Shank3 forms a complex with Gal-3 and ZBP-1 to alleviate PANoptosis in TIA of female ovariectomized mice

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Selective neuron death or loss, which induced by specific pathogen- and damage-associated molecular patterns (PAMPs and DAMPs), was the main reason results in high morbidity, disability, and mortality of transient ischemic attack (TIA) in man and postmenopausal women. Shank3, a key postsynaptic density, is correlated with synaptic dysfunction, oxidative stress, inflammatory, apoptosis and poor outcomes in ischemic stroke, although its role in menopausal women TIA remains elusive. Here we discovered that Shank3 direct binds Gal-3, a positive regulator of aging and inflammation, then regulates innate immune sensors ZBP-1, to drive inflammatory signaling and inflammatory cell death, PANoptosis, during TIA. Base on the defeminization TIA models (a stable female mouse OVX + TIA model was first established as well as an in vitro cultured primary neuron desexualization + tOGD/R model), blockade of Shank3 amplify neuron PANoptosis, oxidative stress and inflammation, arouse persistent behavioral deficits and infarction formation, which does not appear in de-estrogen combination with TIA damage mice. We also observed that Shank3, Gal-3 and ZBP-1 were members of a large multi-protein complex along with Caspase 3, 7, 8, 9, 1, NLRP 3, GSDMD, GSDME, RIPK 1, RIPK 3 and MLKL that drove neuronal-special PANoptosis. In addition, administration of a natural inflammatory inhibitor, D-allose, used for food sweetener, produces anti-PANoptosis effects via activating Shank3 but inhibiting Gal-3 and ZBP-1. Collectively, our findings establish a previously unknown regulatory connection and molecular interaction among Shank3, Gal-3 and ZBP-1 as a driver of neuron-specific PANoptosis in postmenopausal female TIA, and reveal activate of Shank3, such as, D-allose, maybe a potential strategy to halt neuronal loss during TIA.
Full text 196,820 characters · extracted from preprint-html · click to expand
Shank3 forms a complex with Gal-3 and ZBP-1 to alleviate PANoptosis in TIA of female ovariectomized mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Shank3 forms a complex with Gal-3 and ZBP-1 to alleviate PANoptosis in TIA of female ovariectomized mice Lei Zhang, Yaowen Luo, Jimeng Zhang, junkai cheng, Zheming Yue, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5824207/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Selective neuron death or loss, which induced by specific pathogen- and damage-associated molecular patterns (PAMPs and DAMPs), was the main reason results in high morbidity, disability, and mortality of transient ischemic attack (TIA) in man and postmenopausal women. Shank3, a key postsynaptic density, is correlated with synaptic dysfunction, oxidative stress, inflammatory, apoptosis and poor outcomes in ischemic stroke, although its role in menopausal women TIA remains elusive. Here we discovered that Shank3 direct binds Gal-3, a positive regulator of aging and inflammation, then regulates innate immune sensors ZBP-1, to drive inflammatory signaling and inflammatory cell death, PANoptosis, during TIA. Base on the defeminization TIA models (a stable female mouse OVX + TIA model was first established as well as an in vitro cultured primary neuron desexualization + tOGD/R model), blockade of Shank3 amplify neuron PANoptosis, oxidative stress and inflammation, arouse persistent behavioral deficits and infarction formation, which does not appear in de-estrogen combination with TIA damage mice. We also observed that Shank3, Gal-3 and ZBP-1 were members of a large multi-protein complex along with Caspase 3, 7, 8, 9, 1, NLRP 3, GSDMD, GSDME, RIPK 1, RIPK 3 and MLKL that drove neuronal-special PANoptosis. In addition, administration of a natural inflammatory inhibitor, D-allose, used for food sweetener, produces anti-PANoptosis effects via activating Shank3 but inhibiting Gal-3 and ZBP-1. Collectively, our findings establish a previously unknown regulatory connection and molecular interaction among Shank3, Gal-3 and ZBP-1 as a driver of neuron-specific PANoptosis in postmenopausal female TIA, and reveal activate of Shank3, such as, D-allose, maybe a potential strategy to halt neuronal loss during TIA. Biological sciences/Neuroscience/Cell death in the nervous system Biological sciences/Molecular biology/Proteomics/Protein–protein interaction networks Shank3 Galectin-3 Z-conformation nucleic acid binding protein-1 PANoptosis D-allose transient ischemic attack ovariectomy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction More and more evidences suggested that one of specific pathogen- and damage-associated molecular patterns (PAMPs and DAMPs), temporary narrow and/or blockage of a cerebral artery results in transient (less than 24h) neurological dysfunction is reversible after transient ischemic attack (TIA), but the focal brain tissues may often suffer permanent insults and developed ischemic stroke (IS), especially selective neuron death or loss was reported in both experimental and clinical study [ 1 – 4 ] . Growing reviews showed that lots of cell occur PANoptosis, including pyroptosis, apoptosis, and necroptosis, in both homeostasis and disease, such as, infection, cancer, and IS [ 5 ] . However, surprisingly little is known of the role and regulation mechanism of neuronal PANoptosis in TIA damage. Moreover, PANoptosis were the most genetically well-defined programmed cell death (PCD) pathways regulated by the multifaceted PANoptosome complex (different critical initiators, effectors and executioners) via extensive crosstalk and regulate each other in cells [ 6 – 8 ] . Z-conformation nucleic acid binding protein-1 (ZBP-1), a powerful innate immune sensor, has been shown to induce PANoptosis to eliminate infected cells, prevent tumorigenesis, as well as improve the prognosis of IS, and so on [ 9 , 10 ] . Therefore, understanding the PANoptosome complex induced neuron-special PANoptosis is essential for developing targeted therapies of TIA. Of note, TIA is a critical early warning sign for IS in middle-aged and old human, which occurs in men compared with women, but women have worse functional outcomes than men after TIA, nonfecal or atypical stroke symptoms, for example, confusion, impaired consciousness, mental status change, and headache, and so on [ 11 , 12 ] . Also, giving evidences showed that high morbidity, disability, and mortality of ischemic stroke (IS), which induced by TIA in postmenopausal women than that of premenopausal female [ 13 ] . Although some reports indicated that hormone replacement therapy (HRT) is an effective therapeutic strategy for ovariectomized (OVX) animals and menopausal female, but long-term HRT enhances the risks of thromboembolic disease, cardiovascular disease, breast tumor, and endometrial cancer [ 14 ] . More seriously, no differences in IS rate and in mortality of HRT was certified in many randomized controlled trials of cardio-and/or cerebrovascular-disease prevention, furthermore, a higher stroke risk was found in the first year of HRT treatment [ 15 ] . As such, to understanding better the pathophysiology and mechanisms contributing to the sex and outcomes differences in postmenopausal women TIA of other than sex hormones, and to explore novel potential targeting molecular and effective therapy to be used in such mild transient ischemic injury are urgency and necessity. Shank3, a typical synaptic scaffolding protein, which located at the postsynaptic density of glutamatergic synapses of neurons, cardiomyocyte, liver cells and renal cell [ 16 ] , is known to sense signals of excitatory synapses and alleviate neuron-specific apoptosis and autophagy in IS and myocardial infarction via activation of inflammation and oxidative stress [ 17 – 19 ] . However, several critical functions involve cell death and inflammation for Shank3 beyond its canonically described role in dendritic spine and synapses development have been observed that cannot be explained by our current understanding of the Shank3. Shank3, a typical autism spectrum disorder (ASD)-related gene, which located at the postsynaptic density of glutamatergic synapses of neurons, cardiomyocyte, liver cells and renal cell [ 16 ] , alleviate neuron-specific apoptosis and autophagy in IS and myocardial infarction via activation of inflammation and oxidative stress [ 17 , 19 , 20 ] . Moreover, papers suggested that the morbidity of ASD caused by Shank3 was not related to sex differences in vivo [ 21 ] , conversely, other literature reported that Shank3 accounting for more severe ASD symptoms in males than females, but high mortality in females than men [ 22 , 23 ] . These data suggested Shank3 may be a driving factor, which related to gender differences, playing an important role in the development and outcomes of ASD. However, the effects and mechanism of Shank3 in TIA of postmenopausal female is unclear. However, whether there exists a special molecular mechanism for neuron death and inflammation of Shank3 in TIA of postmenopausal female remains elusive. In this work, based on the defeminization TIA models in vivo and transient oxygen glucose deprivation/ reperfusion (tOGD/R) model in vitro, which successfully mimic TIA in human, our results revealed that Shank3 promoted neuronal-special PANoptosis through directly binding Galectin-3 (Gal-3) to subsequent activation of Z-DNA-binding protein-1 (ZBP-1), accounting for more severe TIA in postmenopausal women than premenopausal female. Therefore, Shank3/Gal-3/ZBP-1 signaling axis as an important mechanism underlying D-allose anti-PANoptosis activity and that the overexpression of Shank3 through the development of targeted agonists may be a potential therapeutic strategy for improving the anti-PANoptosis efficacy of HRT in TIA of postmenopausal women treatment. Materials and Methods 1. Animals C57BL/6 female mice (20–25 g, 8 months old) were purchased from the Animal Centre of the Air Force Medical University, and Shank3 flox/flox /Emx1-Cre +/− (20–25 g, 8 months old) based on the genetic background of C57BL/6 at Cyagen Biosciences Inc. All animals were housed under consistent controlled environmental conditions. This study was performed following the National Institutes of Health (NIH) Guide for the Use of Laboratory Animals for all experimental protocols and animal handling procedures and was approved by the Animal Care and Use Committee of the Air Force Medical University (No. IACUC-20230227). Transgenic mice tail genomic DNA was identified by polymerase chain reaction analysis (PCRA) using the following primary primers (Table 1 ). Table 1 PCRA primer sequence Gene Primer sequence(5′-3′) Shank3 flox F: TTTTCTGTCTGTGGTATAAGCTGC R: CTATGACATGACTTTGCCTTCCAG Cre F 1: TTCCTCCTCTCCTGACTACTCCCAG F 2: GTGAAGGTGTGGTTCCAGAATCGG R: CTCTTGTCCCTCTGACAGTGATGGC 2. OVX and TIA modal The OVX procedure was performed through a dorsolateral incision, as previously described [ 24 ] . After the OVX procedure, vaginal smears and blood estrogen tests were performed for 14 days to confirm the success of the OVX procedure and the cessation of the estrous cycle. As described in a previous study [ 4 , 25 ] , our study successfully established a mouse TIA model by middle cerebral artery occlusion (MCAO). General anesthesia was induced with 5% isoflurane (RWD Life Science, Shenzhen, China) before surgery, and anesthesia was maintained by inhalation of 2% isoflurane through a face mask during surgery. A midline skin incision was performed to expose the left common carotid artery (CCA). Then, a nylon monofilament suture (0.12 mm diameter; 3.0 cm length, RWD Life Science, Shenzhen, China) was inserted from the left CCA to the origin of the middle cerebral artery (MCA). Local cerebral blood flow (rCBF) was monitored using Cerebral Blood Flow Measurement by Laser Speckle Contrast Imaging (LSCI). The filaments were removed after 8 minutes and reperfusion was performed. D-allose (Kagawa University, Japan) at different concentrations dissolved in saline, was injected intraperitoneally within 5 minutes after reperfusion. The dosage used in this study was determined based on our primary experiments and previous studies [ 26 ] . 3. Cerebral Blood Flow Measurement by Laser Speckle Contrast Imaging The LSCI (RWD Life Science, Shenzhen, China) was used to observe the regional Cerebral Blood Flow (CBF). The mouse head was fixed on the stereotaxic device under isoflurane anesthesia. After disinfection, the scalp was cut longitudinally to fully expose the skull. The skull was wiped with a saline cotton ball to keep it moist. Subsequently, the mice were placed under the LSCI system to observe their CBF images. The raw images were processed by real-time blood flow algorithms, which directly converted the raw images into blood flow velocity information. Data processing was performed using the image software that comes with the system. A wide region of interest (ROI) was set within the MCA blood supply to measure CBF. CBF images were acquired before surgery (baseline), MCAO, as well as CBF images within 5 minutes and 24 hours of reperfusion. 4. Cell culture and the transient oxygen–glucose deprivation and reperfusion model Primary hippocampal neuronal cells were extracted from C57BL/6 fetal mice. 0.05% poly-lysine (A3890401, Gibco, USA) was added to the culture plate 24 h in advance and rinsed 3 times with PBS before use. Hippocampal tissues were minced with sterile ophthalmic shears, digested with 0.25% trypsin for 3 min at 37°C, and then centrifuged at 1000 rpm for 5 min. The digested brain tissues were cultured in Neurobasal medium (21103049, Gibco, USA) containing 2% B27 (A3653401, Gibco, USA), 1% L-glutamic acid (25030081, Gibco, USA), and 1% penicillin/streptomycin (15140148, Gibco, USA), in an environment of 37°C, 5% CO2. Stable nerve cells are obtained after 7 days of culture. Neuronal cells were identified by morphological analysis and MAP-2 (1:50, #4542, Cell Signaling Technology, USA) staining. The estrogen receptor inhibitor Fulvestrant (GC18000, GlpBio, USA) and PHTPP (GC11863, GlpBio, USA) were added to the cell culture after maturation and cultured for 4 days to mimic the in vitro OVX model. To induce transient oxygen-glucose deprivation (tOGD), the medium was aspirated and the cells were rinsed three times with phosphate-buffered saline (PBS). Glucose-free Neurobasal medium (A2477501, Gibco, USA) was added, and cultured cells were placed in a special chamber containing CO2/N2 (5%/95%) at 37°C and pretreated with N2/ CO2 (95%/5%) to remove other gases. Cells were removed from the hypoxic chamber according to the experimental design. Glucose-free Neurobasal was then replaced with Neurobasal medium and reoxygenated with CO2/O2/N2 (5%/21%/74%) under normoxic conditions for 24 h to induce reperfusion injury. Control cells were cultured under normal conditions with simultaneous fluid exchange. During reoxygenation, different concentrations of D-allose dissolved in PBS were added to the culture medium. 5. Neurological score evaluation Mice were scored before surgery, immediately after surgery, and at 24 hours of reperfusion. The severity of neurological damage in experimental animals was assessed using the Modified Neurological Severity Score (mNSS) [ 27 , 28 ] . The extent of neurological deficits is scored on a scale of 0 to 18, with higher scores indicating greater damage. 6. Infraction volume ratio measurement Mice were executed by intraperitoneal injection of excess pentobarbital sodium. The brains were sliced into 2 mm coronal sections with an even thickness. Staining was performed using 2% solution of 2,3,5-triphenyl tetrazolium chloride (TTC) (G3005, Solarbio, Beijing, China) for 20 min at 37°C [ 29 ] . Stained brain sections were fixed in 2% paraformaldehyde and imaged, after which the percentage of infarct volume (white) was analyzed using ImageJ software (National Institutes of Health, USA). Infarct volume was calculated by multiplying the total infarct area by the thickness of the section (2 mm). The ratio of the infarct volume to the total brain volume indicates cerebral infarction. 7. TUNEL staining Neuronal apoptosis was quantitatively evaluated by NeuN and TUNEL co-staining. TUNEL staining Kit (C1088, Beyotime, Shanghai, China) according to the manufacturer's instructions [ 30 ] , followed by co-staining to label neurons. Briefly, frozen sections were rinsed in phosphate-buffered saline (PBS). Sections were blocked with 10% bovine serum albumin (BSA) containing 0.25% Triton X-100 for 30 min, and sections were incubated in the dark for 1 h at 37°C in a TUNEL reaction mixture. Sections were incubated with rabbit anti-NeuN primary antibody (1:200; Cell Signaling Technology, USA) overnight at 4°C. Then fluorescent staining was performed with goat anti-rabbit IgG secondary antibody (1:200; KFA001, Proteintech Group, China) for 1 h at room temperature, followed by staining of nuclei with 4′,6-diamidino-2-phenylindole (DAPI) (P0131, Beyotime, Shanghai, China). Images were obtained using a fluorescence microscope (Olympus, Tokyo, Japan). At least three microscope fields were randomly selected to analyze each section. The number of TUNEL/NeuN double-positive cells and DAPI labeled cells in each section were counted, and the percentage of double-positive cells relative to the total number of NeuN single-positive labeled cells was calculated. The results were expressed as an apoptotic index. 8. Behavioral tests New object recognition experiment: Mice were stroked daily for 1 week before the start of the experiment to eliminate the feeling of unfamiliarity, and were kept next to the experimental setup for 1 day before the start of the experiment to avoid stimulation of the mice during manipulation. At the beginning of the experiment, the mice were allowed to move freely for 10 min in a cube with a base of 50 cm × 50 cm, then two identical objects (A and B, make sure that the objects do not have an odor and immovable) were placed in the apparatus, about 10 cm from the two side walls, and the mice were placed in the apparatus with their backs facing the objects at equal distances from the objects, and the exploration time of the mice on each of the objects was recorded with a video camera. The mice were placed in the device with their backs facing the objects at equal distances from the objects, and the exploration time of the mice on each object was recorded with a video camera (the time spent on each object was counted as the time spent on the object when the mouse's mouth or nose touched the object, and when the mouse approached the object to 2–3 cm). One hour after the initial test, one of the two objects was replaced by a different object, and the mice were placed in the device with their backs facing the object at an equal distance from the object, and the time spent exploring each object within 5 min was recorded with a video camera. We used analytical software (Smart 3.0, Harvard Apparatus, USA) and manual checking for the statistics. Fatigue baton test: Before to modeling, all mice were pre-trained for 3 d on a fatigue baton test, to select mice that would be able to adapt to this type of locomotion under the same conditions during the behavioral test. Mice were first placed on a stationary rotating bar for 180 s for environmental adaptation, then accelerated from 5 r/min to 40 r/min for 300 s. Mice dropped during training were placed back on the rotating bar until the end of training. The training was performed 3 times/d with an interval of 300 s. After 3 d of training, most mice were dropped for more than 300 s. The animals were placed on the rotary bar at the same time. The animals were placed on the stationary rotor bar for 180 s. Then the rotational speed was accelerated from 5 r/min to 40 r/min for 300 s and continued until 300 s. The time of the 1st fall from the rotating bar was recorded, and 2 passive rotations, i.e., holding the rotating bar instead of walking on it, were a fall. Each animal was tested 3 times per test at 5 min intervals, and the average value was taken. 9. Analysis of cell viability Cell vitality was assessed using the Cell Counting Kit-8 (CCK-8) assay (AC0011S, Accuref scientific, Xi'an, China) according to the manufacturer's instructions. Neuronal cells were inoculated in 96-well plates under normal conditions until the experiment. After OGD of the cells for some time, they were re-cultured normally for 24 hours. 10 µl of CCK-8 reagent was added to each well and incubated at 37°C for 1 h. The optical density (OD) value at 450 nm was determined using a microplate reader (Bio-Rad, Hercules, California, USA). 10. Lactate dehydrogenase (LDH) release assay The release of LDH in the cytoplasm indicates disruption of cell membrane integrity, which implies cellular damage [ 31 ] . LDH levels in cell supernatants were quantified using the LDH kit (AM0211, Accuref scientific, Xi'an, China) according to the instructions provided by the manufacturer. Cell culture medium was added to optically clear 96-well plates for subsequent coupled enzymatic reactions. The LDH reaction solution was added, mixed thoroughly, and incubated at 37°C for 30 min to obtain a brown-red product. The absorbance of the product was determined spectrophotometrically at 450 nm using an enzyme marker (Bio-Rad, Hercules, California, USA). 11. Detection of cell viability and cytotoxicity using Calcein AM/PI Cells were incubated in 3 cm dishes. After treating the cells, the medium was discarded, the cells were washed once with PBS, and 1 ml of Calcein AM/PI (C2015S, Beyotime, Shanghai, China)working solution was added [ 32 ] . Cells were incubated in the dark room at 37°C for 30 min, and the staining effect was observed under the fluorescence microscope (Tokyo, Japan) after the incubation. The cell survival rate was calculated. 12. Measurement of ROS ROS levels were measured in mouse brain tissue using 2′,7′ dichlorodihydrofluorescein (DCFH-DA) (Elabscience, Cat# EBCK138-F, China). DCF accumulation was measured using a fluorescence microtiter plate instrument (FLx800, BioTek, USA) at an excitation wavelength of 500 nm and an emission wavelength of 525 nm. ROS levels in neuronal cells (SIBS Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were measured using the Cell Meter Fluorescent Intracellular Total ROS Activity Assay Kit (AAT Bioquest, Cat# 22900, USA). Fluorescence detection was performed using a fluorescence microtiter plate instrument (FLx800, BioTek, USA) with an excitation wavelength of 650 nm and an emission wavelength of 675 nm. cells were imaged using a laser scanning confocal microscope (FV1000, Olympus, Japan). 13. Transmission electron microscopy Mice were euthanized, and the hippocampal region of the brain was dissected, cut into small pieces, and fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer overnight at 4°C. Then, they were fixed in 1% osmium tetroxide phosphate buffer for 1.5 h, dehydrated through a graded ethanol series, and embedded in Epon812. Ultrathin sections (70 nm) were prepared, stained with uranyl acetate and lead citrate, and examined using an electron microscope (JEOL-1200EX, Jinan Weiya Biotechnology Co., Ltd, Jinan, China). 14. RT-PCR Total RNA was extracted from mouse brains and cells using TRIzol reagent (Sigma Aldrich, USA). cDNA was synthesized by quantifying RNA concentration and reverse transcribing Master Mix (Takara, Tokyo, Japan). mRNA expression was analyzed on a thermal cycler (Bio-Rad, Hercules, California, USA) using SYBR Premix Ex Taq TM II (Takara, Tokyo, Japan) and synthetic primers. Relative mRNA expression was calculated by the 2 −ΔΔCt method after normalization concerning GAPDH expression [ 33 ] . The primers used for real-time fluorescence quantitative PCR in this study are shown in the Table 2 . Table 2 RT-qPCR primer sequence Gene Primer sequence(5′-3′) Base Lgals3 F: CCCTTTGAGAGTGGCAAACCA R: CATCGTTGACCGCAACCTT 21 19 GAPDH F: GGTGAAGGTCGGTGTGAACG R: CTCGCTCCTGGAAGATGGTG 20 20 Shank3 F: ACGAAGTGCCTGCGTCTGGAC 21 R: CTCTTGCCAACCATTCTCATCAGTG 24 ZBP-1 F: GAAGGCCAAGACATAGCTCATT 22 R: GATGTGGCTGTTGGCTCCTT 20 15. Western blot analysis Radioimmunoprecipitation assay (RIPA) (AP0231, Accuref scientific, Xi'an, China) lysis, extraction buffer containing 1% Phenylmethanesulfonyl fluoride (PMSF) (ST506, Beyotime, Shanghai, China), and 1% Phosphatase inhibitors (AP0431, Accuref scientific, Xi'an, China) was used to extract total protein from damaged tissue and cells. The nuclear and cytoplasmic proteins were extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (P0027, China Beyotime, Shanghai, China) and 1% PMSF (ST506, Beyotime, Shanghai, China), respectively, according to the instructions provided by the reagent vendor. Protein quantification was performed using a BCA kit (P0010, Beyotime, Shanghai, China). Equal amounts of proteins were separated from each sample using 8–12% sodium dodecyl sulfate SDS-PAGE gels and subsequently transferred to polyvinylidene difluoride (PVDF) (IPFL00005, Millipore, USA) membranes. The membranes were then blocked with a rapid closure solution (AP0291L, Accuref scientific, Xi'an, China) for 15 min at room temperature, followed by overnight incubation on a shaker with the specific primary antibody HIF-1β (1:1000, #5537, Cell Signaling Technology, USA), Shank3 (1:1000, GTX133133, GeneTex, USA), Galectin-3 (1:1000, A13506, ABclonal Technology, China), ZBP-1 (1:1000, sc-271483, SANTA CRUZ, USA), Caspase 9 and Cleaved-Caspase 9 (1:1000, 10380-1-AP, Proteintech Group, China), Caspase 8 and Cleaved-Caspase 8 (1:1000, 13423-1-AP, Proteintech Group, China), Caspase 7 and Cleaved-Caspase 7 (1:1000, 27155-1-AP, Proteintech Group, China), Caspase 3 and Cleaved-Caspase 3 (1:1000, 19677-1-AP, Proteintech Group, China), Caspase 1 and Cleaved-Caspase 1 (1:1000, A16792, ABclonal Technology, China), RIPK 1 (1:1000, A7414, ABclonal Technology, China), P-RIPK 1 (1:1000, AP1230, ABclonal Technology, China), RIPK 3 (1:1000, A5431, ABclonal Technology, China), P-RIPK 3 (1:1000, AP1408, ABclonal Technology, China), MLKL (1:1000, A21894, ABclonal Technology, China), P-MLKL (1:1000, AP1255, ABclonal Technology, China), NLRP 3 (1:1000, DF7438, Affinity Biosciences Pty Ltd, Australia), GSDMD and N-GSDMD (1:1000, SC393581, SANTA CRUZ, USA), GSDME and N-GSDME (1:1000, A7432, ABclonal Technology, China), β-actin (1:1500, 81115-1-RR, Proteintech Group, China), Lamin b1 (1:1000, 12987-1-AP, Proteintech Group, China), Anti-Ubiquitin (linkage-specific K48) (1:1000, ab140601, abcam, USA) at 4°C. Subsequently, the membranes were washed three times with TBST and then incubated with HRP-conjugated secondary antibodies (1:10000, RGAM001, Proteintech Group, China) in TBST for 1 h at room temperature using a decolorizing shaker. The protein bands were visualized using an ECL substrate (WBKLS, Millipore, USA) and imaged by a detection system (Bio-Rad, Hercules, California, USA). The optical density of the bands was scanned and quantified using image analysis software (ImageJ Software, National Institutes of Health, USA) for β-actin and Lamin b1 as an internal control. 16. Flow cytometry test Neural cells were inoculated in 25 cm 2 cell culture flasks, and randomly grouped, and the cells were treated according to the experimental requirements, and the number of apoptotic sample cells must not be less than 1×10 6 . Cells were collected after digestion with EDTA-free Trypsin (T1350, Solarbio, Beijing, China). Add 300 µL of Binding Buffer to resuspend the cells. Add 5 µL of Annexin V FITC solution (AB_2869082, BD Biosciences, USA) and incubate for 15 min at room temperature away from light. 5 µL of PI solution (AB_2869082, BD Biosciences, USA) should be added 5 min before mounting. Add 200 µL of Binding Buffer and perform fluorescence detection by flow cytometry. 17. Immunohistochemistry Mice were anesthetized and perfused transcranial with heparin saline, followed immediately by a 4% formaldehyde solution. Brain tissues were removed, fixed, dehydrated, and subsequently sectioned into coronal sections of 16 µm thickness (Leica, Wetzlar, Germany). Neural cells were cultured on 6-well plate cell slides and fixed in 4% paraformaldehyde for 15 min at room temperature. Brain sections were rinsed in PBS for 30 min, and cells were rinsed in PBS for 10 min. samples were permeabilized with 0.1% Triton X-100 in PBS for 10 min, blocked with 5% bovine serum albumin (BSA) for 30 min at room temperature, and then rinsed three times in PBS. Sections were incubated overnight at 4°C with specific antibodies Gal-3 (1:200, A13506, ABclonal Technology, China), NeuN (1:200, #24307, Cell Signaling Technology, USA), P-TDP 43 (1:200, 66318-1-Ig, Proteintech Group, China), Caspase 3 (1:200, 19677-1-AP, Proteintech Group, China), Caspase 1 (1:100, A16792, ABclonal Technology, China), RIPK 1 (1:100, A7414, ABclonal Technology, China), Shank3 (1:200, GTX133133, GeneTex, USA), ZBP-1 (1:100, sc-271483, SANTA CRUZ, USA), β-actin(1:1000, 81115-1-RR, Proteintech Group, China), NESTIN (1:200, ab22035, Abcam, USA), OCT 4 (1:100, ab19857, Abcam, USA), DCX (1:50, ab22035, Abcam, USA), TUJ 1 (1:200, ab18207, Abcam, USA), SOX 2 (1:200, ab97959, Abcam, USA), Map 2 (1:50, #4542, Cell Signaling Technology, USA), Hu (1:100, ab191181, Abcam, USA). After washing in PBS for 3 × 10 min, the cells were incubated with fluorescent secondary antibody (1:200; RGAR002/RGAR004, Proteintech Group, China) for 1 h at 37°C. Finally, the nuclei were stained with a stain containing DAPI (P0131, Beyotime, Shanghai, China). Immunofluorescence images were taken using an Olympus fluorescence microscope (Tokyo, Japan). Three random regions of each sample were imaged and analyzed using ImageJ software (National Institutes of Health, USA). 18. Coimmunoprecipitation (CO-IP) Co-immunoprecipitation (Co-IP) assays were performed according to established protocols [ 34 ] . Cells were collected into NP-40 immunoprecipitation lysis buffer (P0013F, Beyotime, Shanghai, China) containing PMSF (ST506, Beyotime, Shanghai, China). After lysis on ice for 30 min, the resulting supernatant was collected and subsequently incubated with primary antibodies against Shank3 (1:50, #64555, Cell Signaling Technology, USA), Gal-3 (1:30, A22768, ABclonal Technology, China), and ZBP-1 (1:50, sc-271483, SANTA CRUZ, USA) or isotype immunoglobulin G (IgG) for 2 h. (#3900, Cell Signaling Technology, Shanghai, P.R. China) Subsequently, 35 µL of protein A/G beads (# sc-2003, Santa Cruz, Shanghai, China) were added to the immunoprecipitation mixtures and allowed to stand at 4°C overnight. The next day, the mixture was washed five times using 1× Co-IP cold buffer, followed by denaturing the bound proteins with 1× sample buffer. The resulting supernatant was collected and used for SDS-PAGE and Western blot analysis. 19. Human induced pluripotent stem cells culture and differentiation Human induced pluripotent stem cells (hiPSCs) (Cellapy Biotechnology, Beijing, China) were cultured in PSCeasy® Type II hiPSC Complement Medium (Cellapy Biotechnology). The hiPSCs were passed when the fusion reached 80%. hiPSCs were induced to differentiate into human neural stem cells (hNSCs) when they reached 100% fusion. In this study, specific antibodies were used to identify hNSCs. for subsequent experiments, hNSCs were passaged more than three times. They were cultured in NeuroEasy human neural cell differentiation medium for 21 days. Cells with a neuronal phenotype were identified using specific neural markers [ 35 ] . 20. CRISPR/CAS9 mediated Shank3 mutation in neuronal cells derived from Human induced pluripotent stem cells The human Shank3 corresponding guide RNA sequence (gRNA1: GATGCCGACGCGCACGACCA) was cloned into PX459v20. after sequence confirmation, the construct was transfected into hiPSCs differentiated mature neurons. The transfected cells were sorted. Cells with successful knockdown of the Shank3 gene were subjected to the next experiments. Sequencing primers were as follows: F: CGCTTCCC TCCCGTCTCAG; R: TCCAGGCGCAGGCACTTCT. 21. RNA sequencing (RNA-Seq) Total RNA was extracted from Shank3 −/− mouse hippocampal brain tissue and Gal-3 knockout neuronal cells using TRIzol reagent (Invitrogen, Cat# 15596026, USA) according to the manufacturer's protocols. An Agilent 2100 Bioanalyzer (Agilent Technologies, USA) was used to analyze the RNA quality. Eukaryotic mRNA was then enriched with Oligo (dT) beads. enriched short fragments were fragmented with fragment buffer and then reverse transcribed into cDNA using random primers. DNA polymerase I, RNase H, dNTP, and buffer facilitated the synthesis of the second-strand cDNA. The resulting cDNA fragments were purified with the QiaQuick PCR extraction kit (Qiagen, Venlo, The Netherlands), end-repaired, added to poly (a), and ligated to an Illumina sequencing adapter. The size of the ligated products was then selected by agarose gel electrophoresis, PCR amplified, and sequenced on an Illumina Novaseq6000 from Gene Denovo Biotech Co. (China). RNA-Seq was followed by Gene Ontology (GO) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Set Enrichment Analysis (GSEA). 22. Enzyme‑linked immunosorbent assay (ELISA) The brain tissues were thoroughly ground and the supernatant of the homogenate was collected after centrifugation. Blood was collected in anticoagulation tubes and plasma was collected after centrifugation. The cell culture supernatants were also collected. IL-1β, IL-6, TNF-α, IL-18, and estrogen levels were detected using a commercial ELISA kit (Nanjing Jiancheng Bioengineering Institute, China). 23. 3D structure prediction In this study, protonation was first carried out under neutral conditions (pH = 7) using the H + + 3 online server. Subsequently, heteroatoms and water molecules were removed from the crystal structure using UCSF Chimera software, leaving only the charge-distributed protein structure. Next, molecular docking was performed using the protein-protein docking tool HDOCK, and molecular docking and conformational scoring were performed using the empirically based iterative scoring function ITScorePP. Negative values indicate successful molecular binding and larger absolute values indicate stronger binding ability. Three-dimensional mapping analyses were performed using PyMOL 2.04, and two-dimensional interaction analyses were performed using Maestro to statistically determine the type, distance, and number of interactions. 24. Glutathione S-transferase (GST) pull-down assay For GST pull-down experiments, equal amounts (0.5 mg) of the purified ANK structural domain of the Shank3-GST fusion protein and the carbohydrate recognition domain (CRD) of the Gal-3 His fusion protein were mixed and incubated on ice for 3 h. Subsequently, the mixture was loaded onto a glutathione Sepharose 4B resin column. After 5 washes with wash buffer, the proteins were eluted with wash buffer containing 15 mm reduced glutathione. The eluate was separated by SDS-PAGE, transferred to a PVDF membrane and probed with mouse anti-HIS (1:50 000, CUSABIO, Cat# CSBMA000159, USA), and mouse anti-GST (1:50 000, CUSABIO, Cat# CSBMA000304, USA) antibodies. Negative controls were GST-labelled and His-labelled by Wuhan Chuang Bioengineering Co. 25. Protein expression The pGEX-6p-1 plasmid-encoded GST, which labeled the ANK structural domain of Shank3 (residues 148–345, UniProtKB: Q4ACU6⋅SHANK3_MOUSE), and the pET32a plasmid-encoded His, which labeled the carbohydrate recognition domain (CRD) of Gal-3 (residues 148–176, UniProtKB: P16110⋅Gal-3_MOUSE), transfected with E. coli BL21-CodonPlus. E. coli cells were induced with 0.1 mM isopropyl β-d-thiogalactopyranoside (IPTG), and cultured in Luria broth at 18°C for 12 h until the D600 nm reaches 0.4–0.6. Then BL21 was harvested cells were sonicated in cold PBS and purified with glutathione s -transferase (GenScript, Cat# L00206, China) beads or nickel-nitrile triacetate (GenScript, Cat# L00250, China) beads according to the user manual. The validity of the purification was verified by SDS-PAGE followed by Komas blue staining. Mouse Shank3-ANK and Gal-3-CRD were cloned into the pcDNA3.1 vector. HA-ANK protein and HA-CRD protein were overexpressed in HT22 cells. HA-ANK mutants were generated in the Shank3-ANK (148–345) sequence and docked by the knockout molecule experimentally predicted binding site constructs. 26. Gene knockdown and overexpression Gal-3, Shank3, and ZBP-1 knockdown and overexpression systems (Hanhen and Jikai, China) were transiently transfected into primary cells using transfection reagents (Beyotime, China) according to the manufacturer's instructions. Cells were collected 3 days after transfection and transfection efficiency was assessed by Western blot and qPCR validation. Mice were anesthetized and fixed on a stereotactic head frame (RWD, Shenzhen, China). A midline scalp incision was made to fully expose the bregma and lambda. for intrahippocampal injections, holes were drilled bilaterally using a high-speed drill in coordinates relative to the bregma (X=-2.06 mm, Y = 2 mm). A syringe was connected to a microinjector pump and a needle was inserted into the brain through a burr hole (Z = 2 mm from the bone surface) to inject 1 µl of adeno-associated virus (AAV) (Hanheng China) [ 36 ] . Postoperatively, the cranial defect was closed with bone wax, and the incision was sutured. Transfection efficiency was measured 21 days later. 27. Statistical analysis Experiments were repeated at least three times and data are expressed as mean ± standard deviation. GraphPad Prism 9.0 (GraphPad Software, La Jolla, CA, USA) was used for statistical analysis. Comparison of data between multiple groups was performed using One-way ANOVA and Two-way ANOVA with Dunnett's test. P < 0.05 was considered a statistically significant difference. Results 1. Neuronal-special PANoptosis increased in defeminization TIA models of female mice An 8-min period of MCAO induced by the suture method was applied to create a TIA model in female mice, which was operated Ovariectomizing (OVX) (Fig. 1 . a). This defeminization TIA models not only truly mimicked human TIA in postmenopausal women but also efficiently evaluated changes in the neuronal PANoptosis and the expression level of Shank3 and Gal-3 in the hippocampus and cortex in mice. The positive results of estrogen identification and vaginal secretion smear examination confirmed successful castration of female mice (S Fig. 1 . a, b). Like previous literates, 8 min cerebral ischemia induced by the suture MCAO method is an appropriate TIA model in C57BL/6 mice, which was successfully determined by significantly deteriorated neuroglial dysfunction after operation, and above changes was recovery in postoperative 24 hours, which was examined by mNSS scores and rotation rod and new object recognition test (Fig. 1 . d - f), also prominently decreased cerebral blood flow (CBF) following with ischemic/ reperfusion injury and these changes returned to baseline levels in postoperative 24 hours, which was measured by laser speckle contrast imaging (Fig. 1 . b, c), as well as markedly increased the levels of HIF-1β (S Fig. 1 . f, g), ROS (S Fig. 1 . e), cell apoptosis rates (Fig. 1 . i, j), and P-TDP43 (Fig. 1 . g, h), expect for no obvious changes of the volume of cerebral infarction which was tested by TTC staining throughout the experimental period (S Fig. 1 . c, d). These results suggested that neither CBF and neurological deficits nor cerebral infarcts occurred in TIA female mice, which truly mimic human TIA. To confirm the occurrence of neuronal-special PANoptosis after TIA and OVX + TIA, we explored the expression changes of key markers of apoptosis, necroptosis, and pyroptosis. Compare with Con group, the levels of Caspase 3, Caspase 1, and RIPK 1 was significantly increased in OVX group and OVX + TIA group, which examined by IF (Fig. 1 . k). Notably, the protein levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 that are indicative of apoptosis, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL that are indicative of necroptosis, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1, GSDMD, N-GSDMD, GSDME, and N-GSDME that are indicative of pyroptosis were robustly higher in OVX + TIA mice than in WT mice and WT + OVX mice (Fig. 2 . h). Moreover, we found markedly increased the release of inflammatory factors, such as, TNF-α、IL-1β、IL-6 and IL-18 dialed with OVX after TIA (S Fig. 1 . h - k). In addition, we found that 14.4% PANoptosis positive neurons in region of hippocampus of mice after TIA by calculating and summing up Caspase3 positive neurons, Caspase1 positive neurons, and RIPK1 positive neurons (S Fig. 1 . p, q). Thus, these data demonstrate that defeminization in combination with TIA contributes to the activation of PANoptosis of neurons, but it did not worsen the degree of injury. Next, to further investigate the type and effect of cell death programs that occurred, multiple inhibitors of common cell death pathways, were used to rescue the neuron death induced by OVX + TIA. Of note, the apoptosis inhibitor Z-VAD-FMK, the necroptosis inhibitor necrostatin-1, and the pyroptosis non-specific inhibitor disulfiram that inhibits both GSDMD and GSDME, reversed the enhanced neuron death, increased markers of PANoptosis expression and amplified inflammatory factors secretion and release induced by TIA under defeminization, and none of the inhibitors leaded to complete recovery to the levels observed in the control group, but also Z-VAD-FMK, necrostatin-1, and disulfiram only specifically restrained apoptosis, necroptosis and pyroptosis which face-to-face forms of cell death. More, the pyroptosis inhibitor disulfiram and the necroptosis inhibitor necrostatin-1, which individually blocks GSDMD and GSDME, as well as RIPK 1, RIPK 3 and MLKL concurrently in OVX + TIA group (Fig. 1 . l, m). Moreover, we found markedly decreased the release of IL-1β and IL-18 of mice treated with disulfiram after OVX + TIA, and TNF-α and IL-6 of hippocampus were no change treated with Z-VAD-FMK and necrostatin-1 after OVX or OVX + TIA (S Fig. 1 . l - o). 2. Establishment of a tOGD/R modal of TIA in neurons which cultured in anti-hormone serum To better mimic the in vivo context, we established a tOGD/R modal of TIA in primary neurons from the mice which cultured in anti-hormone serum to truly mimicked postmenopausal women TIA. Based on cell apoptosis, necroptosis and pyroptosis ratio in hippocampus of animals after TIA, we found that the viability of primary neurons, which experienced OGD 24 hours and reperfusion 1 hour, is like that of animals under both estrogen or estrogen-deficient conditions (Fig. 2 . a). Also, the same results of AM/PI staining (S Fig. 2 . b, c), CCK 8 (Fig. 2 . b, S Fig. 2 . a) further conform the time point of tOGD/R modal for TIA in neurons, which verily impressed mice TIA. Furthermore, using CCK8 assay (S Fig. 2 . d), LDH concentration (Fig. 2 . c), expression of HIF-1β (S Fig. 2 . e, f), flow cytometry (Fig. 2 . d, e), AM/PI staining (Fig. 2 . f, g), ROS staining (Fig. 2 . g, h) and inflammatory factors assay (S Fig. 2 . i - l), to demonstrated that damaged and dead cells, including apoptosis, pyroptosis and necroptosis, significantly increased in -E + OGD/R group than that in Con group and -E group. More, the expression changes of key markers of PANoptosis were once again assessed in vitro to clarify the occurrence and severity of neuronal-special apoptosis, necroptosis, and pyroptosis after TIA. Similar to the results in vivo, the levels of apoptosis biomarker, including Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 ratio, necroptosis biomarker, such as, P-RIPK 1/RIPK 1 ratio, P-RIPK 3/RIPK 3 ratio, and P-MLKL/MLKL ratio, as well as pyroptosis biomarkers, NLRP 3, Cleaved-Caspase 1/Caspase 1 ratio, GSDMD, N-GSDMD, GSDME, and N-GSDME were significantly increased in -E + OGD/R group than that in Con group and -E group (Fig. 2 . h). Furthermore, Z-VAD-FMK, necrostatin-1, the expression of Caspase 3, Caspase 1, and RIPK 1 was restored to normal levels, which observed by immunofluorescence staining (Fig. 2 . j), as well as the biomarker levels of apoptosis, necroptosis, and pyroptosis also was reinstated to physiological levels, which examined by western-blotting (Fig. 2 . k). Additionally, the disulfiram rescued increased IL-1βand IL-18 levels, but did not affect the expression of TNF-α and IL-6 in neurons with tOGD/R and defeminization damage (S Fig. 2 . m - p). These results are consistent with the in vivo results. Together the studies about neuronal-special PANoptosis in vivo and in vitro after TIA, we found that all manner of neuron death programs not only emerged immediately and exhibit extensive crosstalk after cerebral artery occlusion and reperfusion, but also resulted in serious neurological dysfunction, which pronounced remarkably in female mice after defeminization TIA, indicating that momentary ischemia reperfusion, and estrogen deficiency enhanced the sensitivity of neurons to PANoptosis, and PANoptosis of neurons was a key risk factor for exacerbating the occurrence and development of TIA in castrated female mice. 3. Shank3 is lowly expressed in defeminization TIA models and maybe an estrogen sensitivity factor that exacerbates neuronal injury and neurological dysfunction In fact, Shank3, a typical ASD-related gene, ameliorates oxidative stress and inflammation after IS, which was described in previously literature [ 20 ] . Like those in our previous results of IS, the mRNA and protein expression levels of Shank3 decreased steadily, and was negatively correlated with the severity of neuron injury with feminization and defeminization after TIA in vivo and in vitro (Fig. 3 . a, f). Meanwhile, we found that the expression of Shank3 in mRNA and protein levels was significantly descended in primary neurons and hippocampus after defeminization injury (Fig. 3 . b – e, g - j). As such, our findings suggested that Shank3 might promote neuronal insults and account for more severe TIA in postmenopausal women than premenopausal female. Next, we estimated the effect of Shank3 among female mice after TIA vs. TIA + OVX, Shank3A CKO mice were generated and utilized (S Fig. 3 . a - g). Of note, downregulation of Shank3 in the hippocampus of female mice induced severe neurological dysfunction, such as, motor function, memory, cognitive impairment and the volume of cerebral infarction (Fig. 3 . k - o), but no obvious effect on the CBF after TIA compared to Shank3 WT female mice (S Fig. 3 . h, i), suggesting that Shank3 is more sensitive to brain tissue of defeminization mice damage and neurological deterioration, which may be one of key risk factors determining the severity of TIA in postmenopausal women. Meanwhile, we silenced Shank3 in primary neurons (S Fig. 3 . k - o) and found that downregulation of Shank3 obviously enhanced cell toxicity and LDH concentration in -E + Shank3 KO + tOGD/R group than those in -E + Shank3 NC + tOGD/R group and Shank3 KO + tOGD/R group, which were consistent with the results in vivo (S Fig. 3 . p, q), indicating Shank3 maybe an estrogen sensitivity factor that exacerbates neuronal injury in defeminization TIA models in vitro. In fact, we have previously demonstrated that Shank3 deficient aggravated neuronal injury via inhibiting oxidative stress and inflammation after IS. In the current study, knocking down Shank3 in vivo and in vitro successfully induced neuron injury and dead (Fig. 3 . p – s, S Fig. 3 . r, s), indicating that Shank3 may impede the development of TIA in defeminization mice. 4. Shank3 deficiency in vivo and in vitro contributes to neuronal-special PANoptosis Notably, GO and KEGG pathway enrichment analysis showed that Shank3 was strong negatively correlated with apoptosis and necroptosis, but no obvious relationship with pyroptosis (Fig. 4 . a - d). In fact, significant activation of apoptosis through Shank3/Stim1 signaling pathway after IS [ 20 ] , obviously enhancement of pyroptosis through Shank3/DJ-1TNF signaling, axis following with traumatic brain injury (data not supply) were observed in our previous study. Of note, Shank3 deficiency enhanced neuron-special PANoptosis in TIA + OVX group vs. controls and TIA group, as demonstrated by the expression of the key proteins, such as Cleaved-Caspase 3, 7, 8, 9, P-RIPK 1, P-RIPK 3, P-MLKL, NLRP 3, Cleaved-Caspase 1, N-GSDMD, and N-GSDME, as well as the release of oxidative stress and pro-inflammatory factors, including, ROS, TNF-α、IL-1β、IL-6 and IL-18 (Fig. 4 . e - j). As expected, we found that Shank3 loss increased the number of dead cells, at the protein level, compared with contral and tOGD/R neurons, the markers of apoptosis, pyroptosis and necroptosis were all dramatically increased in defeminization neurons after TIA. In addition, the expression of ROS, TNF-α、IL-1β、IL-6 and IL-18, was further increased in de-estrogen neurons after tOGD/R vs. control and de-estrogen neurons (Fig. 4 . k - q). These results are consistent with the in vivo results, leading us to speculate Shank3 could be a widespread target for susceptibility to anti-PANoptosis treatment in TIA human, especially postmenopausal women. 5. Shank3 directly binds to Gal-3 facilitating its ubiquitination and nuclear translocation, and subsequent downregulation of ZBP-1 To investigate the potential mechanism by which Shank3 in neuron promotes PANoptosis activation, the results of RNA sequencing showed that 730 genes were up-regulated and 114 genes were down-regulated on Shank3 cko and Shank3 f/f mice hippocampus, and the top 10 most significantly increased or decreased genes were listed and displayed with a heatmap (Fig. 5 . a, b). Lgals3 (Gal-3) was No. 4 of the most upregulated genes in Shank3 cko vs. Control mice (Fig. 5 . a, b), suggesting that Shank3 knockdown leads to increased Gal-3 level. Consistently, the protein levels of Gal-3 were significantly increased in hippocampus tissues from Shank3 KO vs. WT mice. In fact, Gal-3, a famous β-galactoside-binding protein belonging to the lectin family with aging and neurodegeneration, enhanced neuronal oxidative injury, inflammatory damage and apoptosis after IS was reported in the previous research findings by us and others [ 37 – 40 ] . Notably, the results of 3D molecular docking of protein-protein interactions predicated that the ANK domain of Shank3 directly interacted with the cytoplasmic carbohydrate recognition domain (CRD) of Gal-3 by hydrogen bonds, salt bridges, and π-stacking (Fig. 5 . c). In this study, immunofluorescence analysis revealed that Shank3 colocalized well with Gal-3 in the cytoplasm and on the cell membrane of the hippocampal neurons and cultured primary neurons (Fig. 5 . d - f). Co-immunoprecipitation (Co-IP) using antibodies against either Shank3 and Gal-3 also demonstrated their interaction (Fig. 5 . g). Glutathione S-transferase (GST) pull-down experiments further corroborated the physical association between the ANK domain of Shank3 and the CRD of Gal-3 (Fig. 5 . h, S Fig. 4 . a). Subsequently, to further identify the interaction site of Shank3 and Gal-3, Co-IP experiments showed that the interaction between ANK-HA and CRD-FLAG was reduced significantly in the mutant cell lines (Fig. 5 . i). Furthermore, Shank3 deficiency attenuated the degradation of Gal-3 (Fig. 5 . k - m) and decreased K48-linked ubiquitination of Gal-3 (Fig. 5 . j, S Fig. 4 . b). These data indicate that Shank3 deletion attenuates the K48-linked ubiquitination of Gal-3. Finally, we isolated the nuclear fraction from primary cultured neurons and immunoblotted for Gal-3. Substantially more Gal-3 protein was in the nuclear fractions in neurons treated with Shank3 silencing than in control cells in vivo and in vitro, indicating that Gal-3 entered the nucleus via active transport in response to Shank3 downregulation (S Fig. 4 . c, d). Finally, the results of immunoblot analysis indicated that expression of Gal-3 protein decreased on the condition of Shank3 overexpression, while increased when Shank3 was knocked down suggesting that Shank3 negatively regulated the expression of Gal-3 (S Fig. 4 . e - f). Together, these data demonstrated not only that the physical structures of Shank3 and Gal-3 directly interact but also that loss of Shank3 increased Gal-3 protein stability through the ubiquitin‒proteasome pathway and induced Gal-3 nuclear translocation. It has been accepted that the ZBP-1, an innate sensor of inflammation and a central regulator of cell death, is protective against infection and brain injuries by inhibiting oxidative stress and proinflammatory responses [ 9 , 10 , 41 ] . Given this, the Shank3/ZBP-1 interaction was examined in the following study. Although Shank3 colocalized well with ZBP-1 in the cytoplasm and on the cell membrane of the hippocampal neurons and cultured primary neurons (Fig. 5 . d - f), as well as loss of Shank3 enhanced ZBP-1 protein levels (S Fig. 4 . e - f) and overexpression of Shank3 downregulated expression of ZBP-1 in defeminization TIA models in vivo and in vitro (Fig. 6 . d, g), but the results of CO-IP showed that Shank3 indirectly binds to ZBP-1 in neurons (Fig. 6 . a). These data showed that the enhanced expression of ZBP-1 which were mediately regulated by Shank3 and some downstream target molecules that directly binds to it, such as, Gal-3, participate in the process of neuronal-special PANoptosis. Then, we conformed whether Gal-3, as a downstream target gene of Shank3, was involved in the regulation of ZBP-1 and thereby regulated the activation of PANoptosis after defeminization TIA injury. The results of 3D molecular docking of protein-protein interactions predicated that the ZBP-1 interacted with the CRD of Gal-3 (Fig. 5 . c). Based on the results of Gal-3 co-localized well with ZBP-1 in neurons that examined by immunofluorescence (Fig. 5 . d - f), as expected, the directly protein-protein interaction between Gal-3 and ZBP-1 was corroborated by using Co-IP assay (Fig. 5 . g). Also, Primary neurons treated with Gal-3 overexpression had increased ZBP-1 nuclear translocation than cells treated with vector (Fig. 6 . b, c). Conversely, a similar volume of cells treated with Gal-3 downregulation had decreased ZBP-1 nuclear translocation (Fig. 6 . b, c). Lastly, we constructed lentivirus-based shRNA (D/E) and overexpression (O/E) vectors to regulated the protein levels of Gal-3 and ZBP-1, the results of Western blot showed that ZBP-1 protein level increased on the condition of Gal-3 overexpression, while decreased when Gal-3 was knocked down, but ZBP-1 did not regulate the expression of Gal-3 (S Fig. 4 . e - f). Altogether, these findings suggested that indicating that Gal-3 positively regulated the expression of ZBP-1 and overexpression Gal-3 induced ZBP-1 nuclear translocation in neurons. To further study the function of Gal-3/ZBP-1 complex in neuronal PANoptosis after defeminization TIA injury in vivo and in vitro, using RT-PCR and immunofluorescence analysis, we found firstly that the mRNA and protein levels of Gal-3 and ZBP-1 both increased significantly, and was positively correlated with the severity of neuron injury with feminization and defeminization after TIA (Fig. 6 . d - i). Afterwards, the cultured primary neurons and mouse brain were transfected vectors with lentivirus downregulation and overregulation of Gal-3 and ZBP-1 expression, the results showed that either overregulation Gal-3 or overexpression ZBP-1 both significantly increased the protein levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1, GSDMD, N-GSDMD, GSDME, and N-GSDME in defeminization TIA neurons than in normal neurons and de-estrogen neurons, whereas Gal-3 and ZBP-1 deletion in neurons alleviated development of PANoptosis in vivo and in vitro mice after defeminization TIA injury (Fig. 6 . m - p). Of note, the results of Gal-3 regulate PANoptosis in vivo and in vitro were consistent with the results about the relationship among Gal-3 and apoptosis, pyroptosis, and necroptosis predicted by GO and KEGG pathway enrichment analysis of RNA sequencing (Fig. 6 . j - l). Collectively, these data indicated that both Gal-3 and ZBP-1 induced neuronal-special PANoptosis to promote the development of TIA with de-estrogen. 6. D-allose enhanced Shank3 attenuates PANoptosis and neurological deficits of OVX female mice after TIA As an ultralow calorie sugar with no toxicity, with high levels of sweetness [ 42 , 43 ] , D-allose was demonstrated to attenuate neuroinflammation and neuronal apoptosis following IS in our and others previous reports [ 38 , 44 ] . Here, protein-ligand docking studies firstly confirmed strong Shank3 ANK domain-drug interaction for D-allose, which ten showed promising binding affinities in conjunction with lower inhibition constants (Fig. 7 . a). We next injected intraperitoneally D-allose at five different dosages in Shank3 KO female mice after TIA, followed by mNSS test, and the mRNA and protein levels of Shank3 measurements in vitro at the next day post-administration (S Fig. 5 . b - d). And administration of D-allose at concentrations of 0.6 mg/g improved neurological deficits in female Shank3 KO mice after TIA, while achieved a balance between enhancement of Shank3 expression and minimal potential side effects (S Fig. 5 . a). To further confirm that the neuro-protective effects and mechanism of D-allose, we found that female Shank3 KO mice after TIA and OVX + TIA treated with 0.6 mg/g D-allose significantly enhanced CBF (Fig. 7 . d, e), the mean length and thickness of postsynaptic densities (Fig. 7 . i), and improved neurological dysfunction, including motor function, memory and cognitive impairment (Fig. 7 . f - h), but no obvious effect on the volume of cerebral infarction than observed in Shank3 KO mice after TIA treated with vehicle (Fig. 7 . b, c). Of note, 0.6 mg/g D-allose treatment for restored the enhanced levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 ratio for apoptosis, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL ratio for necroptosis, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1 ratio, GSDMD, N-GSDMD, GSDME, and N-GSDME for pyroptosis in the hippocampus of Shank3 −/− mice after TIA and OVX + TIA, as well as the rose levels of Gal-3 and ZBP-1, neurons death in the hippocampus (Fig. 7 . j, k, m). Similarly, D-allose treatment rescued increased ROS, TNF-α, IL-1β, IL-6, and IL-18 levels in the hippocampus (Fig. 7 . L, n - q). These data showed that D-allose may represent a novel potential drug for neuronal PANoptosis and neurological dysfunction in TIA. 7. D-allose alleviates PANoptosis after tOGD/R induced TIA in Shank3 mutant human neurons with de-estrogen In order to validate whether similar changes occurred in human ASD neurons, we mutated Exon2 of the Shank3 gene of hiPSCs using CRISPR/Cas 9 (S Fig. 6 . b), which was checked by qPCR and Western blotting (S Fig. 6 h - l). hiPSCs of control and Shank3 mutant were induced to over 95% of Tuj-1‐positive neurons after 4 weeks induction, which executed according to a well‐established protocol, and degree of differentiation of hiPSC was determined by immunofluorescence (Fig. 8 . a, b; S Fig. 6 . a). Similarly to the results of primary neurons and mice, compare with normal human neurons, the protein levels of Gal-3 and ZBP-1 markedly increased (S Fig. 6 . h - l). Then, Shank3/Gal-3, Shank3/ZBP-1, and Gal-3/ZBP-1 interaction were examined by protein CO‐IP assay, the results showed that strong Shank3/Gal-3 and Gal-3/ZBP-1 interaction in WT human neurons, while there were no spatial interlocking between Shank3 and ZBP-1 (Fig. 8 . c). Remarkably, more severe oxidative stress and inflammatory insults, as well as significantly PANoptosis, were observed in Shank3 KO -E + OGD/R group, as compared that with in Shank3 NC -E + OGD/R group (Fig. 8 . d - p). Similarly, we next talk about whether anti-PANoptosis effects of D-allose occurred in human iPSCs treated with OGD/R and defeminization after 4 weeks of neuronal differentiation. Based on the results of cell viability, LDH concentration, as well as the mRNA and protein expression level of Shank3, 4 mM, the optimal dose of D-allose in Shank3 mutant human neurons with OGD/R and de-estrogen treatment was screened out (S Fig. 6 . c - g). Notably, like primary neurons with TIA and de-estrogen, 4mMol D-allose treatment remarkably reduced the levels of injured and dead cells, LDH concentration, apoptosis/necrosis cell ratio, as well as restored the increased levels of ROS, TNF-α, IL-1β, IL-6, IL-18, and death cells, especial PANoptosis neurons, in Shank3-mutant human neurons pretreated by tOGD/R and defeminization (Fig. 8 . d - p). The above results suggested that Shank3/Gal-3/ZBP-1 signal overactivation and neuronal-special PANoptosis were drastic changes after tOGD/R induced TIA in Shank3 mutant human neurons with de-estrogen, which can be rescued by D-allose up-regulates Shank3 expression. Discussion Along with a deeper mechanistic understanding of TIA, loss of neurons in cerebral area of transient ischemia-reperfusion damage led to worse functional symptoms, particularly generalized nonspecific weakness, mental status change, and confusion in female than that of man, as well as postmenopausal women more commonly presented with more severe outcomes of IS which results by TIA than men, has proved to be a consensus, however, current evidence is insufficient to allow for HRT [ 13 , 45 – 47 ] . As such, in this study, we first uncovered new knowledge on neuronal-special PANoptosis in in TIA of defeminization mice, and a significant anti-PANoptosis role of Shank3, which directly binds to the aging-related proteins Gal-3, regulates the degradation of Gal-3 through K48-linked ubiquitination, as well as Gal-3 binds with core PANoptosis regulator ZBP-1, increases its nuclear translocation and subsequent downregulation of ZBP-1, promoting worse outcomes of TIA in defeminization mice. Combine with the neuron death ration in defeminization TIA models in vivo and the results of previous reports, we strictly formulate a tOGD/R modal of TIA in de-estrogen neurons approaches, including neurons experienced OGD 24 hours and reperfusion 1 hour, and cultured in anti-hormone serum, which to truly mimicked postmenopausal women TIA in vitro. These results provided a modeling tool for in-depth exploration of the development of TIA in the future. Importantly, we found that considerable proportion of neurons occur PANoptosis, which induced oxidative stress, and inflammatory response, in de-estrogen neurons in vivo and in vitro, suggesting that there may be exists slight secondary brain insults at the cellular level following with TIA. However, as an independent risk factor, defeminization only causes a little PANoptosis of neurons, and did not transform the CBF, neurological deficits and cerebral infarcts, even TIA damage was superimposed. Taken together, TIA and defeminization have associated action in promoting PANoptosis significantly in hippocampus and cortex of de-estrogen mice, prompting that estrogen deficiency enhanced the sensitivity of neurons to PANoptosis. However, the PANoptosis sensitivity does not cause many cell deaths that is sufficient to trigger the formation of cerebral infarcts and deterioration of neurological dysfunction, which explaine the reason why HRT is ineffective in TIA of postmenopausal women, indicating that factors other than hormones might contribute to the biological sex and outcome difference observed. Shank3, as a classical ASD-association and manic gene, is predominantly expressed in neurons [ 17 , 48 ] . In the current study, from the evidence of transcriptome sequencing, Shank3 is lowly expressed in defeminization TIA models and its expression was negatively correlated with neuronal-special PANoptosis in murine infarcted brain. In addition, Shank3 inhibition induces persistent oxidative damage and inflammation insults, leads to postsynaptic densities destroy [ 49 , 50 ] , as well as results in cell death in defeminization TIA, which involve in the expansion of cerebral infarction and the deterioration of neurological deficits, including motor function, memory and cognitive impairment [ 51 ] . As such, it is reasonable to infer that Shank3, as a novel PANoptosis regulator, might inhibit TIA with defeminization and account for the outcomes disparity observed. However, the significance and regulatory mechanism of Shank3 in male TIA mice need to be further studied. Our and others studies have shown that Shank3 deficiency could release excessive ROS production and inflammatory factors [ 19 , 20 ] , which induce worse symptoms by inducing PANoptosis via activation of the PANoptosome. Mechanistically, consist with the results of transcriptome sequencing, Gal-3, acting as a β-galactoside-binding protein, is closely related to aging, involved in many biological processes, such as proliferation, apoptosis, and inflammation, as well as its CRD domains is directly binds with ANK domains of Shank3 in physical structure. Our in vivo and in vitro studies confirm that loss of Shank3 increase Gal-3 protein stability through promoting K48-linked ubiquitination and induce Gal-3 nuclear translocation. Furthermore, the results of Gal-3 increase PANoptosis in Shank3 KO mice after defeminization TIA injury are consistent with the evidences about the relationship among Gal-3 and apoptosis, pyroptosis, and necroptosis predicted by another transcriptome sequencing analysis. However, as a typical central regulator of PANoptosis, ZBP-1 is indirectly associates with Shank3, but directly binds with Gal-3. As expected, ZBP-1 protein level increase on the condition of Gal-3 overexpression, while decrease when Gal-3 was knocked down, but ZBP-1 does not regulate the expression of Gal-3. Collectively, our findings identify that Shank3, Gal-3 and ZBP-1 form a multi-protein complex to regulate neuronal-special PANoptosis during TIA. Defiency of Shank3 induced the expression of Gal-3 and ZBP-1 during transtant ischemic damage, indicating that Shank3-mediated signaling functions as an upstream regulator of Gal-3 and ZBP-1 to control assembly and activation of the neuronal PANoptosis. Moreover, these data show that Shank3 prevents the activation of PANoptosis to alleviate the volume of cerebral infarction and neurological deficits via Gal-3/ZBP-1 signaling pathway, which suggests a novel regulatory mechanism of Shank3 activity in humans. Nevertheless, the potential mechanism through which transient ischemic and reperfusion-mediated PANoptosis mediates the deubiquitinating status of Shank3 and the roles of Shank3 under other damage mode need to be further illustrated. Given the evidence of Shank3 as a key member of neuronal-special PANoptosome and the protective effects of D-allose on IS might occur via the Gal-3 pathway, different dosage of D-allose are deal with Shank3 KO mice, Shank3 mutant cultured primary neuron of rodents, and Shank3 mutant human neurons after TIA or defeminization TIA injury. As expected, D-allose attenuates TIA-induced brain damage, neuronal cytotoxicity and PANoptosis by reducing oxidative stress and inflammation in defeminization Shank3 KO mice. This protective effect may be largely due to the Shank3 inhibiting the Gal-3/ZBP-1 signaling axis in SBI during TIA. To the best of our knowledge, this is the first provide valuable insights into targeting of Shank3/Gal-3/ZBP-1 complex for the treatment of de-estrogen TIA injury (Fig. 9 ). In conclusion, the present study identify a critical interaction between Shank3, Gal-3 and ZBP-1 that drives neuronal-special PANoptosis, alleviate oxidative stress and inflammation, accounts for the postmenopausal female predominance, progression and outcome of TIA. Therefore, like D-allose, the Shank3 agonists play a crucial neuroprotective effect, which is expected to be a potential therapeutic for neuron PANoptosis cerebral after defeminization TIA. Declarations Declaration of Competing Interest: The authors declare that they have no known competing financial interests or personal relational relationships that could have appeared to influence the work reported in this paper. Additional information The online version contains supplementary material available at online at the website. Funding: This work was supported by the National Natural Science Foundation of China (No.81971227, No.81974188, No.82371337), Key Research and Development Program of Shaanxi (Program No. 2023-YBSF-170), Military Medicine Enhancement Program (2021JSTS03). Authors’ contributions: Yaowen Luo, Lei Zhang, Dakuan Gao, and Xia Li designed the project and reviewed the manuscript; Yaowen Luo, Min Zhang, Junkai Cheng, Zheming Yue, and Jimeng Zhang performed the experiments; Yaowen Luo, Min Zhang, Junkai Cheng, Xiaobing Li, Jing Bai, and Yunchao Yuan analyzed the data; Yaowen Luo, Junkai Cheng, Jimeng Zhang, Juan Li, Maorong Gou, and Li Wang interpreted the data; Yaowen Luo, Lei Zhang, Dakuan Gao, Yuefei Zhou, and Lian Zhu drafted and edited the manuscript; Lei Zhang, Dakuan Gao, Xia Li, and Yuefei Zhou critical revision of the manuscript. All authors read and approved the final. Acknowledgements: Not applicable. Data availability: The scRNA-sequencing data are available in figshare with the identifier. The original proteome sequencing analysis in this article have been deposited in this article. All data supporting the findings of this study are available from the corresponding author upon reasonable request. References Anne Waller H and Kay Savage A. mRNA detection by in situ rt-PCR. Methods Mol Med 2001;39:417-29 Arons MH, Thynne CJ, Grabrucker AM, Li D, Schoen M, Cheyne JE, Boeckers TM, Montgomery JM and Garner CC. Autism-associated mutations in ProSAP2/Shank3 impair synaptic transmission and neurexin-neuroligin-mediated transsynaptic signaling. J Neurosci 2012;32:14966-78 Bederson JB, Pitts LH, Germano SM, Nishimura MC, Davis RL and Bartkowski HM. Evaluation of 2,3,5-triphenyltetrazolium chloride as a stain for detection and quantification of experimental cerebral infarction in rats. Stroke 1986;17:1304-8 Chen J, Li Y, Wang L, Lu M, Zhang X and Chopp M. Therapeutic benefit of intracerebral transplantation of bone marrow stromal cells after cerebral ischemia in rats. J Neurol Sci 2001;189:49-57 Chen J, Sanberg PR, Li Y, Wang L, Lu M, Willing AE, Sanchez-Ramos J and Chopp M. Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke 2001;32:2682-8 Gocan S, Fitzpatrick T, Wang CQ, Taljaard M, Cheng W, Bourgoin A, Dowlatshahi D, Stotts G and Shamy M. Diagnosis of Transient Ischemic Attack. Stroke 2020;51:3371-3374 Gong T, Liu L, Jiang W and Zhou R. DAMP-sensing receptors in sterile inflammation and inflammatory diseases. Nat Rev Immunol 2020;20:95-112 Grabrucker AM, Knight MJ, Proepper C, Bockmann J, Joubert M, Rowan M, Nienhaus GU, Garner CC, Bowie JU, Kreutz MR, Gundelfinger ED and Boeckers TM. Concerted action of zinc and ProSAP/Shank in synaptogenesis and synapse maturation. EMBO J 2011;30:569-81 Huang T, Gao D, Hei Y, Zhang X, Chen X and Fei Z. D-allose protects the blood brain barrier through PPARgamma-mediated anti-inflammatory pathway in the mice model of ischemia reperfusion injury. Brain Res 2016;1642:478-486 Jin C, Zhang Y, Kim S, Kim Y, Lee Y and Han K. Spontaneous seizure and partial lethality of juvenile Shank3-overexpressing mice in C57BL/6 J background. Mol Brain 2018;11:57 Karki R and Kanneganti TD. ADAR1 and ZBP1 in innate immunity, cell death, and disease. Trends Immunol 2023;44:201-216 Keiser MS, Chen YH and Davidson BL. Techniques for Intracranial Stereotaxic Injections of Adeno-Associated Viral Vectors in Adult Mice. Curr Protoc Mouse Biol 2018;8:e57 Kernan WN, Viscoli CM, Brass LM, Gill TM, Sarrel PM and Horwitz RI. Decline in physical performance among women with a recent transient ischemic attack or ischemic stroke: opportunities for functional preservation a report of the Women's Estrogen Stroke Trial. Stroke 2005;36:630-4 Kim H, Yoon SC, Lee TY and Jeong D. Discriminative cytotoxicity assessment based on various cellular damages. Toxicol Lett 2009;184:13-7 Kuriakose T and Kanneganti TD. ZBP1: Innate Sensor Regulating Cell Death and Inflammation. Trends Immunol 2018;39:123-134 Lei Y, Wang Y, Shen J, Cai Z, Zhao C, Chen H, Luo X, Hu N, Cui W and Huang W. Injectable hydrogel microspheres with self-renewable hydration layers alleviate osteoarthritis. Sci Adv 2022;8:eabl6449 Lim YR and Oh DK. Microbial metabolism and biotechnological production of D-allose. Appl Microbiol Biotechnol 2011;91:229-35 Lin JS and Lai EM. Protein-Protein Interactions: Co-Immunoprecipitation. Methods Mol Biol 2017;1615:211-219 Lioutas VA, Ivan CS, Himali JJ, Aparicio HJ, Leveille T, Romero JR, Beiser AS and Seshadri S. Incidence of Transient Ischemic Attack and Association With Long-term Risk of Stroke. JAMA 2021;325:373-381 Loo DT. In situ detection of apoptosis by the TUNEL assay: an overview of techniques. Methods Mol Biol 2011;682:3-13 Luo Y, Cheng J, Fu Y, Zhang M, Gou M, Li J, Li X, Bai J, Zhou Y, Zhang L and Gao D. D-allose Inhibits TLR4/PI3K/AKT Signaling to Attenuate Neuroinflammation and Neuronal Apoptosis by Inhibiting Gal-3 Following Ischemic Stroke. Biological Procedures Online 2023;25 Monteiro P and Feng G. SHANK proteins: roles at the synapse and in autism spectrum disorder. Nature Reviews Neuroscience 2017;18:147-157 Naisbitt S, Kim E, Tu JC, Xiao B, Sala C, Valtschanoff J, Weinberg RJ, Worley PF and Sheng M. Shank, a novel family of postsynaptic density proteins that binds to the NMDA receptor/PSD-95/GKAP complex and cortactin. Neuron 1999;23:569-82 Nelson HD, Humphrey LL, Nygren P, Teutsch SM and Allan JD. Postmenopausal Hormone Replacement Therapy. Jama 2002;288 Oh S, Lee J, Oh J, Yu G, Ryu H, Kim D and Lee S. Integrated NLRP3, AIM2, NLRC4, Pyrin inflammasome activation and assembly drive PANoptosis. Cellular & Molecular Immunology 2023;20:1513-1526 Peca J, Feliciano C, Ting JT, Wang W, Wells MF, Venkatraman TN, Lascola CD, Fu Z and Feng G. Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature 2011;472:437-42 Purroy F, Vicente-Pascual M, Arque G, Baraldes-Rovira M, Begue R, Gallego Y, Gil MI, Gil-Villar MP, Mauri G, Quilez A, Sanahuja J and Vazquez-Justes D. Sex-Related Differences in Clinical Features, Neuroimaging, and Long-Term Prognosis After Transient Ischemic Attack. Stroke 2021;52:424-433 Qi Z, Zhu L, Wang K and Wang N. PANoptosis: Emerging mechanisms and disease implications. Life Sci 2023;333:122158 Sare GM, Gray LJ and Bath PM. Association between hormone replacement therapy and subsequent arterial and venous vascular events: a meta-analysis. Eur Heart J 2008;29:2031-41 Shin T. The pleiotropic effects of galectin-3 in neuroinflammation: a review. Acta Histochem 2013;115:407-11 Shinohara N, Nakamura T, Abe Y, Hifumi T, Kawakita K, Shinomiya A, Tamiya T, Tokuda M, Keep RF, Yamamoto T and Kuroda Y. d-Allose Attenuates Overexpression of Inflammatory Cytokines after Cerebral Ischemia/Reperfusion Injury in Gerbil. J Stroke Cerebrovasc Dis 2016;25:2184-8 Soares LC, Al-Dalahmah O, Hillis J, Young CC, Asbed I, Sakaguchi M, O'Neill E and Szele FG. Novel Galectin-3 Roles in Neurogenesis, Inflammation and Neurological Diseases. Cells 2021;10 Sun X, Yang Y, Meng X, Li J, Liu X and Liu H. PANoptosis: Mechanisms, biology, and role in disease. Immunol Rev 2024;321:246-262 Sundaram B, Pandian N, Mall R, Wang Y, Sarkar R, Kim HJ, Malireddi RKS, Karki R, Janke LJ, Vogel P and Kanneganti T-D. NLRP12-PANoptosome activates PANoptosis and pathology in response to heme and PAMPs. Cell 2023;186:2783-2801.e20 Tang X, Ravikumar Y, Zhang G, Yun J, Zhao M and Qi X. D-allose, a typical rare sugar: properties, applications, and biosynthetic advances and challenges. Crit Rev Food Sci Nutr 2024:1-28 Thacker EL, Wiggins KL, Rice KM, Longstreth WT, Bis JC, Dublin S, Smith NL, Heckbert SR and Psaty BM. Short-Term and Long-Term Risk of Incident Ischemic Stroke After Transient Ischemic Attack. Stroke 2010;41:239-243 Tripathi MK, Ojha SK, Kartawy M, Khaliulin I, Hamoudi W and Amal H. Mutations associated with autism lead to similar synaptic and behavioral alterations in both sexes of male and female mouse brain. Sci Rep 2024;14:10 Wang J, Li Y, Yu H, Li G, Bai S, Chen S, Zhang P and Tang Z. Dl-3-N-Butylphthalide Promotes Angiogenesis in an Optimized Model of Transient Ischemic Attack in C57BL/6 Mice. Front Pharmacol 2021;12:751397 Wang J, Zhang P and Tang Z. Animal models of transient ischemic attack: a review. Acta Neurol Belg 2020;120:267-275 Wang M, Xian P, Zheng W, Li Z, Chen A, Xiao H, Xu C, Wang F, Mao H, Meng H, Zhao Y, Luo C, Wang Y and Wu S. Axin2 coupled excessive Wnt‐glycolysis signaling mediates social defect in autism spectrum disorders. EMBO Molecular Medicine 2023;15 Wang X, McCoy PA, Rodriguiz RM, Pan Y, Je HS, Roberts AC, Kim CJ, Berrios J, Colvin JS, Bousquet-Moore D, Lorenzo I, Wu G, Weinberg RJ, Ehlers MD, Philpot BD, Beaudet AL, Wetsel WC and Jiang YH. Synaptic dysfunction and abnormal behaviors in mice lacking major isoforms of Shank3. Hum Mol Genet 2011;20:3093-108 Wang Y, Xu Y, Guo W, Fang Y, Hu L, Wang R, Zhao R, Guo D, Qi B, Ren G, Ren J, Li Y and Zhang M. Ablation of Shank3 alleviates cardiac dysfunction in aging mice by promoting CaMKII activation and Parkin-mediated mitophagy. Redox Biology 2022;58 Writing Group for the Women's Health Initiative I. Risks and Benefits of Estrogen Plus Progestin in Healthy Postmenopausal Women: Principal Results From the Women's Health Initiative Randomized Controlled Trial. JAMA: The Journal of the American Medical Association 2002;288:321-333 Yan Y, Shin S, Jha BS, Liu Q, Sheng J, Li F, Zhan M, Davis J, Bharti K, Zeng X, Rao M, Malik N and Vemuri MC. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Transl Med 2013;2:862-70 Yu AYX, Penn AM, Lesperance ML, Croteau NS, Balshaw RF, Votova K, Bibok MB, Penn M, Saly V, Hegedus J, Zerna C, Klourfeld E, Bilston L, Hong ZM and Coutts SB. Sex Differences in Presentation and Outcome After an Acute Transient or Minor Neurologic Event. JAMA Neurology 2019;76 Zhang H, Feng Y, Si Y, Lu C, Wang J, Wang S, Li L, Xie W, Yue Z, Yong J, Dai S, Zhang L and Li X. Shank3 ameliorates neuronal injury after cerebral ischemia/reperfusion via inhibiting oxidative stress and inflammation . Supplement 2024 Zhang H, Feng Y, Si Y, Lu C, Wang J, Wang S, Li L, Xie W, Yue Z, Yong J, Dai S, Zhang L and Li X. Shank3 ameliorates neuronal injury after cerebral ischemia/reperfusion via inhibiting oxidative stress and inflammation. Redox Biology 2024;69 Zhang M, Fu YH, Luo YW, Gou MR, Zhang L, Fei Z and Gao DK. d-allose protects brain microvascular endothelial cells from hypoxic/reoxygenated injury by inhibiting endoplasmic reticulum stress. Neurosci Lett 2023;793:137000 Zhang T, Yin C, Fedorov A, Qiao L, Bao H, Beknazarov N, Wang S, Gautam A, Williams RM, Crawford JC, Peri S, Studitsky V, Beg AA, Thomas PG, Walkley C, Xu Y, Poptsova M, Herbert A and Balachandran S. ADAR1 masks the cancer immunotherapeutic promise of ZBP1-driven necroptosis. Nature 2022;606:594-602 Zhang Z, Qin P, Deng Y, Ma Z, Guo H, Guo H, Hou Y, Wang S, Zou W, Sun Y, Ma Y and Hou W. The novel estrogenic receptor GPR30 alleviates ischemic injury by inhibiting TLR4-mediated microglial inflammation. J Neuroinflammation 2018;15:206 Zheng M and Kanneganti TD. The regulation of the ZBP1-NLRP3 inflammasome and its implications in pyroptosis, apoptosis, and necroptosis (PANoptosis). Immunol Rev 2020;297:26-38 Additional Declarations There is a conflict of interest Supplementary Files suppl.docx Supplemental material Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5824207","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":409014678,"identity":"ca0b8e69-ffe7-4551-9099-1f38df1059c8","order_by":0,"name":"Lei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYDACCRBRwMDDwHyAgeGDgY0ckVoMgFrYEhgYZxSkGROthQGkhZnnw+FEgjrkZzc/e/jFwEaGv407TdrGgDmBgf3w0Q34tDDOOWZuLGOQxiNxjHebdI4BWx4DT1raDXxamCUSzKQlDA7zMNzvBWnhKWaQ4DHDq4VNIv0bUMt/HnmQLRYGEokNhLTwSOSYSX4wOMBjANLCYGBAWIuERE4ZUGUyj+Ex3s2WPQYJxmyE/CI/I32b5I8KO3u5Y7wbb/z481+On/3wMbxaQICZB8V3hJSDAOMPYlSNglEwCkbByAUAsh9AHgZEleoAAAAASUVORK5CYII=","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Zhang","suffix":""},{"id":409014679,"identity":"1e6ba166-f563-4ed6-ae0f-d0c05d7799e0","order_by":1,"name":"Yaowen Luo","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Yaowen","middleName":"","lastName":"Luo","suffix":""},{"id":409014680,"identity":"39b7c280-5ca4-448f-8177-16852f294739","order_by":2,"name":"Jimeng Zhang","email":"","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Jimeng","middleName":"","lastName":"Zhang","suffix":""},{"id":409014681,"identity":"431d8381-d21d-45dc-9528-59f0f65dedf0","order_by":3,"name":"junkai cheng","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"prefix":"","firstName":"junkai","middleName":"","lastName":"cheng","suffix":""},{"id":409014682,"identity":"2679901f-c999-4d4c-8a45-cfb6130d502c","order_by":4,"name":"Zheming Yue","email":"","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Zheming","middleName":"","lastName":"Yue","suffix":""},{"id":409014683,"identity":"911f6d18-89bc-419b-8a9c-ebe9c1f2969e","order_by":5,"name":"Min Zhang","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Zhang","suffix":""},{"id":409014684,"identity":"7a99b5e7-94b0-4cf7-89e7-f9454cc98e47","order_by":6,"name":"Xiaobing Li","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Xiaobing","middleName":"","lastName":"Li","suffix":""},{"id":409014685,"identity":"3553f5e5-7f6c-4119-964b-61d7e3c8f488","order_by":7,"name":"Jing Bai","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Bai","suffix":""},{"id":409014686,"identity":"cf1af515-cada-419c-a569-15a6e9d1f22c","order_by":8,"name":"Juan Li","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Li","suffix":""},{"id":409014687,"identity":"bf9049c8-0a99-4f34-9cea-f114218ac32c","order_by":9,"name":"Maorong Gou","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Maorong","middleName":"","lastName":"Gou","suffix":""},{"id":409014688,"identity":"7e379219-8680-4f06-977c-89ba60486b1e","order_by":10,"name":"Yunchao Yuan","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yunchao","middleName":"","lastName":"Yuan","suffix":""},{"id":409014689,"identity":"42f165d5-afe7-4f04-af10-5677e3f8ebdb","order_by":11,"name":"Lian Zhu","email":"","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Lian","middleName":"","lastName":"Zhu","suffix":""},{"id":409014690,"identity":"c2bce1ab-c3ca-4648-bfe6-1f269d85709d","order_by":12,"name":"Yuefei Zhou","email":"","orcid":"","institution":"air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Yuefei","middleName":"","lastName":"Zhou","suffix":""},{"id":409014691,"identity":"e21ec96f-419d-46cc-bbfc-11f8b9f8e94f","order_by":13,"name":"Xia Li","email":"","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Li","suffix":""},{"id":409014692,"identity":"0e4f7b43-44b3-4bf1-ac92-854ba4891155","order_by":14,"name":"Dakuan Gao","email":"","orcid":"","institution":"Xijing Hospital, air force military medical university","correspondingAuthor":false,"prefix":"","firstName":"Dakuan","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2025-01-14 05:30:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5824207/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5824207/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75306102,"identity":"922d1a97-0311-4c76-ae2e-681b19866475","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1074861,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/1c9d631bcd06986bc45567fd.jpg"},{"id":75306106,"identity":"040f6c88-6632-41e2-9d48-9cbe9561a459","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":763078,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/773d36b56f0b23229e50ca72.jpg"},{"id":75306103,"identity":"3e8b9ff9-6623-40cd-be74-d47f9b53d2af","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":687678,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/a66b6b8caebcc53319f8d895.jpg"},{"id":75306104,"identity":"0730e0a8-1572-4530-9e2b-a2f84a1cebe4","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":795334,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder14.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/70fe2d853579358c82d9a778.jpg"},{"id":75307853,"identity":"17bfaa0d-2d3b-4139-86bb-fc24b0fe20d0","added_by":"auto","created_at":"2025-02-03 08:40:48","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":731569,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/f0e81349b0c115c5d0dc0b5a.jpg"},{"id":75306107,"identity":"cf40b7c2-e7c5-4d13-8233-f98ff6783b9c","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":810966,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder16.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/cad053bf27cccd269e2ba249.jpg"},{"id":75306112,"identity":"d801bc2f-7bc3-4b61-9219-f185dea21d33","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1008807,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder17.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/4b9763b2db579fcdb069034c.jpg"},{"id":75306109,"identity":"5a354310-4387-4e4a-a8cb-776fab4d8c5e","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":937540,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder18.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/4e0dad010a3e2d3cb2935c9f.jpg"},{"id":75306116,"identity":"6be816b7-714b-4b65-ac69-e068fb881073","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1332603,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Binder19.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/6fd0093c6c6c7ec3c7134a1f.jpg"},{"id":77944861,"identity":"a1a4ec1d-9538-4f32-8d9c-77e77575864c","added_by":"auto","created_at":"2025-03-07 06:18:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9608266,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/6bf54d90-ed43-4caa-ae0c-f84511f5d1f3.pdf"},{"id":75306111,"identity":"e7f98229-4e16-4391-8aa0-25e793f6fa54","added_by":"auto","created_at":"2025-02-03 08:32:48","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3646503,"visible":true,"origin":"","legend":"Supplemental material","description":"","filename":"suppl.docx","url":"https://assets-eu.researchsquare.com/files/rs-5824207/v1/92eb6fe2ce9c67b9b87a9806.docx"}],"financialInterests":"There is a conflict of interest","formattedTitle":"Shank3 forms a complex with Gal-3 and ZBP-1 to alleviate PANoptosis in TIA of female ovariectomized mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMore and more evidences suggested that one of specific pathogen- and damage-associated molecular patterns (PAMPs and DAMPs), temporary narrow and/or blockage of a cerebral artery results in transient (less than 24h) neurological dysfunction is reversible after transient ischemic attack (TIA), but the focal brain tissues may often suffer permanent insults and developed ischemic stroke (IS), especially selective neuron death or loss was reported in both experimental and clinical study\u003csup\u003e[\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Growing reviews showed that lots of cell occur PANoptosis, including pyroptosis, apoptosis, and necroptosis, in both homeostasis and disease, such as, infection, cancer, and IS\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. However, surprisingly little is known of the role and regulation mechanism of neuronal PANoptosis in TIA damage. Moreover, PANoptosis were the most genetically well-defined programmed cell death (PCD) pathways regulated by the multifaceted PANoptosome complex (different critical initiators, effectors and executioners) via extensive crosstalk and regulate each other in cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Z-conformation nucleic acid binding protein-1 (ZBP-1), a powerful innate immune sensor, has been shown to induce PANoptosis to eliminate infected cells, prevent tumorigenesis, as well as improve the prognosis of IS, and so on\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Therefore, understanding the PANoptosome complex induced neuron-special PANoptosis is essential for developing targeted therapies of TIA.\u003c/p\u003e \u003cp\u003eOf note, TIA is a critical early warning sign for IS in middle-aged and old human, which occurs in men compared with women, but women have worse functional outcomes than men after TIA, nonfecal or atypical stroke symptoms, for example, confusion, impaired consciousness, mental status change, and headache, and so on\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Also, giving evidences showed that high morbidity, disability, and mortality of ischemic stroke (IS), which induced by TIA in postmenopausal women than that of premenopausal female\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Although some reports indicated that hormone replacement therapy (HRT) is an effective therapeutic strategy for ovariectomized (OVX) animals and menopausal female, but long-term HRT enhances the risks of thromboembolic disease, cardiovascular disease, breast tumor, and endometrial cancer\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. More seriously, no differences in IS rate and in mortality of HRT was certified in many randomized controlled trials of cardio-and/or cerebrovascular-disease prevention, furthermore, a higher stroke risk was found in the first year of HRT treatment\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. As such, to understanding better the pathophysiology and mechanisms contributing to the sex and outcomes differences in postmenopausal women TIA of other than sex hormones, and to explore novel potential targeting molecular and effective therapy to be used in such mild transient ischemic injury are urgency and necessity.\u003c/p\u003e \u003cp\u003eShank3, a typical synaptic scaffolding protein, which located at the postsynaptic density of glutamatergic synapses of neurons, cardiomyocyte, liver cells and renal cell\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, is known to sense signals of excitatory synapses and alleviate neuron-specific apoptosis and autophagy in IS and myocardial infarction via activation of inflammation and oxidative stress\u003csup\u003e[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. However, several critical functions involve cell death and inflammation for Shank3 beyond its canonically described role in dendritic spine and synapses development have been observed that cannot be explained by our current understanding of the Shank3. Shank3, a typical autism spectrum disorder (ASD)-related gene, which located at the postsynaptic density of glutamatergic synapses of neurons, cardiomyocyte, liver cells and renal cell\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, alleviate neuron-specific apoptosis and autophagy in IS and myocardial infarction via activation of inflammation and oxidative stress\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Moreover, papers suggested that the morbidity of ASD caused by Shank3 was not related to sex differences in vivo\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e, conversely, other literature reported that Shank3 accounting for more severe ASD symptoms in males than females, but high mortality in females than men\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. These data suggested Shank3 may be a driving factor, which related to gender differences, playing an important role in the development and outcomes of ASD. However, the effects and mechanism of Shank3 in TIA of postmenopausal female is unclear. However, whether there exists a special molecular mechanism for neuron death and inflammation of Shank3 in TIA of postmenopausal female remains elusive.\u003c/p\u003e \u003cp\u003eIn this work, based on the defeminization TIA models in vivo and transient oxygen glucose deprivation/ reperfusion (tOGD/R) model in vitro, which successfully mimic TIA in human, our results revealed that Shank3 promoted neuronal-special PANoptosis through directly binding Galectin-3 (Gal-3) to subsequent activation of Z-DNA-binding protein-1 (ZBP-1), accounting for more severe TIA in postmenopausal women than premenopausal female. Therefore, Shank3/Gal-3/ZBP-1 signaling axis as an important mechanism underlying D-allose anti-PANoptosis activity and that the overexpression of Shank3 through the development of targeted agonists may be a potential therapeutic strategy for improving the anti-PANoptosis efficacy of HRT in TIA of postmenopausal women treatment.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1. Animals\u003c/h2\u003e \u003cp\u003eC57BL/6 female mice (20\u0026ndash;25 g, 8 months old) were purchased from the Animal Centre of the Air Force Medical University, and Shank3\u003csup\u003eflox/flox\u003c/sup\u003e/Emx1-Cre\u003csup\u003e+/\u0026minus;\u003c/sup\u003e (20\u0026ndash;25 g, 8 months old) based on the genetic background of C57BL/6 at Cyagen Biosciences Inc. All animals were housed under consistent controlled environmental conditions. This study was performed following the National Institutes of Health (NIH) Guide for the Use of Laboratory Animals for all experimental protocols and animal handling procedures and was approved by the Animal Care and Use Committee of the Air Force Medical University (No. IACUC-20230227).\u003c/p\u003e \u003cp\u003eTransgenic mice tail genomic DNA was identified by polymerase chain reaction analysis (PCRA) using the following primary primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCRA primer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eShank3\u003csup\u003eflox\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTTTCTGTCTGTGGTATAAGCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTATGACATGACTTTGCCTTCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eCre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF 1: TTCCTCCTCTCCTGACTACTCCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF 2: GTGAAGGTGTGGTTCCAGAATCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTCTTGTCCCTCTGACAGTGATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2. OVX and TIA modal\u003c/h3\u003e\n\u003cp\u003eThe OVX procedure was performed through a dorsolateral incision, as previously described\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. After the OVX procedure, vaginal smears and blood estrogen tests were performed for 14 days to confirm the success of the OVX procedure and the cessation of the estrous cycle.\u003c/p\u003e \u003cp\u003eAs described in a previous study\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, our study successfully established a mouse TIA model by middle cerebral artery occlusion (MCAO). General anesthesia was induced with 5% isoflurane (RWD Life Science, Shenzhen, China) before surgery, and anesthesia was maintained by inhalation of 2% isoflurane through a face mask during surgery. A midline skin incision was performed to expose the left common carotid artery (CCA). Then, a nylon monofilament suture (0.12 mm diameter; 3.0 cm length, RWD Life Science, Shenzhen, China) was inserted from the left CCA to the origin of the middle cerebral artery (MCA). Local cerebral blood flow (rCBF) was monitored using Cerebral Blood Flow Measurement by Laser Speckle Contrast Imaging (LSCI). The filaments were removed after 8 minutes and reperfusion was performed. D-allose (Kagawa University, Japan) at different concentrations dissolved in saline, was injected intraperitoneally within 5 minutes after reperfusion. The dosage used in this study was determined based on our primary experiments and previous studies\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003e3. Cerebral Blood Flow Measurement by Laser Speckle Contrast Imaging\u003c/h3\u003e\n\u003cp\u003eThe LSCI (RWD Life Science, Shenzhen, China) was used to observe the regional Cerebral Blood Flow (CBF). The mouse head was fixed on the stereotaxic device under isoflurane anesthesia. After disinfection, the scalp was cut longitudinally to fully expose the skull. The skull was wiped with a saline cotton ball to keep it moist. Subsequently, the mice were placed under the LSCI system to observe their CBF images. The raw images were processed by real-time blood flow algorithms, which directly converted the raw images into blood flow velocity information. Data processing was performed using the image software that comes with the system. A wide region of interest (ROI) was set within the MCA blood supply to measure CBF. CBF images were acquired before surgery (baseline), MCAO, as well as CBF images within 5 minutes and 24 hours of reperfusion.\u003c/p\u003e\n\u003ch3\u003e4. Cell culture and the transient oxygen–glucose deprivation and reperfusion model\u003c/h3\u003e\n\u003cp\u003ePrimary hippocampal neuronal cells were extracted from C57BL/6 fetal mice. 0.05% poly-lysine (A3890401, Gibco, USA) was added to the culture plate 24 h in advance and rinsed 3 times with PBS before use. Hippocampal tissues were minced with sterile ophthalmic shears, digested with 0.25% trypsin for 3 min at 37\u0026deg;C, and then centrifuged at 1000 rpm for 5 min. The digested brain tissues were cultured in Neurobasal medium (21103049, Gibco, USA) containing 2% B27 (A3653401, Gibco, USA), 1% L-glutamic acid (25030081, Gibco, USA), and 1% penicillin/streptomycin (15140148, Gibco, USA), in an environment of 37\u0026deg;C, 5% CO2. Stable nerve cells are obtained after 7 days of culture. Neuronal cells were identified by morphological analysis and MAP-2 (1:50, #4542, Cell Signaling Technology, USA) staining. The estrogen receptor inhibitor Fulvestrant (GC18000, GlpBio, USA) and PHTPP (GC11863, GlpBio, USA) were added to the cell culture after maturation and cultured for 4 days to mimic the in vitro OVX model.\u003c/p\u003e \u003cp\u003eTo induce transient oxygen-glucose deprivation (tOGD), the medium was aspirated and the cells were rinsed three times with phosphate-buffered saline (PBS). Glucose-free Neurobasal medium (A2477501, Gibco, USA) was added, and cultured cells were placed in a special chamber containing CO2/N2 (5%/95%) at 37\u0026deg;C and pretreated with N2/ CO2 (95%/5%) to remove other gases. Cells were removed from the hypoxic chamber according to the experimental design. Glucose-free Neurobasal was then replaced with Neurobasal medium and reoxygenated with CO2/O2/N2 (5%/21%/74%) under normoxic conditions for 24 h to induce reperfusion injury. Control cells were cultured under normal conditions with simultaneous fluid exchange. During reoxygenation, different concentrations of D-allose dissolved in PBS were added to the culture medium.\u003c/p\u003e\n\u003ch3\u003e5. Neurological score evaluation\u003c/h3\u003e\n\u003cp\u003eMice were scored before surgery, immediately after surgery, and at 24 hours of reperfusion. The severity of neurological damage in experimental animals was assessed using the Modified Neurological Severity Score (mNSS)\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. The extent of neurological deficits is scored on a scale of 0 to 18, with higher scores indicating greater damage.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e6. Infraction volume ratio measurement\u003c/h2\u003e \u003cp\u003eMice were executed by intraperitoneal injection of excess pentobarbital sodium. The brains were sliced into 2 mm coronal sections with an even thickness. Staining was performed using 2% solution of 2,3,5-triphenyl tetrazolium chloride (TTC) (G3005, Solarbio, Beijing, China) for 20 min at 37\u0026deg;C\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Stained brain sections were fixed in 2% paraformaldehyde and imaged, after which the percentage of infarct volume (white) was analyzed using ImageJ software (National Institutes of Health, USA). Infarct volume was calculated by multiplying the total infarct area by the thickness of the section (2 mm). The ratio of the infarct volume to the total brain volume indicates cerebral infarction.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e7. TUNEL staining\u003c/h3\u003e\n\u003cp\u003eNeuronal apoptosis was quantitatively evaluated by NeuN and TUNEL co-staining. TUNEL staining Kit (C1088, Beyotime, Shanghai, China) according to the manufacturer's instructions\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e, followed by co-staining to label neurons. Briefly, frozen sections were rinsed in phosphate-buffered saline (PBS). Sections were blocked with 10% bovine serum albumin (BSA) containing 0.25% Triton X-100 for 30 min, and sections were incubated in the dark for 1 h at 37\u0026deg;C in a TUNEL reaction mixture. Sections were incubated with rabbit anti-NeuN primary antibody (1:200; Cell Signaling Technology, USA) overnight at 4\u0026deg;C. Then fluorescent staining was performed with goat anti-rabbit IgG secondary antibody (1:200; KFA001, Proteintech Group, China) for 1 h at room temperature, followed by staining of nuclei with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI) (P0131, Beyotime, Shanghai, China). Images were obtained using a fluorescence microscope (Olympus, Tokyo, Japan). At least three microscope fields were randomly selected to analyze each section. The number of TUNEL/NeuN double-positive cells and DAPI labeled cells in each section were counted, and the percentage of double-positive cells relative to the total number of NeuN single-positive labeled cells was calculated. The results were expressed as an apoptotic index.\u003c/p\u003e\n\u003ch3\u003e8. Behavioral tests\u003c/h3\u003e\n\u003cp\u003eNew object recognition experiment: Mice were stroked daily for 1 week before the start of the experiment to eliminate the feeling of unfamiliarity, and were kept next to the experimental setup for 1 day before the start of the experiment to avoid stimulation of the mice during manipulation. At the beginning of the experiment, the mice were allowed to move freely for 10 min in a cube with a base of 50 cm \u0026times; 50 cm, then two identical objects (A and B, make sure that the objects do not have an odor and immovable) were placed in the apparatus, about 10 cm from the two side walls, and the mice were placed in the apparatus with their backs facing the objects at equal distances from the objects, and the exploration time of the mice on each of the objects was recorded with a video camera. The mice were placed in the device with their backs facing the objects at equal distances from the objects, and the exploration time of the mice on each object was recorded with a video camera (the time spent on each object was counted as the time spent on the object when the mouse's mouth or nose touched the object, and when the mouse approached the object to 2\u0026ndash;3 cm). One hour after the initial test, one of the two objects was replaced by a different object, and the mice were placed in the device with their backs facing the object at an equal distance from the object, and the time spent exploring each object within 5 min was recorded with a video camera. We used analytical software (Smart 3.0, Harvard Apparatus, USA) and manual checking for the statistics.\u003c/p\u003e \u003cp\u003eFatigue baton test: Before to modeling, all mice were pre-trained for 3 d on a fatigue baton test, to select mice that would be able to adapt to this type of locomotion under the same conditions during the behavioral test. Mice were first placed on a stationary rotating bar for 180 s for environmental adaptation, then accelerated from 5 r/min to 40 r/min for 300 s. Mice dropped during training were placed back on the rotating bar until the end of training. The training was performed 3 times/d with an interval of 300 s. After 3 d of training, most mice were dropped for more than 300 s. The animals were placed on the rotary bar at the same time. The animals were placed on the stationary rotor bar for 180 s. Then the rotational speed was accelerated from 5 r/min to 40 r/min for 300 s and continued until 300 s. The time of the 1st fall from the rotating bar was recorded, and 2 passive rotations, i.e., holding the rotating bar instead of walking on it, were a fall. Each animal was tested 3 times per test at 5 min intervals, and the average value was taken.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e9. Analysis of cell viability\u003c/h2\u003e \u003cp\u003eCell vitality was assessed using the Cell Counting Kit-8 (CCK-8) assay (AC0011S, Accuref scientific, Xi'an, China) according to the manufacturer's instructions. Neuronal cells were inoculated in 96-well plates under normal conditions until the experiment. After OGD of the cells for some time, they were re-cultured normally for 24 hours. 10 \u0026micro;l of CCK-8 reagent was added to each well and incubated at 37\u0026deg;C for 1 h. The optical density (OD) value at 450 nm was determined using a microplate reader (Bio-Rad, Hercules, California, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e10. Lactate dehydrogenase (LDH) release assay\u003c/h2\u003e \u003cp\u003eThe release of LDH in the cytoplasm indicates disruption of cell membrane integrity, which implies cellular damage\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. LDH levels in cell supernatants were quantified using the LDH kit (AM0211, Accuref scientific, Xi'an, China) according to the instructions provided by the manufacturer. Cell culture medium was added to optically clear 96-well plates for subsequent coupled enzymatic reactions. The LDH reaction solution was added, mixed thoroughly, and incubated at 37\u0026deg;C for 30 min to obtain a brown-red product. The absorbance of the product was determined spectrophotometrically at 450 nm using an enzyme marker (Bio-Rad, Hercules, California, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e11. Detection of cell viability and cytotoxicity using Calcein AM/PI\u003c/h2\u003e \u003cp\u003eCells were incubated in 3 cm dishes. After treating the cells, the medium was discarded, the cells were washed once with PBS, and 1 ml of Calcein AM/PI (C2015S, Beyotime, Shanghai, China)working solution was added\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Cells were incubated in the dark room at 37\u0026deg;C for 30 min, and the staining effect was observed under the fluorescence microscope (Tokyo, Japan) after the incubation. The cell survival rate was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e12. Measurement of ROS\u003c/h2\u003e \u003cp\u003eROS levels were measured in mouse brain tissue using 2\u0026prime;,7\u0026prime; dichlorodihydrofluorescein (DCFH-DA) (Elabscience, Cat# EBCK138-F, China). DCF accumulation was measured using a fluorescence microtiter plate instrument (FLx800, BioTek, USA) at an excitation wavelength of 500 nm and an emission wavelength of 525 nm.\u003c/p\u003e \u003cp\u003eROS levels in neuronal cells (SIBS Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were measured using the Cell Meter Fluorescent Intracellular Total ROS Activity Assay Kit (AAT Bioquest, Cat# 22900, USA). Fluorescence detection was performed using a fluorescence microtiter plate instrument (FLx800, BioTek, USA) with an excitation wavelength of 650 nm and an emission wavelength of 675 nm. cells were imaged using a laser scanning confocal microscope (FV1000, Olympus, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e13. Transmission electron microscopy\u003c/h2\u003e \u003cp\u003eMice were euthanized, and the hippocampal region of the brain was dissected, cut into small pieces, and fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer overnight at 4\u0026deg;C. Then, they were fixed in 1% osmium tetroxide phosphate buffer for 1.5 h, dehydrated through a graded ethanol series, and embedded in Epon812. Ultrathin sections (70 nm) were prepared, stained with uranyl acetate and lead citrate, and examined using an electron microscope (JEOL-1200EX, Jinan Weiya Biotechnology Co., Ltd, Jinan, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e14. RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from mouse brains and cells using TRIzol reagent (Sigma Aldrich, USA). cDNA was synthesized by quantifying RNA concentration and reverse transcribing Master Mix (Takara, Tokyo, Japan). mRNA expression was analyzed on a thermal cycler (Bio-Rad, Hercules, California, USA) using SYBR Premix Ex Taq TM II (Takara, Tokyo, Japan) and synthetic primers. Relative mRNA expression was calculated by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method after normalization concerning GAPDH expression\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. The primers used for real-time fluorescence quantitative PCR in this study are shown in the Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRT-qPCR primer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBase\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLgals3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCCTTTGAGAGTGGCAAACCA\u003c/p\u003e \u003cp\u003eR: CATCGTTGACCGCAACCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGAAGGTCGGTGTGAACG\u003c/p\u003e \u003cp\u003eR: CTCGCTCCTGGAAGATGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eShank3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACGAAGTGCCTGCGTCTGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTCTTGCCAACCATTCTCATCAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZBP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAAGGCCAAGACATAGCTCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GATGTGGCTGTTGGCTCCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e15. Western blot analysis\u003c/h2\u003e \u003cp\u003eRadioimmunoprecipitation assay (RIPA) (AP0231, Accuref scientific, Xi'an, China) lysis, extraction buffer containing 1% Phenylmethanesulfonyl fluoride (PMSF) (ST506, Beyotime, Shanghai, China), and 1% Phosphatase inhibitors (AP0431, Accuref scientific, Xi'an, China) was used to extract total protein from damaged tissue and cells. The nuclear and cytoplasmic proteins were extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (P0027, China Beyotime, Shanghai, China) and 1% PMSF (ST506, Beyotime, Shanghai, China), respectively, according to the instructions provided by the reagent vendor. Protein quantification was performed using a BCA kit (P0010, Beyotime, Shanghai, China). Equal amounts of proteins were separated from each sample using 8\u0026ndash;12% sodium dodecyl sulfate SDS-PAGE gels and subsequently transferred to polyvinylidene difluoride (PVDF) (IPFL00005, Millipore, USA) membranes. The membranes were then blocked with a rapid closure solution (AP0291L, Accuref scientific, Xi'an, China) for 15 min at room temperature, followed by overnight incubation on a shaker with the specific primary antibody HIF-1β (1:1000, #5537, Cell Signaling Technology, USA), Shank3 (1:1000, GTX133133, GeneTex, USA), Galectin-3 (1:1000, A13506, ABclonal Technology, China), ZBP-1 (1:1000, sc-271483, SANTA CRUZ, USA), Caspase 9 and Cleaved-Caspase 9 (1:1000, 10380-1-AP, Proteintech Group, China), Caspase 8 and Cleaved-Caspase 8 (1:1000, 13423-1-AP, Proteintech Group, China), Caspase 7 and Cleaved-Caspase 7 (1:1000, 27155-1-AP, Proteintech Group, China), Caspase 3 and Cleaved-Caspase 3 (1:1000, 19677-1-AP, Proteintech Group, China), Caspase 1 and Cleaved-Caspase 1 (1:1000, A16792, ABclonal Technology, China), RIPK 1 (1:1000, A7414, ABclonal Technology, China), P-RIPK 1 (1:1000, AP1230, ABclonal Technology, China), RIPK 3 (1:1000, A5431, ABclonal Technology, China), P-RIPK 3 (1:1000, AP1408, ABclonal Technology, China), MLKL (1:1000, A21894, ABclonal Technology, China), P-MLKL (1:1000, AP1255, ABclonal Technology, China), NLRP 3 (1:1000, DF7438, Affinity Biosciences Pty Ltd, Australia), GSDMD and N-GSDMD (1:1000, SC393581, SANTA CRUZ, USA), GSDME and N-GSDME (1:1000, A7432, ABclonal Technology, China), β-actin (1:1500, 81115-1-RR, Proteintech Group, China), Lamin b1 (1:1000, 12987-1-AP, Proteintech Group, China), Anti-Ubiquitin (linkage-specific K48) (1:1000, ab140601, abcam, USA) at 4\u0026deg;C. Subsequently, the membranes were washed three times with TBST and then incubated with HRP-conjugated secondary antibodies (1:10000, RGAM001, Proteintech Group, China) in TBST for 1 h at room temperature using a decolorizing shaker. The protein bands were visualized using an ECL substrate (WBKLS, Millipore, USA) and imaged by a detection system (Bio-Rad, Hercules, California, USA). The optical density of the bands was scanned and quantified using image analysis software (ImageJ Software, National Institutes of Health, USA) for β-actin and Lamin b1 as an internal control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e16. Flow cytometry test\u003c/h2\u003e \u003cp\u003eNeural cells were inoculated in 25 cm\u003csup\u003e2\u003c/sup\u003e cell culture flasks, and randomly grouped, and the cells were treated according to the experimental requirements, and the number of apoptotic sample cells must not be less than 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e. Cells were collected after digestion with EDTA-free Trypsin (T1350, Solarbio, Beijing, China). Add 300 \u0026micro;L of Binding Buffer to resuspend the cells. Add 5 \u0026micro;L of Annexin V FITC solution (AB_2869082, BD Biosciences, USA) and incubate for 15 min at room temperature away from light. 5 \u0026micro;L of PI solution (AB_2869082, BD Biosciences, USA) should be added 5 min before mounting. Add 200 \u0026micro;L of Binding Buffer and perform fluorescence detection by flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e17. Immunohistochemistry\u003c/h2\u003e \u003cp\u003eMice were anesthetized and perfused transcranial with heparin saline, followed immediately by a 4% formaldehyde solution. Brain tissues were removed, fixed, dehydrated, and subsequently sectioned into coronal sections of 16 \u0026micro;m thickness (Leica, Wetzlar, Germany). Neural cells were cultured on 6-well plate cell slides and fixed in 4% paraformaldehyde for 15 min at room temperature. Brain sections were rinsed in PBS for 30 min, and cells were rinsed in PBS for 10 min. samples were permeabilized with 0.1% Triton X-100 in PBS for 10 min, blocked with 5% bovine serum albumin (BSA) for 30 min at room temperature, and then rinsed three times in PBS. Sections were incubated overnight at 4\u0026deg;C with specific antibodies Gal-3 (1:200, A13506, ABclonal Technology, China), NeuN (1:200, #24307, Cell Signaling Technology, USA), P-TDP 43 (1:200, 66318-1-Ig, Proteintech Group, China), Caspase 3 (1:200, 19677-1-AP, Proteintech Group, China), Caspase 1 (1:100, A16792, ABclonal Technology, China), RIPK 1 (1:100, A7414, ABclonal Technology, China), Shank3 (1:200, GTX133133, GeneTex, USA), ZBP-1 (1:100, sc-271483, SANTA CRUZ, USA), β-actin(1:1000, 81115-1-RR, Proteintech Group, China), NESTIN (1:200, ab22035, Abcam, USA), OCT 4 (1:100, ab19857, Abcam, USA), DCX (1:50, ab22035, Abcam, USA), TUJ 1 (1:200, ab18207, Abcam, USA), SOX 2 (1:200, ab97959, Abcam, USA), Map 2 (1:50, #4542, Cell Signaling Technology, USA), Hu (1:100, ab191181, Abcam, USA). After washing in PBS for 3 \u0026times; 10 min, the cells were incubated with fluorescent secondary antibody (1:200; RGAR002/RGAR004, Proteintech Group, China) for 1 h at 37\u0026deg;C. Finally, the nuclei were stained with a stain containing DAPI (P0131, Beyotime, Shanghai, China). Immunofluorescence images were taken using an Olympus fluorescence microscope (Tokyo, Japan). Three random regions of each sample were imaged and analyzed using ImageJ software (National Institutes of Health, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e18. Coimmunoprecipitation (CO-IP)\u003c/h2\u003e \u003cp\u003eCo-immunoprecipitation (Co-IP) assays were performed according to established protocols\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Cells were collected into NP-40 immunoprecipitation lysis buffer (P0013F, Beyotime, Shanghai, China) containing PMSF (ST506, Beyotime, Shanghai, China). After lysis on ice for 30 min, the resulting supernatant was collected and subsequently incubated with primary antibodies against Shank3 (1:50, #64555, Cell Signaling Technology, USA), Gal-3 (1:30, A22768, ABclonal Technology, China), and ZBP-1 (1:50, sc-271483, SANTA CRUZ, USA) or isotype immunoglobulin G (IgG) for 2 h. (#3900, Cell Signaling Technology, Shanghai, P.R. China) Subsequently, 35 \u0026micro;L of protein A/G beads (# sc-2003, Santa Cruz, Shanghai, China) were added to the immunoprecipitation mixtures and allowed to stand at 4\u0026deg;C overnight. The next day, the mixture was washed five times using 1\u0026times; Co-IP cold buffer, followed by denaturing the bound proteins with 1\u0026times; sample buffer. The resulting supernatant was collected and used for SDS-PAGE and Western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e19. Human induced pluripotent stem cells culture and differentiation\u003c/h2\u003e \u003cp\u003eHuman induced pluripotent stem cells (hiPSCs) (Cellapy Biotechnology, Beijing, China) were cultured in PSCeasy\u0026reg; Type II hiPSC Complement Medium (Cellapy Biotechnology). The hiPSCs were passed when the fusion reached 80%. hiPSCs were induced to differentiate into human neural stem cells (hNSCs) when they reached 100% fusion. In this study, specific antibodies were used to identify hNSCs. for subsequent experiments, hNSCs were passaged more than three times. They were cultured in NeuroEasy human neural cell differentiation medium for 21 days. Cells with a neuronal phenotype were identified using specific neural markers\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e20. CRISPR/CAS9 mediated Shank3 mutation in neuronal cells derived from Human induced pluripotent stem cells\u003c/h2\u003e \u003cp\u003eThe human Shank3 corresponding guide RNA sequence (gRNA1: GATGCCGACGCGCACGACCA) was cloned into PX459v20. after sequence confirmation, the construct was transfected into hiPSCs differentiated mature neurons. The transfected cells were sorted. Cells with successful knockdown of the Shank3 gene were subjected to the next experiments. Sequencing primers were as follows: F: CGCTTCCC TCCCGTCTCAG; R: TCCAGGCGCAGGCACTTCT.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003e21. RNA sequencing (RNA-Seq)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from Shank3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mouse hippocampal brain tissue and Gal-3 knockout neuronal cells using TRIzol reagent (Invitrogen, Cat# 15596026, USA) according to the manufacturer's protocols. An Agilent 2100 Bioanalyzer (Agilent Technologies, USA) was used to analyze the RNA quality. Eukaryotic mRNA was then enriched with Oligo (dT) beads. enriched short fragments were fragmented with fragment buffer and then reverse transcribed into cDNA using random primers. DNA polymerase I, RNase H, dNTP, and buffer facilitated the synthesis of the second-strand cDNA. The resulting cDNA fragments were purified with the QiaQuick PCR extraction kit (Qiagen, Venlo, The Netherlands), end-repaired, added to poly (a), and ligated to an Illumina sequencing adapter. The size of the ligated products was then selected by agarose gel electrophoresis, PCR amplified, and sequenced on an Illumina Novaseq6000 from Gene Denovo Biotech Co. (China). RNA-Seq was followed by Gene Ontology (GO) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Set Enrichment Analysis (GSEA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e22. Enzyme‑linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe brain tissues were thoroughly ground and the supernatant of the homogenate was collected after centrifugation. Blood was collected in anticoagulation tubes and plasma was collected after centrifugation. The cell culture supernatants were also collected. IL-1β, IL-6, TNF-α, IL-18, and estrogen levels were detected using a commercial ELISA kit (Nanjing Jiancheng Bioengineering Institute, China).\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003e23. 3D structure prediction\u003c/h2\u003e \u003cp\u003eIn this study, protonation was first carried out under neutral conditions (pH\u0026thinsp;=\u0026thinsp;7) using the H\u0026thinsp;+\u0026thinsp;+\u0026thinsp;3 online server. Subsequently, heteroatoms and water molecules were removed from the crystal structure using UCSF Chimera software, leaving only the charge-distributed protein structure. Next, molecular docking was performed using the protein-protein docking tool HDOCK, and molecular docking and conformational scoring were performed using the empirically based iterative scoring function ITScorePP. Negative values indicate successful molecular binding and larger absolute values indicate stronger binding ability. Three-dimensional mapping analyses were performed using PyMOL 2.04, and two-dimensional interaction analyses were performed using Maestro to statistically determine the type, distance, and number of interactions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003e24. Glutathione S-transferase (GST) pull-down assay\u003c/h2\u003e \u003cp\u003eFor GST pull-down experiments, equal amounts (0.5 mg) of the purified ANK structural domain of the Shank3-GST fusion protein and the carbohydrate recognition domain (CRD) of the Gal-3 His fusion protein were mixed and incubated on ice for 3 h. Subsequently, the mixture was loaded onto a glutathione Sepharose 4B resin column. After 5 washes with wash buffer, the proteins were eluted with wash buffer containing 15 mm reduced glutathione. The eluate was separated by SDS-PAGE, transferred to a PVDF membrane and probed with mouse anti-HIS (1:50 000, CUSABIO, Cat# CSBMA000159, USA), and mouse anti-GST (1:50 000, CUSABIO, Cat# CSBMA000304, USA) antibodies. Negative controls were GST-labelled and His-labelled by Wuhan Chuang Bioengineering Co.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003e25. Protein expression\u003c/h2\u003e \u003cp\u003eThe pGEX-6p-1 plasmid-encoded GST, which labeled the ANK structural domain of Shank3 (residues 148\u0026ndash;345, UniProtKB: Q4ACU6\u0026sdot;SHANK3_MOUSE), and the pET32a plasmid-encoded His, which labeled the carbohydrate recognition domain (CRD) of Gal-3 (residues 148\u0026ndash;176, UniProtKB: P16110\u0026sdot;Gal-3_MOUSE), transfected with E. coli BL21-CodonPlus. E. coli cells were induced with 0.1 mM isopropyl β-d-thiogalactopyranoside (IPTG), and cultured in Luria broth at 18\u0026deg;C for 12 h until the D600 nm reaches 0.4\u0026ndash;0.6. Then BL21 was harvested cells were sonicated in cold PBS and purified with glutathione s -transferase (GenScript, Cat# L00206, China) beads or nickel-nitrile triacetate (GenScript, Cat# L00250, China) beads according to the user manual. The validity of the purification was verified by SDS-PAGE followed by Komas blue staining.\u003c/p\u003e \u003cp\u003eMouse Shank3-ANK and Gal-3-CRD were cloned into the pcDNA3.1 vector. HA-ANK protein and HA-CRD protein were overexpressed in HT22 cells. HA-ANK mutants were generated in the Shank3-ANK (148\u0026ndash;345) sequence and docked by the knockout molecule experimentally predicted binding site constructs.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e26. Gene knockdown and overexpression\u003c/h2\u003e \u003cp\u003eGal-3, Shank3, and ZBP-1 knockdown and overexpression systems (Hanhen and Jikai, China) were transiently transfected into primary cells using transfection reagents (Beyotime, China) according to the manufacturer's instructions. Cells were collected 3 days after transfection and transfection efficiency was assessed by Western blot and qPCR validation.\u003c/p\u003e \u003cp\u003eMice were anesthetized and fixed on a stereotactic head frame (RWD, Shenzhen, China). A midline scalp incision was made to fully expose the bregma and lambda. for intrahippocampal injections, holes were drilled bilaterally using a high-speed drill in coordinates relative to the bregma (X=-2.06 mm, Y\u0026thinsp;=\u0026thinsp;2 mm). A syringe was connected to a microinjector pump and a needle was inserted into the brain through a burr hole (Z\u0026thinsp;=\u0026thinsp;2 mm from the bone surface) to inject 1 \u0026micro;l of adeno-associated virus (AAV) (Hanheng China)\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Postoperatively, the cranial defect was closed with bone wax, and the incision was sutured. Transfection efficiency was measured 21 days later.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e27. Statistical analysis\u003c/h2\u003e \u003cp\u003eExperiments were repeated at least three times and data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. GraphPad Prism 9.0 (GraphPad Software, La Jolla, CA, USA) was used for statistical analysis. Comparison of data between multiple groups was performed using One-way ANOVA and Two-way ANOVA with Dunnett's test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered a statistically significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e1. Neuronal-special PANoptosis increased in defeminization TIA models of female mice\u003c/h2\u003e \u003cp\u003eAn 8-min period of MCAO induced by the suture method was applied to create a TIA model in female mice, which was operated Ovariectomizing (OVX) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. a). This defeminization TIA models not only truly mimicked human TIA in postmenopausal women but also efficiently evaluated changes in the neuronal PANoptosis and the expression level of Shank3 and Gal-3 in the hippocampus and cortex in mice. The positive results of estrogen identification and vaginal secretion smear examination confirmed successful castration of female mice (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. a, b). Like previous literates, 8 min cerebral ischemia induced by the suture MCAO method is an appropriate TIA model in C57BL/6 mice, which was successfully determined by significantly deteriorated neuroglial dysfunction after operation, and above changes was recovery in postoperative 24 hours, which was examined by mNSS scores and rotation rod and new object recognition test (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. d - f), also prominently decreased cerebral blood flow (CBF) following with ischemic/ reperfusion injury and these changes returned to baseline levels in postoperative 24 hours, which was measured by laser speckle contrast imaging (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. b, c), as well as markedly increased the levels of HIF-1β (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. f, g), ROS (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. e), cell apoptosis rates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. i, j), and P-TDP43 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. g, h), expect for no obvious changes of the volume of cerebral infarction which was tested by TTC staining throughout the experimental period (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. c, d). These results suggested that neither CBF and neurological deficits nor cerebral infarcts occurred in TIA female mice, which truly mimic human TIA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm the occurrence of neuronal-special PANoptosis after TIA and OVX\u0026thinsp;+\u0026thinsp;TIA, we explored the expression changes of key markers of apoptosis, necroptosis, and pyroptosis. Compare with Con group, the levels of Caspase 3, Caspase 1, and RIPK 1 was significantly increased in OVX group and OVX\u0026thinsp;+\u0026thinsp;TIA group, which examined by IF (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. k). Notably, the protein levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 that are indicative of apoptosis, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL that are indicative of necroptosis, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1, GSDMD, N-GSDMD, GSDME, and N-GSDME that are indicative of pyroptosis were robustly higher in OVX\u0026thinsp;+\u0026thinsp;TIA mice than in WT mice and WT\u0026thinsp;+\u0026thinsp;OVX mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. h). Moreover, we found markedly increased the release of inflammatory factors, such as, TNF-α、IL-1β、IL-6 and IL-18 dialed with OVX after TIA (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. h - k). In addition, we found that 14.4% PANoptosis positive neurons in region of hippocampus of mice after TIA by calculating and summing up Caspase3 positive neurons, Caspase1 positive neurons, and RIPK1 positive neurons (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. p, q). Thus, these data demonstrate that defeminization in combination with TIA contributes to the activation of PANoptosis of neurons, but it did not worsen the degree of injury.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, to further investigate the type and effect of cell death programs that occurred, multiple inhibitors of common cell death pathways, were used to rescue the neuron death induced by OVX\u0026thinsp;+\u0026thinsp;TIA. Of note, the apoptosis inhibitor Z-VAD-FMK, the necroptosis inhibitor necrostatin-1, and the pyroptosis non-specific inhibitor disulfiram that inhibits both GSDMD and GSDME, reversed the enhanced neuron death, increased markers of PANoptosis expression and amplified inflammatory factors secretion and release induced by TIA under defeminization, and none of the inhibitors leaded to complete recovery to the levels observed in the control group, but also Z-VAD-FMK, necrostatin-1, and disulfiram only specifically restrained apoptosis, necroptosis and pyroptosis which face-to-face forms of cell death. More, the pyroptosis inhibitor disulfiram and the necroptosis inhibitor necrostatin-1, which individually blocks GSDMD and GSDME, as well as RIPK 1, RIPK 3 and MLKL concurrently in OVX\u0026thinsp;+\u0026thinsp;TIA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. l, m). Moreover, we found markedly decreased the release of IL-1β and IL-18 of mice treated with disulfiram after OVX\u0026thinsp;+\u0026thinsp;TIA, and TNF-α and IL-6 of hippocampus were no change treated with Z-VAD-FMK and necrostatin-1 after OVX or OVX\u0026thinsp;+\u0026thinsp;TIA (S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. l - o).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003e2. Establishment of a tOGD/R modal of TIA in neurons which cultured in anti-hormone serum\u003c/h2\u003e \u003cp\u003eTo better mimic the in vivo context, we established a tOGD/R modal of TIA in primary neurons from the mice which cultured in anti-hormone serum to truly mimicked postmenopausal women TIA.\u003c/p\u003e \u003cp\u003eBased on cell apoptosis, necroptosis and pyroptosis ratio in hippocampus of animals after TIA, we found that the viability of primary neurons, which experienced OGD 24 hours and reperfusion 1 hour, is like that of animals under both estrogen or estrogen-deficient conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. a). Also, the same results of AM/PI staining (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. b, c), CCK 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. b, S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. a) further conform the time point of tOGD/R modal for TIA in neurons, which verily impressed mice TIA. Furthermore, using CCK8 assay (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. d), LDH concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. c), expression of HIF-1β (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. e, f), flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. d, e), AM/PI staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. f, g), ROS staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. g, h) and inflammatory factors assay (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. i - l), to demonstrated that damaged and dead cells, including apoptosis, pyroptosis and necroptosis, significantly increased in -E\u0026thinsp;+\u0026thinsp;OGD/R group than that in Con group and -E group.\u003c/p\u003e \u003cp\u003eMore, the expression changes of key markers of PANoptosis were once again assessed in vitro to clarify the occurrence and severity of neuronal-special apoptosis, necroptosis, and pyroptosis after TIA. Similar to the results in vivo, the levels of apoptosis biomarker, including Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 ratio, necroptosis biomarker, such as, P-RIPK 1/RIPK 1 ratio, P-RIPK 3/RIPK 3 ratio, and P-MLKL/MLKL ratio, as well as pyroptosis biomarkers, NLRP 3, Cleaved-Caspase 1/Caspase 1 ratio, GSDMD, N-GSDMD, GSDME, and N-GSDME were significantly increased in -E\u0026thinsp;+\u0026thinsp;OGD/R group than that in Con group and -E group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. h). Furthermore, Z-VAD-FMK, necrostatin-1, the expression of Caspase 3, Caspase 1, and RIPK 1 was restored to normal levels, which observed by immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. j), as well as the biomarker levels of apoptosis, necroptosis, and pyroptosis also was reinstated to physiological levels, which examined by western-blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. k). Additionally, the disulfiram rescued increased IL-1βand IL-18 levels, but did not affect the expression of TNF-α and IL-6 in neurons with tOGD/R and defeminization damage (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. m - p). These results are consistent with the in vivo results.\u003c/p\u003e \u003cp\u003eTogether the studies about neuronal-special PANoptosis in vivo and in vitro after TIA, we found that all manner of neuron death programs not only emerged immediately and exhibit extensive crosstalk after cerebral artery occlusion and reperfusion, but also resulted in serious neurological dysfunction, which pronounced remarkably in female mice after defeminization TIA, indicating that momentary ischemia reperfusion, and estrogen deficiency enhanced the sensitivity of neurons to PANoptosis, and PANoptosis of neurons was a key risk factor for exacerbating the occurrence and development of TIA in castrated female mice.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3. Shank3 is lowly expressed in defeminization TIA models and maybe an estrogen sensitivity factor that exacerbates neuronal injury and neurological dysfunction\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn fact, Shank3, a typical ASD-related gene, ameliorates oxidative stress and inflammation after IS, which was described in previously literature\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Like those in our previous results of IS, the mRNA and protein expression levels of Shank3 decreased steadily, and was negatively correlated with the severity of neuron injury with feminization and defeminization after TIA in vivo and in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. a, f). Meanwhile, we found that the expression of Shank3 in mRNA and protein levels was significantly descended in primary neurons and hippocampus after defeminization injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. b \u0026ndash; e, g - j). As such, our findings suggested that Shank3 might promote neuronal insults and account for more severe TIA in postmenopausal women than premenopausal female.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we estimated the effect of Shank3 among female mice after TIA vs. TIA\u0026thinsp;+\u0026thinsp;OVX, Shank3A CKO mice were generated and utilized (S Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. a - g). Of note, downregulation of Shank3 in the hippocampus of female mice induced severe neurological dysfunction, such as, motor function, memory, cognitive impairment and the volume of cerebral infarction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. k - o), but no obvious effect on the CBF after TIA compared to Shank3 WT female mice (S Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. h, i), suggesting that Shank3 is more sensitive to brain tissue of defeminization mice damage and neurological deterioration, which may be one of key risk factors determining the severity of TIA in postmenopausal women. Meanwhile, we silenced Shank3 in primary neurons (S Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. k - o) and found that downregulation of Shank3 obviously enhanced cell toxicity and LDH concentration in -E\u0026thinsp;+\u0026thinsp;Shank3\u003csup\u003eKO\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;tOGD/R group than those in -E\u0026thinsp;+\u0026thinsp;Shank3\u003csup\u003eNC\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;tOGD/R group and Shank3\u003csup\u003eKO\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;tOGD/R group, which were consistent with the results in vivo (S Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. p, q), indicating Shank3 maybe an estrogen sensitivity factor that exacerbates neuronal injury in defeminization TIA models in vitro. In fact, we have previously demonstrated that Shank3 deficient aggravated neuronal injury via inhibiting oxidative stress and inflammation after IS. In the current study, knocking down Shank3 in vivo and in vitro successfully induced neuron injury and dead (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. p \u0026ndash; s, S Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. r, s), indicating that Shank3 may impede the development of TIA in defeminization mice.\u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003e4. Shank3 deficiency in vivo and in vitro contributes to neuronal-special PANoptosis\u003c/h2\u003e \u003cp\u003eNotably, GO and KEGG pathway enrichment analysis showed that Shank3 was strong negatively correlated with apoptosis and necroptosis, but no obvious relationship with pyroptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. a - d). In fact, significant activation of apoptosis through Shank3/Stim1 signaling pathway after IS\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, obviously enhancement of pyroptosis through Shank3/DJ-1TNF signaling, axis following with traumatic brain injury (data not supply) were observed in our previous study. Of note, Shank3 deficiency enhanced neuron-special PANoptosis in TIA\u0026thinsp;+\u0026thinsp;OVX group vs. controls and TIA group, as demonstrated by the expression of the key proteins, such as Cleaved-Caspase 3, 7, 8, 9, P-RIPK 1, P-RIPK 3, P-MLKL, NLRP 3, Cleaved-Caspase 1, N-GSDMD, and N-GSDME, as well as the release of oxidative stress and pro-inflammatory factors, including, ROS, TNF-α、IL-1β、IL-6 and IL-18 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. e - j).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs expected, we found that Shank3 loss increased the number of dead cells, at the protein level, compared with contral and tOGD/R neurons, the markers of apoptosis, pyroptosis and necroptosis were all dramatically increased in defeminization neurons after TIA. In addition, the expression of ROS, TNF-α、IL-1β、IL-6 and IL-18, was further increased in de-estrogen neurons after tOGD/R vs. control and de-estrogen neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. k - q). These results are consistent with the in vivo results, leading us to speculate Shank3 could be a widespread target for susceptibility to anti-PANoptosis treatment in TIA human, especially postmenopausal women.\u003c/p\u003e \u003cp\u003e \u003cb\u003e5. Shank3 directly binds to Gal-3 facilitating its ubiquitination and nuclear translocation, and subsequent downregulation of ZBP-1\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential mechanism by which Shank3 in neuron promotes PANoptosis activation, the results of RNA sequencing showed that 730 genes were up-regulated and 114 genes were down-regulated on Shank3\u003csup\u003ecko\u003c/sup\u003e and Shank3\u003csup\u003ef/f\u003c/sup\u003e mice hippocampus, and the top 10 most significantly increased or decreased genes were listed and displayed with a heatmap (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. a, b). Lgals3 (Gal-3) was No. 4 of the most upregulated genes in Shank3\u003csup\u003ecko\u003c/sup\u003e vs. Control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. a, b), suggesting that Shank3 knockdown leads to increased Gal-3 level. Consistently, the protein levels of Gal-3 were significantly increased in hippocampus tissues from Shank3 KO vs. WT mice. In fact, Gal-3, a famous β-galactoside-binding protein belonging to the lectin family with aging and neurodegeneration, enhanced neuronal oxidative injury, inflammatory damage and apoptosis after IS was reported in the previous research findings by us and others\u003csup\u003e[\u003cspan additionalcitationids=\"CR38 CR39\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Notably, the results of 3D molecular docking of protein-protein interactions predicated that the ANK domain of Shank3 directly interacted with the cytoplasmic carbohydrate recognition domain (CRD) of Gal-3 by hydrogen bonds, salt bridges, and π-stacking (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. c). In this study, immunofluorescence analysis revealed that Shank3 colocalized well with Gal-3 in the cytoplasm and on the cell membrane of the hippocampal neurons and cultured primary neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. d - f). Co-immunoprecipitation (Co-IP) using antibodies against either Shank3 and Gal-3 also demonstrated their interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. g). Glutathione S-transferase (GST) pull-down experiments further corroborated the physical association between the ANK domain of Shank3 and the CRD of Gal-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. h, S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. a). Subsequently, to further identify the interaction site of Shank3 and Gal-3, Co-IP experiments showed that the interaction between ANK-HA and CRD-FLAG was reduced significantly in the mutant cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. i). Furthermore, Shank3 deficiency attenuated the degradation of Gal-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. k - m) and decreased K48-linked ubiquitination of Gal-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. j, S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. b). These data indicate that Shank3 deletion attenuates the K48-linked ubiquitination of Gal-3. Finally, we isolated the nuclear fraction from primary cultured neurons and immunoblotted for Gal-3. Substantially more Gal-3 protein was in the nuclear fractions in neurons treated with Shank3 silencing than in control cells in vivo and in vitro, indicating that Gal-3 entered the nucleus via active transport in response to Shank3 downregulation (S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. c, d). Finally, the results of immunoblot analysis indicated that expression of Gal-3 protein decreased on the condition of Shank3 overexpression, while increased when Shank3 was knocked down suggesting that Shank3 negatively regulated the expression of Gal-3 (S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. e - f). Together, these data demonstrated not only that the physical structures of Shank3 and Gal-3 directly interact but also that loss of Shank3 increased Gal-3 protein stability through the ubiquitin‒proteasome pathway and induced Gal-3 nuclear translocation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIt has been accepted that the ZBP-1, an innate sensor of inflammation and a central regulator of cell death, is protective against infection and brain injuries by inhibiting oxidative stress and proinflammatory responses\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Given this, the Shank3/ZBP-1 interaction was examined in the following study. Although Shank3 colocalized well with ZBP-1 in the cytoplasm and on the cell membrane of the hippocampal neurons and cultured primary neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. d - f), as well as loss of Shank3 enhanced ZBP-1 protein levels (S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. e - f) and overexpression of Shank3 downregulated expression of ZBP-1 in defeminization TIA models in vivo and in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. d, g), but the results of CO-IP showed that Shank3 indirectly binds to ZBP-1 in neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. a). These data showed that the enhanced expression of ZBP-1 which were mediately regulated by Shank3 and some downstream target molecules that directly binds to it, such as, Gal-3, participate in the process of neuronal-special PANoptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThen, we conformed whether Gal-3, as a downstream target gene of Shank3, was involved in the regulation of ZBP-1 and thereby regulated the activation of PANoptosis after defeminization TIA injury. The results of 3D molecular docking of protein-protein interactions predicated that the ZBP-1 interacted with the CRD of Gal-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. c). Based on the results of Gal-3 co-localized well with ZBP-1 in neurons that examined by immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. d - f), as expected, the directly protein-protein interaction between Gal-3 and ZBP-1 was corroborated by using Co-IP assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. g). Also, Primary neurons treated with Gal-3 overexpression had increased ZBP-1 nuclear translocation than cells treated with vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. b, c). Conversely, a similar volume of cells treated with Gal-3 downregulation had decreased ZBP-1 nuclear translocation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. b, c). Lastly, we constructed lentivirus-based shRNA (D/E) and overexpression (O/E) vectors to regulated the protein levels of Gal-3 and ZBP-1, the results of Western blot showed that ZBP-1 protein level increased on the condition of Gal-3 overexpression, while decreased when Gal-3 was knocked down, but ZBP-1 did not regulate the expression of Gal-3 (S Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. e - f). Altogether, these findings suggested that indicating that Gal-3 positively regulated the expression of ZBP-1 and overexpression Gal-3 induced ZBP-1 nuclear translocation in neurons.\u003c/p\u003e \u003cp\u003eTo further study the function of Gal-3/ZBP-1 complex in neuronal PANoptosis after defeminization TIA injury in vivo and in vitro, using RT-PCR and immunofluorescence analysis, we found firstly that the mRNA and protein levels of Gal-3 and ZBP-1 both increased significantly, and was positively correlated with the severity of neuron injury with feminization and defeminization after TIA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. d - i). Afterwards, the cultured primary neurons and mouse brain were transfected vectors with lentivirus downregulation and overregulation of Gal-3 and ZBP-1 expression, the results showed that either overregulation Gal-3 or overexpression ZBP-1 both significantly increased the protein levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1, GSDMD, N-GSDMD, GSDME, and N-GSDME in defeminization TIA neurons than in normal neurons and de-estrogen neurons, whereas Gal-3 and ZBP-1 deletion in neurons alleviated development of PANoptosis in vivo and in vitro mice after defeminization TIA injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. m - p). Of note, the results of Gal-3 regulate PANoptosis in vivo and in vitro were consistent with the results about the relationship among Gal-3 and apoptosis, pyroptosis, and necroptosis predicted by GO and KEGG pathway enrichment analysis of RNA sequencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. j - l). Collectively, these data indicated that both Gal-3 and ZBP-1 induced neuronal-special PANoptosis to promote the development of TIA with de-estrogen.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003e6. D-allose enhanced Shank3 attenuates PANoptosis and neurological deficits of OVX female mice after TIA\u003c/h2\u003e \u003cp\u003eAs an ultralow calorie sugar with no toxicity, with high levels of sweetness\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e, D-allose was demonstrated to attenuate neuroinflammation and neuronal apoptosis following IS in our and others previous reports\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Here, protein-ligand docking studies firstly confirmed strong Shank3 ANK domain-drug interaction for D-allose, which ten showed promising binding affinities in conjunction with lower inhibition constants (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. a). We next injected intraperitoneally D-allose at five different dosages in Shank3 KO female mice after TIA, followed by mNSS test, and the mRNA and protein levels of Shank3 measurements in vitro at the next day post-administration (S Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. b - d). And administration of D-allose at concentrations of 0.6 mg/g improved neurological deficits in female Shank3 KO mice after TIA, while achieved a balance between enhancement of Shank3 expression and minimal potential side effects (S Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. a). To further confirm that the neuro-protective effects and mechanism of D-allose, we found that female Shank3 KO mice after TIA and OVX\u0026thinsp;+\u0026thinsp;TIA treated with 0.6 mg/g D-allose significantly enhanced CBF (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. d, e), the mean length and thickness of postsynaptic densities (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. i), and improved neurological dysfunction, including motor function, memory and cognitive impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. f - h), but no obvious effect on the volume of cerebral infarction than observed in Shank3 KO mice after TIA treated with vehicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. b, c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOf note, 0.6 mg/g D-allose treatment for restored the enhanced levels of Cleaved-Caspase 3, 7, 8, 9/Caspase 3, 7, 8, 9 ratio for apoptosis, P-RIPK 1/RIPK 1, P-RIPK 3/RIPK 3, and P-MLKL/MLKL ratio for necroptosis, as well as NLRP 3, Cleaved-Caspase 1/Caspase 1 ratio, GSDMD, N-GSDMD, GSDME, and N-GSDME for pyroptosis in the hippocampus of Shank3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice after TIA and OVX\u0026thinsp;+\u0026thinsp;TIA, as well as the rose levels of Gal-3 and ZBP-1, neurons death in the hippocampus (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. j, k, m). Similarly, D-allose treatment rescued increased ROS, TNF-α, IL-1β, IL-6, and IL-18 levels in the hippocampus (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. L, n - q). These data showed that D-allose may represent a novel potential drug for neuronal PANoptosis and neurological dysfunction in TIA.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003e7. D-allose alleviates PANoptosis after tOGD/R induced TIA in Shank3 mutant human neurons with de-estrogen\u003c/h3\u003e\n\u003cp\u003eIn order to validate whether similar changes occurred in human ASD neurons, we mutated Exon2 of the Shank3 gene of hiPSCs using CRISPR/Cas 9 (S Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. b), which was checked by qPCR and Western blotting (S Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh - l). hiPSCs of control and Shank3 mutant were induced to over 95% of Tuj-1‐positive neurons after 4 weeks induction, which executed according to a well‐established protocol, and degree of differentiation of hiPSC was determined by immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. a, b; S Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. a). Similarly to the results of primary neurons and mice, compare with normal human neurons, the protein levels of Gal-3 and ZBP-1 markedly increased (S Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. h - l). Then, Shank3/Gal-3, Shank3/ZBP-1, and Gal-3/ZBP-1 interaction were examined by protein CO‐IP assay, the results showed that strong Shank3/Gal-3 and Gal-3/ZBP-1 interaction in WT human neurons, while there were no spatial interlocking between Shank3 and ZBP-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. c). Remarkably, more severe oxidative stress and inflammatory insults, as well as significantly PANoptosis, were observed in Shank3\u003csup\u003eKO\u003c/sup\u003e-E\u0026thinsp;+\u0026thinsp;OGD/R group, as compared that with in Shank3\u003csup\u003eNC\u003c/sup\u003e-E\u0026thinsp;+\u0026thinsp;OGD/R group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. d - p).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, we next talk about whether anti-PANoptosis effects of D-allose occurred in human iPSCs treated with OGD/R and defeminization after 4 weeks of neuronal differentiation. Based on the results of cell viability, LDH concentration, as well as the mRNA and protein expression level of Shank3, 4 mM, the optimal dose of D-allose in Shank3 mutant human neurons with OGD/R and de-estrogen treatment was screened out (S Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. c - g). Notably, like primary neurons with TIA and de-estrogen, 4mMol D-allose treatment remarkably reduced the levels of injured and dead cells, LDH concentration, apoptosis/necrosis cell ratio, as well as restored the increased levels of ROS, TNF-α, IL-1β, IL-6, IL-18, and death cells, especial PANoptosis neurons, in Shank3-mutant human neurons pretreated by tOGD/R and defeminization (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. d - p). The above results suggested that Shank3/Gal-3/ZBP-1 signal overactivation and neuronal-special PANoptosis were drastic changes after tOGD/R induced TIA in Shank3 mutant human neurons with de-estrogen, which can be rescued by D-allose up-regulates Shank3 expression.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlong with a deeper mechanistic understanding of TIA, loss of neurons in cerebral area of transient ischemia-reperfusion damage led to worse functional symptoms, particularly generalized nonspecific weakness, mental status change, and confusion in female than that of man, as well as postmenopausal women more commonly presented with more severe outcomes of IS which results by TIA than men, has proved to be a consensus, however, current evidence is insufficient to allow for HRT\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. As such, in this study, we first uncovered new knowledge on neuronal-special PANoptosis in in TIA of defeminization mice, and a significant anti-PANoptosis role of Shank3, which directly binds to the aging-related proteins Gal-3, regulates the degradation of Gal-3 through K48-linked ubiquitination, as well as Gal-3 binds with core PANoptosis regulator ZBP-1, increases its nuclear translocation and subsequent downregulation of ZBP-1, promoting worse outcomes of TIA in defeminization mice.\u003c/p\u003e \u003cp\u003eCombine with the neuron death ration in defeminization TIA models in vivo and the results of previous reports, we strictly formulate a tOGD/R modal of TIA in de-estrogen neurons approaches, including neurons experienced OGD 24 hours and reperfusion 1 hour, and cultured in anti-hormone serum, which to truly mimicked postmenopausal women TIA in vitro. These results provided a modeling tool for in-depth exploration of the development of TIA in the future. Importantly, we found that considerable proportion of neurons occur PANoptosis, which induced oxidative stress, and inflammatory response, in de-estrogen neurons in vivo and in vitro, suggesting that there may be exists slight secondary brain insults at the cellular level following with TIA. However, as an independent risk factor, defeminization only causes a little PANoptosis of neurons, and did not transform the CBF, neurological deficits and cerebral infarcts, even TIA damage was superimposed. Taken together, TIA and defeminization have associated action in promoting PANoptosis significantly in hippocampus and cortex of de-estrogen mice, prompting that estrogen deficiency enhanced the sensitivity of neurons to PANoptosis. However, the PANoptosis sensitivity does not cause many cell deaths that is sufficient to trigger the formation of cerebral infarcts and deterioration of neurological dysfunction, which explaine the reason why HRT is ineffective in TIA of postmenopausal women, indicating that factors other than hormones might contribute to the biological sex and outcome difference observed.\u003c/p\u003e \u003cp\u003eShank3, as a classical ASD-association and manic gene, is predominantly expressed in neurons\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. In the current study, from the evidence of transcriptome sequencing, Shank3 is lowly expressed in defeminization TIA models and its expression was negatively correlated with neuronal-special PANoptosis in murine infarcted brain. In addition, Shank3 inhibition induces persistent oxidative damage and inflammation insults, leads to postsynaptic densities destroy\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e, as well as results in cell death in defeminization TIA, which involve in the expansion of cerebral infarction and the deterioration of neurological deficits, including motor function, memory and cognitive impairment\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. As such, it is reasonable to infer that Shank3, as a novel PANoptosis regulator, might inhibit TIA with defeminization and account for the outcomes disparity observed. However, the significance and regulatory mechanism of Shank3 in male TIA mice need to be further studied.\u003c/p\u003e \u003cp\u003eOur and others studies have shown that Shank3 deficiency could release excessive ROS production and inflammatory factors\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, which induce worse symptoms by inducing PANoptosis via activation of the PANoptosome. Mechanistically, consist with the results of transcriptome sequencing, Gal-3, acting as a β-galactoside-binding protein, is closely related to aging, involved in many biological processes, such as proliferation, apoptosis, and inflammation, as well as its CRD domains is directly binds with ANK domains of Shank3 in physical structure. Our in vivo and in vitro studies confirm that loss of Shank3 increase Gal-3 protein stability through promoting K48-linked ubiquitination and induce Gal-3 nuclear translocation. Furthermore, the results of Gal-3 increase PANoptosis in Shank3 KO mice after defeminization TIA injury are consistent with the evidences about the relationship among Gal-3 and apoptosis, pyroptosis, and necroptosis predicted by another transcriptome sequencing analysis. However, as a typical central regulator of PANoptosis, ZBP-1 is indirectly associates with Shank3, but directly binds with Gal-3. As expected, ZBP-1 protein level increase on the condition of Gal-3 overexpression, while decrease when Gal-3 was knocked down, but ZBP-1 does not regulate the expression of Gal-3. Collectively, our findings identify that Shank3, Gal-3 and ZBP-1 form a multi-protein complex to regulate neuronal-special PANoptosis during TIA. Defiency of Shank3 induced the expression of Gal-3 and ZBP-1 during transtant ischemic damage, indicating that Shank3-mediated signaling functions as an upstream regulator of Gal-3 and ZBP-1 to control assembly and activation of the neuronal PANoptosis. Moreover, these data show that Shank3 prevents the activation of PANoptosis to alleviate the volume of cerebral infarction and neurological deficits via Gal-3/ZBP-1 signaling pathway, which suggests a novel regulatory mechanism of Shank3 activity in humans. Nevertheless, the potential mechanism through which transient ischemic and reperfusion-mediated PANoptosis mediates the deubiquitinating status of Shank3 and the roles of Shank3 under other damage mode need to be further illustrated.\u003c/p\u003e \u003cp\u003eGiven the evidence of Shank3 as a key member of neuronal-special PANoptosome and the protective effects of D-allose on IS might occur via the Gal-3 pathway, different dosage of D-allose are deal with Shank3 KO mice, Shank3 mutant cultured primary neuron of rodents, and Shank3 mutant human neurons after TIA or defeminization TIA injury. As expected, D-allose attenuates TIA-induced brain damage, neuronal cytotoxicity and PANoptosis by reducing oxidative stress and inflammation in defeminization Shank3 KO mice. This protective effect may be largely due to the Shank3 inhibiting the Gal-3/ZBP-1 signaling axis in SBI during TIA. To the best of our knowledge, this is the first provide valuable insights into targeting of Shank3/Gal-3/ZBP-1 complex for the treatment of de-estrogen TIA injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn conclusion, the present study identify a critical interaction between Shank3, Gal-3 and ZBP-1 that drives neuronal-special PANoptosis, alleviate oxidative stress and inflammation, accounts for the postmenopausal female predominance, progression and outcome of TIA. Therefore, like D-allose, the Shank3 agonists play a crucial neuroprotective effect, which is expected to be a potential therapeutic for neuron PANoptosis cerebral after defeminization TIA.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of Competing Interest:\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relational relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAdditional information\u003c/strong\u003e \u003cp\u003eThe online version contains supplementary material available at online at the website.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No.81971227, No.81974188, No.82371337), Key Research and Development Program of Shaanxi (Program No. 2023-YBSF-170), Military Medicine Enhancement Program (2021JSTS03).\u003c/p\u003e\u003ch2\u003eAuthors\u0026rsquo; contributions:\u003c/h2\u003e \u003cp\u003eYaowen Luo, Lei Zhang, Dakuan Gao, and Xia Li designed the project and reviewed the manuscript; Yaowen Luo, Min Zhang, Junkai Cheng, Zheming Yue, and Jimeng Zhang performed the experiments; Yaowen Luo, Min Zhang, Junkai Cheng, Xiaobing Li, Jing Bai, and Yunchao Yuan analyzed the data; Yaowen Luo, Junkai Cheng, Jimeng Zhang, Juan Li, Maorong Gou, and Li Wang interpreted the data; Yaowen Luo, Lei Zhang, Dakuan Gao, Yuefei Zhou, and Lian Zhu drafted and edited the manuscript; Lei Zhang, Dakuan Gao, Xia Li, and Yuefei Zhou critical revision of the manuscript. All authors read and approved the final.\u003c/p\u003e\u003ch2\u003eAcknowledgements:\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eData availability:\u003c/h2\u003e \u003cp\u003eThe scRNA-sequencing data are available in figshare with the identifier. The original proteome sequencing analysis in this article have been deposited in this article. All data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAnne Waller H and Kay Savage A. mRNA detection by in situ rt-PCR. Methods Mol Med 2001;39:417-29\u003c/li\u003e\n\u003cli\u003eArons MH, Thynne CJ, Grabrucker AM, Li D, Schoen M, Cheyne JE, Boeckers TM, Montgomery JM and Garner CC. Autism-associated mutations in ProSAP2/Shank3 impair synaptic transmission and neurexin-neuroligin-mediated transsynaptic signaling. J Neurosci 2012;32:14966-78\u003c/li\u003e\n\u003cli\u003eBederson JB, Pitts LH, Germano SM, Nishimura MC, Davis RL and Bartkowski HM. Evaluation of 2,3,5-triphenyltetrazolium chloride as a stain for detection and quantification of experimental cerebral infarction in rats. Stroke 1986;17:1304-8\u003c/li\u003e\n\u003cli\u003eChen J, Li Y, Wang L, Lu M, Zhang X and Chopp M. Therapeutic benefit of intracerebral transplantation of bone marrow stromal cells after cerebral ischemia in rats. J Neurol Sci 2001;189:49-57\u003c/li\u003e\n\u003cli\u003eChen J, Sanberg PR, Li Y, Wang L, Lu M, Willing AE, Sanchez-Ramos J and Chopp M. Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke 2001;32:2682-8\u003c/li\u003e\n\u003cli\u003eGocan S, Fitzpatrick T, Wang CQ, Taljaard M, Cheng W, Bourgoin A, Dowlatshahi D, Stotts G and Shamy M. Diagnosis of Transient Ischemic Attack. Stroke 2020;51:3371-3374\u003c/li\u003e\n\u003cli\u003eGong T, Liu L, Jiang W and Zhou R. DAMP-sensing receptors in sterile inflammation and inflammatory diseases. Nat Rev Immunol 2020;20:95-112\u003c/li\u003e\n\u003cli\u003eGrabrucker AM, Knight MJ, Proepper C, Bockmann J, Joubert M, Rowan M, Nienhaus GU, Garner CC, Bowie JU, Kreutz MR, Gundelfinger ED and Boeckers TM. Concerted action of zinc and ProSAP/Shank in synaptogenesis and synapse maturation. EMBO J 2011;30:569-81\u003c/li\u003e\n\u003cli\u003eHuang T, Gao D, Hei Y, Zhang X, Chen X and Fei Z. D-allose protects the blood brain barrier through PPARgamma-mediated anti-inflammatory pathway in the mice model of ischemia reperfusion injury. Brain Res 2016;1642:478-486\u003c/li\u003e\n\u003cli\u003eJin C, Zhang Y, Kim S, Kim Y, Lee Y and Han K. Spontaneous seizure and partial lethality of juvenile Shank3-overexpressing mice in C57BL/6 J background. Mol Brain 2018;11:57\u003c/li\u003e\n\u003cli\u003eKarki R and Kanneganti TD. ADAR1 and ZBP1 in innate immunity, cell death, and disease. Trends Immunol 2023;44:201-216\u003c/li\u003e\n\u003cli\u003eKeiser MS, Chen YH and Davidson BL. Techniques for Intracranial Stereotaxic Injections of Adeno-Associated Viral Vectors in Adult Mice. Curr Protoc Mouse Biol 2018;8:e57\u003c/li\u003e\n\u003cli\u003eKernan WN, Viscoli CM, Brass LM, Gill TM, Sarrel PM and Horwitz RI. Decline in physical performance among women with a recent transient ischemic attack or ischemic stroke: opportunities for functional preservation a report of the Women\u0026apos;s Estrogen Stroke Trial. Stroke 2005;36:630-4\u003c/li\u003e\n\u003cli\u003eKim H, Yoon SC, Lee TY and Jeong D. Discriminative cytotoxicity assessment based on various cellular damages. Toxicol Lett 2009;184:13-7\u003c/li\u003e\n\u003cli\u003eKuriakose T and Kanneganti TD. ZBP1: Innate Sensor Regulating Cell Death and Inflammation. Trends Immunol 2018;39:123-134\u003c/li\u003e\n\u003cli\u003eLei Y, Wang Y, Shen J, Cai Z, Zhao C, Chen H, Luo X, Hu N, Cui W and Huang W. Injectable hydrogel microspheres with self-renewable hydration layers alleviate osteoarthritis. Sci Adv 2022;8:eabl6449\u003c/li\u003e\n\u003cli\u003eLim YR and Oh DK. Microbial metabolism and biotechnological production of D-allose. Appl Microbiol Biotechnol 2011;91:229-35\u003c/li\u003e\n\u003cli\u003eLin JS and Lai EM. Protein-Protein Interactions: Co-Immunoprecipitation. Methods Mol Biol 2017;1615:211-219\u003c/li\u003e\n\u003cli\u003eLioutas VA, Ivan CS, Himali JJ, Aparicio HJ, Leveille T, Romero JR, Beiser AS and Seshadri S. Incidence of Transient Ischemic Attack and Association With Long-term Risk of Stroke. JAMA 2021;325:373-381\u003c/li\u003e\n\u003cli\u003eLoo DT. In situ detection of apoptosis by the TUNEL assay: an overview of techniques. Methods Mol Biol 2011;682:3-13\u003c/li\u003e\n\u003cli\u003eLuo Y, Cheng J, Fu Y, Zhang M, Gou M, Li J, Li X, Bai J, Zhou Y, Zhang L and Gao D. D-allose Inhibits TLR4/PI3K/AKT Signaling to Attenuate Neuroinflammation and Neuronal Apoptosis by Inhibiting Gal-3 Following Ischemic Stroke. Biological Procedures Online 2023;25\u003c/li\u003e\n\u003cli\u003eMonteiro P and Feng G. SHANK proteins: roles at the synapse and in autism spectrum disorder. Nature Reviews Neuroscience 2017;18:147-157\u003c/li\u003e\n\u003cli\u003eNaisbitt S, Kim E, Tu JC, Xiao B, Sala C, Valtschanoff J, Weinberg RJ, Worley PF and Sheng M. Shank, a novel family of postsynaptic density proteins that binds to the NMDA receptor/PSD-95/GKAP complex and cortactin. Neuron 1999;23:569-82\u003c/li\u003e\n\u003cli\u003eNelson HD, Humphrey LL, Nygren P, Teutsch SM and Allan JD. Postmenopausal Hormone Replacement Therapy. Jama 2002;288\u003c/li\u003e\n\u003cli\u003eOh S, Lee J, Oh J, Yu G, Ryu H, Kim D and Lee S. Integrated NLRP3, AIM2, NLRC4, Pyrin inflammasome activation and assembly drive PANoptosis. Cellular \u0026amp; Molecular Immunology 2023;20:1513-1526\u003c/li\u003e\n\u003cli\u003ePeca J, Feliciano C, Ting JT, Wang W, Wells MF, Venkatraman TN, Lascola CD, Fu Z and Feng G. Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature 2011;472:437-42\u003c/li\u003e\n\u003cli\u003ePurroy F, Vicente-Pascual M, Arque G, Baraldes-Rovira M, Begue R, Gallego Y, Gil MI, Gil-Villar MP, Mauri G, Quilez A, Sanahuja J and Vazquez-Justes D. Sex-Related Differences in Clinical Features, Neuroimaging, and Long-Term Prognosis After Transient Ischemic Attack. Stroke 2021;52:424-433\u003c/li\u003e\n\u003cli\u003eQi Z, Zhu L, Wang K and Wang N. PANoptosis: Emerging mechanisms and disease implications. Life Sci 2023;333:122158\u003c/li\u003e\n\u003cli\u003eSare GM, Gray LJ and Bath PM. Association between hormone replacement therapy and subsequent arterial and venous vascular events: a meta-analysis. Eur Heart J 2008;29:2031-41\u003c/li\u003e\n\u003cli\u003eShin T. The pleiotropic effects of galectin-3 in neuroinflammation: a review. Acta Histochem 2013;115:407-11\u003c/li\u003e\n\u003cli\u003eShinohara N, Nakamura T, Abe Y, Hifumi T, Kawakita K, Shinomiya A, Tamiya T, Tokuda M, Keep RF, Yamamoto T and Kuroda Y. d-Allose Attenuates Overexpression of Inflammatory Cytokines after Cerebral Ischemia/Reperfusion Injury in Gerbil. J Stroke Cerebrovasc Dis 2016;25:2184-8\u003c/li\u003e\n\u003cli\u003eSoares LC, Al-Dalahmah O, Hillis J, Young CC, Asbed I, Sakaguchi M, O\u0026apos;Neill E and Szele FG. Novel Galectin-3 Roles in Neurogenesis, Inflammation and Neurological Diseases. Cells 2021;10\u003c/li\u003e\n\u003cli\u003eSun X, Yang Y, Meng X, Li J, Liu X and Liu H. PANoptosis: Mechanisms, biology, and role in disease. Immunol Rev 2024;321:246-262\u003c/li\u003e\n\u003cli\u003eSundaram B, Pandian N, Mall R, Wang Y, Sarkar R, Kim HJ, Malireddi RKS, Karki R, Janke LJ, Vogel P and Kanneganti T-D. NLRP12-PANoptosome activates PANoptosis and pathology in response to heme and PAMPs. Cell 2023;186:2783-2801.e20\u003c/li\u003e\n\u003cli\u003eTang X, Ravikumar Y, Zhang G, Yun J, Zhao M and Qi X. D-allose, a typical rare sugar: properties, applications, and biosynthetic advances and challenges. Crit Rev Food Sci Nutr 2024:1-28\u003c/li\u003e\n\u003cli\u003eThacker EL, Wiggins KL, Rice KM, Longstreth WT, Bis JC, Dublin S, Smith NL, Heckbert SR and Psaty BM. Short-Term and Long-Term Risk of Incident Ischemic Stroke After Transient Ischemic Attack. Stroke 2010;41:239-243\u003c/li\u003e\n\u003cli\u003eTripathi MK, Ojha SK, Kartawy M, Khaliulin I, Hamoudi W and Amal H. Mutations associated with autism lead to similar synaptic and behavioral alterations in both sexes of male and female mouse brain. Sci Rep 2024;14:10\u003c/li\u003e\n\u003cli\u003eWang J, Li Y, Yu H, Li G, Bai S, Chen S, Zhang P and Tang Z. Dl-3-N-Butylphthalide Promotes Angiogenesis in an Optimized Model of Transient Ischemic Attack in C57BL/6 Mice. Front Pharmacol 2021;12:751397\u003c/li\u003e\n\u003cli\u003eWang J, Zhang P and Tang Z. Animal models of transient ischemic attack: a review. Acta Neurol Belg 2020;120:267-275\u003c/li\u003e\n\u003cli\u003eWang M, Xian P, Zheng W, Li Z, Chen A, Xiao H, Xu C, Wang F, Mao H, Meng H, Zhao Y, Luo C, Wang Y and Wu S. Axin2 coupled excessive Wnt‐glycolysis signaling mediates social defect in autism spectrum disorders. EMBO Molecular Medicine 2023;15\u003c/li\u003e\n\u003cli\u003eWang X, McCoy PA, Rodriguiz RM, Pan Y, Je HS, Roberts AC, Kim CJ, Berrios J, Colvin JS, Bousquet-Moore D, Lorenzo I, Wu G, Weinberg RJ, Ehlers MD, Philpot BD, Beaudet AL, Wetsel WC and Jiang YH. Synaptic dysfunction and abnormal behaviors in mice lacking major isoforms of Shank3. Hum Mol Genet 2011;20:3093-108\u003c/li\u003e\n\u003cli\u003eWang Y, Xu Y, Guo W, Fang Y, Hu L, Wang R, Zhao R, Guo D, Qi B, Ren G, Ren J, Li Y and Zhang M. Ablation of Shank3 alleviates cardiac dysfunction in aging mice by promoting CaMKII activation and Parkin-mediated mitophagy. Redox Biology 2022;58\u003c/li\u003e\n\u003cli\u003eWriting Group for the Women\u0026apos;s Health Initiative I. Risks and Benefits of Estrogen Plus Progestin in Healthy Postmenopausal Women: Principal Results From the Women\u0026apos;s Health Initiative Randomized Controlled Trial. JAMA: The Journal of the American Medical Association 2002;288:321-333\u003c/li\u003e\n\u003cli\u003eYan Y, Shin S, Jha BS, Liu Q, Sheng J, Li F, Zhan M, Davis J, Bharti K, Zeng X, Rao M, Malik N and Vemuri MC. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Transl Med 2013;2:862-70\u003c/li\u003e\n\u003cli\u003eYu AYX, Penn AM, Lesperance ML, Croteau NS, Balshaw RF, Votova K, Bibok MB, Penn M, Saly V, Hegedus J, Zerna C, Klourfeld E, Bilston L, Hong ZM and Coutts SB. Sex Differences in Presentation and Outcome After an Acute Transient or Minor Neurologic Event. JAMA Neurology 2019;76\u003c/li\u003e\n\u003cli\u003eZhang H, Feng Y, Si Y, Lu C, Wang J, Wang S, Li L, Xie W, Yue Z, Yong J, Dai S, Zhang L and Li X. \u003cstrong\u003eShank3 ameliorates neuronal injury after cerebral ischemia/reperfusion via inhibiting oxidative stress and inflammation\u003c/strong\u003e. Supplement 2024\u003c/li\u003e\n\u003cli\u003eZhang H, Feng Y, Si Y, Lu C, Wang J, Wang S, Li L, Xie W, Yue Z, Yong J, Dai S, Zhang L and Li X. Shank3 ameliorates neuronal injury after cerebral ischemia/reperfusion via inhibiting oxidative stress and inflammation. Redox Biology 2024;69\u003c/li\u003e\n\u003cli\u003eZhang M, Fu YH, Luo YW, Gou MR, Zhang L, Fei Z and Gao DK. d-allose protects brain microvascular endothelial cells from hypoxic/reoxygenated injury by inhibiting endoplasmic reticulum stress. Neurosci Lett 2023;793:137000\u003c/li\u003e\n\u003cli\u003eZhang T, Yin C, Fedorov A, Qiao L, Bao H, Beknazarov N, Wang S, Gautam A, Williams RM, Crawford JC, Peri S, Studitsky V, Beg AA, Thomas PG, Walkley C, Xu Y, Poptsova M, Herbert A and Balachandran S. ADAR1 masks the cancer immunotherapeutic promise of ZBP1-driven necroptosis. Nature 2022;606:594-602\u003c/li\u003e\n\u003cli\u003eZhang Z, Qin P, Deng Y, Ma Z, Guo H, Guo H, Hou Y, Wang S, Zou W, Sun Y, Ma Y and Hou W. The novel estrogenic receptor GPR30 alleviates ischemic injury by inhibiting TLR4-mediated microglial inflammation. J Neuroinflammation 2018;15:206\u003c/li\u003e\n\u003cli\u003eZheng M and Kanneganti TD. The regulation of the ZBP1-NLRP3 inflammasome and its implications in pyroptosis, apoptosis, and necroptosis (PANoptosis). Immunol Rev 2020;297:26-38\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Shank3, Galectin-3, Z-conformation nucleic acid binding protein-1, PANoptosis, D-allose, transient ischemic attack, ovariectomy","lastPublishedDoi":"10.21203/rs.3.rs-5824207/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5824207/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSelective neuron death or loss, which induced by specific pathogen- and damage-associated molecular patterns (PAMPs and DAMPs), was the main reason results in high morbidity, disability, and mortality of transient ischemic attack (TIA) in man and postmenopausal women. Shank3, a key postsynaptic density, is correlated with synaptic dysfunction, oxidative stress, inflammatory, apoptosis and poor outcomes in ischemic stroke, although its role in menopausal women TIA remains elusive. Here we discovered that Shank3 direct binds Gal-3, a positive regulator of aging and inflammation, then regulates innate immune sensors ZBP-1, to drive inflammatory signaling and inflammatory cell death, PANoptosis, during TIA. Base on the defeminization TIA models (a stable female mouse OVX\u0026thinsp;+\u0026thinsp;TIA model was first established as well as an in vitro cultured primary neuron desexualization\u0026thinsp;+\u0026thinsp;tOGD/R model), blockade of Shank3 amplify neuron PANoptosis, oxidative stress and inflammation, arouse persistent behavioral deficits and infarction formation, which does not appear in de-estrogen combination with TIA damage mice. We also observed that Shank3, Gal-3 and ZBP-1 were members of a large multi-protein complex along with Caspase 3, 7, 8, 9, 1, NLRP 3, GSDMD, GSDME, RIPK 1, RIPK 3 and MLKL that drove neuronal-special PANoptosis. In addition, administration of a natural inflammatory inhibitor, D-allose, used for food sweetener, produces anti-PANoptosis effects via activating Shank3 but inhibiting Gal-3 and ZBP-1. Collectively, our findings establish a previously unknown regulatory connection and molecular interaction among Shank3, Gal-3 and ZBP-1 as a driver of neuron-specific PANoptosis in postmenopausal female TIA, and reveal activate of Shank3, such as, D-allose, maybe a potential strategy to halt neuronal loss during TIA.\u003c/p\u003e","manuscriptTitle":"Shank3 forms a complex with Gal-3 and ZBP-1 to alleviate PANoptosis in TIA of female ovariectomized mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-03 08:32:43","doi":"10.21203/rs.3.rs-5824207/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6fc97727-82cc-4a98-918d-b7576a7564f5","owner":[],"postedDate":"February 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":43613146,"name":"Biological sciences/Neuroscience/Cell death in the nervous system"},{"id":43613147,"name":"Biological sciences/Molecular biology/Proteomics/Protein\u0026#x2013;protein interaction networks"}],"tags":[],"updatedAt":"2025-03-07T06:10:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-03 08:32:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5824207","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5824207","identity":"rs-5824207","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0