cells form a distinct cluster in the dorsomedial portion of the Nissl-defined Bar nucleus and are more concentrated at central and caudal levels, with peak density observed around Bregma –5.55 ( Fig. 3c ). To further delineate their molecular identity, we evaluated the overlap of the Penk -expressing neurons with known Bar markers using RNAscope ISH and immunohistochemistry ( Fig. 3d ). Virtually all Bar Penk neurons expressed Vglut2 mRNA (95%, n = 6), confirming their excitatory nature, while only a small subset (5%) co-expressed Crh mRNA (n = 6). Immunohistochemistry revealed that just over half of Bar Penk neurons were positive for Esr1, another marker for glutamatergic Bar neurons, with no significant difference between males and females ( ED Fig. 3a, b ; 57%, n = 4 males, 3 females). Overall, Penk+ neurons comprise one-fifth of the total Bar population, while Crh+ neurons account for 40%, and other populations (negative for both markers) make up the remaining 38%. Remarkably, only 1% of the total Bar neuronal pool expressed both Penk and Crh ( Fig. 3e ). Esr1 + neurons comprised 75% of the overall Bar population and showed substantial overlap with both Penk and Crh ( ED Fig. 3c-e ), consistent with Esr1 being broadly expressed in Bar ( ED Fig. 1d-f , ED Fig. 2g ). Download figure Open in new tab Figure 3. Penk expression marks a novel neuronal population in Bar. a-b . Anatomical distribution of Penk+ (blue) and Crh + (yellow) neurons across Bregma levels in Bar; neuronal cell bodies are counterstained with Nissl (gray). c. Quantification of Bar Penk , Bar Crh and other (unlabeled) Bar neurons across four Bregma levels. d. Overlap of Bar Penk neurons with known Bar markers: Vglut2 ( 95 ± 0.8%, n = 6 ), Esr1 ( 57 ± 3.4%, n = 7 ), and Crh ( 5 ± 0.7%, n = 6 ). e. Proportion of Penk+ and Crh+ neurons in Bar. Scale bars : 200 μm. Abbreviations : Bar, Barrington’s nucleus; LC, locus coeruleus. See also ED Fig. 3 . To further characterize Bar Penk axonal innervation of the lumbosacral spinal cord, we compared the distribution of synaptic boutons from Bar Penk and Bar Crh neurons at L6-S2 spinal levels. Although both populations projected to the DGC and IML ( Fig. 2c, d ), their relative patterns of innervation diverged. At L6, where the IML starts to emerge, the DGC vs. IML distribution of synapses was similar between the two populations. However, at S1 and S2, the patterns differed significantly, with Bar Penk boutons enriched in the DGC and Bar Crh boutons showing greater enrichment in the IML ( ED Fig. 3f-j ). Thus, despite overlapping spinal targets, the two populations exhibit distinct subregional distributions of synaptic input. Penk neurons in Bar activate specifically during voiding To determine whether the physiological, in vivo activity of Bar Penk neurons correlates with specific phases of the bladder fill-void cycle, we simultaneously monitored neural activity and bladder pressure using fiber photometry and cystometry in awake, freely behaving mice ( Fig. 4a-c ). Bar Penk neurons consistently activated around the time of void onset and remained active for the duration of the void ( Fig. 4d-f ). Notably, increases in neural activity did not precede rises in intravesical pressure; these findings suggest that Bar Penk neuron activity is closely correlated with voiding, potentially coordinating EUS relaxation rather than detrusor contractions. Small transient changes in GCaMP fluorescence also accompanied pressure changes during non-voiding contractions, but activity was attenuated compared to that observed during voids ( ED Fig. 4a, b ). Download figure Open in new tab Figure 4. Bar Penk neurons selectively activate during voiding. a . Experimental setup combining fiber photometry and cystometry (CMG) to record neural activity and bladder pressure simultaneously. b. Schematic showing unilateral injection of DIO-GCaMP6s targeting Bar with optic fiber placement above. c. DIO-GCaMP6s expression in Bar of a Penk-IRES-Cre mouse, with the fiber positioned above. d. Heatmap of GCaMP6s signal ( ΔF/F 0 , converted to Z-score) before, during, and after individual voiding events. e. Average GCaMP6s signal ( ΔF/F 0 ) during voiding vs. at random times ( mean ± SEM , n = 40 events from 4 mice, equally weighted; ****p < 0.0001, Mann-Whitney test). f. Averaged CMG trace (orange) and GCaMP6s signal (blue, ΔF/F 0 ) across 86 voiding events from 4 mice (solid lines represent the mean, shaded areas – SEM). g. Experimental approach for retrograde targeting and fiber photometry of spinally projecting Bar Penk neurons: lumbosacral spinal injection of AAVretro-FLEX-GCaMP8s in Penk-IRES-Cre mice, followed by optic fiber implantation over Bar. h. GCaMP8s expression in retrogradely labeled Bar Penk neurons and fiber placement above. i. Averaged photometry trace ( z-scored ΔF/F 0 ; mean ± SEM; n = 37 events from 6 mice ) from spinally projecting Bar Penk neurons recorded during MVT, aligned to void onset (t = 0, first thermal frame where urine spot appears). j. Mean z-scored ΔF/F 0 during voiding vs. pre-void baseline ( mean ± SEM; n = 37 events from 6 mice; ****p < 0.0001, Mann-Whitney test ). k. Relationship between voiding duration and peak-plateau duration of Bar Penk activity (sustained high GCAMP signal; n = 32 events, from 6 mice; Pearson correlation r = 0.86, 95% CI 0.73 – 0.93; R² = 0.74; p < 0.0001; linear regression line shown) . In (d, f, i) dashed line marks approximate void onset. In ( c, h ), neuronal cell bodies are counterstained with Nissl (blue). Scale bars : 200 μm. Abbreviations : 4V, 4 th ventricle; Bar, Barrington’s nucleus; LC, locus coeruleus; MVT, Micturition Video Thermography. See also ED Fig. 4 . Fiber photometry recordings specifically from the spinally-projecting Bar Penk neurons ( Fig. 4g, h ), coupled with video thermography, revealed a similar activity pattern, with robust activation time-locked to the void onset ( Fig. 4i, j ; ED Fig. 4c ). Moreover, the duration of peak-plateau neural activity strongly correlated with void duration, indicating that Bar Penk activity scales with the length of urine release ( Fig. 4k ; ED Fig. 4d ). Activation of Bar Penk neurons results in a sex-dependent behavioral phenotype Having established that Bar Penk neurons project to the lumbosacral spinal cord and are active during voiding, we next asked whether their selective activation alters micturition behavior in male and female mice ( Fig. 5a, b ). In males, chemogenetic stimulation led to increased voiding frequency in some animals, although the average number of regular corner voids did not change ( Fig. 5c ). Urine volume per void was significantly reduced, which could suggest that prolonged Bar Penk activation impairs normal bladder emptying ( Fig. 5d ). Additionally, throughout the session, we observed numerous small urine spots consistent with leaks. These events occurred outside the typical voiding sequence with the spots scattered throughout the behavioral arena, suggestive of an incontinence-like phenotype. ( Fig. 5b, e, i ). In contrast, stimulation of the Bar Penk neurons in female mice produced no significant change in voiding frequency, urine volume per void, or leak occurrence between agonist and saline conditions ( Fig. 5f-h ). Download figure Open in new tab Figure 5. Activation of Bar Penk neurons triggers a sex-dependent behavioral phenotype. a . Bilateral expression of DIO-hM3Dq (magenta) in Bar of a Penk-IRES-Cre mouse. TH-immunoreactive LC neurons are shown in teal blue; nuclei counterstained with DAPI (gray). b. Representative MVT screenshots showing micturition behavior under saline control (top) and after hM3Dq agonist administration (bottom). c-h. Quantification of micturition parameters, including voiding frequency (c, f) , urine volume per void (d, g) , and number of leaks (e, h) after Bar Penk activation. Data are shown for males ( c, d, e; n = 6, p = 0.33, *p = 0.027, *p = 0.017, respectively) and females ( f, g, h; n = 7, p = 0.17, p = 0.67, p > 0.99, respectively ). Off-target effects of hM3Dq agonist were tested in control animals lacking viral expression ( c, d, e; n = 4 males, all p > 0.99 ; f, g, h; n = 6 females, p = 0.97, p > 0.99, p = 0.44, respectively). Mean ± SEM, Kruskal-Wallis, followed by Dunn’s multiple comparisons tests across all panels. i. Raster plot showing voiding behavior during 2h MVT runs under saline control (top) and agonist-treated (bottom) conditions ( n = 6 ; corresponding quantification is shown in c and e ). Each row represents one recording session (two per animal for each condition). Voids are shown as open white triangles and leaks as cyan ticks. j. Experimental approach for selective targeting and chemogenetic activation of spinally projecting Bar Penk neurons: bilateral AAVretro-DIO-FLPo injection into the lumbosacral spinal cord (one side shown) of Penk-IRES-Cre mice, followed 3 weeks later by bilateral injection of AAV8-fDIO-hM3Dq-mCherry into Bar. k. Flp-dependent hM3Dq-mCherry expression in spinally projecting Bar Penk neurons. l. Voiding frequency (left), volume per void (middle), and number of leaks (right) following activation of spinally projecting Bar Penk neurons ( mean ± SEM; n = 7; p = 0.51, *p = 0.035, **p = 0.0012, respectively; Mann–Whitney tests ). Scale bars : 200 μm. Abbreviations : 4V, 4th ventricle; Bar, Barrington’s nucleus; LC, locus coeruleus; MVT, Micturition Video Thermography; TH, tyrosine hydroxylase. See also ED Fig. 5 . To control for potential off-target effects of the DREADDs agonist, we tested whether administration of the agonist in mice lacking viral expression influenced LUT function. No significant differences were observed between agonist-treated naïve animals and saline controls, in either males (n = 4 vs. 6) or females (n = 6 vs. 7) for any of the parameters tested ( Fig. 5c-h ). Selective activation of spinally projecting Bar Penk neurons in males ( Fig. 5j, k ) recapitulated the main effects observed after overall Bar Penk stimulation, reducing urine volume per void and increasing leak occurrence without significantly altering void frequency ( Fig. 5l ), indicating that activating the spinally projecting population is sufficient to produce the incontinence-like phenotype. Bar Penk neurons are essential for voluntary scent-marking behavior To assess whether Penk neurons in Bar are necessary for normal LUT function, we ablated them using diphtheria toxin (dtA) ( Fig. 6a, b ). Conditional ablation of the Bar Penk neurons did not affect voiding frequency or void sizes in either sex ( Fig. 6c-f ; ED Fig. 6a-d ), in contrast to ablation of the entire glutamatergic Bar population, which leads to severe urinary retention with overflow incontinence. Download figure Open in new tab Figure 6. Bar Penk neurons are essential for voluntary scent-marking behavior. a . The viral construct of Cre-dependent diphtheria toxin A (dtA). b. Injection site images showing mCherry expression in Cre-negative cells and absence of dtA-infected Penk-GFP neurons (lime-green) in Bar (experimental, left). In sham controls (right), Penk+ neurons co-express GFP and DIO-mCherry. One side is shown; both groups received bilateral injections. c-f. Average voiding frequency ( c, e ) and urine volume per void ( d, f ) before and after dtA-mediated Bar Penk ablation in males ( c, d; n = 8 vs. n 4; in ( c ), p = 0.34 (POD –1), p = 0.42 (POD21); in ( d ), p = 0.60 (POD – 1), p = 0.60 (POD21)) and females ( e, f ; n = 6 vs. n = 3 ; in ( e ), p = 0.22 (POD –1), p = 0.30 (POD21); in ( f ), p = 0.18 (POD –1), p = 0.26 (POD21)). Mean ± SEM , multiple Mann-Whitney tests with Holm-Šídák correction across all panels. g. Experimental timeline for investigating effects of Bar Penk ablation on scent-marking behavior. h . Natural scent-marking behavior of dominant male mice exposed to female mouse urine cues. i. Raster plot of marking events (gold lines) recorded during two 1h MVT trials at POD 21-25, comparing Bar Penk -ablated experimental animals to sham controls. j, k. Quantification of urine marks ( j ) and latency to the first mark ( k ) at POD 21-25 in experimental vs. control groups ( mean ± SEM , n = 6 vs. n = 7; **p = 0.0047, **p = 0.0058, Mann-Whitney tests ). Abbreviations : 4V, 4th ventricle; Bar, Barrington’s nucleus; dtA, diphtheria toxin A; LC, locus coeruleus; MVT, Micturition Video Thermography; POD, postoperative day; TH, tyrosine hydroxylase. See also ED Fig. 6 . Since Bar Penk neuron activation led to the appearance of scattered urinary spots throughout the cage ( Fig. 5b, e ), and ablation did not disrupt normal voiding, we asked whether these neurons may play a role in voluntary marking behaviors. Scent-marking relies on rapid, inhibitory control over the striated EUS muscle, and male mice engage in prolific scent-marking to attract female mates [ 22 , 23 , 25 ]. To evaluate the role of Bar Penk neurons in scent-marking, we recorded marking behavior before and three weeks after bilateral injection of dtA or mCherry ( Fig. 6g, h ; ED Fig. 6e-g ). Ablation of the Penk -expressing neurons resulted in a significant reduction in the number of urine marks in response to a stimulus (female mouse urine), along with a pronounced delay in the initiation of marking ( Fig. 6i-k ), with the effects observed only following complete bilateral ablation ( ED Fig. 6h ). These findings demonstrate that Bar Penk neurons are essential for this voluntary behavior in male mice. Photostimulation of Bar Penk neurons promotes relaxation of the external urethral sphincter To elucidate whether activation of Bar Penk neurons affects EUS behavior, we performed electromyography (EMG) recordings of the EUS and cystometry (CMG) in awake, freely behaving mice, coupled with optogenetic stimulation ( Fig. 7a, b ). Photostimulation at 20Hz frequency produced a time-locked reduction in EUS activity on EMG compared to pre-stimulation baseline and recovery periods ( Fig. 7c, d ; ED Fig. 7a ), while intravesical pressure remained unchanged ( Fig. 7e ). Notably, 75% of stimulations resulted in EUS relaxation, whereas an increase in bladder pressure was observed in only 6% of trials ( Fig. 7f ). These results suggest that Bar Penk neurons are sufficient to induce sphincter relaxation independent of bladder contractions. Download figure Open in new tab Figure 7. Photostimulation of Bar Penk neurons promotes relaxation of the external urethral sphincter. a . Experimental setup integrating optogenetics, cystometry (CMG), and electromyography (EMG to record bladder pressure and EUS activity during Bar Penk photostimulation. b. Schematic of unilateral FLEX-ChrimsonR injection into Bar with an optic fiber above. c . Representative urodynamic tracings showing bladder pressure (red) and EUS-EMG activity (black) with 10s light pulses (orange shading), and a magnified 30s window capturing baseline, stimulation, and recovery phases. d, e. EUS-EMG total power ( d ) and average bladder pressure ( e ) before, during, and after stimulation ( n = 30 events from 3 mice, equally weighted; in ( d ), ****p 0.99; Friedman test followed by Dunn’s multiple comparisons test). Blue lines indicate medians. f. Likelihood of EUS and bladder responses during photostimulation ( n = 3 mice, 74 events ). Abbreviations : Bar, Barrington’s nucleus; EUS, external urethral sphincter. See also ED Fig. 7 . Retrograde tracing reveals the neural circuits underlying voluntary EUS control Given that Bar Penk neurons regulate EUS activity and are essential for voluntary scent marking, they may function as descending command neurons that coordinate voluntary EUS control upon integrating excitatory and inhibitory signals from upstream brain regions. To map afferent inputs to Penk+ neurons, we employed two complementary retrograde tracing strategies using modified rabies virus (RVdG) ( Fig. 8a, b ) . First, we traced upstream inputs to the entire Bar Penk population (“All Penk +”) by injecting helper AAV (FLEX-TVA-mCherry-oG) and, subsequently, RVdG directly into Bar of Penk-IRES2-Cre mice. Notable input sites to Bar Penk neurons included the subcoeruleus nuclei; the entire extent of the ventrolateral PAG (vlPAG; Bregma –4.3 to –5.1mm), lateral PAG (lPAG; Bregma –4.0 to –4.9), and the dorsomedial PAG (dmPAG); the lateral hypothalamic area (LHA, Bregma –1.2 to –2.5); the bed nucleus of the stria terminalis (BST), with GFP+ cells concentrated in the laterodorsal division; and the central amygdala (CeA) ( Fig. 8c-i ; Supp. Table 3; Supp. Video 4 ). Interestingly, a small number of helper-negative, GFP+ neurons were also detected in both the contralateral and the ipsilateral Bar, indicating reciprocal connections between the two Bar nuclei, as well as local connectivity within the nucleus. As a second approach, we labeled upstream neurons that selectively connect with the spinally-projecting Bar Penk neurons by injecting a retrograde helper virus (AAVrg-DIO-TVA-oG-mCherry) into the lumbosacral spinal cord ( ED Fig. 8a ), followed by RVdG injection into Bar ( Fig. 8b ). The input sites corresponded to those identified with the first approach, though fewer GFP+ neurons were detected in the BST and CeA. While this may suggest that not all Bar Penk neurons send axons to the spinal cord, differences could also reflect technical factors, such as the use of different helper viruses or local transduction versus retrograde viral uptake at the spinal terminals. Furthermore, dense labeling was observed in the midbrain (vlPAG and lPAG) and pons (PPN) and in a defined ventral region of the zona incerta (SubI nucleus), indicating strong innervation of the spinally projecting Bar Penk neurons ( Fig. 8i ; Supp. Table 3 ). Download figure Open in new tab Figure 8. Monosynaptic retrograde tracing of Bar Penk inputs using modified rabies virus. a . Injection of a Cre-dependent helper AAV encoding TVA-mCherry and optimized rabies glycoprotein (oG) into Bar of a Penk-IRES-Cre mouse (red, left), followed four weeks later by modified rabies virus (RVdG) injection into the same site (green, middle). Co-labeled starter cells appear yellow (right). b. TVA/oG expression (red, left) in Bar of a Penk-IRES-Cre mouse following lumbosacral spinal injection of retrograde AAV encoding DIO-TVA/oG/mCherry, selectively labeling spinally projecting Bar Penk neurons. RVdG was injected into Bar (green, middle) four weeks later. Co-labeled starter cells appear yellow (right). c. 3D reconstruction of a cleared (iDISCO+) whole brain, displaying Bar Penk starter cells (red) and RVdG-labeled upstream neurons (green). d-h. Representative coronal sections showing RVdG-labeled neurons (green) in key upstream regions: vlPAG ( d ), LH ( e, f ), SubI ( f ), CeA ( g ), and BST ( h ). Approximate Bregma levels are indicated. i. Summary table showing distribution of presynaptic neurons to Bar Penk , on an arbitrary density scale from 1 to 4 stars. Bracketed stars indicate input regions observed in only a subset of animals. Regions marked with † correspond to panels ( d-h ). In ( a, b, d-h ), neuronal cell bodies are counterstained with Nissl (blue). Scale bars : 200 μm, unless noted. Abbreviations: form., formation; n., nucleus; proj., projecting. See also ED Fig. 8 , Supp. Table 3, and Supp. Video 4 . Discussion This study advances our understanding of Barrington’s nucleus by providing a multi-scale analysis that defines the cell-type architecture, circuit connectivity, and behavioral roles of its neuronal populations. Our analysis identified five distinct excitatory subtypes, including the well-studied Crh -expressing neurons [ 24 , 27 , 30 ], and showed that Esr1 does not mark a distinct neuronal population in Bar, as previously suggested [ 25 ]. We evaluated the specific contributions of the neuronal populations to LUT function; activation of the glutamatergic Penk -expressing population revealed striking sex-dependent effects on micturition behavior. Bar Penk neurons control EUS relaxation in a highly specific manner and are essential for voluntary, socially motivated urinary behaviors such as scent-marking. These findings provide new insights into the brainstem circuits that control reflexive and voluntary micturition and highlight how discrete molecular subtypes within Bar contribute to sexually dimorphic regulation of the LUT. Voiding is initiated when descending output from Bar excites parasympathetic preganglionic neurons in the lumbosacral spinal cord, while simultaneously engaging inhibitory circuits that suppress somatic EUS motor neuron activity. Strong projections targeting the IML and DGC regions have previously been reported for Bar neurons, including Bar Crh [ 25 – 27 , 39 ]. Here we show that four of the identified glutamatergic populations project to the lumbosacral spinal cord: Crh , Penk , Tac1 , and Fgf10 -expressing neurons. Chemogenetic activation of two subtypes – the Bar Crh and Bar Penk neurons – increases voiding frequency, consistent with a role in regulating LUT function. The Tac1+ and Fgf10+ populations may play modulatory roles or instead contribute to other autonomic functions, for example, colorectal innervation or pain modulation. The glutamatergic Penk neurons in Bar, comprising approximately 20% of Bar’s neuronal pool and showing negligible overlap with Bar Crh neurons, represent a distinct molecular subtype that we characterize in detail here for the first time. In awake and freely behaving animals, Bar neurons are active at specific times during the fill-void cycle [ 27 , 40 ]. We have previously shown that the intrinsic activity of Bar Vglut2 neurons precedes and then follows the increase in bladder pressure, suggesting that their activation drives micturition [ 27 ]. Neural activity in the glutamatergic Crh subpopulation in Bar closely tracks bladder pressure during voiding contractions, likely acting to augment detrusor contraction. In contrast, Bar Penk neurons are active selectively during voiding: their activity rises after the onset of bladder contraction and the duration of this activity closely tracks void duration, suggesting that these neurons are engaged in the ongoing execution of voiding rather than its initiation alone. During non-voiding contractions, which are not accompanied by urine release, Bar Penk activity is markedly attenuated and typically ceases prematurely. These findings suggest that the neurons may operate downstream of a void-specific gating mechanism, possibly coordinating EUS relaxation only when conditions for micturition are met, and their activity remains inhibited when voiding is contextually inappropriate. Indeed, photostimulation of Bar Penk neurons suppresses EUS activity in awake mice, confirming that these neurons can reliably induce EUS relaxation. Among the major projection targets of Bar Penk neurons is the DGC, which is preferentially innervated relative to the IML. The DGC contains GABAergic/glycinergic interneurons that, when electrically stimulated, evoke relaxation of the EUS [ 20 ]. Penk neurons likely exert control over the somatic EUS motor neurons, at least in part, via these inhibitory sacral DGC interneurons. During normal voiding, relaxation of the EUS is accompanied by phasic bursting activity, which is thought to facilitate efficient elimination of urine [ 41 , 42 ]. Our findings suggest that Bar Penk neurons selectively engage the sacral inhibitory circuit to promote EUS relaxation, without recruiting the spinal bursting center localized in the L3/L4 spinal cord [ 43 , 44 ]. This is in line with evidence that EUS bursting originates from intraspinal circuitry, as it persists following complete transection above these levels, which eliminates all supraspinal input [ 45 ]. Notably, although both Bar Penk and Bar Crh neurons project to the DGC and IML, they differentially engage these spinal circuits, with Bar Crh primarily linked to detrusor activity [ 25 , 27 ], which highlights the need to resolve the molecular identity and organization of spinal projection targets, as well as local circuitry. The apparent selectivity of Bar Penk neurons for the EUS relaxation pathway positions them as a promising entry point for dissecting and modulating specific aspects of LUT control in relevant disease models. Chemogenetic activation of Bar Penk neurons in male mice produced an aberrant phenotype characterized by numerous leaks, while the frequency of typical, corner-associated voids remained unchanged, albeit with reduced volume per void. Although bladder fullness may influence the extent of leakage, the overall pattern was not consistent with an overflow-incontinence phenotype and instead supports poorly timed, involuntary urine release. Together, these findings suggest that prolonged Bar Penk activation disrupts bladder-outlet coordination, with frequent and mistimed sphincter relaxation contributing to leakage, while altered coordination between bladder contraction and EUS relaxation may hinder efficient voiding, resulting in smaller void volumes. This interpretation is supported by our optogenetic CMG/EMG recordings, which show that Bar Penk activation suppresses EUS activity without increasing bladder pressure, indicating that the behavioral effects of chemogenetic stimulation arise from disrupted bladder-outlet coordination rather than direct bladder activation. Our finding that ablation of Bar Penk neurons had no impact on void frequency, volume, or the ability to maintain continence indicates that Penk neurons contribute to, but are not essential for, typical voiding behavior. In fact, ablation of Bar Crh neurons also does not abolish voiding, despite their proposed role in driving detrusor contractions [ 24 , 25 , 27 , 30 ]. Together, these findings may suggest the presence of functional redundancy within Bar. Interestingly, male mice lacking Bar Penk neurons lose the ability to scent-mark in response to female mouse urine cues, demonstrating their necessity for socially motivated urinary output. Because the detrusor is comprised of smooth muscle cells and is under autonomic control, volitional LUT regulation likely targets the striated muscle of the EUS, which must be actively relaxed to permit urine release [ 46 ]. Taken together, these findings position Bar Penk neurons as a specialized glutamatergic population that coordinates EUS activity both during regular voiding and context-dependent voluntary behaviors. A key rationale for including both male and female mice in this study stems from the well-established anatomical differences between the male and female LUT system. This sex-specificity is clinically relevant, as LUT conditions, such as overactive bladder and ensuing incontinence, affect aging men and women differently [ 47 ], and disorders like Fowler’s Syndrome – a form of urinary retention caused by a poorly relaxing EUS – primarily affects young women [ 48 , 49 ]. Research directly addressing differences in the neural control of LUT function between sexes remains scarce, but will be essential for advancing clinically relevant insights. Stimulation of Bar Penk neurons produces a distinct micturition phenotype in males without an equivalent outcome in females. This raises the possibility that Bar Penk neurons possess sex-specific characteristics, whether in their molecular identity or circuit connectivity. However, our data does not directly support this interpretation: transcriptomic clustering showed equal contributions from male and female samples, with no evidence of sex-specific subclusters. The proportion of Bar Penk neurons that are positive for Vglut2 , or negative for Crh , is comparable between sexes, as is the number of Esr1 -expressing Penk cells. Even though potential differences in hormone sensitivity related to sex-specific variation in circulating or brain estradiol levels cannot be ruled out [ 50 , 51 ]. Furthermore, axonal tracing revealed similar projection patterns from Bar Penk neurons in males and females (n = 4M, 4F), and comparable synaptic distribution in lumbosacral regions (n = 4M, 3F), including both the IML and DGC. Kawatani and colleagues analyzed Bar Crh and Bar Esr1 neuron connectivity with spinal neurons in both sexes, but did not report on sex-specific differences [ 39 ]. The observed sex-specific functional output could also arise at the level of downstream circuits. Differences in molecular identity, receptor composition, or excitability of the postsynaptic neurons could influence how the Bar Penk output is integrated into the spinal circuits. For example, sex-specific variation in opioid receptor expression could result in divergent responses to enkephalin release. Peripheral anatomical differences may also contribute: the EUS is smaller in female mice, and the urethra is shorter [ 52 ]. These organs may therefore receive different motor innervation. Lastly, motor neuron pools in females are smaller [ 53 ], which may affect the responsiveness of these neurons to descending signals and ultimately influence muscle activation. Future studies are needed to identify sex-specific neuroanatomic and neurophysiological features in LUT signaling, and to determine whether spinal targets of Bar Penk neurons differ molecularly between sexes. Both mice and humans maintain voluntary control over urination, and in many mammals, urinary behaviors also serve as a means of social communication via pheromones in urine [ 22 , 23 ]. Our findings suggest that Bar Penk neurons facilitate voluntary, scent-marking behavior. Bar receives convergent inputs from multiple brain regions [ 24 , 27 , 54 ], which enables the integration of visceral signals, such as bladder fullness, with contextual cues, to accomplish specific motivated behaviors. The network of upstream sites monosynaptically connecting to Bar Penk neurons includes regions involved in visceromotor regulation and behavioral state integration, namely vlPAG and LHA [ 55 ]. Additional inputs arise from VMH, a sexually dimorphic nucleus implicated in mating behavior [ 56 ], MPOA, an area known for its role in social behaviors and previously shown to modulate Bar neurons during socially motivated urination [ 24 ], and ZI, which is linked to sensorimotor integration and novelty seeking [ 57 ]. Voiding behaviors in general, including scent-marking, require coordinated bladder contraction and EUS relaxation, with different Bar populations serving complementary roles within the voluntary micturition circuit. Consistent with this, the major input sites to Bar Penk neurons largely overlap with those previously reported for Bar Crh neurons [ 24 , 27 ], suggesting that both populations are recruited by shared circuits rather than controlled by distinct upstream nuclei. Their functional divergence may therefore emerge primarily downstream, through differential engagement of spinal targets. Within this broader framework, Bar Penk neurons may serve as a key node for integrating internal and external cues to coordinate outlet control during context-dependent urinary behaviors. The vlPAG region is a well-established source of direct projections to Bar [ 16 , 27 ]. Modulation of this PAG-Bar axis can alter micturition behavior bidirectionally, with glutamatergic signals promoting voiding, and GABAergic ones inhibiting it, consistent with the idea that the PAG serves as a central gate for Bar activity [ 27 , 58 , 59 ]. When voiding is contextually inappropriate, Bar activity remains suppressed despite increasing bladder afferent input to PAG [ 27 , 60 ]. The sharp rise in Bar Penk neuron activity at void onset supports a model in which upstream inhibition is transiently lifted to allow sphincter relaxation in synchrony with bladder contraction, facilitating efficient voiding. While PAG likely is an important contributor to this inhibitory gating, additional inputs to Bar [ 24 , 27 , 61 ] may also shape Bar Penk activity, extending a control network beyond the PAG. In addition to identifying distinct and functional subpopulations within Bar, our findings refine Bar’s anatomical and molecular boundaries and underscore the need for transcriptomic and spatial resolution when assigning neuronal populations to specific nuclei. For example, while Esr1 and Prlr are expressed across multiple Bar subtypes – including Bar Crh and Bar Penk neurons – and their stimulation can reliably promote micturition, neither gene defines a unique population within Bar [ 33 , 62 ]. Our data indicate that Esr1 expression is more widespread in and around Bar than previously reported, with substantial overlap between Esr1 and Crh -expressing neurons. A recent study further supports Esr1 expression across multiple subtypes, revealing distinct Bar Esr1 subgroups: one projecting via the pelvic nerve to regulate bladder-urethra coordination, and another via the pudendal nerve to influence EUS function [ 32 ]. Penk, in contrast, marks a molecularly and functionally distinct population with a specific role in LUT control. The previously observed effects on EUS activity with Bar Esr1 stimulation are likely mediated, at least in part, by the Esr1 + Bar Penk neurons. Limitations of this study include the reliance on DroNc-seq data, which, due to its relatively low sensitivity, may have failed to detect low-abundance transcripts contributing to sex-specific differences in gene expression or missed rare, small populations or subtypes within larger transcriptional clusters. Identification of highly specific molecular markers for Bar may also be inherently limited by the technical constraints of the DroNc-seq approach and by the close anatomical proximity and transcriptional similarity of neighboring pontine populations. Additionally, our tracing studies focused primarily on projections to the spinal cord; future work is needed to map local brainstem circuits and brain-wide afferents to each of the Bar subpopulations, including potential sexual dimorphism. Finally, functional studies under varying physiological and hormonal conditions will be necessary to capture more nuanced differences in LUT regulation between males and females. Together, these findings establish a cellular and functional framework for understanding how distinct neuronal populations in Bar coordinate autonomic and somatic components of LUT control. This work highlights the intricate brain-body interactions underlying bladder function and identifies Bar Penk neurons as a specialized population that controls sphincter activity and enables socially motivated micturition in a sex-dependent manner. Extended data figures and legends Download figure Open in new tab Extended Data Figure 1. Quality control of snRNA sequencing and Esr1 expression in Bar. Related to Fig. 1 . a. Violin plots displaying quality control metrics for each of the 22 glutamatergic neuronal clusters: number of unique molecular identifiers (top), number of detected genes (middle), and percentage of mitochondrial gene expression (bottom). b. Number of nuclei per cluster for the glutamatergic subset of the snRNA-seq dataset. c. Dot plot showing Esr1 expression across the 22 glutamatergic clusters. d. Overlap between Crh-GFP (green) and Esr1-immunoreactive neurons (magenta) in Bar of a Crh-IRES-Cre mouse crossed to a reporter line; lower panel shows zoomed-in view of the boxed regions above, with yellow arrows indicating neurons co-expressing Crh and Esr1 . e. Proportion of Crh+ neurons in Bar that co-express Esr1, as detected by immunohistochemistry ( n = 3; 88% ± 1% ). f. Expression of DIO-GFP (green) in Bar of an Esr1-Cre mouse; Esr1-immunoreactive cells are shown in magenta. Catecholaminergic neurons in the LC are stained for tyrosine hydroxylase (TH, blue). Scale bar: 200 μm. Abbreviations: Bar, Barrington’s nucleus; i.r., immunoreactive; LC, locus coeruleus; TH, tyrosine hydroxylase; sn-RNA-seq, single-nucleus RNA sequencing; UMI, unique molecular identifier. Download figure Open in new tab Extended Data Figure 2. Characterization of additional putative Bar populations. Related to Fig. 2 . a, b. Schematics of knock-in (KI) cassette inserts for Fgf10-IRES-Cre (a) and Prlr-P2A-Cre (b) mouse lines generated using the Easi-CRISPR method. The KI cassette for Prlr includes a 147 bp 5’ homology arm, P2A linker, Cre, NLS, stop codon, and a 108 bp 3’ homology arm. The KI cassette for Fgf10 includes a 130 bp 5’ homology arm, a stop codon, IRES2, NLS, Cre, stop codon, and a 120 bp 3’ homology arm. c-g. Injection of DIO-mCherry (red) in Bar of Vglut2-IRES-Cre (c) , Vgat-IRES-Cre (d) , Foxp2-IRES-Cre (e) , Prlr-P2A-Cre (f) , and Esr1-Cre (g) mouse lines (left panels), with neuronal cell bodies counterstained with Nissl (teal blue). Corresponding axonal projections (or lack thereof) to lumbosacral spinal cord levels are shown (right panels). Ipsilateral (ipsi) and contralateral (contra) projections are indicated when present. Cholinergic neurons are stained for ChAT (green), and nuclei are counterstained with DAPI (blue). h. Prlr-GFP expression (pink) in Bar of Prlr-P2A-Cre mice crossed with an L10-GFP reporter, showing the distribution of Prlr -expressing neurons in and around Bar. Catecholaminergic neurons in the locus coeruleus (LC) are stained for tyrosine hydroxylase (TH, teal blue). i. Penk mRNA (blue, second panel) and Crh mRNA (yellow, third panel) expression in Prlr-GFP+ neurons (pink, first panel) in Bar. The merged image (fourth panel) shows the overlap of Prlr expression with other Bar markers. Yellow arrows indicate neurons co-expressing Prlr and Crh , while blue two-headed arrows highlight Prlr-Penk colocalization. j. Micturition frequency recorded during 2h MVT trials in Prlr-IRES-Cre mice injected with DIO-hM3Dq following saline or hM3Dq agonist administration ( mean ± SEM, n = 6, *p = 0.031, Wilcoxon matched-pairs signed-rank test ). Scale bars: 200 μm. Abbreviations: 4V, 4th ventricle; Bar, Barrington’s nucleus; bp, base pair; ChAT, choline acetyltransferase; DGC, dorsal gray commissure; IML, intermediolateral column; KI, knock-in; LC, locus coeruleus; MVT, Micturition Video Thermography; NLS, nuclear localization sequence; TH, tyrosine hydroxylase; UTR, Untranslated Region. See also Supp.Table 5 Download figure Open in new tab Extended Data Figure 3. Molecular and anatomical characterization of Bar Penk neurons. Related to Fig. 3 . a. Schematic representation of Penk-TdTomato (red, left panel) and Esr1-immunoreactive neurons (magenta, middle) distribution in Bar. The merged image (right panel) shows their overlap (white), with TH-positive neurons of LC (green) included as an anatomical landmark. b. Bar graph comparing the percentage of neurons co-expressing Penk and Esr1 in Bar for males ( 53.3 ± 3.9%, n = 4 ) and females ( 61.4 ± 5.8%, n = 3 ). Mean ± SEM, p = 0.23, Mann-Whitney test . c. Distribution of Esr1+ (magenta) neurons across Bregma levels in Bar; neuronal cell bodies are counterstained with Nissl (gray). d. Left, proportion of Esr1-expressing neurons in Bar shown as a pie chart ( 75% ± 1.5%, n = 3). Right, schematic breakdown of the Bar Esr1 population inferred from measured overlap with Bar Penk and Bar Crh populations, showing contributions of Esr1::Penk (12% of total Bar neurons), Esr1::Crh (35% of Bar), and Esr1 neurons negative for both markers (28% of Bar). e. Penk mRNA (blue, first panel), Crh mRNA (yellow, second panel), and Esr1 mRNA (pink, third panel) expression in Bar, with merged image shown on the right (scale bar 100µm). f. Imaris-processed images of the sacral spinal cord showing the distribution of Bar Penk (top) and Bar Crh (bottom) synaptic terminals within the DGC (red spots) and IML (green spots) following injection of AAV-DIO-mSyp1-tdTomato into Bar of Penk-IRES2-Cre and Crh-IRES-Cre mice. Numbers denote synaptic spot counts within the DGC and IML in the representative sections shown; spots outside the quantified ROIs appear in yellow. g. DGC:IML synapse ratio for Bar Penk (blue, n = 7 ) and Bar Crh (yellow, n = 4 ) across lumbosacral spinal levels (L6, S1, and S2). Mean ± SEM; p = 0.98; **p = 0.0078; **p = 0.0058, two-way ANOVA with Sidak’s multiple-comparisons test. h. Average distribution of synapses between the DGC and IML at each spinal level, expressed as the % of terminals within that level, for Bar Penk (blue) and Bar Crh (yellow). i, j. Distribution of synaptic terminals in the DGC and IML, expressed as the percentage of total synapses across all analyzed spinal levels for Bar Penk ( i ; n = 7, ****p < 0.0001 for all ) and Bar Crh ( j ; n = 4, ****p < 0.0001, p = 0.51, p = 0.44, respectively). Mean ± SEM, one-way ANOVA with Sidak’s multiple-comparisons test . Scale bars: 200 μm, unless noted. Abbreviations: Bar, Barrington’s nucleus; DGC, dorsal gray commissure; IML, intermediolateral column; LC, locus coeruleus; TdT, TdTomato; TH, tyrosine hydroxylase. Download figure Open in new tab Extended Data Figure 4. Fiber photometry-based Ca²+ imaging of Bar Penk during voiding and non-voiding contractions. Related to Fig. 4 . a. Averaged gCaMP6s signals ( ΔF/F 0 ) aligned to the onset of voiding (solid blue line), the peak of non-voiding contractions (dashed light blue line), and randomly shuffled time points (solid gray line). Data are presented as mean ± SEM (n = 86, 73, and 44 events, respectively, from 4 mice), with shading representing the standard error of the mean. b. Mean gCaMP6s signal ( ΔF/F 0 ) during voiding events, non-voiding contractions, and random time points. Thick blue lines indicate the median (n = 32 events from 4 mice, equally weighted; ****p < 0.0001, ****p < 0.0001, **p = 0.0074, Kruskal-Wallis test followed by Dunn’s multiple comparisons test) . c. Heatmap of GCaMP8s signal recorded from spinally projecting Bar Penk neurons before, during, and after individual voiding events ( z-scored ΔF/F 0 ; n = 37 events from 6 mice ), sorted by peak signal. d. Representative void-aligned fiber photometry trace highlighting peak-plateau neural activity (red shaded region), defined as the sustained elevated GCaMP signal between the rapid rise and subsequent rapid decline in fluorescence. Abbreviations : NVC, non-voiding contraction. Download figure Open in new tab Extended Data Figure 5. Efficacy of different DREADD agonists. Related to Fig. 5 . a. Comparison of the effects of different DREADD agonists on LUT function in mice expressing hM3Dq receptor in Bar Penk neurons. Micturition frequency was recorded during 2-hour MVT trials following administration of saline, CNO, or C21 ( n = 2 mice, two trials per condition (averaged) ). Abbreviations: C21; Compound 21; CNO, clozapine N-oxide; DREADD, Designer Receptors Exclusively Activated by Designer Drugs. Download figure Open in new tab Extended Data Figure 6. Extended time course of Bar Penk ablation effects and pre-ablation scent-marking behavior. Related to Fig. 6 . a, c. Average voiding frequency during 2h MVT trials before and after ablation of Bar Penk neurons compared to sham controls for males ( a ; n = 8 vs. n 4; p = 0.57, p = 0.57, p > 0.99 p = 0.66 ) and females ( c ; n = 6 vs. n = 3; p = 0.33 for all PODs ). Mean ± SEM, multiple Mann-Whitney tests with Holm-Šídák’s correction for multiple comparisons . b, d. Average urine volume per void recorded MVT trials before and after ablation of Bar Penk neurons compared to sham controls for males ( b ; n = 8 vs. n 4; p = 0.75, p = 0.74, p = 0.75, p = 0.75 ) and females ( d ; n = 6 vs. n = 3; p = 0.33, p =0.86, p = 0.86, p = 0.60 ). Mean ± SEM, multiple Mann-Whitney tests with Holm-Šídák’s correction for multiple comparisons . e. Injection site overlap from 6 Penk-IRES-Cre mice injected with AAV8-mCherry-DIO-dtA, reconstructed from mCherry-labeled Cre-negative cells surrounding the ablated Bar Penk population. f, g. Baseline scent-marking behavior: Average number of urine marks (f) and latency to the first mark (g) recorded during pre-ablation MVT trials (POD –1) before AAV injection of either DIO-dtA (experimental group) or DIO-mCherry (control), ( f, g ; n = 6 vs. n = 7; p = 0.73, p = 0.63, respectively; mean ± SEM, Mann-Whitney test ). h. Average number of urine marks during 1h MVT trials on POD 21-25 in control (mCherry; n = 7 ), complete bilateral Bar Penk ablation ( n = 6 ), and incomplete ablation groups (partial, unilateral/mistargeted Bar coverage; n = 6 ). Mean ± SEM, control vs complete: **p = 0.009; complete vs incomplete: *p = 0.02; control vs incomplete: p >0.99, Kruskal-Wallis, followed by Dunn’s multiple comparisons tests . Abbreviations: Bar, Barrington’s nucleus; dtA, diphtheria toxin A; MVT, Micturition Video Thermography; POD, postoperative day. Download figure Open in new tab Extended Data Figure 7. Effects of optogenetic stimulation at different frequencies. Related to Fig. 7 . a. EUS-EMG activity recorded in response to different photostimulation frequencies applied to Bar Penk neurons expressing FLEX-ChrimsonR. Transparent red bars indicate light pulses delivered via an Arduino-controlled system. Abbreviations: EUS, External Urethral Sphincter; EMG, Electromyography. Download figure Open in new tab Extended Data Figure 8. Monosynaptic rabies tracing from spinally projecting Bar Penk neurons. Related to Fig. 8 . (a) Representative histological image showing the injection site of a retrograde helper AAV encoding a Cre-dependent construct for TVA (avian receptor for leukosis viruses), optimized rabies glycoprotein (oG), and mCherry (red) in the lumbosacral spinal cord of a Penk-IRES2-Cre mouse. Cholinergic neurons are stained with ChAT (green), and nuclei are counterstained with DAPI (blue). The dashed white line indicates the L6/S1 level of the spinal cord. Scale bar: 200 μm. Abbreviations: ChAT, choline acetyltransferase. Online Methods Mice. Mice used in this study were bred on a mixed background primarily composed of C57Bl/6J (The Jackson Laboratory). Except for two in-house-generated mouse lines, all mice were obtained from either the Jackson Laboratory or the Lowell Lab (BIDMC, Boston). Prlr-P2A-Cre and Fgf10-IRES-Cre knock-in mice were generated at the Beth Israel Deaconess Medical Center Transgenic Core Facility, as described below. All transgenic mice included in the functional experiments were used in a heterozygous state. We used male and female mice ranging from 6 to 25 weeks old (median age: ∼10.5 weeks), with any behavioral and/or histological assessments starting no earlier than 8 weeks of age. Mice weighed between 20 and 32 g. The exact numbers for each genotype used in specific experiments are detailed below and in the figure legends where applicable (see also Supp. Table 5 ). To label axonal projections from different neuronal Bar populations to the spinal cord, we utilized male and female mice from the following lines: Crh-IRES-Cre (n = 3) [ 63 ], Penk-IRES2-Cre (n = 8, Jax# 025112), Tac1-IRES2-Cre-D (n = 3, Jax# 021877) [ 64 ], Fgf10-IRES-Cre (n = 4), Vglut2-IRES-Cre (n = 3, Jax# 016963) [ 65 ], Vgat-IRES-Cre (n = 2, Jax# 028862) [ 65 ], Foxp2-IRES-Cre (n = 4, Jax# 030541) [ 66 ], Prlr-P2A-Cre (n = 2), and Esr1-Cre (Jax# 017911, n = 3) [ 67 ]; some of which were crossed with R26-lsl-L10-GFP [ 63 ]. For chemogenetic (DREADDs) experiments, we used male Penk-IRES2-Cre (n = 6), Tac1-IRES2-Cre-D (n = 8), Fgf10-IRES-Cre (n = 5), and Prlr-P2A-Cre (n = 6) mice, some of which were crossed with R26-lsl-L10-GFP . To examine the sex-specific effects of chemogenetic activation of Bar Penk , we additionally included female Penk-IRES2-Cre mice (n = 6). To assess the off-target effects of the DREADDs agonists on LUT function, we used male and female Penk-IRES2-Cre mice (n = 4 and 6, respectively). To label and quantify Bar neurons expressing Crh and Penk , we used adult male Crh-IRES-Cre and Penk-IRES2-Cre mice crossed to H2B-TRAP reporter [ 68 ] mice (Jax# 029789) (n = 3 and 3, respectively), while for quantification of Esr1 -expressing neurons in Bar, we used Esr1-Cre mice crossed to Sun1.sfGFP reporter (Jax# 021039, n = 3) [ 69 ]. To quantify the overlap of Bar Penk neurons with previously known Bar markers, we used male and female Penk-IRES2-Cre mice crossed to the ROSA-lsl-tdTomato ( Ai9 , Jax# 007909) reporter (n = 8) [ 70 ] . To study the overlap of Bar Crh with Esr1 , we utilized adult male Crh-IRES-Cre mice crossed to H2B-TRAP reporter mice (n = 3) and Esr1-Cre (Jax# 017911, n = 2) to validate the anti-Esr1 antibody labeling results. To visualize and quantify the distribution of Bar Crh and Bar Penk synaptic terminals in the lumbosacral spinal cord, we used Crh-IRES-Cre (n = 4) and Penk-IRES2-Cre mice (n = 4 males). Fiber photometry experiments utilized Penk-IRES2-Cre male mice for both all-Bar Penk (n = 4) and spinally-projecting-Bar Penk (n = 6) recordings. For experiments investigating the effects of dtA-mediated ablation of Bar Penk neurons on normal voiding function, we used male and female Penk-IRES2-Cre mice crossed to R26-lsl-L10-GFP , with n = 8 and 6 in the experimental group and n = 4 and 3 for sham controls. Scent-marking and ablation experiments were conducted using dominant Penk-IRES2-Cre; R26-lsl-L10-GFP mice (n = 6 for experimental group (complete ablation), n = 7 for sham control, and n = 6 for the incomplete ablation group). For optogenetic experiments, we used male Penk-IRES2-Cre mice (n = 3). Retrograde tracing with modified rabies studies was performed using male Penk-IRES2-Cre mice (n = 7). Mouse husbandry Mice were housed in ventilated racks within air-sealed rooms maintained at a stable temperature (21–23°C) and humidity (30–40%) under a 12-hour light-dark cycle. Each cage contained corncob bedding and nesting material, with ad libitum access to water and standard rodent chow (Teklad F6 Rodent Diet 8664). In most cases, mice were group-housed after weaning (≤5 per cage), except in the following cases. For scent-marking experiments, male mice were single-housed for at least one week before behavioral assessment. For fiber photometry with cystometry (CMG) and optogenetics with CMG/electromyography (EMG) experiments, mice were singly housed following bladder catheter and/or EMG electrode implantation surgery to minimize implant damage. All animal care and experimental procedures were conducted following protocols approved by the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee and in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Use of Published Data for Bar Single-Nucleus Atlas The Bar single-nucleus atlas was generated using a subset of previously published DroNc-seq data from Nardone et al., 2024 [ 33 ]. Specifically, we utilized the portion of the dataset corresponding to the micro-dissected Bar (described in the “Mouse Strains and Brain Dissections” section of Nardone et al., 2024). In brief, Crh-IRES-Cre mice [ 63 ] were crossed with the L10-GFP reporter line [ 63 ] to generate Crh-IRES-Cre::R26-lsl-L10-GFP mice in which Crh -expressing neurons were selectively labeled with GFP . The highly specific expression of Crh in Bar neurons enabled precise 1 mm biopsy punches centered on the GFP + Bar. Tissue from 18 males and 21 females, processed in 4 and 5 batches, respectively, was used to generate this dataset using DroNc-seq. We utilized the published digital gene expression (DGE) matrices [ 33 ], following standard DroNc-seq processing pipelines. Details on sequencing and data processing, including demultiplexing (bcl2fastq), alignment to the GRCm38 genome (STAR v2.7.3), and UMI collapsing (Hamming distance ≤1), can be found in Nardone et al., 2024. To construct the Bar single-nucleus atlas, 30 DGE matrices from multiple Bar-centered dissections were aggregated and converted into a single Seurat object, with metadata assigned to each batch before merging. Clustering analysis and downstream computational processing were performed by the BNORC Functional Genomics and Bioinformatics Core at Beth Israel Deaconess Medical Center. Clustering Strategy and Quality Control A Single-Cell Remover of Doublets (Scrublet v0.3.2) [ 71 ] pipeline was applied to the Bar-DroNc dataset to identify and remove potential doublets. Genes detected in ≤2 cells were filtered out, and nuclei with a mitochondrial gene expression rate >10% and/or <400 unique gene features were removed, as they likely represented empty droplets or low-quality nuclei. This post-filtered dataset of 61,806 nuclei × 26,530 genes was analyzed using Seurat (v3.1.2 [ 89 ]; R version 3.6.2; see the “session_info.txt” file in the data repository for a complete listing of all R packages used, together with versioning information). Data were pre-processed using Seurat’s ‘ SCTransform’ function per-sample, which simultaneously performed batch correction, normalization, scaling, and variable feature detection while also regressing out mitochondrial content and inferred cell cycle scores (S and G2/M phases based on known marker gene expression). Nuclei were then integrated across all samples to ensure proper alignment across different batches. T-SNE (using t-distributed Stochastic Neighbor Embedding) categorical plots were examined to confirm that all samples contributed proportionally to the identified clusters, minimizing batch effect biases. Principal Component Analysis (PCA) was conducted on the 5000 top variable features, followed by clustering and visualization via the aforementioned tSNE plots using the first 30 principal components. A range of parameters was tested to determine the optimal clustering resolution, including 2000, 3000, 4000 or 5000 variable features, 20, 30, or 40 principal components, and clustering resolutions of 0.6, 0.8, 1.0, and 1.2. Cluster stability across resolutions was assessed using Cluster tree plots , and the cumulative proportion of variance within each principal component was examined using elbow plots to guide PCA cutoff selection. The final clustering resolution was determined in consultation with a bioinformatician. Differential expression analysis between clusters was performed to identify marker genes. Cell types were assigned to each cluster based on the expression of specific marker genes. Clusters were excluded if they met either of the following criteria: (1) Clusters were considered low-quality if they exhibited very low gene counts and/or high mitochondrial content, (2) clusters were considered mixed or potential doublets if they contained significant markers from multiple unrelated cell types. After excluding three low-quality or mixed clusters, clustering was performed in three phases to generate a single-nucleus atlas of glutamatergic Bar neurons: (1) all cell types, (2) GABA/Glut neurons, and (3) glutamatergic neurons. In the first phase, the remaining dataset (60,135 nuclei x 26,553 genes) was clustered as described above using a 400UMI cutoff, 5000 variable genes, a 30 principal component cutoff, and a resolution of 0.6. Each cluster of the “All Cells Atlas” (a. 1a-b), was assigned to one of nine major cell types based on the expression of known marker genes. In the second phase, to achieve better separation of excitatory and inhibitory neurons, all non-neuronal clusters were excluded along with neuronal clusters originating from distinct nuclei outside of Bar. The resulting dataset (36,705 nuclei × 26,090 genes) was then re-clustered using the same approach (data not shown). In the third phase, to generate the final “Atlas of Glutamatergic Putative Bar Neurons”, all GABAergic clusters were excluded based on their expression of the vesicular GABA transporter Vgat (Slc32a1) . This was performed iteratively, removing additional GABAergic clusters as they separated. Mixed clusters expressing Vglut2 ( Slc17a6 ) above 10%, regardless of Vgat expression, were retained. To reduce the presence of lower-quality nuclei that likely contain a higher proportion of ambient RNA, the UMI cutoff was increased to 800. The final dataset (13,076 nuclei × 25,629 genes) was re-clustered using 2000 variable genes, a 20 principal component cut-off, and a resolution of 0.6. Generation of the Knock-in Mouse Lines Prlr-P2A-Cre and Fgf10-IRES-Cre knock-in mice were generated at the Transgenic Core Facility at Beth Israel Deaconess Medical Center using the Easi-CRISPR method [ 73 ]. A Cre knock-in cassette was inserted into exon 10 of Prlr and exon 3 of Fgf10 using the CRISPR/Cas9 system ( ED Fig. 2a, b ). Pronuclear Injection & sgRNA Design Male C57Bl/6J mice (>8 weeks old, Jax # 000664) were bred with superovulated females to generate zygotes for pronuclear injection. The single-guide RNAs (sgRNAs) were designed using the Benchling platform ( https://www.benchling.com/crispr/ ), and those with the highest scores were selected. sgRNA synthesis was performed using the CRISPRevolution sgRNA EZ Kit (Synthego). Synthego added an 80-mer SpCas9 scaffold to the 20-nucleotide genome targeting sequence in 5’ to 3’ order (excluding the PAM sequence) to create a single guide RNA (1.5 nmol)). Recombinant Cas9 nuclease (#CP01-50) was obtained from PNA Bio. ssDNA templates for Prlr-2A-Cre and Fgf10-IRES-Cre knock-in cassettes were synthesized by Genscript. Silent mutations were introduced near the protospacer adjacent motif (PAM) in Prlr and Fgf10 to reduce homology with the wild-type sequence [ 74 ]. For effective cleavage at the target site and minimizing non-specific off-target cleavage events, the DNA sequence and target region for the Prlr gene was selected to be at position 10329237. On the negative strand, the guide sequence was GCAUGAAGCACGUAGGAUCC with PAM sequence AGG. The knock-in-cassette for Prlr contains 147 bp for the 5’ homology arm, the PAM sequence, the modified sgRNA sequence (5’-G GA C CC A AC C TG T TT T ATG C –3’), linker P2A, Cre, NLS, stop codon and 108 bp for the 3’ homology arm. For the Fgf10 gene, the selected guide sequence was TCTATGTTTGGATCGTCATG with PAM sequence GGG in exon 3 at position 118789301 on the negative strand. The knock-in-cassette for Fgf10 contained 130 bp for the 5’ homology arm, the PAM sequence, the modified sgRNA sequence including stop codon (5’– C ATG AC C AT T CA G AC T TA A A –3’), IRES2, NLS, Cre, stop codon and 120 bp for the 3’ homology arm. Embryo Microinjection & Transfer Pronuclear-stage embryos were collected and injected following established methods [ 75 – 77 ] using complexes of sgRNA (crRNA + tracrRNA), Cas9, and ssDNA. In brief, the zygotes were microinjected with the aid of an IX71 inverted microscope. Viable zygotes were immediately transferred to a new drop of the M2 medium and then incubated at 37°C in a 5% CO 2 , until reaching the two-cell stage (∼24h post-injection). C57Bl/6J pseudo-pregnant females were used as recipients for embryo transfer, receiving 15–18 microinjected zygotes per oviduct 0.5 days post coitus (dpc). Recipient mothers delivered pups at approximately 19.5 dpc. Founder Generation & Genotyping Of the 260 (for Prlr ) and 302 (for Fgf10 ) injected zygotes, 221 and 267 were successfully transferred; this resulted in 50 pups and 10 pups born, respectively. DNA sequencing of F0-generation pups revealed that 14/50 of Prlr transgenic mice carried the mutant allele instead of the endogenous allele sequence (3 homozygous, 11 heterozygous). As for Fgf10 transgenic mice, 2 were homozygous, 3 were heterozygous for Fgf10 -specific Cre insertion, and 1 was positive for generic Cre but not for Fgf10 -specific Cre, suggesting random genomic Cre insertion(s). Targeted alleles from founder mice were sequenced to confirm correct knock-in cassette insertion without disruption of endogenous gene expression or function, using Kapa Biosystems HiFi PCR Kit (Roche 07958838001) and TaKaRa Taq DNA Polymerase (Takara HR001A-200U). See Table S2 for primers used for Sanger sequencing. Backcrossing & Line Establishment One sequence-confirmed founder (N) was selected for each of the new transgenic lines and backcrossed to wild-type C57Bl/6J mice (Jax # 000664). N1 heterozygous carriers were selected, and their targeted alleles were sequenced (also) and further backcrossed. Resulting F1 heterozygous transgene pups were genotyped (see table S2 for primers) using Roche Taq DNA Polymerase (Sigma Aldrich 4728866001), dNTPack, 100 Units (Sigma Aldrich 728866001). F2–F8 generations were produced by repeated outcrossing with newly purchased wild-type C57Bl/6J mice (Jax # 000664). With generation F8, stable transgenic lines were established and confirmed via sequencing and genotyping. General Surgical Procedures Mice were anesthetized with isoflurane (4% induction, 1–2% maintenance; Kent Scientific VetFlo™) and positioned on a heating mat in a stereotaxic frame (Harvard Apparatus 75-1810). Ophthalmic ointment (Puralub 211-38) was applied to protect the eyes, and either meloxicam-SR (4 mg/kg, s.c.) or buprenorphine-SR (1.2 mg/kg, s.c.) was administered subcutaneously at the start of the procedure, along with antibiotics (Enrofloxacin, 5 mg/kg, s.c.). A sterile field was maintained throughout the surgery, and all surgical tools were sterilized between animals. After surgery, mice were placed in a clean cage on a heating pad and monitored until fully awake before being returned to their regular housing. Postoperative monitoring was conducted daily, and mice were given at least 21 days for recovery and viral expression before behavioral testing or histological assessment. For some of the earlier pilot experiments, stereotaxic surgery was performed under ketamine/xylazine anesthesia (100/10 mg/kg, i.p.) using a Kopf stereotaxic frame (David Kopf Instruments 940). Viral Injections and Fiber Optic Implantation Viral vectors were delivered using a Microinjection Syringe Pump System (World Precision Instruments UMP3T-1) with a 10µl Hamilton syringe (Model 1701 RN, Hamilton 7653-01) fitted with a 34G needle (Hamilton 207434). For some of the earlier pilot experiments, intracranial injections were performed using pulled glass pipettes with an inner diameter of ∼20 µm. An air pressure system was used to deliver picoliter air puffs through a solenoid valve (Clippard EV 24VDC) controlled by a Grass stimulator (Model S48). Barrington’s Nucleus Injections The skin overlaying the skull was shaved and sterilized using sterile alcohol prep pads (Fisher 22-363-750) and povidone-iodide prep pads (Professional Disposables International B40600). A midline incision was made to expose the skull, and after the Bregma-Lambda alignment, a small burr hole was drilled above the target region using a microdrill (Braintree Scientific MD1200120V). The dura was carefully punctured with a pulled glass capillary pipette, and the Hamilton syringe was lowered into the target region. Using stereotaxic coordinates, injections were targeted to Bar at AP: –5.50 mm, ML: ±0.67 mm, DV: – 3.85 mm from Bregma. The needle was left in place for 2 minutes before injecting 15–200 nL of the viral vector per side, at a rate of 50 nL/min (exact volumes for specific experiments are detailed below). The needle was left in place for an additional 5–10 minutes before slow retraction. After injections, the incision edges were re-apposed and secured using tissue adhesive (Vetbond 361931). Spinal Cord Injections The surgical area was shaved and sterilized with alcohol and povidone-iodide prep pads. A 10–15 mm incision was made over the T12 to L2 vertebrae, and the L1 vertebra was identified and secured using spinal clamps attached to the stereotaxic apparatus. The connective tissue and muscles were separated from the L1 vertebra to expose the L6–S1 spinal cord by removing the L1 spinous process. The dura was punctured using a 30G needle, and the 10-µl Hamilton syringe fitted with a 34G needle was positioned 0.3 mm lateral to the dorsal spinal vein and lowered 0.5–0.6 mm into the spinal cord. The needle remained in place for 2 minutes before injecting 75 nL at a rate of 50 nL/min. After injection, the needle was left in place for an additional 5–10 minutes before being slowly retracted. A total of six injections were performed, three per side, at different rostral-caudal coordinates across the L6–S1 spinal levels. Following injections, the muscle layer was sutured using 6-0 absorbable vicryl sutures (Ethicon J212H), and the skin was closed using 5-0 non-absorbable polypropylene sutures (Oasis MV-8661). Optical Fiber Implantation Optical fibers were implanted during the same surgery as AAV injections. A Ferrule Holder (RWD Life Science 68214) mounted onto the stereotaxic arm was used to hold and guide a fiber optic cannula along the needle track, as described above, positioning it 0.2-0.3 mm above the injection site. For fiber photometry experiments, stainless steel ferrules (Precision Fiber Products MM-FER2007-304-4500-P) with 400-µm core optical fibers (Thorlabs FT400UMT Multimode, NA 0.39) were implanted unilaterally over Bar. For optogenetics experiments, fiber optic cannulae with Ø1.25 mm ceramic ferrule, 200-µm core (RWD Life Science R-FOC-L200C-50NA) were implanted unilaterally over Bar. Viral Vectors: Injection Volumes and Laterality For anterograde axonal tracing studies, the majority of mice (≥ 2 for each mouse line representing the Bar population) received unilateral injections of AAV8-hSyn-DIO-mCherry (Addgene; plasmid #50459, 15-40nL). Additionally, for some of the pilot cases included here, mice were injected with AAV9-CAG-ChR2(H134R)-mCherry (UPenn; Addgene plasmid #100054), AAV1-Syn-Flex-GCaMP6s-WPRE-SV40 (UPenn; Addgene plasmid #100845), or AAV8-hSyn-DIO-hM3Dq(Gq)-mCherry (Addgene; plasmid #44361). As part of the anti-Esr1 labelling validation, we injected AAV9-hSyn1-DIO-eGFP-2A-FLAG-TeTxLC-WPRE-SV40p (Zurich VVF; v322-9, ∼50 nL). For analysis of synaptic terminal distribution in the lumbosacral spinal cord, mice received a unilateral Bar injection of AAV9-EF1α-DIO-mSyp1-tdTomato-WPRE-bGHp (Zurich VVF; v991-9, ∼30-50 nL). For fiber photometry recordings from all Bar Penk neurons, AAV1-Syn-Flex-GCaMP6s.WPRE.SV40 (Addgene; plasmid #100845, ∼30nL) was injected into Bar unilaterally. For recordings specifically from spinally projecting Bar Penk neurons, mice received 2-4 unilateral spinal injections of the AAVretro-Syn-FLEX-jGCaMP8s-WPRE [ 80 ] (Addgene; plasmid #162377, ∼150nL). For chemogenetic experiments, AAV8-hSyn-DIO-hM3D(Gq)-mCherry (Addgene; plasmid #44361, ∼40nL) was injected bilaterally for all mouse lines. For selective activation of spinally projecting Bar Penk neurons, mice received three bilateral spinal injections of the AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA [ 81 ] (Addgene; plasmid #87306, ∼150nL), followed by bilateral Bar injection of AAV8-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA (Addgene; plasmid #154868, 100-150nL) 3-4 weeks later. For conditional ablation experiments, AAV8-EF1-lox-Cherry-lox-(dtA)-lox2 (P. Fuller, M. Lazerus; Beth Israel Deaconess Medical Center, ∼40nL) was injected bilaterally, while sham controls received bilateral injections of AAV8-hSyn-DIO-mCherry (∼40nL). AAV5-Syn-FLEX-ChrimsonR-tdTomato-WPRE-bGHp [ 82 ] (Addgene; plasmid #62723, ∼30nL) was injected unilaterally for optogenetic experiments. For monosynaptic conditional retrograde tracing from Bar Penk neurons, mice received a unilateral injection of the helper vector AAV8-CMV-FLEX-TVAmCherry-2A-oG (Salk; Addgene plasmid #102985, 20–30nL), followed by pseudotyped G-deleted rabies SAD. DG-EnvA-GFP [ 84 ] (Salk, Addgene plasmid #32635, 150–200nL) 3–4 weeks later. For retrograde tracing from spinally projecting Bar Penk neurons, mice received three bilateral spinal injections of the helper vector AAVretro-hSyn1-DIO-TVA-2A-mCherry-2A-oG-WPRE-bGHp (Zurich VVF; v306-retro, ∼75nL), followed by bilateral Bar injection of SAD-DG-EnvA-GFP (150–200nL) 3–4 weeks later. Micturition Video Thermography (MVT) MVT was performed as described previously [ 27 , 85 ]. In brief, up to four bottomless, open-top enclosures were placed on filter paper (Cosmos Blotting paper, 360 gsm; Legion Paper P05-COS4060) for each experiment, with an overhead A65 thermal camera (FLIR) capturing the void spot signature. Enclosures were cleaned with Clidox between trials (5-minute contact time, then towel– and air-dried) and high-temperature washed between cohorts to prevent cross-contamination. Thermal recordings were processed using ResearchIR software, converting sequence files to WMV with embedded timestamps. Voiding events were identified as the first frame of void hotspot appearance, with a screenshot captured once the void spot stabilized (typically 10–15 minutes post-voiding). ImageJ (NIH) was used for volume estimation, with screenshots converted to 8-bit grayscale and thresholded. A 10 cm² reflecting template in each recording calibrated pixel-to-cm² conversion, accounting for camera height and angle variations. Final volume estimates were derived using established calibration curves [ 85 ]. To standardize bladder filling, mice received a subcutaneous injection of 1 mL prewarmed 5% dextrose water before recordings and were briefly returned to their home cage (5–10 minutes) for absorption and to prevent filter paper contamination. Mice received a single chow pellet to minimize exploratory behavior during the recording. Water was withheld during recordings to reduce variability in bladder filling and prevent spillage from interfering with void spot analysis. Experiments were conducted in same-sex cohorts of up to four mice, with each placed in its own enclosure. Recordings lasted 2 hours, except for scent-marking assessments (1 hour), as pilot experiments showed dominant mice marked extensively early in the session before subsiding. To control for circadian influences, all recordings were performed at the same time of day, spanning the late light to early dark cycle. Typical Mouse Voiding Behavior A typical voiding sequence begins with the mouse leaving its “home” corner, where it spends most of the test session. The mouse briefly explores, rears, paces, and/or grooms before walking to a corner or wall, turning around to face away from the corner, lifting its tail, and remaining still for several seconds. A fresh urine hotspot then appears on the filter paper, after which the mouse walks away. In control mice, these behavioral features are observed in nearly all voids. Voiding events that deviate from this pattern, such as urine leakage mid-stride, in the center of the cage, or while the mouse is engaged in other behaviors, were categorized as abnormal urine spots (leaks). In rare cases (<5% of mice, though not formally quantified), we observed animals that appeared unable to exhibit typical conscious voiding behavior and instead showed features of incontinence before any experimental intervention. These mice exhibited (frequent) small leaks during movement, rest, or other behaviors, failed to produce larger voids, or showed signs suggestive of stress incontinence. If these abnormalities persisted across two recording sessions, the mice were excluded from analysis and further experiments. Cystometry Bladder Catheter Implantation Mice were anesthetized with continuous isoflurane (4% induction, 1.5% maintenance). A 1 cm midline abdominal incision was made using a scalpel, and the underlying abdominal muscle was blunt-dissected to expose the bladder. A 3Fr bladder catheter (Instech C30PU-RJV1307) was inserted into the bladder dome and secured with a purse-string suture (8-0 Prolene, DemeTech PM6980065G0P). The catheter was then tunneled subcutaneously to the back of the neck, exteriorized, and attached to a vascular infusion harness (22ga, Instech C30PU-RJV1307). The abdominal muscles were sutured with 6-0 monoacryl sutures (Ethicon Y492G), and the skin was closed with 5-0 non-absorbable sutures (Oasis MV-8661). Buprenorphine-SR (1.2 mg/kg, s.c.) was administered subcutaneously at the start of the procedure, along with antibiotics (Enrofloxacin, 5 mg/kg, s.c.). After surgery, animals were placed on a heated mat for recovery before being returned to the animal care facility. Mice were monitored and received Enrofloxacin (5 mg/kg, s.c.) daily, until the end of the experiment. To minimize the risk of catheter damage, they were singly housed for the duration of the study. Animals were allowed to recover for 7–10 days before experiments began. EUS-EMG Electrode Implantation If electromyography (EMG) recording was required, electrode implantation was performed during the same surgical procedure. PFA-coated stainless steel wire (37G, A-M Systems 790600) was stripped at one end and shaped into a hook for insertion. Two electrodes were implanted into the external urethral sphincter (EUS), while a ground electrode was sutured to the abdominal muscle. EMG wires were tunneled subcutaneously to the back of the neck, where they were exteriorized and secured. Postoperative recovery followed the same protocol as the catheter implantation, ensuring optimal healing before the experiment started. Urodynamic and EUS-EMG Measurements Urodynamic measurements were performed at approximately the same time of day during the light phase. Awake mice were placed in custom-made acrylic enclosures with filter paper flooring. The bladder catheter was connected to a syringe pump, with an in-line pressure transducer linked to PowerLab for pressure monitoring. EMG electrodes were connected to an amplifier (x1000, 8 Hz to 2 kHz bandpass filter), and EMG signals were sampled using PowerLab. Saline was continuously infused at a rate of 15-30 µL/min for 2-3 hours. Intravesical pressure and EUS-EMG activity were recorded using LabChart software. Chemogenetic experiments and analysis Following hM3Dq AAV injections, mice were allowed 3–4 weeks for recovery and viral expression before testing. Mice received an i.p. injection of either saline (vehicle) or DREADDs agonist 10 minutes before being placed in the MVT behavioral arena. Each session lasted 2 hours, and every mouse underwent the paradigm twice with saline and twice with the agonist, alternating treatments. Behavioral responses were averaged across the two runs. For Bar Penk chemogenetic experiments in males, we used Clozapine N-Oxide (CNO, 1 mg/kg, i.p.). We selected a dose at the lower end of the commonly used range (1–5 mg/kg) [ 25 , 27 , 30 ]. For later chemogenetic experiments, we used Compound 21 (C21, 0.8 mg/kg, i.p.), which has been reported to have better brain penetration and possibly fewer off-target effects than CNO [ 87 , 88 ]. To determine the optimal C21 dosage, we tested a range of 0.5, 0.75, 1.0, and 2.0 mg/kg. Higher doses (>1 mg/kg) induced mild, non-LUT-related side effects, including body temperature changes and decreased locomotion, which were mitigated by using doses ≤1 mg/kg. Therefore, we used C21 in a concentration strictly below 1 mg/kg for all experiments. To evaluate potential micturition behavior-related off-target effects of these agonists, we administered CNO or C21 to naïve (no DREADDs/Gq present) male and female Penk-IRES2-Cre mice (n = 4 and 5, respectively). Additionally, to assess the efficacy of different agonists, we conducted MVT trials with saline, CNO, or C21 (two trials per condition, n = 2, ED Fig. 5a ). Fiber Photometry Setup Fiber photometry was conducted as previously described [ 27 ] using the Doric Lenses 1-site, 2-color Fiber Photometry system (FPS_1S2C_405/GFP_400-0.48). Calcium-dependent GCaMP6s fluorescence was excited at 465 nm, with the signal modulated at 515 Hz. A 405 nm reference signal was recorded and modulated at 211 Hz to control for motion artifacts and tissue movement. Both excitation wavelengths were coupled through a Doric FMC5 mini cube, and emission light was collected via the same fiber, filtered through the GFP filter, and focused onto a Newport 2151 femtowatt photoreceiver. The photoreceiver signal was recorded at 4 kHz using LabChart software (AD Instruments). Data were demodulated using an adapted MATLAB script from Doric, downsized to 0.1 s resolution, and further analyzed with custom MATLAB scripts. Bladder pressure (CMG) and GCaMP recordings were synchronized and recorded simultaneously in separate LabChart channels at 4 kHz. Experimental Protocol AAV was allowed to express for at least six weeks before recordings. One-week post-bladder catheter implantation, mice were placed in a metabolic cage with filter paper flooring and connected to the fiber photometry system via an optical patchcord, while the pinport of the harness was linked to a saline infusion pump. Light intensity at the patchcord tip (465 nm) was 0.1–0.2 mW. A thermal camera (FLIR C2) was positioned below the cage to confirm micturition events by the heat signatures on the filter paper following a void. Each mouse underwent 1-3 hour recording sessions over multiple days, with at least 11 voiding events included per animal. Trials from all sessions were pooled to calculate mean fluorescence changes within 60 seconds before and 60 seconds after micturition events for each mouse. After the experiments, mice were perfused, and brain sections were examined for fluorophore expression and fiber placement. Mice with insufficient gCaMP6s expression in the Bar region or incorrect fiber placement were excluded from the final analysis. For fiber photometry recordings from spinally projecting Bar Penk neurons, recordings were performed in conjunction with micturition video thermography (MVT). The spinal cord-injected AAV was allowed to express for 3-4 weeks before optic fiber implantation over Bar. One to two weeks after fiber implantation, mice were volume-loaded with 1 mL of 5% Dextrose (s.c.) and placed in MVT arenas for 2-3 h recording sessions, repeated across multiple days. GCaMP recordings and thermal video were synchronized, and the first thermal video frame in which a urine spot became visible was defined as void onset. Fiber Photometry Analysis Relative fluorescence changes were calculated as ΔF/F₀ = (F – F₀) / F₀, where F₀ was obtained by applying a best-fit curve to the entire trace. To correct for motion artifacts, the 405 nm (isosbestic) excited GCaMP fluorescence (ΔF/F₀ (405)) was subtracted from the 465 nm calcium-dependent GCaMP fluorescence (ΔF/F₀ (465)). Heatmaps and graphs were generated using custom MATLAB scripts. To generate an averaged FP-CMG graph, GCaMP traces were normalized per event to account for variability in fluorescence levels between animals and recording days, caused by differences in fiber placement and gradual GCaMP signal decay. The normalization formula used was: (ΔF/F₀ − baseline(ΔF/F₀)) / baseline(ΔF/F₀) × 100, where baseline ΔF/F₀ was defined as the mean ΔF/F₀ during the 60 seconds preceding the event. To create heatmaps, ΔF/F₀ values were converted to Z-scores using the formula: Z = (ΔF/F₀ − mean(ΔF/F₀)) / Std(ΔF/F₀). Fiber photometry recordings from spinally projecting Bar Penk neurons were processed using the same approach. For correlation analysis between void duration and the duration of peak-plateau neural activity, void duration was defined as the time (in seconds) between the first thermal video frame in which a urine spot became visible and the frame at which the urine spot stopped spreading and/or the mouse left the latrine corner. Peak-plateau duration was defined as the period of sustained-high GCaMP signal following a steep rise in fluorescence shortly before void onset and ending with the subsequent rapid decline in fluorescence ( ED Fig. 4d ). Alignment of Voiding and Non-Voiding Events To align multiple voiding events, we calculated and plotted the differential bladder pressure change rate (dP/dt) and used its maximum value preceding the contraction, representing the steepest rise in bladder pressure before voiding begins, as the alignment point (0-line). Voiding contractions were aligned to MAX (dP/dt), marking the moment of peak detrusor activity. Voiding contraction events were included in the analysis if the cystometry trace showed a single contraction peak. Non-voiding contractions (NVCs) were aligned to peak bladder pressure. Only NVCs with a single peak with ≥5 cm H 2 O increase in bladder pressure were included to minimize motion-related pressure artifacts. The graph and heatmap display the GCaMP signal from 60 s before to 60 s after the aligned event for both voiding and NVCs. For random-shuffle graphs, we included 120s of GCaMP traces surrounding randomly selected time points (using the MATLAB randomizer function ‘Randy’), ensuring a comparable number of events while using the same traces as the zero-lag condition. Ablation Experiments and Analysis For DTA-mediated ablation experiments, MVT-recorded behavioral trials were conducted on sexually naïve group-housed mice before AAV injection (POD –1) to establish baseline voiding patterns. Following this initial screening, mice were injected on POD 0 with either a Cre-dependent DTA virus (experimental) or a DIO-mCherry virus (sham control). Both groups underwent identical experimental paradigms and were tested in same-sex cohorts of up to four mice. Before each session, mice were volume-loaded with 1 mL of prewarmed 5% dextrose water subcutaneously and placed in the MVT behavioral arena. Each session lasted 2 hours, with voiding frequency and volume per void recorded for each mouse, following the MVT analysis methods. Behavioral assessments were conducted weekly post-surgery on POD 7, 14, and 21. Following the final behavioral session, mice were perfused, and brain sections encompassing the core of Barrington’s nucleus (Bar) and adjacent regions were analyzed histologically. Successful ablation was confirmed by a substantial reduction in GFP+ neurons at the injection site, in Penk-IRES2-Cre::L10 mice. Only cases with sufficient bilateral ablation (≥90–95% loss of GFP+ neurons in Bar) and minimal viral spread beyond Bar borders were included in the final analysis. Scent-Motivated Marking Behavior Sexually naïve, group-housed adult Penk-IRES2-Cre::L10-GFP male mice were singly housed for at least one week prior to behavioral testing. Before exposure to female scent, mice were habituated to the behavioral arena and screened for abnormal voiding behaviors (e.g., signs of incontinence; see Typical Voiding Behavior section) using the standard MVT setup. To establish baseline scent-marking behavior, mice underwent two screening sessions before surgery. Before each session, mice were volume-loaded with 1 mL dextrose water sub-cutaneously, introduced to the behavioral arena, and allowed to explore for 5-10 minutes before being exposed to the stimulus: 100 μL of pre-warmed female mouse urine, pipetted onto filter paper placed in the center of the cage. Scent-marking behavior was then recorded throughout a 1-hour MVT session. Mice that failed to initiate marking within the first 5 minutes or produced fewer than 10 urine marks during the session were classified as subordinate and excluded from further analysis. The remaining dominant mice were randomly assigned to either the experimental or sham control group ( ED Fig. 6e, f ) and received bilateral Bar injections of DIO-dtA (experimental) or DIO-mCherry (sham control). 1-hour MVT recordings were conducted in mixed cohorts of four, composed of experimental and control animals. Post-Surgical Testing and Analysis The mice were reintroduced to the behavioral arena three weeks post-injection (POD 21–25), and presented with the urine stimulus again. Each mouse was tested twice on consecutive days, with MVT recordings lasting 1 hour per session. Testing was conducted in mixed cohorts of up to four mice. Thermography videos were analyzed for urine marking behavior, excluding typical corner voids, and latency to marking was noted. Behavioral responses were averaged across both trials. Researchers were blinded to the experimental group during analysis. Following the final behavioral assessment, mice were perfused, and brain sections encompassing Bar and adjacent regions were analyzed histologically. Successful ablation was confirmed by a substantial reduction (≥90–95%) of Penk-GFP+ neurons at the injection site, with minimal viral spread beyond Bar borders. Female Urine Collection Urine was collected from adult (8–25 weeks) female mice, group-housed up to five per cage. Urine was collected by holding each mouse over wax paper and massaging the bladder (if the mouse did not void spontaneously), then pipetting the urine from the wax paper into a sterile 2mL tube. Urine was pooled from 4–5 cages over four consecutive days to ensure representation of all estrous cycle stages, and briefly stored at −20°C. After the collection period, samples were thawed on ice, pooled in equal proportions, aliquoted, and refrozen at −20°C for use in behavioral assays. Optogenetic Experimental Setup Optogenetic stimulation was delivered using a single-channel LED driver (Plexon, PlexBright LD-1) controlling a 620-nm PlexBright Table-Top LED module (Plexon), delivering 5-10 mW at the fiber tip. The TTL signal was modulated using an Arduino Uno board (Arduino A000066), programmed via Arduino IDE Software to set the frequency and pulse duration. Optical power was measured using a Thorlabs light meter before and after each session to ensure consistency. For photostimulation experiments, fiber-implanted mice were briefly anesthetized with 4% isoflurane before being connected to optogenetic patch cables (Plexon OPT/PC-FC-LCF-200/230-HP-1.0L KIT) via a ceramic mating sleeve (included in the same kit). The bladder catheter pin port of the harness was connected to a saline infusion pump, and EUS-EMG electrodes were linked to an amplifier. Bladder pressure (CMG), EUS-EMG, and Arduino output recordings were synchronized and recorded simultaneously in separate LabChart channels at 10 kHz. Photostimulation Parameters During pilot experiments, we tested multiple stimulation frequencies (2, 5, 10, and 20 Hz; ED Fig. 7a ). Based on our observations, photostimulation was delivered using 10-ms pulses at 20 Hz, for 5 or 10 seconds per stimulation. We found that motion-related artifacts interfered with the EMG signal when recorded in awake, freely behaving mice. To minimize this, stimulations were delivered during quiescent periods, avoiding naturally occurring voids. Each mouse underwent 1–2.5-hour recording sessions across multiple days, with at least 19 stimulation events recorded per animal. Optogenetic Experiments Analysis To compare EUS-EMG activity before, during, and after stimulation, the EMG signal (mV) was converted to Total Power (TTP, V 2 ), defined as the sum of power across all frequencies within the epoch, using the built-in LabChart function. Mean TTP values were extracted from LabChart for three time periods: before stimulation (baseline, same duration as stimulation), during stimulation (5s or 10s light delivery), and after stimulation (recovery period, same duration as stimulation). To account for variability in voltage across trials and animals, TTP values were normalized using the following formula: TTP p = TTP p / (TTP before + TTP stim + TTP after ) × 100, where TTP p represents the total power during a specific period (before, during, or after stimulation). Similarly, mean bladder pressure (CMG) values were extracted for the same three time periods and normalized using the same approach. To ensure equal representation across animals, an equal number of randomly selected trials (10 per animal) were included using a randomizer function for both Total Power and CMG analyses. Trials were excluded from analysis if movement or electrical/static artifacts were present during the baseline phase (before stimulation). However, trials with potential artifacts during the stimulation or recovery phase were retained to avoid bias in trial selection. The response rate was calculated per animal. For EMG, the percentage of trials in which a ≥5% decrease in EUS-EMG activity was observed compared to the baseline period (before stimulation). For CMG, the percentage of trials where bladder pressure increased by ≥3 cm H₂O compared to the baseline period, accounting for the natural filling-related pressure increase. After all experiments, mice were perfused, and brain sections were examined for viral expression and fiber placement. Mice with insufficient Chrimson expression in the Bar region or incorrect fiber placement were excluded from the final analysis. Perfusion, Histology Processing, and Assessment Mice were anesthetized with chloral hydrate (7% w/v in sterile saline, ∼20mg/mL i.p.) and transcardially perfused with phosphate-buffered saline (PBS) at room temperature, followed by 10% formalin (Fisher Scientific 245-685). Brains, and in some cases, spinal cords, were immediately extracted and postfixed overnight in 10% formalin at 4°C. After 24–48 hours of cryoprotection in 25% sucrose, tissues were sectioned using a freezing microtome (Leica SM2000R) in a 1-in-4 series. The whole brain or rostral brainstem were sectioned coronally, while the spinal cord was cut either coronally or horizontally. In most experiments, sections were cut at 30 or 40 μm, except for in situ hybridization and neuronal quantification experiments, where sections were cut at 15–25 μm. Sections were stored in cryoprotectant solution at −20°C or in PBS-azide at 4°C before immunofluorescence labeling. RNAScope In-Situ Hybridization Brain tissue was collected using the same perfusion protocol described above, with strictly controlled post-fixation (≤12 hours) and dehydration (12-15 hours) steps. Coronal sections were cut at 15-20 μm, and stored at –20°C until processing according to the protocol provided within RNAscope® Fluorescent Multiplex Reagent Kit (Advanced Cell Diagnostics 320851) user manual. In brief, brain sections were mounted onto Superfrost Plus microscope slides (Fisher Scientific 12-550-15), washed 3-5 times with distilled water, pretreated with Protease III for 30 minutes, and hybridized with mixed probes (see below). for 2 hours at 40°C, followed by four subsequent amplification steps, each lasting 15-30 minutes. Each of the pretreatment and hybridization steps was followed by 3×2 min washes with RNAscope wash buffer. The slides were then air-dried in a light-protected environment, coverslipped using DAPI Fluoromount-G mounting medium (Southern Biotech 0100-20), and stored at –20°C until imaging, typically within 24-48 hours. List of RNAscope probes used: Mm- Bnc2 -C2 (ACD 518521); Mm- Calcr -C3 (ACD 494071); Mm- Cdh6 -C2 (ACD 519541); Mm- Crh -C2 (ACD 316091); Mm- Esr1- C3 (ACD 478201), Mm- Fign -C2 (ACD 871521); Mm- Fgf10 -C2 (ACD 446371); Mm- Foxp2 -C1 (ACD 428791); Mm- Inhba -C2 (ACD 455871); Mm- Npas1- C1 (ACD 468851); Mm- Oprk1- C2 (ACD 316111); Mm- Otof- C2 (ACD 485671); Mm- Penk- C3 and Mm- Penk- C4 (ACD 318761); Mm- Prlr- C3 (ACD 430791); Mm- Tac1 -C2 (ACD 410351); Mm- Tfap2b- C3 (ACD 536371); Mm- Tnc -C2 (ACD 465021); Mm- Slc32a1- C3 (ACD 319191); Mm- Slc17a6- C3 (ACD 319171); Mm- Slc17a8- C1 (ACD 431261); Mm- Sox6 -C2 (ACD 472061); Mm- UBC- C3 (positive control, ACD 320881). Immunohistochemistry and Nissl Staining Immunohistochemistry was performed as previously described. In brief, free-floating sections were blocked in 3% normal donkey serum (NDS, Sigma-Aldrich S30) in 0.25% PBST (PBS + 0.25% Triton X-100) for 1 hour, followed by overnight incubation at room temperature with primary antibodies (one to three per experiment) diluted in 3% NDS, 0.25% PBST. The following dilutions were used: anti-ChAT (goat; Millipore AB144P) at 1:250, anti-Esr1 (rabbit; Millipore 06-935) at 1:4000, anti-DsRed (rabbit; Takara 632496) at 1:2000, anti-GFP (chicken; Thermo Fisher A10262) at 1:2000, anti-FOX3 (NeuN, mouse; BioLegend 834501), and anti-TH (mouse; Millipore MAB318) at 1:1000. After washing, sections were incubated with secondary antibodies diluted in 3% NDS, 0.25% PBST for 1–3 hours at room temperature. All secondary antibodies, including anti-Goat (donkey; –488, –594 or –647; Thermo Fisher A-11055, A-11058, A-32849), anti-Rabbit (donkey; –488, –594 or –647; Thermo Fisher A-21206, A-21207, A-32795), anti-Chicken (–488 or –647; Jackson ImmunoResearch 703-546-155, 703-606-155), anti-Mouse (donkey; –488, –594 or –647; Thermo Fisher A-21202, A-21203, A-31571) were used at 1:1000. Each step was followed by three 2-minute PBS washes. For Nissl staining, NeuroTrace Blue (ThermoFisher N21479) or Deep Red (ThermoFisher N21483) was added to the secondary solution at 1:250; or sections were incubated in 0.25% PBST containing NeuroTrace at 1:250 for 1–2 hours. Sections were then mounted onto gelatin-subbed microscope slides (SouthernBiotech SLD01-CS), air-dried, coverslipped with DAPI Fluoromount-G mounting medium (Southern Biotech 0100-20), and stored at +4°C until imaging. Imaging Whole-slide fluorescence imaging was performed using 10X or 20X objective on an Olympus BX63 scanning microscope with CellSens software (Olympus). OlyVIA software (Olympus) was used to screen cases and identify regions containing transduced soma in Bar or axonal projections to the spinal cord. Cases with missed injections, incomplete hits, extensive spread beyond Bar borders, or incorrect fiber placement were excluded from the analysis. Representative histological images were acquired using a Leica Stellaris 5 scanning confocal microscope with a 10X air or 20X air objective, using LAS X microscope software. Imaging settings were optimized for each experiment to maximize signal range, and z-stack maximum projections were used for representative images and axonal projections. Anatomical quantifications To quantify the percentage of Bar neurons expressing Penk, Crh , and Esr1 we analyzed four consecutive Bar levels (∼15μm thick, ∼100 μm apart) of Penk-IRES2-Cre::H2B-TRAP, Crh-IRES-Cre::H2B-TRAP, and Esr1-Cre::Sun1.sfGFP mice (n = 3 per group), counterstained with Nissl. Bar borders were manually delineated bilaterally in Adobe Photoshop (Adobe) based on the distinct oval-shaped boundaries visualized in the Nissl channel, with the reporter channel turned off to avoid bias. The number of Nissl-positive cells within the defined Bar region, representing the total neuronal count, was quantified manually by placing markers on each identified neuron. Reporter-positive cells ( Penk + , Crh + or Esr1 + ) were then quantified using the same approach. The percentage of reporter-positive neurons was calculated as: the number of reporter-positive cells / total Nissl-positive neurons × 100. To examine the overlap of Bar Penk neurons with other known Bar markers, we analyzed tissue from male and female Penk-IRES2-Cre::tdTomato mice. Three ∼25 μm sections covering the central, rostral, and caudal Bar were included. For Penk:Esr1 overlap (n = 4M, 3F), immunohistochemistry was performed using an anti-Esr1 antibody (1:4000, Millipore Sigma 06-935). For Penk:Vglut2 (n = 3M, 3F) and Penk:Crh (n = 3M, 3F) co-localization, RNAscope in situ hybridization was performed using Vglut2 (Mm-Slc17a6-C3; ACDBio 319171) and Crh (Mm-Crh-C2; ACDBio 316091) probes. Quantification was performed manually in Adobe Photoshop using a similar approach as above. First, the total number of Penk:tdTomato-positive cells in Bar was quantified, followed by the number of double-positive cells (expressing both tdTomato and the corresponding marker). The percentage of overlap was calculated as follows: the number of double-positive cells / total Penk:tdTomato-positive cells × 100. Researchers were blinded to the extent possible regarding the specific marker being quantified to minimize bias. To quantify and compare Bar Penk and Bar Crh synaptic terminal distribution in the lumbosacral spinal cord, we analyzed three consecutive spinal levels (L6, S1, and S2) from Penk-IRES2-Cre mice (n = 4M, 3F) and Crh-IRES-Cre (n = 4M) injected unilaterally in Bar with DIO-mSyp1-tdTomato. ChAT and NeuN immunostaining were used to identify spinal cord levels. Sections were imaged at 20X on a confocal microscope (Leica Stellaris 5) and processed in Imaris software (Oxford Instruments). Synaptic terminals were thresholded and converted to spots using the same settings for all images. DGC boundaries were manually delineated based on NeuN staining, with the mSyp1-tdTomato channel hidden during ROI assignment to avoid bias. The IML was defined using a standardized circular ROI centered on ChAT-positive bladder motor neurons and applied consistently across sections and animals. Spot counts within each ROI were quantified automatically. Synapse distribution at each level was calculated as: synaptic spots in the ROI (DGC or IML) / total synaptic spots in DGC + IML × 100. For across-level analyses, spot counts in each ROI at a given level were normalized to the total number of synaptic spots detected in DGC + IML across all analyzed levels (L6 + S1 + S2) for that animal. Retrograde Tracing Using Modified Rabies Virus For tracing input sites to Penk+ neurons in Bar (“all Penk +”), we introduced a TVA, a receptor for avian leukosis viruses, and optimized rabies glycoprotein (oG) specifically to Penk -positive neurons in Bar. This was achieved by focal unilateral injection of Cre-dependent AAV-Flex-TVA-mCherry-oG vector (“helper AAV”) into the Bar region of Penk-IRES2-Cre mice. After 3–4 weeks for optimal protein expression, G-deleted rabies virus (RVdG) pseudotyped with the avian sarcoma leukosis virus envelope (EnvA), and encoding eGFP was injected into Bar using the same coordinates. For tracing upstream sites of spinally projecting Bar Penk neurons (“spinally proj. Penk +”), a retrograde Cre-dependent helper AAV retrograde viral vector (AAVretro-DIO-TVA-oG-mCherry) was injected bilaterally into the lumbosacral spinal cord (L6-S2 region). After 3-4 weeks of expression, the same EnvA-G-deleted rabies virus (RVdG) was injected bilaterally into Bar. In both cases, seven days after RVdG injection, mice were perfused as described above. After post-fixation in formalin, whole brains were coronally sectioned at 30μm thickness. Every other section was stained with anti-DsRed, Nissl stain, and DAPI, then mounted and scanned as described above. A subset of brains was cleared and stained using the iDISCO+ protocol. These whole brains were then imaged with a light-sheet microscope, followed by 3D reconstruction as described below. We confirmed a sufficient number of starter cells in Bar (co-labeled with both mCherry and eGFP ). Cases with very few or no starter cells, as well as those with starter cells located outside of Bar borders, were excluded from further analysis. Putative presynaptic neurons expressing eGFP (only) were quantified and manually assigned to specific brain regions based on the Paxinos and Franklin Atlas (4th edition) [ 89 ], using landmarks visualized with Nissl stain and/or DAPI, and tissue autofluorescence. The number of neurons within each brain structure was normalized to estimate whole-brain values by applying a correction factor, i.e., multiplying by 2 for coronally sectioned brains, where quantification was performed on 2 out of 4 series. iDISCO+ tissue clearing Seven days after rabies virus injection, mice were perfused as described above. Brains were dissected and post-fixed overnight at 4°C in 10% formalin F, then stored in PBS-azide (PBS + 0.02% sodium azide) at 4°C. All incubation steps were performed in 5 mL tubes filled to the top. Brains were processed according to the iDISCO+ protocol [ 90 ]. In brief, samples were dehydrated through a graded methanol / ddH 2 O series (20%, 40%, 60%, 80%, 100%, 100%) at room temperature (RT) for 1 hour per step. They were then chilled in 100% methanol at 4°C for 20 minutes before overnight incubation in 66% dichloromethane / 33% methanol at RT with shaking. Following two washes in 100% methanol, samples were bleached overnight at 4°C in 100% methanol containing 5% H 2 O 2 . Rehydration was performed through a descending methanol / ddH 2 O series (80%, 60%, 40%, 20%) for 1 hour per step, followed by a 1-hour PBS wash. Two additional washes were performed in 0.2% PBST (PBS + 0.2% Triton X-100) before incubation in a permeabilization solution (40 mL PBS, 80 µL Triton X-100, 1.15g glycine, 10mL DMSO, and 0.02% sodium azide, for a total of 50 mL stock solution) for 2 days at 37°C with shaking. Samples were then incubated in a blocking solution (42 mL PBS, 84 uL Tween-20, 0.42mg Heparin, 3 mL normal donkey serum, 5 mL DMSO, and 0.02% sodium azide, for a total of 50 mL stock solution) for 2 days at 37°C with shaking. For immunolabeling, samples were incubated for 7 days at 37°C with shaking in antibody solution (46 mL PBS, 92 µL Tween-20, 0.46 mg Heparin, 2.5 mL DMSO, 1.5 mL Normal Donkey Serum (NDS), and 0.02% sodium azide) containing primary antibodies (Chicken anti-GFP (1:1000), Rabbit anti-DsRed (1:1000)). This was followed by washing in PBS-based washing solution (50 mL PBS, 0.1 mL Tween-20, 0.5 mg Heparin, and 0.02% sodium azide, for a total of 50 mL stock solution), with five solution changes over 5 hours. Secondary antibody incubation (antibody solution + Donkey anti-Chicken AlexaFluor 647 + Donkey anti-Rabbit AlexaFluor 594) was performed for 7 days at 37°C with shaking, followed by a washing step in the same washing solution with five solution changes over 5 hours, plus an overnight wash. Samples were then cleared by dehydration through an ascending methanol / ddH 2 O series (20%, 40%, 60%, 80%, 100%, 100%) at RT for 1 hour per step, followed by a 3-hour incubation in 66% dichloromethane / 33% methanol with shaking at RT. Residual methanol was removed by two 30-minute washes in 100% dichloromethane or until samples fully sank. Finally, samples were immersed in dibenzyl ether (DBE) for refractive index matching. Lightsheet imaging and 3D reconstruction Cleared whole-mount mouse brains were imaged using a LaVision BioTec Ultramicroscope II. Samples were immersed in a DBE-filled imaging chamber to maintain refractive index matching and imaged using a 2× zoom objective. The voxel resolution was 1.62 µm × 1.63 µm × 5 µm in the x-, y-, and z-axes, respectively. Image stacks (16-bit TIFF format) were stitched and reconstructed in 3D using Imaris software (Oxford Instruments). Quantification and statistical analysis Statistical analyses were performed using Prism 9 (GraphPad, San Diego, CA, USA), with tests selected based on Prism Software recommendations, and in consultation with the Statistical Support Core at Beth Israel Deaconess Medical Center. Nonparametric tests that avoid assumptions about data distributions or variances were used for all experiments. Statistical parameters, including sample size (n), arithmetic mean, standard error of the mean (mean ± SEM), statistical tests, and significance values, are reported in the Figures and Figure Legends. Statistical significance is indicated in figures as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; ns (not significant). Details on quantification and analysis of behavior, anatomy, fiber photometry, cystometry, and electromyography data are provided in the corresponding sections. Sample sizes were not predetermined by statistical methods but were chosen based on prior studies [ 25 , 27 ] and standard practices in animal behavior experiments. All animals were housed under identical conditions, and littermates were randomly assigned to experimental groups. Investigators scoring behavioral recordings were blinded to recording conditions. Animals were excluded from analysis if histological validation showed poor or absent reporter expression or excessive spread, with exclusion criteria established before data processing. Final sample sizes (n) reflect the number of validated animals per group. Resource availability Lead contact Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Anne M.J. Verstegen ( aversteg{at}bidmc.harvard.edu ). Materials availability Mouse lines generated in this study will be made available upon request but may require a completed material transfer agreement. Data and code availability This paper analyzes existing, publicly available data, accessible at the GEO database under accession code GSE226809 [ 33 ]. Processed snRNA-seq Bar datasets, the Seurat pipeline used for analysis, and associated metadata have been deposited on Zenodo and are publicly available under DOI 10.5281/zenodo.15225406 , as of the date of publication. Any additional data supporting the findings of this study, as well as custom scripts used for analysis, are available from the lead contact upon request. Author contributions Conceptualization: A.M.J.V. and N.K.; Methodology: N.K., A.M.J.V., and A.M.S.; Investigation: N.K., A.M.S., M.L., A.M.J.V., J.M., C.S., and R.L.; Formal analysis: N.K., A.M.S., M.L., A.M.J.V., and C.S.; Software: N.K., A.M.S., and J.M.; Writing – original draft: A.M.J.V., N.K. and C.S.; Writing – Review & Editing: A.M.J.V., N.K., A.M.S., C.S., M.L. and R.L.; Visualization: N.K., A.M.S., R.L. and A.M.J.V.; Data Curation: N.K. and A.M.J.V.; Supervision: N.K. and A.M.J.V.; Project Administration: A.M.J.V.; Funding acquisition: A.M.J.V. Acknowledgements The authors thank Dr. Linus Tsai, Dr. Christopher Jacobs, Harini Srinivasan, and the Functional Genomics and Bioinformatics Core at Beth Israel Deaconess Medical Center (BIDMC) for their assistance with snRNA-seq analysis; Dr. Da-qing Wang and the BIDMC Transgenic Core Facility for support in generating transgenic mouse lines; Dr. Clif Saper’s Lab for the generous use of shared confocal equipment, as well as BIDMC Confocal Imaging Core and Neurobiology Imaging Facility at Harvard Medical School for imaging resources. We thank the BIDMC Statistical Support Core for guidance with data analysis, and Dr. Mark Zeidel and members of the lab for helpful feedback and support throughout the project. This work was supported by NIH grants (NIDDK P20-DK119789, R01-DK113030, R01-DK125708). Funder Information Declared National Institute of Diabetes and Digestive and Kidney Diseases , P20-DK119789 , R01-DK113030 , R01-DK125708 Footnotes This version of the manuscript has been revised to address reviewer comments and to improve clarity, specificity, and overall presentation of the study. New experiments and analyses have been added, including intersectional targeting of spinally projecting Bar-Penk neurons, expanded characterization of spinal innervation patterns, additional analysis of Esr1 expression in Bar and projections, and expanded analysis of voiding behavior during MVT assay. The Results and Discussion have been updated accordingly to incorporate these additions, clarify the interpretation of Bar-Penk function in lower urinary tract control and connectivity, and to better address the limitations of the study. References 1. ↵ de Groat , W.C. , D. Griffiths , and N. Yoshimura , Neural control of the lower urinary tract . Compr Physiol , 2015 . 5 ( 1 ): p. 327 – 96 . OpenUrl PubMed 2. ↵ Rouzade-Dominguez , M.L. , et al. , Convergent responses of Barrington’s nucleus neurons to pelvic visceral stimuli in the rat: a juxtacellular labelling study . Eur J Neurosci , 2003 . 18 ( 12 ): p. 3325 – 34 . OpenUrl CrossRef PubMed Web of Science 3. ↵ P.J. Dyck De Groat , W.C. and A.M. Booth , Chapter 14 – Autonomic Systems to the Urinary Bladder and Sexual Organs , in Peripheral Neuropathy (Fourth Edition) , P.J. Dyck and P.K. Thomas , Editors. 2005 , W.B. Saunders : Philadelphia . p. 299 – 322 . 4. ↵ Marson , L. and A.Z. Murphy , Identification of neural circuits involved in female genital responses in the rat: a dual virus and anterograde tracing study . Am J Physiol Regul Integr Comp Physiol , 2006 . 291 ( 2 ): p. R419 – 28 . OpenUrl CrossRef PubMed 5. ↵ Holstege , G ., How the Emotional Motor System Controls the Pelvic Organs . Sexual Medicine Reviews , 2016 . 4 : p. 303 – 328 . OpenUrl CrossRef PubMed 6. ↵ Danziger , Z.C. and W.M. Grill , Sensory and circuit mechanisms mediating lower urinary tract reflexes . Auton Neurosci , 2016 . 200 : p. 21 – 28 . OpenUrl CrossRef PubMed 7. ↵ Roy , H.A. and A.L. Green , The Central Autonomic Network and Regulation of Bladder Function . Front Neurosci , 2019 . 13 : p. 535 . OpenUrl CrossRef PubMed 8. ↵ Barrington , F.J ., The effect of lesions of the hind– and mid-brain on micturition in the cat . Quarterly Journal of Experimental Physiology , 1925 . 15 : p. 81 – 102 . OpenUrl CrossRef 9. ↵ Tang , P.C. and T.C. Ruch , Localization of brainstem and diencephalic areas controlling the micturition reflex . The Journal of Comparative Neurology , 1956 . 106 ( 1 ): p. 213 – 45 . OpenUrl CrossRef PubMed Web of Science 10. ↵ Skelly , J. and A.J. Flint , Urinary Incontinence Associated with Dementia . Journal of the American Geriatrics Society , 1995 . 43 ( 3 ): p. 286 – 294 . OpenUrl CrossRef PubMed Web of Science 11. Nishii , H ., A Review of Aging and the Lower Urinary Tract: The Future of Urology . Int Neurourol J , 2021 . 25 ( 4 ): p. 273 – 284 . OpenUrl CrossRef PubMed 12. Welk , B. , et al. , Lower urinary tract dysfunction in uncommon neurological diseases: A report of the neurourology promotion committee of the International Continence Society . Continence , 2022 . 1 : p. 100022 . OpenUrl 13. Doelman , A.W. , et al. Assessing Neurogenic Lower Urinary Tract Dysfunction after Spinal Cord Injury: Animal Models in Preclinical Neuro-Urology Research . Biomedicines , 2023 . 11 , DOI: 10.3390/biomedicines11061539 . OpenUrl CrossRef 14. ↵ Leslie , S.W. , P. Tadi , and M. Tayyeb , Neurogenic Bladder and Neurogenic Lower Urinary Tract Dysfunction , in StatPearls . 2025 , StatPearls Publishing Copyright © 2025, StatPearls Publishing LLC .: Treasure Island (FL) . 15. ↵ Noto , H. , et al. , Electrophysiological analysis of the ascending and descending components of the micturition reflex pathway in the rat . Brain Research , 1991 . 549 : p. 95 – 105 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Blok , B.F.M. and G. Holstege , Direct projections from the periaqueductal gray to the pontine micturition center (M-region). An anterograde and retrograde tracing study in the cat . Neuroscience Letters , 1994 . 166 : p. 93 – 96 . OpenUrl CrossRef PubMed Web of Science 17. ↵ Satoh , K. , et al. , Descending projection of the nucleus tegmentalis laterodorsalis to the spinal cord: studied by the horseradisch peroxidase method following hydroxy-dopa adminstration . Neuroscience Letters , 1978 . 8 : p. 9 – 15 . OpenUrl CrossRef PubMed Web of Science 18. Blok , B.F.M. , H. deWeerd , and G. Holstege , The pontine micturition center projects to sacral cord GABA immunoreactive neurons in the cat . Neuroscience Letters , 1997 . 233 : p. 109 – 112 . OpenUrl CrossRef PubMed Web of Science 19. ↵ Blok , B.F. and G. Holstege , Ultrastructural evidence for a direct pathway from the pontine micturition center to the parasympathetic preganglionic motoneurons of the bladder of the cat . Neurosci Lett , 1997 . 222 ( 3 ): p. 195 – 8 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Blok , B.F.M. , J.T. Van Maarseveen , and G. Holstege , Electrical stimulation of the sacral dorsal gray commissure evokes relaxation of the external urethral sphincter in the cat . Neurosci Lett ., 1998 . 249 ( 1 ): p. 68 – 70 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Sie , J.A.L. , et al. , Ultrastructural Evidence for Direct Projections From the Pontine Micturition Center to Glycine-Immunoreactive Neurons in the Sacral Dorsal Gray Commissure in the Cat . The Journal of Comparative Neurology , 2001 . 429 : p. 631 – 637 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Reynolds , E ., Urination as a Social Response in Mice . Nature , 1971 . 234 ( 5330 ): p. 481 – 483 . OpenUrl CrossRef PubMed Web of Science 23. ↵ Hurst , J.L. and R.J. Beynon , Scent wars: the chemobiology of competitive signalling in mice . Bioessays , 2004 . 26 ( 12 ): p. 1288 – 98 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Hou , X.H. , et al. , Central Control Circuit for Context-Dependent Micturition . Cell , 2016 . 167 ( 1 ): p. 73 – 86 . OpenUrl CrossRef PubMed 25. ↵ Keller , J.A. , et al. , Voluntary urination control by brainstem neurons that relax the urethral sphincter . Nat Neurosci ., 2018 . 21 ( 9 ): p. 1229 – 1238 . OpenUrl CrossRef PubMed 26. ↵ Verstegen , A.M.J. , et al. , Barrington’s nucleus: Neuroanatomic landscape of the mouse “pontine micturition center” . The Journal of Comparative Neurology , 2017 . 525 : p. 2287 – 2309 . OpenUrl CrossRef PubMed 27. ↵ Verstegen , A.M.J. , et al. , Non-Crh glutamatergic neurons in Barrington’s nucleus control micturition via glutamatergic afferents from the midbrain and hypothalamus . Current Biology , 2019 . 29 ( 17 ): p. 2775 – 2789 . OpenUrl CrossRef PubMed 28. ↵ Vincent , S.R. and K. Satoh , Corticotropin-releasing factor (CRF) immunoreactivity in the dorsolateral pontine tegmentum” further studies on the micturition reflex system . Brain Research , 1984 . 308 : p. 387 – 391 . OpenUrl CrossRef PubMed Web of Science 29. ↵ Valentino , R.J. , et al. , Evidence for widespread afferents to barrington’s nucleus, a brainstem region rich in corticotropin-releasing hormone neurons . Neuroscience , 1994 . 62 ( 1 ): p. 125 – 143 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Ito , H. , et al. , Probabilistic, spinally-gated control of bladder pressure and autonomous micturition by Barrington’s nucleus CRH neurons . eLife , 2020 . 9 : p. e56605 . OpenUrl CrossRef PubMed 31. ↵ Vanderhorst , V.G. , J.A. Gustafsson , and B. Ulfhake , Estrogen receptor-alpha and –beta immunoreactive neurons in the brainstem and spinal cord of male and female mice: relationships to monoaminergic, cholinergic, and spinal projection systems . J Comp Neurol , 2005 . 488 ( 2 ): p. 152 – 79 . OpenUrl CrossRef PubMed Web of Science 32. ↵ Li , X. , et al. , Brainstem neurons coordinate the bladder and urethra sphincter for urination . 2024 , eLife Sciences Publications, Ltd . 33. ↵ Nardone , S. , et al. , A spatially-resolved transcriptional atlas of the murine dorsal pons at single-cell resolution . Nat Commun , 2024 . 15 ( 1 ): p. 1966 . OpenUrl CrossRef PubMed 34. ↵ Allen Mouse Brain Atlas Allen Institute for Brain Science , 2004 ; https://mouse.brain-map.org/ ]. 35. ↵ Geerling , J.C. and A.D. Loewy , Aldosterone-sensitive neurons in the nucleus of the solitary tract: efferent projections . J Comp Neurol , 2006 . 497 ( 2 ): p. 223 – 50 . OpenUrl CrossRef PubMed Web of Science 36. ↵ Shin , J.W. , et al. , FoxP2 brainstem neurons project to sodium appetite regulatory sites . J Chem Neuroanat , 2011 . 42 ( 1 ): p. 1 – 23 . OpenUrl CrossRef PubMed 37. Gasparini , S. , et al. , Aldosterone-sensitive HSD2 neurons in mice . Brain Struct Funct , 2019 . 224 ( 1 ): p. 387 – 417 . OpenUrl CrossRef PubMed 38. ↵ Gasparini , S. , et al. , Pre-locus coeruleus neurons in rat and mouse . Am J Physiol Regul Integr Comp Physiol , 2021 . 320 ( 3 ): p. R342 – r361 . OpenUrl CrossRef PubMed 39. ↵ Kawatani , M. , et al. , Downstream projection of Barrington’s nucleus to the spinal cord in mice . J Neurophysiol , 2021 . 40. ↵ Yao , J. , et al. , Simultaneous Measurement of Neuronal Activity in the Pontine Micturition Center and Cystometry in Freely Moving Mice . Frontiers in Neuroscience, methods , 2019 . 13 : p. 663 . OpenUrl CrossRef 41. ↵ Peng , C.W. , et al. , Role of pudendal afferents in voiding efficiency in the rat . Am J Physiol Regul Integr Comp Physiol , 2008 . 294 ( 2 ): p. R660 – 72 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Langdale , C.L. and W.M. Grill , Phasic activation of the external urethral sphincter increases voiding efficiency in the rat and the cat . Experimental Neurology , 2016 . 285 : p. 173 – 181 . OpenUrl CrossRef PubMed 43. ↵ Abud , E.M. , et al. , Spinal stimulation of the upper lumbar spinal cord modulates urethral sphincter activity in rats after spinal cord injury . Am J Physiol Renal Physiol , 2015 . 308 ( 9 ): p. F1032 – 40 . OpenUrl CrossRef PubMed 44. ↵ Karnup , S.V. and W.C. de Groat , Propriospinal Neurons of L3-L4 Segments Involved in Control of the Rat External Urethral Sphincter . Neuroscience , 2020 . 425 : p. 12 – 28 . OpenUrl CrossRef PubMed 45. ↵ LaPallo , B.K. , et al. , Spinal Transection Alters External Urethral Sphincter Activity during Spontaneous Voiding in Freely Moving Rats . J Neurotrauma , 2017 . 34 ( 21 ): p. 3012 – 3026 . OpenUrl CrossRef PubMed 46. ↵ Mukhopadhyay , S. and L. Stowers , Choosing to urinate. Circuits and mechanisms underlying voluntary urination . Curr Opin Neurobiol , 2020 . 60 : p. 129 – 135 . OpenUrl CrossRef PubMed 47. ↵ Nitti , V.W ., The prevalence of urinary incontinence . Rev Urol , 2001 . 3 Suppl 1 (Suppl 1): p. S2 – 6 . OpenUrl 48. ↵ Panicker , J.N. , et al. , The possible role of opiates in women with chronic urinary retention: observations from a prospective clinical study . J Urol , 2012 . 188 ( 2 ): p. 480 – 4 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Osman , N.I. and C.R. Chapple , Fowler’s syndrome—a cause of unexplained urinary retention in young women? Nature Reviews Urology , 2014 . 11 ( 2 ): p. 87 – 98 . OpenUrl PubMed 50. ↵ Rune , G.M. , et al. , Estrogen up-regulates estrogen receptor alpha and synaptophysin in slice cultures of rat hippocampus . Neuroscience , 2002 . 113 ( 1 ): p. 167 – 75 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Amateau , S.K. , et al. , Brain estradiol content in newborn rats: sex differences, regional heterogeneity, and possible de novo synthesis by the female telencephalon . Endocrinology , 2004 . 145 ( 6 ): p. 2906 – 17 . OpenUrl CrossRef PubMed Web of Science 52. ↵ Jung , J. , H.K. Ahn , and Y. Huh , Clinical and functional anatomy of the urethral sphincter . Int Neurourol J , 2012 . 16 ( 3 ): p. 102 – 6 . OpenUrl CrossRef PubMed 53. ↵ Fuller-Jackson , J.-P. , et al. , A 3D atlas of sexually dimorphic lumbosacral motor neurons that control and integrate pelvic visceral and somatic functions in rats . bioRxiv , 2024 : p. 2024.04.16.589836. 54. ↵ Rao , Y. , et al. , Ventrolateral Periaqueductal Gray Neurons Are Active During Urination . Front Cell Neurosci , 2022 . 16 : p. 865186 . OpenUrl CrossRef PubMed 55. ↵ Sammons , M. , et al. , Brain-body physiology: Local, reflex, and central communication . Cell , 2024 . 187 ( 21 ): p. 5877 – 5890 . OpenUrl CrossRef PubMed 56. ↵ Yang , C.F. , et al. , Sexually Dimorphic Neurons in the Ventromedial Hypothalamus Govern Mating in Both Sexes and Aggression in Males . Cell , 2013 . 153 ( 4 ): p. 896 – 909 . OpenUrl CrossRef PubMed 57. ↵ Monosov , I.E. , et al. , The zona incerta in control of novelty seeking and investigation across species . Current Opinion in Neurobiology , 2022 . 77 : p. 102650 . OpenUrl CrossRef PubMed 58. ↵ Kitta , T. , et al. , GABAergic mechanism mediated via D1 receptors in the rat periaqueductal gray participates in the micturition reflex: an in vivo microdialysis study . European Journal of Neuroscience , 2008 . 27 ( 12 ): p. 3216 – 3225 . OpenUrl CrossRef PubMed 59. ↵ Stone , E. , et al. , GABAergic control of micturition within the periaqueductal grey matter of the male rat . J Physiol , 2011 ( 589 ): p. 2065 – 2078 . OpenUrl CrossRef PubMed 60. ↵ Athwal , B.S. , et al. , Brain responses to changes in bladder volume and urge to void in healthy men . Brain , 2001 . 124 (Pt 2 ): p. 369 – 77 . OpenUrl CrossRef PubMed Web of Science 61. ↵ Hyun , M. , et al. , Social isolation uncovers a circuit underlying context-dependent territory-covering micturition . Proceedings of the National Academy of Sciences , 2021 . 118 ( 1 ): p. e2018078118 . OpenUrl CrossRef PubMed 62. ↵ Li , T. , et al. , A pontine center in descending pain control . Neuron , 2025 . 63. ↵ Krashes , M.J. , et al. , An excitatory paraventricular nucleus to AgRP neuron circuit that drives hunger . Nature , 2014 . 507 ( 7491 ): p. 238 – 42 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Harris , J.A. , et al. , Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation . Front Neural Circuits , 2014 . 8 : p. 76 . OpenUrl CrossRef PubMed 65. ↵ Vong , L. , et al. , Leptin Action on GABAergic Neurons Prevents Obesity and Reduces Inhibitory Tone to POMC Neurons . Neuron , 2011 . 71 : p. 142 – 154 . OpenUrl CrossRef PubMed Web of Science 66. ↵ Rousso , D.L. , et al. , Two Pairs of ON and OFF Retinal Ganglion Cells Are Defined by Intersectional Patterns of Transcription Factor Expression . Cell Rep , 2016 . 15 ( 9 ): p. 1930 – 44 . OpenUrl CrossRef PubMed 67. ↵ Lee , H. , et al. , Scalable control of mounting and attack by Esr1+ neurons in the ventromedial hypothalamus . Nature Research Letter , 2014 . 509 : p. 628 – 632 . OpenUrl 68. ↵ Roh , H.C. , et al. , Simultaneous Transcriptional and Epigenomic Profiling from Specific Cell Types within Heterogeneous Tissues In Vivo . Cell Rep , 2017 . 18 ( 4 ): p. 1048 – 1061 . OpenUrl CrossRef PubMed 69. ↵ Mo , A. , et al. , Epigenomic Signatures of Neuronal Diversity in the Mammalian Brain . Neuron , 2015 . 86 ( 6 ): p. 1369 – 84 . OpenUrl CrossRef PubMed 70. ↵ Madisen , L. , et al. , A robust and high-throughput Cre reporting and characterization system for the whole mouse brain . Nat Neurosci , 2010 . 13 ( 1 ): p. 133 – 40 . OpenUrl CrossRef PubMed Web of Science 71. ↵ Wolock , S.L. , R. Lopez , and A.M. Klein , Scrublet: Computational Identification of Cell Doublets in Single-Cell Transcriptomic Data . Cell Systems , 2019 . 8 ( 4 ): p. 281 – 291 .e9. OpenUrl PubMed 72. Hafemeister , C. and R. Satija , Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression . Genome Biology , 2019 . 20 ( 1 ): p. 296 . OpenUrl CrossRef PubMed 73. ↵ Quadros , R.M. , et al. , Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteins . Genome Biol , 2017 . 18 ( 1 ): p. 92 . OpenUrl CrossRef PubMed 74. ↵ Miura , H. , et al. , Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors . Nature Protocols , 2018 . 13 ( 1 ): p. 195 – 215 . OpenUrl PubMed 75. ↵ Pinkert , C.A. and I.A. Trounce , Production of transmitochondrial mice . Methods , 2002 . 26 ( 4 ): p. 348 – 357 . OpenUrl CrossRef PubMed Web of Science 76. Ittner , L.M. and J. Götz , Pronuclear injection for the production of transgenic mice . Nat Protoc , 2007 . 2 ( 5 ): p. 1206 – 15 . OpenUrl CrossRef PubMed 77. ↵ Delerue , F. and L.M. Ittner , Generation of Genetically Modified Mice through the Microinjection of Oocytes . JoVE , 2017 ( 124 ): p. e55765 . OpenUrl 78. Thestrup , T. , et al. , Optimized ratiometric calcium sensors for functional in vivo imaging of neurons and T lymphocytes . Nature Methods , 2014 . 11 ( 2 ): p. 175 – 182 . OpenUrl PubMed 79. Chen , T.W. , et al. , Ultra-sensitive fluorescent proteins for imaging neuronal activity . Nature , 2013 . 499 : p. 295 – 300 . OpenUrl CrossRef PubMed Web of Science 80. ↵ Zhang , Y. , GCaMP8 Fast Genetically Encoded Calcium Indicators . doi: 10.25378/janelia.13148243.v4 , 2020 . OpenUrl CrossRef 81. ↵ Zingg , B. , et al. , AAV-Mediated Anterograde Transsynaptic Tagging: Mapping Corticocollicular Input-Defined Neural Pathways for Defense Behaviors . Neuron , 2017 . 93 : p. 33 – 47 . OpenUrl CrossRef PubMed 82. ↵ Klapoetke , N.C. , et al. , Independent optical excitation of distinct neural populations . Nat Methods , 2014 . 11 ( 3 ): p. 338 – 46 . OpenUrl CrossRef PubMed Web of Science 83. Ciabatti , E. , et al. , Life-Long Genetic and Functional Access to Neural Circuits Using Self-Inactivating Rabies Virus . Cell , 2017 . 170 : p. 382 – 392 . OpenUrl CrossRef PubMed 84. ↵ Osakada , F. , et al. , New rabies virus variants for monitoring and manipulating activity and gene expression in defined neural circuits . Neuron , 2011 . 71 ( 4 ): p. 617 – 31 . OpenUrl CrossRef PubMed Web of Science 85. ↵ Verstegen , A.M.J. , et al. , Micturition video thermography in awake, behaving mice . Journal of Neuroscience Methods , 2020 . 331 : p. 108449 . OpenUrl CrossRef PubMed 86. Schneider , C.A. , W.S. Rasband , and K.W. Eliceiri , NIH image to imageJ: 25 years of image analysis . nat methods , 2012 . 9 ( 7 ): p. 671 – 675 . OpenUrl CrossRef PubMed Web of Science 87. ↵ Manvich , D.F. , et al. , The DREADD agonist clozapine N-oxide (CNO) is reverse-metabolized to clozapine and produces clozapine-like interoceptive stimulus effects in rats and mice . Sci Rep , 2018 . 8 ( 1 ): p. 3840 . OpenUrl CrossRef PubMed 88. ↵ Jendryka , M. , et al. , Pharmacokinetic and pharmacodynamic actions of clozapine-N-oxide, clozapine, and compound 21 in DREADD-based chemogenetics in mice . Sci Rep , 2019 . 9 ( 1 ): p. 4522 . OpenUrl CrossRef PubMed 89. ↵ Paxinos , G. and K.B.J. Franklin , Paxinos and Franklin’s the mouse brain in stereotaxic coordinates . 4th ed. ed. Mouse brain in stereotaxic coordinates . 2013 , Amsterdam ;: Elsevier Academic Press . 90. ↵ Habart , M. , et al. , An optimized iDISCO+ protocol for tissue clearing and 3D analysis of oxytocin and vasopressin cell network in the developing mouse brain . STAR Protocols , 2023 . 4 ( 1 ): p. 101968 . OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted May 04, 2026. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following “Enkephalinergic Neurons in Barrington’s Nucleus Gate Sex-Biased Control of Micturition” Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share “Enkephalinergic Neurons in Barrington’s Nucleus Gate Sex-Biased Control of Micturition” Nataliya Klymko , Andrea M. Sartori , Mihoko Leon , Cassandra N. Seifert , Richard Lee , John C. Mathai , Anne M.J. Verstegen bioRxiv 2025.05.16.654570; doi: https://doi.org/10.1101/2025.05.16.654570 Share This Article: Copy Citation Tools “Enkephalinergic Neurons in Barrington’s Nucleus Gate Sex-Biased Control of Micturition” Nataliya Klymko , Andrea M. Sartori , Mihoko Leon , Cassandra N. Seifert , Richard Lee , John C. Mathai , Anne M.J. Verstegen bioRxiv 2025.05.16.654570; doi: https://doi.org/10.1101/2025.05.16.654570 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13894) Bioinformatics (41951) Biophysics (21455) Cancer Biology (18592) Cell Biology (25507) Clinical Trials (138) Developmental Biology (13380) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24321) Genetics (15610) Genomics (22509) Immunology (17737) Microbiology (40398) Molecular Biology (17182) Neuroscience (88618) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7641) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)