Tbx genes influence early gene expression and photoreceptor patterning in the chick retina

Tbx genes influence early gene expression and photoreceptor patterning in the chick retina | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Tbx genes influence early gene expression and photoreceptor patterning in the chick retina Monika Ayten , Heer N.V. Joisher , Constance Cepko doi: https://doi.org/10.1101/2025.10.18.683251 Monika Ayten 1 Departments of Genetics and Ophthalmology, Harvard Medical School , Boston, MA 02115, USA 2 Howard Hughes Medical Institute, Harvard Medical School , Boston, MA 02115, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Heer N.V. Joisher 1 Departments of Genetics and Ophthalmology, Harvard Medical School , Boston, MA 02115, USA 2 Howard Hughes Medical Institute, Harvard Medical School , Boston, MA 02115, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Constance Cepko 1 Departments of Genetics and Ophthalmology, Harvard Medical School , Boston, MA 02115, USA 2 Howard Hughes Medical Institute, Harvard Medical School , Boston, MA 02115, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: cepko{at}genetics.med.harvard.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The retina, our sensory organ for vision, displays distinct photoreceptor distributions and can have a specialized region for high visual acuity. The establishment of these spatial patterns during development depends on regionally restricted transcription factors and signaling molecules. Members of the T-box family of transcription factors, Tbx2, Tbx3, and Tbx5, show such restricted patterns of expression, with a dorsal high to ventral low pattern in the early retina. Their potential regulatory interactions and roles in patterning have not been fully explored. Here, we investigated their regulatory interactions by overexpression (OE) and knockdown (KD) approaches. We found that Tbx2, Tbx3, and Tbx5, directly or indirectly regulate each other as well as other early, patterned genes, including Fgf8, Cyp26a1, Cyp26c1, Cyp1b1, Raldh1, Ventroptin, and Bmp2 . KD of any one of these Tbx genes increased rod photoreceptor density in a specific region of the retina, whereas Tbx2 loss additionally reduced the number of UV cones throughout the retina. Notably, KD of Tbx2, Tbx3, or Tbx5 consistently resulted in a smaller rod-free zone (RFZ), a domain within the high acuity area. These findings demonstrate that T-box transcription factors form a coordinated regulatory network that governs regional gene expression and photoreceptor patterning. Highlights Tbx2, Tbx3, and Tbx5 regulate each other during chick retinal development Tbx2, Tbx3, and Tbx5 regulate the expression of early patterned genes, including Fg8, Cyp26c1, Cyp26a1, Cyp1b1, and Bmp2 Knockdown of either Tbx2/3/5 increased rod numbers in the equatorial retina and reduced the size of the rod-free zone (RFZ) Tbx2 knockdown decreased UV cone numbers dorsally, ventrally and in the RFZ Tbx2, Tbx3, and Tbx5 had no impact on green or red cone abundance Introduction Vision is initiated by the capture of light by highly specialized retinal cells, the photoreceptors. Among photoreceptors there is a wide range of sensitivity to light, with rod photoreceptors able to detect very few photons, enabling night vision ( 1 ). Cone photoreceptors are typically much less sensitive and initiate our daylight and color vision ( 2 ). Rods and cones are not equally distributed within the retina but exhibit patterns that can influence multiple aspects of vision, including acuity. Species with high acuity vision, like birds of prey and humans, have a specialized high acuity area (HAA) characterized by a high density of cone photoreceptors and the absence of rod photoreceptors. Moreover, different types of cones, defined by their morphology and tuning to different wavelengths of light, can also be patterned. For example, in humans, “red” and “green” cones are the only photoreceptor types in the central HAA, the foveola. Rods are excluded from this region (also known as the rod-free zone, RFZ) but are the most abundant photoreceptor type throughout the majority of the rest of the human retina, and in almost all mammals ( 3 , 4 ). In addition to photoreceptors, other retinal cell types are distributed in specific patterns. The output neurons of the retina, the retinal ganglion cells, are most abundant in the central retina of many species. They also exhibit patterning throughout the retina, with their projections to the brain forming a topographic map of the visual field ( 5 , 6 ). The mechanisms that drive photoreceptor patterning have not been well elucidated. Our lab has been exploring this topic in the chicken, as we discovered that they have a central RFZ ( 7 ) in an area with other anatomical features of a HAA ( 8 ). The RFZ has a high density of cones with elongated outer segments, as in humans. There is also a higher density of retinal ganglion cells in this area, and an aster, a specialized structure in the inner nuclear layer of the retina ( 8 , 9 ).The chick retina provides an excellent model to study photoreceptor patterning due to its accessibility early in development, when patterns are being established. We have used it as a model of HAA development and have started to identify some key regulators of the formation of this area. Lack of retinoic acid (RA) signaling and presence of Fgf8, both of which are specific to a circumscribed central area, are required for formation of the chick HAA ( 8 ). RA signaling gradients also have been implicated in cone subtype specification in other species ( 10 ). Ventrally restricted expression of cVax is required for the dorsal-ventral gradient of rods across the entire retina ( 11 ). We have further examined the expression of other genes that are expressed very early in development, with patterns suggestive of the regulation of photoreceptor pattern (Joisher et al, BioRxiv). These include Fgf8, Cyp26c1, Cyp26a1, Raldh1, Cyp1b1, Bmp2, and Ventroptin. The regulators of these patterned genes have not been identified, but transcription factors that are also expressed very early are potentially part of their regulatory network. The T-box (Tbx) genes provide one such example of potential regulators. They encode a family of evolutionary conserved transcription factors that play essential roles in embryonic development and organogenesis ( 12 , 13 ). During retinal development, Tbx2, Tbx3, and Tbx5 are expressed in the dorsal optic cup of humans, mice, and chicks ( 14 – 16 ), where they exhibit distinct but partially overlapping expression domains. Tbx proteins are characterized by a conserved DNA-binding motif, or T-box domain, that binds DNA in a sequence-specific manner. Several Tbx genes display partially redundant functions and act as key regulators of cell fate decisions, tissue patterning, and differentiation across multiple organs, including the nervous system and sensory structures ( 12 , 13 ). The expression patterns of the Tbx genes suggest both unique and overlapping roles in shaping retinal patterns and cell fates (Joisher et al., BioRxiv). For example, Tbx5 is known to determine dorsal identity and thereby contribute to the formation of the topographic map made by the projections of the retinal ganglion cells ( 15 , 17 ). The Tbx2 orthologue in zebrafish, Tbx2b, inhibits rods and promotes UV cone fate ( 18 , 19 ). This makes the dorsally restricted expression of Tbx2, Tbx3, and Tbx5 in the chick retina particularly intriguing, as the dorsal chick retina has a relatively low rod density ( 7 ). Moreover, a restricted central domain of Tbx3 expression overlaps with the developing rod-free HAA during early development (Joisher et al., BioRxiv). These observations raise the possibility that Tbx factors not only contribute to overall dorsoventral patterning but also participate in the formation of the RFZ within the HAA. Here, we examined the expression patterns and functions of these Tbx genes in the developing chick retina. Specifically, we focused on how their activity influences dorsoventral patterning, early retinal gene expression, and the spatial distribution of photoreceptor subtypes, including the formation of the RFZ. Beyond informing our understanding of the development of this important area, these findings set a framework for understanding the interplay of early patterning events with later cell fate choices in an accessible system. Results Tbx genes exhibit distinct spatial expression patterns in the developing chick retina To investigate the spatial expression patterns for Tbx2, Tbx3, and Tbx5 during retinal development, we examined chick retinal flatmounts from embryonic day (E) 3 to E8 using the hybridization chain reaction (HCR) method of single molecule fluorescent in situ hybridization (smFISH) ( Fig. 1A ). This developmental window was selected because it encompasses key stages of retinal neurogenesis and lamination. Between E3 and E3.5, retinal progenitor cells begin to produce daughter cells that exit the cell cycle, with the first born cells, the retinal ganglion cells, differentiating in the central retina ( 20 ). Neurogenesis continues until it is nearly complete by E8 ( 21 ). Retinal lamination is ongoing during this period, with the sequential addition of horizontal, amacrine, and photoreceptor cells ( 22 , 23 ). Download figure Open in new tab Figure 1: Spatial expression patterns of Tbx2, Tbx3, and Tbx5 in the developing chick retina. (A) Representative smFISH images of retinal flatmounts from embryonic day (E)3 to E8 probed for Tbx2, Tbx3, and Tbx5. The white arrowhead marks a spot of Tbx3 that overlaps with Fgf8 (and see panel C) (B) Schematic representation of the expression domains of Tbx2 (gray), Tbx3 (blue), and Tbx5 (magenta) in the retina. The yellow box indicates the equatorial retinal domain. (C) smFISH image of a retinal flatmount from E5, probed for Tbx3 and Fgf8. (A,C) Scale bar, 100 µm. All three genes, Tbx2, Tbx3, and Tbx5, are expressed in the dorsal retina ( Fig. 1A ), with Tbx2 extending furthest ventrally. We define the region between the dorsal (upper third) and ventral (lower third) domains as the ‘equatorial’ domain of the DV (dorsal-ventral) axis, where Tbx2 shows strong expression ( Fig. 1A,B , yellow box), with a rounded termination of its ventral border of expression. In contrast, Tbx3 displays a more dorsally confined expression pattern, with a distinct spot of enrichment in the equatorial domain that is most prominent between E3 and E4 and largely reduced by E8 ( Fig. 1A , middle panel, arrowhead). Notably, both Tbx2 and Tbx3 also exhibit a nasal–temporal (NT) component to their expression: Tbx2 shows a rounded termination at both nasal and temporal borders, whereas Tbx3 has a straight border that runs diagonally from the nasal and temporal sides towards the enriched spot in the equatorial domain. Tbx5 is the most dorsally restricted of the three genes, exhibiting a sharp boundary with the equatorial domain ( Fig. 1B , yellow box) that remains clearly defined through E8 ( Fig. 1A , lower panel). These patterns thus show nested domains of expression along the DV axis, with Tbx2 furthest ventrally, Tbx3 enriched in a unique central spot, and Tbx5 the most dorsally restricted ( Fig. 1B ). To assess whether the central spot of Tbx3 enrichment overlaps with the developing HAA of the chick retina, a multiplexed smFISH approach was used to simultaneously visualize Tbx3 and Fgf8 expression. A central spot of high Fgf8 expression within the equatorial domain serves as a molecular marker of the developing chick HAA , with Fgf8 playing a crucial role in its formation ( 8 , 24 ). The central spot of Tbx3 expression was seen to coincide with the spot of high Fgf8 expression, but not with the broader stripe of Fgf8 expression, demonstrating that Tbx3 is selectively enriched in the prospective HAA ( Fig. 1C ). Tbx2, Tbx3, and Tbx5 cross-regulate during chick retinal development To begin to probe the function(s) of the Tbx genes, we performed OE experiments by in ovo electroporation of plasmids encoding the Tbx genes. They were delivered at the beginning of neurogenesis, at E2 (Hamburger-Hamilton (HH) stages 9 – 12). Expression was driven by the broadly active chicken beta-actin (CAG) promoter. OE was visualized by use of a ZsGreen reporter gene which was expressed in a polycistronic fashion with the Tbx genes using an IRES sequence. To maintain expression following multiple cell divisions, these plasmids included the sequences necessary for piggyBac transposition, and a piggyBac plasmid was co-electroporated ( 25 ) ( Fig. 2A ). Gene expression in retinal flatmounts was examined at E5 using smFISH ( Fig. 2B ). In all Tbx2, Tbx3 , and Tbx5 OE conditions, ZsGreen signal co-localized with a strong Tbx probe signal for the respective Tbx gene ( Fig. 2C-E ), confirming successful delivery and expression. Download figure Open in new tab Figure 2: Cross-regulation of Tbx genes in the developing chick retina. (A) Diagram of OE plasmids. PiggyBac transposase was used for integration of the Tbx-ZsGreen plasmids. The genes were expressed under the control of the CAG promoter. ZsGreen was used as a fluorescent marker of the electroporated plasmids (B) Experimental timeline of the electroporation experiments. (C-E) Representative smFISH images of retinal flatmounts electroporated at E2 with Tbx2 (C) , Tbx3 (D) , and Tbx5 (E) OE plasmids and harvested at E5. ZsGreen marks the area of electroporation. Probes for the Tbx genes are indicated in text within each panel. The red square in each panel marks the retinal position at which the representative image was taken. White arrowheads indicate sites of Tbx upregulation within, or adjacent to, the endogenous Tbx expression domain, whereas orange arrowheads mark regions outside the domain where no effect on Tbx expression was observed. Scale bar, 50 µm. All retinas electroporated with Tbx OE plasmids showed an unusual arrangement of ZsGreen- labelled cells as they appeared in tight clusters. If mCherry, rather than a Tbx gene, was upstream of IRES-ZsGreen, the electroporated cells appeared fairly uniformly distributed in the electroporated region (Fig. S1A). This observation may reflect the activity of Tbx genes on adhesion, migration, and/or survival as reported previously for Tbx genes in other tissues ( 26 , 27 ). Nonetheless, these retinas were analyzed for their effects on gene expression, and the results were further interpreted in light of results from Tbx knockdown (KD) experiments, as shown later in this study. OE of Tbx2 led to a modest upregulation of Tbx3 in the equatorial retinal domain near the Tbx3 - enriched spot ( Fig. 2C ), but not in other retinal domains (Fig. S1B). Tbx2 OE also resulted in increased Tbx5 expression within the endogenous dorsal Tbx5 expression domain, but not outside of it ( Fig. 2C and Fig. S1B and S1C). OE of Tbx3 resulted in a marked repression of Tbx2 across the entire endogenous Tbx2 expression domain ( Fig. 2D , Fig. S1D). In contrast, Tbx5 expression was increased both within its endogenous dorsal domain and, to a lesser extent, in the equatorial retinal domain ( Fig. 2D , magenta), but not in other regions (Fig. S1D). These findings suggest that Tbx3 acts as a negative regulator of Tbx2 while positively influencing Tbx5 expression. Notably, Tbx5 OE induced both Tbx2 and Tbx3 expression ( Fig. 2E , Fig. S1E). Tbx2 was strongly upregulated within its endogenous dorsal domain and ectopically in the dorsal periphery, but not in the ventral retina, whereas Tbx3 was robustly induced throughout the retina, extending into both dorsal and ventral regions. These findings suggest that Tbx5 acts as a positive regulator of Tbx2 and Tbx3 , particularly within the dorsal retina where they are normally co-expressed. Analysis of KD of Tbx2, Tbx3, and Tbx5 using mir30-based shRNAs To determine the requirement of each Tbx gene for the regulation of other Tbx genes, as well as for the expression of other early, patterned genes, knock down (KD) experiments were conducted. A microRNA30 (mir30)-based small hairpin (shRNA) expression system ( 28 , 29 ) driven by the CAG promoter (CAG-mir30) was used to achieve KD. For stable genomic integration of the electroporated plasmids, the piggyBac transposon system was again used ( Fig. 3A ) ( 25 ). Download figure Open in new tab Figure 3: Analysis of efficiency of shRNA-mediated KD of Tbx2, Tbx3, and Tbx5 in vitro and in vivo. (A) Diagram of the plasmids for mir30-based RNAi and PiggyBac Transposase. mCherry was used as a marker of the electroporated plasmids (B-D) qRT-PCR analysis of KD efficiency for Tbx2 (B) , Tbx3 (C) , and Tbx5 (D) in whole eyecups harvested at E4 after electroporation at E2. Each point represents one biological replicate. Data presented as mean ± SEM. (E-J) Representative retinal flatmounts electroporated with a Tbx OE plasmid alone (E,G,I) or in combination with the corresponding combination of mir30-shRNA constructs (F,H,J) . ZsGreen is expressed from the same transcript as Tbx, serving as an indicator of KD. N = 2 per condition. (E-J) Scale bar, 100 µm. Several KD constructs for each gene were evaluated for efficacy in 293T cells (Fig S2, 25). A non- targeting scrambled shRNA construct expressing mCherry (sh-sc-mCherry) was used as a control for non-specific effects of KD (Fig. S2A-C) ( 30 ). KD constructs were also tested for the KD of an unrelated target: OTX2-d2EGFP. The OTX2-d2EGFP signal remained unaffected after co- transfection with any of the Tbx2, Tbx3, or Tbx5 shRNAs (Fig. S2D). Combinations of shRNAs were used to maximize KD. However, to evaluate specificity, additional shRNA constructs were delivered as single constructs, with a single shRNA used for Tbx3 and two single shRNAs for Tbx2 and Tbx5 (Fig. S3J) These single shRNAs had the same effects on early developmental genes as the combinations of shRNAs (Fig. S3I-M). KD efficiency of the shRNA combinations was quantified by qRT-PCR analysis of whole eyecups collected at E4 after electroporation at E2 ( Fig. 3B-D ), with efficiencies ranging from 56-71 %. Interestingly, shRNA- mediated KD of Tbx2 or Tbx3 also reduced Tbx5 expression, consistent with our observation that OE of Tbx2 or Tbx3 induced Tbx5 upregulation within its endogenous expression domain ( Fig. 2E ). In contrast, KD of Tbx5 did not reduce Tbx2 and Tbx3 expression, as might have been predicted from the Tbx5 OE experiment ( Fig. 2E ), possibly reflecting supranormal levels of Tbx5 achieved by OE. The relatively high variability between biological replicates likely reflects the use of whole eyecups for qRT-PCR analysis. As the size and position of electroporated regions vary considerably among embryos, the proportion of successfully targeted cells differs from sample to sample, thereby reducing the apparent KD efficiency and contributing to inter-sample variability. To address this limitation and further validate KD efficiency in vivo, we co-electroporated the respective Tbx OE constructs either alone or together with the corresponding miR30-shRNA plasmids ( Fig. 3E-J ). This strategy was chosen because the available smFISH probes for Tbx2 , Tbx3 , and Tbx5 did not reliably detect downregulation of their respective targets, perhaps due to a lack of quantitative read out of the endogenous range of these target RNAs. In addition, antibodies to the Tbx proteins did not reliably work in the tissue. Electroporation of Tbx2 ( Fig. 3E ), Tbx3 ( Fig. 3G ), or Tbx5 ( Fig. 3I ) OE plasmids alone led to strong ZsGreen expression, appearing in bright, patchy domains throughout the retina. In contrast, co-electroporation with the corresponding shRNA constructs resulted in a marked reduction in ZsGreen signal intensity and a more diffuse, less clustered expression pattern across the retina after Tbx2, Tbx3 , and Tbx5 KD ( Fig. 3F,H ,J). Based on both the qRT-PCR and in vivo validation results, it appears that the miR30-shRNA constructs effectively reduced expression of their respective target genes. KD of Tbx2/3/5 affects expression of early, patterned genes Early patterning genes are critical for establishing regional identity within the retina and guiding photoreceptor cell fate ( 11 , 31 – 34 ). Additionally, HAA development has been shown to depend on Fgf8 expression and the activity of retinoic acid (RA) degrading enzymes ( 8 ). To assess whether Tbx2/3/5 influence early patterning genes, including those involved in RA metabolism, in ovo electroporation was carried out at E2 (HH 8-9) using the mir30-shRNA constructs ( Fig. 3 ). Retinas were collected at E5 and analyzed by smFISH on retinal flatmounts ( Fig. 4 ). Only retinas in which the electroporation marker covered at least 60% of the equatorial and dorsal domains were included in our analysis. To exclude any effects from the electroporation procedure itself and potential off-target effects of the shRNA backbone, all control retinas were electroporated with a mir30-srambled construct (sh-sc-mCherry) at E2 and processed identically. mCherry was used as a fluorescent marker to visualize electroporated cells ( Fig. 4 ). Download figure Open in new tab Figure 4: Analysis of effects of KD of Tbx2, Tbx3, and Tbx5 on early retinal genes. (A-G) Representative smFISH images of retinal flatmounts electroporated at E2 and harvested at E5. The first column shows control samples electroporated with scrambled shRNA. The electroporated area (mCherry positive) in each representative flatmount is indicated in the upper right corner of each image. The flatmounts were probed for Fgf8 (Tbx2 KD: N = 3; Tbx3, Tbx5 KD: N = 4) (A) , Cyp26c1 (Tbx2 KD: N = 3; Tbx3, Tbx5 KD: N = 4) (B) , Cyp26a1 (Tbx2, Tbx3, Tbx5 KD: N = 3) (C) , Raldh1 (Tbx2 KD: N = 5; Tbx3 KD: N = 7; Tbx5 KD: N = 3) (D) , Cyp1b1 (Tbx2, Tbx5 KD: N = 4; Tbx3 KD: N = 5) (E) , Bmp2 (Tbx2 KD: N = 4; Tbx3 KD: N = 6; Tbx5 KD: N = 5) (F) , and Ventroptin (Tbx2, Tbx3 KD: N = 4; Tbx5 KD: N = 3) (G). (C,E,G) Arrowheads indicate areas with reduced signal intensity. (A-G) Scale bar, 100 µm. Fgf8 is expressed in the equatorial domain, in a spot and stripe pattern ( Fig. 1B , yellow box) ( Fig. 4A ). As the ventral borders of Tbx expression align with aspects of the Fgf8 pattern, the effects of their KD on Fgf8 expression were evaluated. KD of Tbx2, Tbx3, or Tbx5 resulted in a complete loss of the defined Fgf8 pattern, leading to diffuse and reduced Fgf8 expression ( Fig. 4A ). To characterize the influence of Tbx genes on the spatiotemporal expression patterns of RA- degrading enzymes, the expression of Cyp26c1 ( Fig. 4B ) and Cyp26a1 ( Fig. 4C ) was investigated. Under normal conditions, Cyp26c1 appears as a distinct, bright spot in the equatorial retinal domain ( Fig. 4B ), overlapping with the Fgf8 spot ( 8 ). After KD of Tbx2 with a combination of shRNAs against Tbx2 , the Cyp26c1 signal became more dispersed i.e. no longer a definitive spot. An additional single shRNA (i.e. an shRNA not included in the combination of shRNAs used in Fig. 4B ) directed against the 3’UTR of Tbx2 affected Cyp26c1 (Fig. S3I) and Fgf8 (Fig. S3J), similarly. KD of Tbx3 resulted in a smaller Cyp26c1 domain with reduced signal intensity. Consistent with this, Tbx3 OE induced ectopic Cyp26c1 expression around the developing HAA (Fig. S3A). In contrast, Tbx5 KD disrupted the focal expression of Cyp26c1 in a manner that depended on the size of the electroporated patch. When most of the dorsal retina was electroporated, Cyp26c1 expression became dispersed and disorganized ( Fig. 4B ). However, when the electroporated area did not cover the majority of the dorsal retina, Cyp26c1 expression was largely preserved (N = 4, not shown). Cyp26a1 expression also was examined following alterations in Tbx gene expression ( Fig. 4C ). Under normal conditions, Cyp26a1 is expressed as a broad stripe along the retinal equator, with a distinct but small circular region on the nasal side that does not express Cyp26a1 ( 8 ) ( Fig. 4C ). Additional expression is observed along the optic fissure, with some transcripts present between the fissure and equatorial stripe. Following KD of Tbx2, Tbx3 , or Tbx5, the Cyp26a1-negative spot on the nasal side was no longer visible. Beyond this local change, Tbx KD also broadly altered the overall Cy26a1 expression pattern. Specifically, Tbx2 and Tbx3 KD led to a more diffuse and less defined Cyp26a1 expression pattern along the equator, while Tbx5 KD resulted in ectopic expansion of Cyp26a1 expression into the dorsal domain, extending beyond its normal boundary and appearing more diffuse. Similarly, a single shRNA targeting the Tbx3 coding sequence caused diffuse expression of Cyp26a1 (Fig. S3K), consistent with the phenotype observed using two shRNAs in combination ( Fig. 4C ). Raldh1 , a key enzyme in RA biosynthesis, is restricted to the dorsal retina and exhibits a sharp, well-defined boundary at the equator ( Fig. 4D ). The KD of Tbx2 or Tbx3 had no apparent effect on the Raldh1 expression pattern; the equatorial boundary remained intact, and expression levels appeared unchanged. In contrast, Tbx5 KD resulted in a blurred Raldh1 border, suggesting that the equatorial boundary requires intact Tbx5 activity. This is consistent with the complete overlap of Tbx5 and Raldh1 expression domains (Fig. S3B) and is further supported by the observation that Tbx5 OE induced ectopic Raldh1 expression throughout the retina (Fig. S3C). Cyp1b1 , another enzyme involved in RA metabolism and known to play a role in ocular fissure closure ( 35 ) is normally expressed in a vertical stripe extending from the dorsal to the ventral retina ( Fig. 4E ). While Tbx3 KD had no discernible effect on Cyp1b1 , Tbx2 KD left the overall expression pattern unchanged but caused a modest reduction of expression in the dorsal retina, where the signal appeared dimmer and more diffuse. Strikingly, Tbx5 KD led to a near-complete loss of Cyp1b1 expression dorsal to the retinal equator. A single shRNA targeting Tbx5 was tested and was found sufficient on its own to reduce dorsal Cyp1b1 expression (Fig. S3L). This observation is supported by the finding that Tbx5 OE induced ectopic Cyp1b1 expression, particularly in the ventral retina (Fig. S3D). The expression of Ventroptin, a gene expressed ventrally, and Bmp2 , expressed in the equatorial domain along the dorsal border of Ventroptin, also were examined. Bmp2 plays a key role in retinal development and in maintaining regional specificity along the D/V axis ( 36 ). Its expression is antagonistic to that of Ventroptin ( 36 ), and both genes exhibit oblique-gradient expression patterns in the developing retina ( Fig. 4F,G ). Ventroptin shows a characteristic depression on the nasal side – precisely coincident with the Fgf8 spot. In contrast to the sharp border around the Fgf8 spot, the dorsal border of the Ventroptin expression domain is diffuse as it meets the equatorial domain ( Fig. 3G , S3F) (Joisher et al, BioRxiv). Tbx2 KD caused a blurred dorsal boundary and dorsal expansion of the Ventroptin expression domain ( Fig. 4G ). This is consistent with Tbx2 OE, which reduced Ventroptin expression (Fig. S3G). Furthermore, Bmp2 expression appeared dorsally shifted but its overall expression pattern remained intact after Tbx2 KD ( Fig. 4F ). Bmp2 may thus act downstream of Tbx2 , consistent with previous findings ( 37 ) alternatively, the expansion of the Ventroptin expression domain dorsally may have caused a dorsal shift in the Bmp2 expression domain. Tbx3 KD led to a pronounced reduction in Bmp2 expression, accompanied by dim Ventroptin expression that extended dorsally and showed loss of the characteristic nasal depression. In Tbx5 KD retinas, Bmp2 expression expanded into the dorsal retina, and Ventroptin expression also extended slightly dorsally, with the nasal depression of Ventroptin no longer visible. These observations suggest that Tbx5 functions as a negative regulator of Bmp2 expression, which is further supported by Tbx5 OE leading to a reduction in Bmp2 expression (Fig. S3H). Tbx gene KD affects rod photoreceptor patterning and the RFZ Previous studies have shown that photoreceptor patterning and cell fate decisions rely on spatially restricted gene expression ( 8 , 11 , 18 , 38 ). To assess whether Tbx2, Tbx3, or Tbx5 influence photoreceptor distribution and/or fate specification, chick retinas were electroporated at E2 with Tbx shRNA constructs and harvested at E16, after the onset of photoreceptor differentiation ( 39 ). Rods and different types of cones were detected using smFISH ( Fig. 5A ). Download figure Open in new tab Figure 5: Analysis of rod photoreceptor distribution and RFZ size following Tbx KD. (A) Experimental timeline of the electroporation experiments. (B) Schematic showing dorsal (highlighted by yellow rectangle), equatorial (green), and ventral (orange) retinal regions analyzed for rod photoreceptor counts. The brown circle marks the RFZ. (C-F) Representative smFISH images of E16 retinal flatmounts probed for Rho, following E2 electroporation with sc-shRNA control (C) , shTbx2 (D) , shTbx3 (E) , and shTbx5 (F) . Scale bars: mCherry overview images (top row), 500 µm; Rho images, 100 µm. (G) Quantification of RFZ size in control and Tbx KD retinas. Control (sh): N = 8; Tbx2, Tbx3 KD: N = 5, Tbx5 KD: N = 4. (H) Quantification of rod photoreceptor numbers in dorsal, equatorial and ventral retinal domains. Each point represents one biological replicate. (G,H) Data, presented as mean ± SEM, were compared by one-way (G) and two-way (H) ANOVA. * P ≤ .05, ** P ≤ .01. (I) Representative smFISH image of retinal flatmounts electroporated at E2 with a Tbx2 OE plasmid and harvested at E16 and probed for Rho. Scale bar, 500 µm. Electroporated KD flatmounts were probed for Rhodopsin (Rho), a marker of maturing and mature rod photoreceptors ( 7 , 40 ). Rod numbers were quantified in three retinal regions, allowing a comparison of changes in regional patterning ( Fig. 5B ). Quantification was restricted to mCherry- positive areas to ensure that only regions with successful plasmid integration were analyzed. Representative images of control flatmounts (scrambled (sc) shRNA; Fig. 5C ) and those with KD of Tbx2 ( Fig. 5D ), Tbx3 ( Fig. 5E ), or Tbx5 ( Fig. 5F ) are shown in side-by-side subcolumns to illustrate regional changes in rod numbers. In the dorsal retina, rod numbers were comparable across all conditions, suggesting that KD of these Tbx genes did not impact rod formation dorsally. In contrast, the equatorial retinal domain, located adjacent to the RFZ of the HAA, exhibited a noticeable increase in rod numbers following KD of each of the three Tbx genes. However, this increase reached statistical significance only in Tbx2 - and Tbx5 -deficient retinas ( Fig. 5H ; ANOVA, ** P ≤ .01). Consistent with Tbx2 KD, ectopic OE of Tbx2 inhibited rod formation ( Fig. 5I ), reinforcing its inhibitory role in rod photoreceptor development. The ventral retina typically has a higher number of rod photoreceptors than the dorsal region ( 7 ). This region remained largely unaffected after Tbx3 and Tbx5 KD. KD of Tbx2 led to a significant reduction in rod numbers in the ventral domain ( Fig. 5H ; ANOVA, * P ≤ .05), while it led to an increase in the equatorial domain. This non-cell-autonomous effect implies that Tbx2 may influence overall spatial patterning, as well as rod fate specification. Given the spatially distinct expression patterns of Tbx2, Tbx3 , and Tbx5 around the presumptive RFZ and their roles in regulating the expression of patterned genes such as Fgf8, Cyp26c1, and Cyp26a1 ( Fig. 4A-C ) it was also of interest to analyze the size of the RFZ itself ( Fig. 5G ). In controls, the RFZ appeared as a well-defined, circular region devoid of rods ( Fig. 5C ). KD of Tbx2 and Tbx3 significantly reduced the size of the RFZ, while its circular shape remained mostly intact ( Fig. 5D, E, S4A -C). In contrast, Tbx5 KD not only reduced the RFZ size but also distorted its shape ( Fig. 5F , S4D), making quantification less reliable and resulting in greater variability ( Fig. 5G ). In some cases, the RFZ was also shifted dorsally (Fig. S4D). Notably, the RFZ was completely absent in two biological replicates after Tbx2 KD and in one replicate following Tbx5 KD, further reinforcing the importance of these transcription factors in HAA formation, but also contributing to variability ( Fig. 5G ). A summary of the diverse effects on RFZ formation after Tbx KD is shown in Fig. S4E. Effect of Tbx2, Tbx3, and Tbx5 KD on cone photoreceptors To further investigate the role of Tbx genes on photoreceptor patterning, cone photoreceptors were quantified following Tbx KD. Tbx2 KD resulted in a significant reduction of UV cones in the dorsal and ventral retinal domains, as well as in the distorted RFZ, compared to control (sh-sc- mCherry) retinas ( Fig. 6A,B ). This reduction was statistically significant across all three retinal regions ( Fig. 6C ; ANOVA, * P ≤ .05, *** P ≤ .001). In contrast, Tbx3 and Tbx5 KD did not noticeably affect UV cone numbers in the dorsal region or the RFZ, but appeared to reduce UV cone numbers in the ventral region, although this decrease did not reach statistical significance ( Fig. 6C ). The lack of statistical significance and the relatively high variability may in part reflect the fact that the total number of UV cones is approximately six times lower than that of rods, making the data more sensitive to fluctuations between samples. The role of Tbx2 in UV cone development was further confirmed by Tbx2 OE experiments, which demonstrated that Tbx2 OE can induce UV cones ( Fig. 6D ). Download figure Open in new tab Figure 6: Analysis of Tbx gene alterations on types of cones. (A,B) Representative smFISH images of E16 retinal flatmounts probed for UV cones following E2 electroporation with control shRNA-scrambled (A) or shTbx2 (B) . Scale bars: mCherry overview images (top row), 500 µm; UV cone images, 100 µm. (C) Quantification of UV cone numbers in dorsal and ventral domains and in the RFZ in control and Tbx KD retinas. (D) Representative smFISH image of a retinal flatmount electroporated at E2 with a Tbx2 OE plasmid, harvested at E16, and probed for UV cones. Scale bar, 500 µm. (E,F) Quantification of green (E) and red (F) cone numbers in dorsal, equatorial, and ventral retinal domains. (C,E,F) Each point represents one biological replicate (Fig. S4F). Data, presented as mean ± SEM, were compared by two-way ANOVA. * P ≤ .05, *** P ≤ .001. The effect of Tbx KD on green and red cones also was examined. In control retinas, green cones were slightly more abundant dorsally than ventrally, and this distribution pattern persisted following Tbx2 , Tbx3 , or Tbx5 KD. Moreover, the total number of green cones in each retinal region remained unchanged compared to controls ( Fig. 6E ). In control retinas, red cones were more abundant ventrally than dorsally, and this distribution pattern was also not altered by Tbx perturbations ( Fig. 6F ). Discussion The gain- and loss-of-function experiments reported herein demonstrate that Tbx2, Tbx3, and Tbx5 directly or indirectly regulate each other, while each gene also has its own distinctive effects on the expression patterns of other early genes. They also have some common regulatory roles, as KD of each of them disrupts the early expression patterns of Fgf8, Cyp26c1, and Cyp26a1 . As Fgf8 and Cyp26c1 mark the developing HAA, and the RA and Fgf8 pathways play a role in formation of the HAA ( 8 ), these results indicate that the Tbx genes also play a role in formation of the HAA. In keeping with this, analysis of a component of the HAA, the RFZ, near the end of development, showed that it was clearly disrupted following KD of each Tbx gene. Rod photoreceptor patterning also was impaired outside of the RFZ in all KDs. Tbx2 KD additionally led to a smaller number of UV cones. Intriguingly, none of the Tbx KDs affected red and green cones. Overlapping expression domains and cross-regulation of Tbx2, 3 and 5 All three Tbx genes are expressed in the dorsal retina, with different ventral borders of expression. OE of Tbx2 induces Tbx3 and Tbx5 within their endogenous dorsal domains, consistent with previous work demonstrating that Tbx2 is required to maintain the correct spatial expression of Tbx5 ( 14 ). In contrast, Tbx3 represses Tbx2 , but induces Tbx5 , within the normal expression domain of Tbx5 . This regulatory effect of Tbx3 on Tbx2 may indicate a complex balance among Tbx genes, potentially involving shared or partially overlapping functions ( 41 ). The upregulation of Tbx2 and Tbx3 upon Tbx5 OE suggests that Tbx5 serves as central regulator of dorsal retinal identity by coordinating the activation of other T-box members. This creates a mutual activation loop among Tbx2, Tbx3 , and Tbx5 , with the notable exception that Tbx3 represses Tbx2 , as was reported for cancer cells ( 42 , 43 ). This inhibitory effect may help refine the expression boundaries within the equatorial region, where Tbx3 is highly expressed in the presumptive HAA, and Tbx2 is excluded. Tbx2 and Tbx3 are generally regarded as transcriptional repressors, mediated by their C-terminal repression domains ( 26 , 44 ). The upregulation of Tbx5 by OE of either of these genes, only in the normal expression domain of Tbx5 , suggests that there are other regulators of Tbx5 that interact with and/or are regulated by Tbx2 and Tbx3 . It is also possible that Tbx2 and Tbx3 positively regulate Tbx5 directly as they harbor potential activation domains ( 13 , 42 ), and they have been shown to positively drive gene expression in a cofactor- and context-dependent manner ( 37 , 42 , 45 ). Tbx5 is considered to be a transcriptional activator ( 13 , 46 ), consistent with our findings that it positively regulates Tbx2 and Tbx3 . To examine the individual contributions of these Tbx genes, we designed shRNAs for each gene. Analysis by qRT-PCR revealed that KD of either Tbx2 or Tbx3 led to reduced Tbx5 expression, providing complementary evidence of cross-regulation consistent with the OE experiments. Similar relationships are known from studies of heart development. In the heart, Tbx2 and Tbx3 can repress or cooperate with Tbx5 , in part through interactions with cofactors such as Nkx2.5 and GATA4/6. These transcription factors act at shared or neighboring enhancer elements, and therefore balancing Tbx5-mediated activation and Tbx2/Tbx3-mediated repression to shape the development of the conduction system and chamber myocardium ( 47 – 49 ). In the retina, Tbx2 and Tbx3 may similarly stabilize the transcriptional environment required for Tbx5 , potentially through shared upstream regulatory pathways. The downregulation of Tbx5 in the Tbx2 and Tbx3 shRNA experiments could cause a change in other factors that directly affect Tbx5 ( 50 , 51 ). Because of the cross regulatory effects of these Tbx genes, it is possible that any KD effects were due to the loss of more than one family member. This might lead to common effects following KD of each gene, as were seen in some assays, e.g. disruption of the RFZ. However, some aspects of the expression patterns of Tbx2, Tbx3, and Tbx5 did not overlap ( Fig. 1A, B ), and KD experiments did reveal some specific effects following KD of each Tbx gene, e.g. Tbx5 KD reduced Cyp1B1 more strongly than KD of Tbx2 or Tbx3 . Effects of Tbx OE on electroporated cells Three days following electroporation of Tbx OE plasmids, the electroporated cells had an unusual appearance. They were arranged in tight clusters, not seen in past experiments or in control electroporated cells in the current studies, e.g. using a plasmid with mCherry upstream of the IRES, rather than a Tbx gene. Tbx OE may be stressful or toxic to retinal progenitor cells. Cells unable to tolerate high levels of these transcription factors may die or exit the cell cycle, leaving behind clusters of “resistant,” ZsGreen-positive cells. Alternatively, the effect may arise from Tbx activities which are not directly toxic. All three Tbx genes are known to influence cell adhesion and migration either directly or indirectly through regulation of genes involved in proliferation and attachment ( 52 – 54 ). For example, Tbx5 OE was shown to prevent proepicardial cell migration ( 55 ). In cancer, TGF-β1–induced upregulation of Tbx3 leads to repression of Tbx2, thereby promoting cell migration and invasion ( 43 ). Likewise, Tbx3 OE impaired cell growth and migration in skeletal muscle cells ( 56 ). These findings collectively suggest that Tbx expression levels must be tightly controlled to maintain normal cellular adhesion, migration, and survival. Despite these caveats, the effects of Tbx OE are likely to be relevant to their gene regulatory roles and photoreceptor patterning, as they complement the KD results with respect to the cross regulation of these Tbx genes. KD of Tbx2, Tbx3, and Tbx5 affects expression of early patterned genes A distinctive pattern in the early chick retina, which we refer to as a "spot and stripe" pattern, was first discovered for Fgf8. In this previous study, we found that Fgf8 is not only patterned in an auspicious manner, but it is required for formation of the HAA, as its KD led to disruption of this area ( 8 ). The specific and characteristic Fgf8 expression pattern was disrupted by KD of Tbx2, Tbx3, or Tbx5, indicating that these genes play a role in setting up the HAA. In Xenopus , Tbx2 represses Fgf8 signaling by inhibiting Flrt3, a positive regulator of Fgf signaling ( 57 ). Tbx2- mediated downregulation of Fgf8 could explain the expanded Fgf8 domain we observed following Tbx2 KD. In contrast, Tbx5 has been implicated as an indirect regulator of Fgf8 via RA signaling ( 58 ). Specifically, in Xenopus and mouse cardiopulmonary development, Tbx5 maintains Raldh2 expression, a RA synthesizing enzyme, thereby antagonizing an Fgf8-Cyp regulatory module to restrict Fgf activity. Consistently, OE of Tbx5 in the early chick retina showed increased Raldh1 expression adjacent to the Fgf8 domain. Although the precise molecular relationship between Tbx5 and Raldh1 remains unclear, it has been shown that Tbx5 expression precedes the onset of Raldh1 during retinal development ( 31 ), further supporting a positive regulatory role. The diffuse Fgf8 expression after Tbx5 KD may reflect disrupted RA homeostasis, through disturbed Raldh1 expression and/or altered expression of RA-degrading enzymes, Cyp26c1 and Cyp26a1 Both of these RA-degrading enzymes are likely to shape the Fgf8 domain ( 8 , 59 ), and both were suggested to mediate RA degradation within the equatorial mouse retina ( 60 ). The observed disruption of the focal Cyp26c1 expression after Tbx2 and Tbx5 KD suggests that Tbx2 and Tbx5 are required to establish the spatial boundaries of Cyp26c1 expression. High Tbx3 expression overlaps with the small Cyp26c1 domain in the developing HAA, whereas Tbx5 is absent and Tbx2 is weakly expressed. Our data further suggest that Tbx3 is required to maintain the size of the Cyp26c1 domain as well as its expression level, as Tbx3 KD nearly abolished Cyp26c1 expression. In addition, Tbx3 KD resulted in weak and broadly expressed Cyp26a1 , further pointing to an imbalance in the RA pathway. Interestingly, Tbx3 KD did not affect Cyp1b1 , another enzyme that can make RA, whereas Tbx2 reduced its expression and Tbx5 abolished it dorsally. Consistently, Tbx5 OE induced ectopic Cyp1b1 expression, but only ventrally, suggesting that specific cofactors restrict its transactivation activity dorsally. Together, these findings reveal a previously unrecognized regulatory role of Tbx2 and Tbx5 on Cyp1b1 and further indicate that coordinated regulation of Tbx genes is essential for maintaining the spatiotemporal patterning of RA-degrading enzymes. We also observed Tbx gene-specific effects on Bmp2 , a morphogen critical for retinotectal mapping ( 36 ). Bmp2 is expressed from E5 onward in an oblique-gradient pattern complementary to that of Ventroptin in the ventral retina ( 36 ). Tbx2 KD did not affect Bmp2 expression, consistent with prior evidence that Bmp2 acts upstream of Tbx2 ( 36 , 37 ). In contrast, Tbx3 KD caused strong Bmp2 downregulation, while Tbx5 KD led to a dorsal expansion of the Bmp2 domain. This is consistent with data showing that Tbx3 can directly regulate Bmp2 in limb development ( 61 ) whereas in heart development, a Bmp2–Tbx2/3 feed-forward loop operates ( 62 ). For Tbx5 , the data suggest a boundary-setting function: while Tbx5 expression in the heart is not Bmp2- responsive ( 63 ), in the retina Bmp2 KD reduced Tbx5 expression ( 36 ). Our finding that Tbx5 KD expanded Bmp2 expression dorsally, and OE reduced it, supports a boundary-setting function of Tbx5 for the mid-retinal Bmp2 domain. Ventroptin , a BMP antagonist, is expressed ventrally and was also affected by Tbx OE and KD. Tbx2 KD resulted in a dorsal shift of Bmp2 expression, while Ventroptin expanded into the equatorial retina. This is consistent with Tbx2 acting as a direct Ventroptin repressor. This is further supported by our finding that Tbx2 OE reduced Ventroptin expression. This relationship has not previously been reported. Tbx3 KD did not alter the Ventroptin domain size but reduced its intensity and led to reduced Bmp2 levels. This might be surprising given their antagonistic relationship, perhaps indicating additional levels of regulation in the equatorial domain. Moreover, the loss of the characteristic Ventroptin notch marking the Fgf8 spot following Tbx3 and Tbx5 KD correlates with the disrupted Fgf8 and Cyp26c1 patterning. Collectively, these findings indicate that Tbx2, Tbx3 , and Tbx5 modulate the expression domains of Bmp2 and Ventroptin , potentially allowing aberrant dorsal expansion of Ventroptin - a gene normally confined to the ventral retina - perhaps due to, or thereby causing, disturbed dorsoventral patterning. Taken together, Tbx2, Tbx3, and Tbx5 KD disrupted domain boundaries separating the equatorial region from dorsal and ventral territories. Interestingly, some of the KD and OE effects occurred in domains where the gene was not expressed, e.g. Tbx5 OE resulted in ectopic Raldh1 expression beyond its normal dorsal expression domain and Tbx2 KD led to reduced ventral rods in a domain larger than the Tbx2 expression domain. This sort of effect likely reflects aberrant early retinal patterning, which propagate in gene expression changes at a distance. Tbx factors regulate photoreceptor cell types and RFZ formation Perturbations of Tbx2, Tbx3 , and Tbx5 resulted in changes in photoreceptor patterning for rods and UV cones, while not affecting red and green cones. KD of Tbx2 or Tbx5 resulted in an increased number of rods, but this increase was only significant in the equatorial domain. Neither the dorsal nor the ventral retina showed such an increase, though there was a trend towards an increase in the dorsal region, following Tbx2 or Tbx5 KD. In contrast to the increase in rods in the equatorial domain by Tbx2 KD, the opposite effect was seen in ventral retina, where rods are normally enriched ( 28 ). The reduction in rods in the ventral retina occurred in an area outside of the normal domain of Tbx2 expression. This non-cell-autonomous effect implies that Tbx2 influences overall spatial patterning, leading to the effect on rods in the ventral retina, and possibly in the equatorial region as well. It may additionally directly affect rod specification in other regions where it is expressed. Supporting this idea, ectopic OE of Tbx2 inhibited rod formation. Interestingly, the results of Tbx2 KD in the ventral retina gave the opposite phenotype to that of Tbx2b and Tbx2a in zebrafish, where the number of rods increased upon loss of Tbx2a or Tbx2b ( 18 ), much as we saw in the equatorial domain of the chick retina with Tbx2 KD. UV cone numbers decreased in the zebrafish Tbx2 mutants, with the numbers of rods and UV cones suggesting a fate switch of UV cones to rods ( 18 , 64 ). Here we saw a decrease in UV cones in all retinal domains, not just the equatorial domain where rods increased. Even in a control retina, there are almost ten times as many rods as UV cones. Therefore, it would have been difficult to quantify a significant fate switch of UV cones to rods, but this may have occurred in the equatorial domain. The mechanism for the increase in rods in the zebrafish Tbx2 mutants was shown to be due to the lack of repression of Nrl, a gene required for rod formation. The chick has an Nrl homologue, MafA, which may have different regulation from that of zebrafish ( 65 , 66 ). As mentioned above, the selective increase in equatorial rods with KD of Tbx2 and Tbx5 genes fates may be due to alterations in patterning, through changes in RA signaling. Tbx KD disrupted the balance between RA-synthesizing enzymes ( Raldh1, Cyp1b1 ) and RA-degrading enzymes ( Cyp26a1, Cyp26c1 ). We previously found that RA injection into chick eyes led to an increase in rods only in the RFZ ( 8 ). RA has been shown to promote rod differentiation at the expense of amacrine cells in rat retina ( 67 ). In zebrafish, RA exposure shifts fates toward rods and red cones over UV/blue cone types ( 68 ). In human retinal organoids, RA is thought to induce formation of green (M) opsin cones and repress formation of red (L) opsin cones ( 69 ). Here, we did not detect an effect on the numbers or patterns of red or green cones. M and L cones in chickens likely represent distinct cell types, whereas in humans, M and L cones may represent the same cell type with the only difference being opsin choice, which may be the regulatory step influenced by RA. In addition to changes in the number of rods in the conditions discussed above, we found that the RFZ was consistently reduced in size and in some cases completely absent following KD of Tbx2 , Tbx3 , or Tbx5 . Formation of all of the features of the HAA – the absence of rods, enrichment of ganglion cells, and a distinctive inner nuclear layer (INL) organization – requires lack of RA and presence of Fgf8 ( 8 ). Its formation has not previously been linked to Tbx genes. Although in our experiments we only quantified RFZ size, the consistent reduction (or loss) of the RFZ strongly suggests impaired HAA formation. This suggestion is also supported by the effects of Tbx gene manipulations on the RA and Fgf8 expression patterns, as RA and Fgf8 perturbations each disrupt all defining HAA features ( 8 ). Taken together, these results demonstrate that Tbx2, Tbx3 , and Tbx5 regulate each other, and additionally regulate early retinal genes, including Fgf8, Cyp26c1, Cyp26a1, Cyp1b1, Raldh1, Bmp2 , and Ventroptin . Tbx-dependent positioning of the RA pathway, and potentially of other pathways, are likely at least partially responsible for the downstream effects of Tbx KD and OE on photoreceptor fates and the formation of the HAA. These data thus provide a framework to understand not only the molecular mechanisms of HAA development, but more generally how early patterning events influence later cell fate choices. Materials and Methods Animals Embryonic retinal tissue was collected from fertilized White Leghorn eggs (Charles River). The eggs were incubated at 38 °C under ∼40 % humidity, and embryos for electroporation were staged according to the criteria of Hamburger and Hamilton ( 70 ). Tissue preparation Retinas from the right eye of embryos between E3 - E8 were dissected in 1X PBS without additional treatment, as the retina could be easily separated from the RPE at these stages. For E16 embryos, eyeballs were first cleaned of muscle tissue in 1X PBS and then transferred to a 0.1 mg/mL Dispase I solution (Sigma-Aldrich, D4818; 2 mg dissolved in 20 ml distilled water). The lens and choroid were removed, followed by separation of the RPE. Once detached, the retina was immediately transferred to 1X PBS. Retinas were fixed for 45 min in 4 % paraformaldehyde (v/v) (Thermo Scientific, 28906) at room temperature (RT), then washed 3 × 5 min in 1X PBS prior to HCR RNA-FISH. HCR smFISH on retinal flatmounts HCR smFISH was performed as previously described ( 24 , 71 ) with minor modifications. Probes were synthesized by Molecular Instruments based on the following sequences: Tbx2 (XM_001235320.7), Tbx3 (NM_001270878.2), Tbx5 (NM_204173.1), Fgf8 (NM_001012767.2), Cyp26c1 (XM_040675448.1), Cyp26a1 (XM_015283751.4), Cyp1b1 (XM_015283751.4), Raldh1 (NM_204577.5), Bmp2 (NM_001398170.1), Ventroptin (NM_204171.2), Opn1sw (NM_205438.1), Opn1msw (NM_205490.1), Opn1lw (NM_205440.2), and Rho (NM_001397497.1). Fixed retinas were washed once in 1X PBS at RT for 5 min, permeabilized in 70 % ethanol/PBS for 2 - 4 h at RT, washed in washing buffer for 5 min at RT, and incubated in hybridization buffer at 37 °C for 30 min. Samples were then hybridized overnight at 37 °C with probes diluted in hybridization buffer (6 µl/ml, 6nM). The next day, retinas were washed twice in prewarmed washing buffer for 30 min each at RT, followed by two washes in 5X SSC (Invitrogen, 15557044) with 0.1 % Tween-20 for 20 min each at RT. Samples were incubated in amplification buffer for 10 min at RT. Meanwhile, matching amplifiers were heated for 90 s at 95 °C, and cooled at RT for 30 min in the dark. Afterwards amplifiers were diluted in amplification buffer (8 µl/ml, 48nM), and applied to retinal samples for overnight incubation at RT in the dark. On the following day, retinas were washed twice in 5× SSCT with 0.1% Tween-20 for 30 min each at RT, then mounted and imaged. For multiplexing, coverslips were removed in 1X PBS after flatmount imaging. Demounted retinas were incubated with DNase solution (Roche, 04716728001; 30 µl DNase and 150 µl 10X DNase buffer in 1320 µl distilled water) for 1 h at 37 °C. The solution was then replaced with fresh DNase, and samples were incubated overnight at 37 °C. On the following day, retinas were washed twice in wash solution (1 ml 20X SSC and 6.5 ml formamide in 2.5 ml distilled water) for 30 min each at 37 °C, followed by two 30 min washes in 5X SSCT for 30 min each at RT. A second round of smFISH was then performed as described above. In vivo electroporation For OE experiments, HH10 - HH11 chick embryos were electroporated in the optic vesicle with CAG-Tbx2-ZsGreen, CAG-Tbx3-ZsGreen or CAG-Tbx5-ZsGreen plasmids (1 µg/ul, final concentration) together with CAG-piggyBacTransposase (1 μg/μl, final concentration). For KD experiments, HH8 – HH10 chick embryos were electroporated with combinations of shRNAs (4 µg/µl each) targeting the respective Tbx gene. A beveled glass capillary needle filled with the plasmid mixture and 0.1 % Fast Green was used to inject the right optic vesicle. To prevent bacterial growth and prevent dehydration, two drops of 1X PBS supplemented with 1 % penicillin- streptomycin (15140148, Thermo Fisher) were added on top of the embryo. Electrodes (Nepagene, CUY610P1.5-1) were positioned extra-embryonically, with the negative electrode placed next to the left optic vesicle and the positive cathode next to the right. The electrodes were gently pressed against the vitelline membrane, and electroporation was performed using a NEPA21 type II electroporater (Nepagene) with five transfer pulses of 15 V, each lasting 50 ms with a 950 ms interpulse interval. Eggs were then sealed with tape and returned to a humidified incubator until the desired developmental stages was reached. 293T cell transfection To identify shRNAs with effective KD efficiency, three candidate shRNAs per gene were tested in HEK293T cells ( 30 ). HEK293T cells were cultured at 37 °C in DMEM (11995040, Thermo Fisher) supplemented with 10 % FBS (A4736301,Thermo Fisher), and 1 % penicillin-streptomycin (15140148, Thermo Fisher). Cells at ∼ 70 % confluency in 60-mm dishes were either transfected with a Tbx-overexpressing plasmid with IRES-d2EGFP (unstable GFP) reporter or co-transfected with a CAG-driven mir30-shRNA construct expressing mCherry as an electroporation control. Fluorescent images were acquired 48 h post-transfection using a LEICA DMI3000 B fluorescence microscope. A combination of shRNAs #1, #2, and #3 for Tbx2 and Tbx5 KD, and shRNAs #1 and #2 for Tbx3, were used for in ovo electroporation experiments, with the following sequences: scrambled (sc) 5’- CCTAAGGTTAAGTCGCCCTCGTA-3’, Tbx2#1 5’-AGCAAATGTCCCATGCCCATA-3’, Tbx2#2 5’- TTCTGCAGTTCGTTGAGGGAT-3’, Tbx2#3 5’- AGAGCTTTGGGACCAATTCCA-3’; Tbx2-3’UTR 5’- ACCGCAATGTTTGGAGTCATT-3’ ; Tbx3#1 5’- CCTGGCTAAGCCCATTATGGA-3’; Tbx3#2 5’- GACCGCATACCAGAATGATAA-3’; Tbx3#3 5’- CGGCCCTAAAGTAGACGAGAA-3’; Tbx5#1 5’- GGTCACTGGACTCAATCCAAA-3’; Tbx5#2 5’- ATGTCCAGGATGCAGAGTAAA-3’; and Tbx5#3 5’-ATTTCTCTGCCCACTTCACCT-3’. qRT-PCR RNA was isolated from retinas with the NucleoSpin® RNA kit (Macherey-Nagel) according to the manufacturer’s protocol. 0.1 – 0.3 µg of total RNA was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. The obtained cDNA was diluted 1:3 with distilled water and used for quantitative real- time PCR using the PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific) on a CFX96™ Real-Time System (C1000Touch™, Bio-Rad). Exon-spanning primer pairs were designed using the UCSC genome browser. They hybridized exclusively to the desired transcript to avoid detection of genomic contamination. The following primers were used: Tbx2 5’- ACCAAATCCGGGAGGAGGAT- 3’ (Forward), 5’- TCGTCGGCCGCAACTATATC-3’ (Reverse); Tbx3 5’- TCAAGCTTCCCTACAGCACG -3‘ (Forward), 5’- CAGGGTCAGCTGCTTCCTTT-3‘ (Reverse); Tbx5 5’- GACCCTGCTGTCCGCAT-3‘ (Forward), 5’- CGAATCCCCCACTGCGT-3‘ (Reverse); Gapdh 5’-GGCCATCAATGATCCCTTCATCG-3’ (Forward), 5’-GGCGTGCCCATTGATCACAA -3’ (Reverse). Gapdh was used as the reference gene for data normalization. The “double delta Ct” method (ΔΔCt) was used to calculate the relative expression of the target gene. Imaging and quantification All flatmounts from E16, including those used for quantitative analyses, were imaged with a high- throughput slide scanner (Olympus VS200) using a UPlan X Apo 10x/0.4 air objective lens, and photoreceptor numbers and the RFZ size were quantified in Fiji. For each embryo, cone opsin subtypes were counted within three distinct regions (1.23 mm 2 each): dorsal, nasal, and the RFZ. Rods were quantified in three regions of the same size, located dorsally, nasally, and temporally adjacent to the RFZ. The size of the RFZ was determined by delineating the border along the transition from the rod-sparse to the rod-dense region, such that portions of the rod-sparse area were included in the measurement. Data were plotted using GraphPad Prism 10.3. Normality was tested with the Shapiro-Wilk test. Values are presented as mean ± standard error of mean (SEM). Photoreceptor counts were analyzed by two-way ANOVA, and RFZ size was compared by one- way ANOVA. Statistical significance was set at P < 0.05 (*P < 0.05; **P < 0.01; ***P < 0.001). N values refer to the number of individual animals per condition, as listed in Fig. S4E. Control smFISH and Tbx OE retinas were imaged with a Yokogawa CSU-W1 (50 μm pinhole size) spinning disk confocal unit attached to a fully motorized Nikon Ti2 inverted microscope equipped with a Nikon motorized stage and an Andor Zyla 4.2 plus sCMOS monochrome camera. A Plan Apo λ 20x/0.8 DIC I and a Plan Fluor 40x/1.3 Oil DIC H/N2 objective lens were used. Data acquisition was performed with Nikon Elements AR 5.02 acquisition software. Z-stacks were acquired using Piezo Z-device, with the shutter closed during axial movements. KD retinas were imaged using a single point laser scanning confocal microscope (Leica Inverted DMi8) equipped with a motorized stage (ITK) and five spectral confocal detectors (2 HydS, 2 HyDX, 1 HyDR). All images were acquired using a Plan Apo 20x/0.75 air objective. Funding source Monika Ayten and Heer Joisher were supported by HHMI and 1R01EY029771. Heer Joisher was also supported by the Fujifilm Fellowship. CRediT authorship contribution statement Monika Ayten: Writing – review & editing, Writing – original draft, Visualization, Validation, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Heer N.V. Joisher: Resources, Conceptualization, Methodology, Writing – review. Constance Cepko: Writing – review & editing, Supervision, Conceptualization. Declaration of interests The authors declare no competing interests. Acknowledgements The images were acquired using Microscopy Resources on the North Quad (MicRoN) core at Harvard Medical School. We thank Paula Montero Llopis, Praju Vikas Anekal, and Adrienne Wells for their assistance with microscopy and helpful discussions. We thank Ryan N. Delgado and Isabella van der Weide for comments on the manuscript. References 1. ↵ J. Reingruber , D. Holcman , G. L. Fain , How rods respond to single photons: Key adaptations of a G-protein cascade that enable vision at the physical limit of perception . Bioessays 37 , 1243 – 1252 ( 2015 ). OpenUrl CrossRef PubMed 2. ↵ P. Ala-Laurila , Visual pigments underlie the sensitivity difference between day and night vision . Proceedings of the National Academy of Sciences 122 , e2424071122 ( 2025 ). OpenUrl PubMed 3. ↵ A. Bringmann et al. , The primate fovea: Structure, function and development . Progress in Retinal and Eye Research 66 , 49 – 84 ( 2018 ). OpenUrl CrossRef PubMed 4. ↵ D. Mustafi , A. H. Engel , K. Palczewski , Structure of cone photoreceptors . Progress in Retinal and Eye Research 28 , 289 – 302 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 5. ↵ C. A. Ellsworth , A. W. Lyckman , D. A. Feldheim , J. G. Flanagan , M. Sur , Ephrin-A2 and -A5 influence patterning of normal and novel retinal projections to the thalamus: conserved mapping mechanisms in visual and auditory thalamic targets . J Comp Neurol 488 , 140 – 151 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 6. ↵ L. Erskine , E. Herrera , Connecting the retina to the brain . ASN Neuro 6 ( 2014 ). 7. ↵ S. L. Bruhn , C. L. Cepko , Development of the pattern of photoreceptors in the chick retina . J Neurosci 16 , 1430 – 1439 ( 1996 ). OpenUrl Abstract / FREE Full Text 8. ↵ S. da Silva , C. L. Cepko , Fgf8 Expression and Degradation of Retinoic Acid Are Required for Patterning a High-Acuity Area in the Retina . Developmental Cell 42 , 68 – 81 .e66 ( 2017 ). OpenUrl CrossRef PubMed 9. ↵ V. B. Morris , An afoveate area centralis in the chick retina . Journal of Comparative Neurology 210 , 198 – 203 ( 1982 ). OpenUrl CrossRef PubMed Web of Science 10. ↵ K. Viets , K. Eldred , R. J. Johnston , Jr . ., Mechanisms of Photoreceptor Patterning in Vertebrates and Invertebrates . Trends Genet 32 , 638 – 659 ( 2016 ). OpenUrl CrossRef PubMed 11. ↵ D. Schulte , M. A. Peters , J. Sen , C. L. Cepko , The rod photoreceptor pattern is set at the optic vesicle stage and requires spatially restricted cVax expression . J Neurosci 25 , 2823 – 2831 ( 2005 ). OpenUrl Abstract / FREE Full Text 12. ↵ Y. Takashima , A. Suzuki , Regulation of organogenesis and stem cell properties by T- box transcription factors . Cell Mol Life Sci 70 , 3929 – 3945 ( 2013 ). OpenUrl CrossRef PubMed 13. ↵ V. E. Papaioannou , The T-box gene family: emerging roles in development, stem cells and cancer . Development 141 , 3819 – 3833 ( 2014 ). OpenUrl Abstract / FREE Full Text 14. ↵ H. Behesti , V. E. Papaioannou , J. C. Sowden , Loss of Tbx2 delays optic vesicle invagination leading to small optic cups . Dev Biol 333 , 360 – 372 ( 2009 ). OpenUrl CrossRef PubMed 15. ↵ M. A. Peters , C. L. Cepko , The dorsal-ventral axis of the neural retina is divided into multiple domains of restricted gene expression which exhibit features of lineage compartments . Dev Biol 251 , 59 – 73 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ J. J. Gibson-Brown , S. I. Agulnik , L. M. Silver , V. E. Papaioannou , Expression of T-box genes Tbx2–Tbx5 during chick organogenesis . Mechanisms of Development 74 , 165 – 169 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 17. ↵ K. Koshiba-Takeuchi et al. , Tbx5 and the Retinotectum Projection . Science 287 , 134 – 137 ( 2000 ). OpenUrl Abstract / FREE Full Text 18. ↵ K. Alvarez-Delfin et al. , Tbx2b is required for ultraviolet photoreceptor cell specification during zebrafish retinal development . Proc Natl Acad Sci U S A 106 , 2023 – 2028 ( 2009 ). OpenUrl Abstract / FREE Full Text 19. ↵ M. G. DuVal , A. P. Oel , W. T. Allison , gdf6a Is Required for Cone Photoreceptor Subtype Differentiation and for the Actions of tbx2b in Determining Rod Versus Cone Photoreceptor Fate . PLOS ONE 9 , e92991 ( 2014 ). OpenUrl CrossRef PubMed 20. ↵ C. Prada , J. I. Medina , R. López , J. M. Génis-Gálvez , F. A. Prada , Development of retinal displaced ganglion cells in the chick: neurogenesis and morphogenesis . J Neurosci 12 , 3781 – 3788 ( 1992 ). OpenUrl Abstract / FREE Full Text 21. ↵ D. Dütting , A. Gierer , G. Hansmann , Self-renewal of stem cells and differentiation of nerve cells in the developing chick retina . Developmental Brain Research 10 , 21 – 32 ( 1983 ). OpenUrl 22. ↵ S. Finnegan et al. , Protein expression profiling during chick retinal maturation: a proteomics-based approach . Proteome Sci 6 , 34 ( 2008 ). 23. ↵ A. W. B. Weysse , Waldo S ., Histogenesis of the Retina . The American Naturalist 40 , 611 – 637 ( 1906 ). OpenUrl 24. ↵ J. Choi , H. N. V. Joisher , H. K. Gill , L. Lin , C. Cepko , Characterization of the development of the high-acuity area of the chick retina . Dev Biol 511 , 39 – 52 ( 2024 ). OpenUrl CrossRef PubMed 25. ↵ T. Kumamoto et al. , Direct Readout of Neural Stem Cell Transgenesis with an Integration-Coupled Gene Expression Switch . Neuron 107 , 617 – 630 .e616 ( 2020 ). OpenUrl CrossRef PubMed 26. ↵ S. Li et al. , Context-dependent T-BOX transcription factor family: from biology to targeted therapy . Cell Communication and Signaling 22 , 350 ( 2024 ). 27. ↵ Timo H. Lüdtke et al. , Tbx2 and Tbx3 Act Downstream of Shh to Maintain Canonical Wnt Signaling during Branching Morphogenesis of the Murine Lung . Developmental Cell 39 , 239 – 253 ( 2016 ). OpenUrl CrossRef PubMed 28. ↵ Y. Zeng , E. J. Wagner , B. R. Cullen , Both Natural and Designed Micro RNAs Can Inhibit the Expression of Cognate mRNAs When Expressed in Human Cells . Molecular Cell 9 , 1327 – 1333 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 29. ↵ P. J. Paddison et al. , Cloning of short hairpin RNAs for gene knockdown in mammalian cells . Nature Methods 1 , 163 – 167 ( 2004 ). OpenUrl PubMed 30. ↵ T. Matsuda , C. L. Cepko , Controlled expression of transgenes introduced by in vivo electroporation . Proc Natl Acad Sci U S A 104 , 1027 – 1032 ( 2007 ). OpenUrl Abstract / FREE Full Text 31. ↵ J. Sen , S. Harpavat , M. A. Peters , C. L. Cepko , Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina . Development 132 , 5147 – 5159 ( 2005 ). OpenUrl Abstract / FREE Full Text 32. P. Lyu et al. , Gene regulatory networks controlling temporal patterning, neurogenesis, and cell-fate specification in mammalian retina . Cell Reports 37 , 109994 ( 2021 ). 33. X. Zhang , P. Leavey , H. Appel , N. Makrides , S. Blackshaw , Molecular mechanisms controlling vertebrate retinal patterning, neurogenesis, and cell fate specification . Trends in Genetics 39 , 736 – 757 ( 2023 ). OpenUrl CrossRef PubMed 34. ↵ A. Picker et al. , Dynamic Coupling of Pattern Formation and Morphogenesis in the Developing Vertebrate Retina . PLOS Biology 7 , e1000214 ( 2009 ). OpenUrl CrossRef PubMed 35. ↵ E. M. Bolton , A. Drackley , A. L. Williams , B. L. Bohnsack , Insights into CYP1B1- Related Ocular Diseases Through Genetics and Animal Studies . Life (Basel ) 15 ( 2025 ). 36. ↵ H. Sakuta et al. , Role of bone morphogenic protein 2 in retinal patterning and retinotectal projection . J Neurosci 26 , 10868 – 10878 ( 2006 ). OpenUrl Abstract / FREE Full Text 37. ↵ M. Shirai , K. Imanaka-Yoshida , M. D. Schneider , R. J. Schwartz , T. Morisaki , T-box 2, a mediator of Bmp-Smad signaling, induced hyaluronan synthase 2 and Tgfβ2 expression and endocardial cushion formation . Proceedings of the National Academy of Sciences 106 , 18604 – 18609 ( 2009 ). OpenUrl Abstract / FREE Full Text 38. ↵ K. A. Hussey , S. E. Hadyniak , R. J. Johnston , Jr. , Patterning and Development of Photoreceptors in the Human Retina . Front Cell Dev Biol 10 , 878350 ( 2022 ). 39. ↵ R. Adler , A model of retinal cell differentiation in the chick embryo . Progress in Retinal and Eye Research 19 , 529 – 557 ( 2000 ). OpenUrl CrossRef PubMed Web of Science 40. ↵ S. Khalili et al. , Induction of rod versus cone photoreceptor-specific progenitors from retinal precursor cells . Stem Cell Research 33 , 215 – 227 ( 2018 ). OpenUrl PubMed 41. ↵ A. Lopatka , A. M. Moon , Complex functional redundancy of Tbx2 and Tbx3 in mouse limb development . Dev Dyn 251 , 1613 – 1627 ( 2022 ). OpenUrl PubMed 42. ↵ S. F. Khan et al. , The roles and regulation of TBX3 in development and disease . Gene 726 , 144223 ( 2020 ). 43. ↵ J. Li et al. , The anti-proliferative function of the TGF-β1 signaling pathway involves the repression of the oncogenic TBX2 by its homologue TBX3 . J Biol Chem 289 , 35633 – 35643 ( 2014 ). OpenUrl Abstract / FREE Full Text 44. ↵ J. Lu , X.-P. Li , Q. Dong , H.-f. Kung , M.-L. He , TBX2 and TBX3: The special value for anticancer drug targets . Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1806 , 268 – 274 ( 2010 ). OpenUrl PubMed 45. ↵ A. J. Washkowitz , S. Gavrilov , S. Begum , V. E. Papaioannou , Diverse functional networks of Tbx3 in development and disease . Wiley Interdiscip Rev Syst Biol Med 4 , 273 – 283 ( 2012 ). OpenUrl CrossRef PubMed 46. ↵ J. D. Steimle , I. P. Moskowitz , TBX5: A Key Regulator of Heart Development . Curr Top Dev Biol 122 , 195 – 221 ( 2017 ). OpenUrl CrossRef PubMed 47. ↵ W. M. Hoogaars et al. , The transcriptional repressor Tbx3 delineates the developing central conduction system of the heart . Cardiovasc Res 62 , 489 – 499 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 48. F. Greulich , C. Rudat , A. Kispert , Mechanisms of T-box gene function in the developing heart . Cardiovascular Research 91 , 212 – 222 ( 2011 ). OpenUrl CrossRef PubMed 49. ↵ T. F. Plageman Jr , K. E. Yutzey , T-box genes and heart development: Putting the “T” in heart . Developmental Dynamics 232 , 11 – 20 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 50. ↵ 50. Y. Takagaki , H. Yamagishi , R. Matsuoka , " Chapter four - Factors Involved in Signal Transduction During Vertebrate Myogenesis " in International Review of Cell and Molecular Biology , K. W. Jeon , Ed. ( Academic Press , 2012 ), vol. 296, pp. 187-272. 51. ↵ S. Teegala , R. Chauhan , E. Lei , D. C. Weinstein , Tbx2 is required for the suppression of mesendoderm during early Xenopus development . Dev Dyn 247 , 903 – 913 ( 2018 ). OpenUrl PubMed 52. ↵ J. Peres et al. , The Highly Homologous T-Box Transcription Factors, TBX2 and TBX3, Have Distinct Roles in the Oncogenic Process . Genes Cancer 1 , 272-282 ( 2010 ). 53. C. Bellis , M. V. Mlaza , A. Ali , A. Abrahams , S. Prince , Exploring the oncogenic roles of T-box transcription factor TBX2 and its potential as a therapeutic target . Biochemical Society Transactions 53 , 193 – 204 ( 2025 ). OpenUrl 54. ↵ N. Y. S. G. Diman et al. , Tbx5 Is Required for Avian and Mammalian Epicardial Formation and Coronary Vasculogenesis . Circulation Research 115 , 834 – 844 ( 2014 ). OpenUrl Abstract / FREE Full Text 55. ↵ C. J. Hatcher et al. , A role for Tbx5 in proepicardial cell migration during cardiogenesis . Physiological Genomics 18 , 129 – 140 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 56. ↵ T.-J. Oh , A. Adhikari , T. Mohamad , A. Althobaiti , J. Davie , TBX3 represses TBX2 under the control of the PRC2 complex in skeletal muscle and rhabdomyosarcoma . Oncogenesis 8 , 27 ( 2019 ). 57. ↵ G. S. Cho , D. S. Park , S. C. Choi , J. K. Han , Tbx2 regulates anterior neural specification by repressing FGF signaling pathway . Dev Biol 421 , 183 – 193 ( 2017 ). OpenUrl PubMed 58. ↵ S. A. Rankin et al. , Tbx5 drives Aldh1a2 expression to regulate a RA-Hedgehog-Wnt gene regulatory network coordinating cardiopulmonary development . Elife 10 ( 2021 ). 59. ↵ A. B. Rydeen , J. S. Waxman , Cyp26 Enzymes Facilitate Second Heart Field Progenitor Addition and Maintenance of Ventricular Integrity . PLOS Biology 14 , e2000504 ( 2016 ). OpenUrl CrossRef PubMed 60. ↵ Y. Sakai , T. Luo , P. McCaffery , H. Hamada , U. C. Dräger , CYP26A1 and CYP26C1 cooperate in degrading retinoic acid within the equatorial retina during later eye development . Dev Biol 276 , 143 – 157 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ T. Suzuki , J. Takeuchi , K. Koshiba-Takeuchi , T. Ogura , Tbx Genes Specify Posterior Digit Identity through Shh and BMP Signaling . Developmental Cell 6 , 43 – 53 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 62. ↵ R. Singh et al. , Tbx2 and Tbx3 induce atrioventricular myocardial development and endocardial cushion formation . Cell Mol Life Sci 69 , 1377 – 1389 ( 2012 ). OpenUrl CrossRef PubMed 63. ↵ T. F. Plageman , Jr. , K. E. Yutzey , Differential Expression and Function of Tbx5 and Tbx20 in Cardiac Development * . Journal of Biological Chemistry 279 , 19026 – 19034 ( 2004 ). OpenUrl Abstract / FREE Full Text 64. ↵ G. J. Neil , K. H. Kluttig , W. T. Allison , Determining Photoreceptor Cell Identity: Rod Versus Cone Fate Governed by tbx2b Opposing nrl . Invest Ophthalmol Vis Sci 65 , 39 ( 2024 ). 65. ↵ J. W. Kim et al. , Recruitment of Rod Photoreceptors from Short-Wavelength-Sensitive Cones during the Evolution of Nocturnal Vision in Mammals . Dev Cell 37 , 520 – 532 ( 2016 ). OpenUrl CrossRef PubMed 66. ↵ H. Ochi et al. , Temporal expression of L-Maf and RaxL in developing chicken retina are arranged into mosaic pattern . Gene Expression Patterns 4 , 489 – 494 ( 2004 ). OpenUrl PubMed 67. ↵ M. W. Kelley , J. K. Turner , T. A. Reh , Retinoic acid promotes differentiation of photoreceptors in vitro . Development 120 , 2091 – 2102 ( 1994 ). OpenUrl Abstract 68. ↵ C. B. Stevens , D. A. Cameron , D. L. Stenkamp , Plasticity of photoreceptor-generating retinal progenitors revealed by prolonged retinoic acid exposure . BMC Dev Biol 11 , 51 ( 2011 ). 69. ↵ S. E. Hadyniak et al. , Retinoic acid signaling regulates spatiotemporal specification of human green and red cones . PLoS Biol 22 , e3002464 ( 2024 ). OpenUrl CrossRef PubMed 70. ↵ V. Hamburger , H. L. Hamilton , A series of normal stages in the development of the chick embryo . Developmental Dynamics 195 , 231 – 272 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 71. ↵ H. M. T. Choi et al. , Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust . Development 145 ( 2018 ). View the discussion thread. Back to top Previous Next Posted October 18, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Tbx genes influence early gene expression and photoreceptor patterning in the chick retina Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Tbx genes influence early gene expression and photoreceptor patterning in the chick retina Monika Ayten , Heer N.V. Joisher , Constance Cepko bioRxiv 2025.10.18.683251; doi: https://doi.org/10.1101/2025.10.18.683251 Share This Article: Copy Citation Tools Tbx genes influence early gene expression and photoreceptor patterning in the chick retina Monika Ayten , Heer N.V. Joisher , Constance Cepko bioRxiv 2025.10.18.683251; doi: https://doi.org/10.1101/2025.10.18.683251 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41951) Biophysics (21456) Cancer Biology (18594) Cell Biology (25520) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22510) Immunology (17737) Microbiology (40401) Molecular Biology (17183) Neuroscience (88622) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)