Elevated ILC3s-related Inflammatory Factors may Promote Tendinopathy

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background: The prevalence of tendinopathy has risen dramatically over the last few decades and has become a common and serious orthopedic problem in sports injury and elderly populations. Immune cells have been shown to be associated with tendinopathy, with the percentage of Group 3 Innate Lymphoid Cells (ILC3s) having been shown to be upregulated in tendon tissue compared with peripheral blood. Methods: We used flow cytometry to investigate the percentage of circulating ILC3s in patients with tendinopathy and controls patients; Realtime-PCR was performed to detect the mRNA levels of ILC3s surface markers, CD45, IL-23R, ICOS and ILC3s-related inflammatory factors and transcription factors IL-17A, IL-22 and RORC in tendon samples. Results: Our results showed that the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy has no significant difference from that of controls by flow cytometry for Lin‑IL-2R+IL-23R + cells; however, the surface marker of ILC3s was upregulated in tendon tissue. In addition, IL-23, a characteristic activating factor of ILC3s, was also upregulated. Relative mRNA expression levels of IL-17A and IL-22 were also upregulated in tendinopathy tendon tissue compared to control patients. Conclusions: These results suggest that ILC3s may be a potential immune factor for tendinopathy.
Full text 69,310 characters · extracted from preprint-html · click to expand
Elevated ILC3s-related Inflammatory Factors may Promote Tendinopathy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Elevated ILC3s-related Inflammatory Factors may Promote Tendinopathy Peng Xu, Jiawei Yue, Xu Xu, Yumin Wu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-72214/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The prevalence of tendinopathy has risen dramatically over the last few decades and has become a common and serious orthopedic problem in sports injury and elderly populations. Immune cells have been shown to be associated with tendinopathy, with the percentage of Group 3 Innate Lymphoid Cells (ILC3s) having been shown to be upregulated in tendon tissue compared with peripheral blood. Methods: We used flow cytometry to investigate the percentage of circulating ILC3s in patients with tendinopathy and controls patients; Realtime-PCR was performed to detect the mRNA levels of ILC3s surface markers, CD45, IL-23R, ICOS and ILC3s-related inflammatory factors and transcription factors IL-17A, IL-22 and RORC in tendon samples. Results: Our results showed that the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy has no significant difference from that of controls by flow cytometry for Lin ‑ IL-2R + IL-23R + cells; however, the surface marker of ILC3s was upregulated in tendon tissue. In addition, IL-23, a characteristic activating factor of ILC3s, was also upregulated. Relative mRNA expression levels of IL-17A and IL-22 were also upregulated in tendinopathy tendon tissue compared to control patients. Conclusions: These results suggest that ILC3s may be a potential immune factor for tendinopathy. Orthopedics Orthopedic Surgery Tendinopathy ILC3s IL-17A IL-22 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Shoulder pain is a common and serious orthopedic problem in sports injuries and the elderly population and is caused by overuse of tendon injuries, i.e., tendinopathy[ 1 ]. Although it has been shown that proinflammatory mediators, such as immune cells[ 2 ], play an important role in tendon diseases, their intrinsic pathogenesis remains unclear. In particular, the interaction between immune cells and the initiation and development of tendon injury has not yet been fully elucidated. The development and progression of tendon sheath lesions is associated with an imbalance of inflammatory factors, immune cells, and chemical mediators. Previous studies have shown that vigorous immune cells infiltrate the site of tendon injury, and these immune cells subsequently release cytokines, such as IL-1β, IL-6 and TNF-α, which are involved in the processes of tendon injury and repair[ 3 , 4 ]. IL-17A, a member of the IL-17 cytokine family, is a proinflammatory mediator involved in the development of a variety of immune-related diseases[ 5 ]. It has been reported that IL-17A expression is increased in "early tendinopathy" compared to control samples. Additionally, after IL-17A treatment, tenocytes secreted more proinflammatory cytokines and produced more type III collagen[ 6 ]. The previous concept suggested that IL-17A is mainly secreted by Th17 cells; however, newly discovered Group 3 Innate Lymphoid Cells (ILC3s), which are a type of non-B, non-T innate lymphocytes, can also secrete large amounts of IL-17A, and their immune response process is earlier than the adaptive immune response[ 7 ]. Innate lymphocytes play important roles in tissue homeostasis, repair and remodeling[ 8 ]. Unlike adaptive immune cells, ILCs are nonspecific antigens, lack recombinant antigen-specific receptors, and lack dendritic cell phenotypic markers and myeloid cell markers[ 8 ]. ILCs can be divided into three groups and are based on the designations of helper T cells: (1) Group 1 ILCs (ILC1s) that produce IFN-γ predominately[ 9 ]; (2) Group 2 ILCs (ILC2s) that produce type 2 cytokines, especially IL-5 and IL-13 predominately[ 10 ]; (3) Group 3 ILCs (ILC3s) that produce IL-17 and/or IL-22 predominately[ 11 ]; and regulatory ILCs (ILCreg) that produce IL-10 and TGF-β[ 12 ]. As a counterpart of Th17 cells, ILC3s have also been confirmed to be involved in the development and progression of various diseases, such as atherosclerosis and inflammatory bowel disease [ 13 , 14 ]. In addition, there has been evidence that ILC3s are closely associated with fibrosis[ 15 ]. Interestingly, in donors without systemic inflammatory diseases, the proportion of ILC3s in tendon soft tissue was higher than its proportion in peripheral blood, and this portion of ILC3s secreted large amounts of IL-17 and IL-22 under the stimulation of IL-23[ 11 ], creating conditions for the involvement of ILC3s in the process of tendinopathy. However, no article has reported that the process of tendinopathy is associated with ILC3s. In this study, we aimed to test our hypothesis that ILC3s in peripheral blood and related factors of ILC3s in tendon tissue are associated with tendinopathy. Methods Patients This study was conducted at the Third Affiliated Hospital of Soochow University (Changzhou, China). It was reviewed and approved by the Ethics Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China) and was conducted according to standard surgical procedures with informed consent. Fifteen tendon samples were collected from patients with shoulder cuff tears undergoing shoulder surgery. The mean age was 52 years (range, 35–67). Only patients with no clinical evidence of subscapularis tendinopathy on preoperative MRI scans or macroscopic subscapularis tendon injury on arthroscopy were included — they represent a true preclinical cohort according to these criteria. All patients in this cohort met the following criteria: 1) a history of shoulder pain and dysfunction, 2) no history of surgery in the affected shoulder; 3) no imaging signs of fracture in the shoulder, and 4) no history of rheumatoid or osteoarthritis. Another independent control package consisted of 10 subscapularis tendon samples from patients undergoing shoulder arthroscopy for stabilization of the shoulder, with arthroscopic confirmation of no tendon tear, no history of shoulder surgery, no previous history of rheumatoid or osteoarthritis, no radiographic evidence of shoulder fracture, and a control mean age of 32 years (25–42). Cell preparation and flow cytometry quantification Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque density gradient centrifugation (GE Healthcare, Tokyo, Japan) and immediately quantified by flow cytometry, and for flow cytometry quantification, the cells were stained with fluorescein-conjugated monoclonal antibodies against the following in strict accordance with the instructions. The following antibodies were used in this study: Anti-Lineage-FITC CD2, CD3, CD14, CD16, CD19, CD56, and CD235a (eBioscience (San Diego, CA, USA), Anti-IL-23R-PE (BioLegend), and Anti-IL-2R-APC (BD Biosciences). After incubation, the samples were washed twice with phosphate-buffered saline (PBS) and resuspended with 300 microliters of PBS. For the control group, the corresponding isotype-matched antibody was used for each staining. Labeled cells were quantified by flow cytometry (BD Biosciences). Flow cytometry data were analyzed with Flowjo10 software. Tissue collection and preparation Arthroscopic tendon repair was performed using a standard three-door technique as previously described. The subscapularis tendon was collected arthroscopically from the superior border of the tendon 1 cm lateral to the glenoid cavity, and the suprascapular tendon was removed 1.5 cm from the tear edge before surgical repair. The tissues were divided into two aliquots, and one of the tissue specimens was placed in 4% formalin and fixed for 4 to 6 hours, followed by paraffin embedding for HampE staining. One milliliter of TRIzol (Invitrogen, USA) was then added to another specimen, which was cryopreserved at − 80 ° C for extraction of total RNA. Histological examination The tendons were fixed in 4% paraformaldehyde, dehydrated and embedded in paraffin. The tissue was cut into 4-µm-thick sections and stained with hematoxylin and eosin (H&E) for evaluation of inflammation. Inflammation in H&E-stained tendon sections was evaluated by five independent, blinded readers according to a semiquantitative scoring system. The results were calculated as the percentage of positive cells in each group. Data are presented as medians (range). All experiments were performed three times. RNA extraction and fluorescence quantitative PCR Total RNA from tendon tissue was extracted with TRIzol in strict accordance with the instructions, and the concentration and purity of RNA were measured by a NanoDrop 2000c and diluted to 500 ng/microliter per specimen with RNase-free water. Subsequently, equal amounts of RNA were analyzed by quantitative fluorescence PCR using the SYBR Green Premix EX Taq kit. Each RNA sample was tested for relative expression of CD45, RORC, IL-23, IL-22, and IL-17A mRNA and normalized to β -actin as a housekeeping gene, with comparative threshold cycles calculated with the Ct value method. All sequences of primers are shown in Table 1 . Each sample was analyzed in duplicate with the CFXA96 Cycler (Thermal). Table 1 The primer sequences for RT-PCR Gene Sequence (5’-3’) Accession D45 Fwd: GTGAGGCGTCTGTACTGATG NM_002838 Rev: ACGGCTGACTTCCAGATATG ICOS Fwd: GGCATGAGAATGGTCCAAGT NM_012092 Rev: CATGAAGTCAGGCCTCTGGT IL-23R Fwd: TGATGGATGCTAFGAGTATT AF461422.1 Rev: -AGTCT TCTGGGTGGCA GTGAT IL-23 Fwd: ACAGAGAGAATCAGGCTCA NM_016584.2 Rev: GGTACACAGGGTGATCA IL-22 Fwd: CAGGCTCAGCAACAGGCTAA NM_020525.4 Rev: TGATCTCTCCACTCTCTCCAAGC IL-17A Fwd: CCTGGAGGCCATAGTGAAGG NM_002190.2 Rev: TTCCGGTTATGGATGTTCAGG RORC Fwd: CCGAGATGCTGTCAAGTTCG G NM_001001523.1 Rev: GTTCCTGTTGCTGCTGTTGC β-Actin Fwd: TGGCACCCAGCACAATGAA XM_005249820.1 Rev: TAAGTCATAGTCCGCCTAGAAGC Statistical analysis All data were statistically analyzed using Prism 5 (Graph Pad Software, La Jolla, CA, USA), and the data are expressed as the mean ± standard deviation. Student's unpaired t-test was used for difference analysis, Spearman's analysis was used for correlation analysis between two variables, and the difference was statistically significant when the p value was less than 0.05. Results Lesion tendons show infiltration of inflammatory cells compared to control tendons To verify the infiltration of inflammatory cells in the diseased tendons, H&E staining was performed on the tendons of healthy controls and patients with tendinopathy in this study, and the results are shown in Fig. 1 . The tendons of patients with tendinopathy showed more significant infiltration of inflammatory cells. There was no significant difference in the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy compared with controls To verify whether ILC3s differ in the peripheral blood of patients with tendinopathy, we examined the relative and absolute numbers of ILC3s in the periphery circulation of 15 patients with tendinopathy and 10 healthy controls. The gating strategy of ILC3s in PBMCs is shown in Fig. 2 A. In this study, the proportion of ILC3s was expressed by the percentage of Lin − IL2R + IL-23R + . Our findings show that ILC3s are associated with Lin − (B) relative to healthy controls, there were no significant differences in the proportions of lymphocytes (C) and total PBMCs (D). Expression levels of ILC3s-Associated surface Markers in tendon samples We then examined the expression of CD45 antigen on all leukocytes, and the results are shown in Fig. 3 A, where the mRNA expression level of CD45 was upregulated in the diseased tendons relative to healthy controls. Additionally, the expression of IL-23R, the surface marker receptor of ILC3s, was also consistent with CD45, showing a trend of upregulation (Fig. 3 B). We also examined the expression of ICOS, a marker associated with lymphocyte activation, and showed that the mRNA expression level of ICOS in diseased tendons was also upregulated relative to healthy controls. Since IL-23 is considered to be an activator of ILC3s, we also examined the expression levels of IL-23, consistent with the expression of its receptor IL-23R, and showed that the mRNA expression levels of IL-23 were upregulated in diseased tendons. Expression levels of ILC3s-related inflammatory factors and transcription factors in tendon samples Since IL-17A and IL-22 are characteristic inflammatory factors secreted by ILC3s, RORC is a characteristic transcription factor of ILC3s. We then examined the mRNA expression levels of IL-17A, IL-22, and RORC, and the results showed that the expression levels of IL-17A (A), IL-22 (B), and RORC (C) in the diseased tendons showed a tendency to be upregulated compared with healthy controls. Discussion In this study, we observed that although the proportion of ILC3s in the peripheral blood circulation of tendinopathy patients was not significantly different from that of healthy controls, the expression levels of surface molecules characteristic of ILC3s (CD45, ICOS, IL-23R), related inflammatory factors (IL-17A and IL-22), and their characteristic transcription factors (RORC) tended to be upregulated in diseased tendon tissues. Soft tissue lesions of the shoulder such as tendinopathy cause pain, loss of function, joint failure, and the development of secondary osteoarthritis, resulting in a huge social and economic burden[ 16 ]. Identification of key immune cell populations that act as master regulators in this inflammatory process will advance our understanding of its pathogenic mechanisms. Accumulating evidence supports the contribution of inflammation in the development of tendinopathy[ 17 ]. Recent studies have highlighted the importance of the innate immune response during the persistence of inflammation[ 18 ]. As a newly discovered class of innate immune cells, the role of ILC3s in the development of tendinopathy remains to be examined. Researchers have found that ILC3s are involved in promoting the development of rheumatoid arthritis[ 19 ]. IL-17A secreted by Th17 cells is also a characteristic cytokine of ILC3s, and when IL-17A stimulates tenocytes, tenocytes produce large amounts of TNF-α, MIP-1α, IL-6, IL-8 and MCP-1, and tenocyte apoptosis is increased[ 6 ]. Meanwhile, ILC3s have been found to be present in tendon soft tissues. We collected peripheral blood and tendon tissues from patients who met the diagnostic criteria for tendinopathy and control patients and then examined the infiltration of inflammatory cells in tendon tissues from these tendinopathy patients and control patients (Fig. 1 ) and the proportion of ILC3s in the peripheral blood circulation (Fig. 2 A). Interestingly, although the proportion of ILC3s in the peripheral blood circulation of tendinopathy patients was not significantly different from that of control patients (Fig. 2 B-D), HampE sections showed that more inflammatory cells were infiltrated in the tendon tissue of tendinopathy patients (Fig. 1 ). Considering that tendinopathy is a local inflammatory response, and previous inflammation suggested that the proportion of ILC3s in tendon soft tissue was higher than its proportion in the peripheral blood, we then examined the relevant surface markers of ILC3s in tendon tissue. ILC is defined by characteristic antigens expressed on its surface, characteristic cytokines secreted by it, and specific transcription factors. For example, human ILC1s express CD56 to secrete IFN-γ, and their transcription factor is T-beta [ 20 ]; ILC2s express CRTH2 to secrete IL-13, and their transcription factor is RORA [ 21 ]; and ILC3s express IL-23R, secrete IL-17A, and their transcription factor is RORC [ 22 ]. As shown in Fig. 3 A and B, the expression of CD45, a common leukocyte differentiation marker, was upregulated; additionally, the expression of IL-23R, a surface marker of ILC3s, was also upregulated relative to tendon tissues from control patients. Furthermore, as an activation marker of leukocytes, the expression of ICOS in tendon tissues from tendinopathy patients also tended to be consistent with that of IL-23R (Fig. 3 C). The expression of IL-23, a cytokine that activates ILC3s, was also upregulated in tendon tissues from patients with tendinopathy (Fig. 3 D). The flow staining protocol for ILC3s consists of a variety of protocols. In this study, our staining protocol defines ILC3s as Lin − IL-2R + IL-23R + , which is commonly used in the flow cytometry detection of ILC3s[ 22 ]. These Lin − IL-2R + IL-23R + cells may include two populations of cells, namely, NKp44 + ILC3s and NKp44 − ILC3s; however, according to previous studies, NKp44 + mainly secretes IL-17A, and NKp44 − ILC3s mainly secretes IL-22. Therefore, we then examined the expression of these two cytokines. As shown in Fig. 4 A and B, the expression levels of IL-17A and IL-22 were upregulated in the tendon tissue of patients with tendinopathy, suggesting that both NKp44 + ILC3s and NKp44 − ILC3s were upregulated in the tendon tissue of patients with tendinopathy. As a characteristic transcription factor of ILC3s, RORC also maintained a consistent trend of upregulation with IL-17A and IL-22 (Fig. 4 C). Based on these results, we propose that ILC3s are potential immune factors for tendon sheath lesions. A better insight into the mechanisms by which ILC3s are involved in lesion development may advance the development of cell-targeted therapeutic modalities for early tendon disorders in humans. Abbreviations ILC3s: Group 3 Innate Lymphoid Cells; IL-23: Interleukin-23; IL-17A: Interleukin-17A; IL-22: Interleukin-22; RORC: RAR Related Orphan Receptor C; ICOS: Inducible T Cell Costimulator. Declarations Acknowledgements Not applicable Funding This work was supported by grants from the National Natural Science Foundation of China (grant 81801568), the National Science Foundation for Post-doctoral Scientists of China (grant 2018M642314), the Postdoctoral Science Foundation of Jiangsu Province (grant 2018K235C), the Changzhou Science and Technology Project (Applied Based Research, No. CJ20180035), and the Young Talent Development Plan of Changzhou Health Commission(CZQM2020009). Availability of data and materials The datasets generated/analyzed during the current study are available Authors’ contributions Peng Xu performed all the experiments and prepared the initial draft of the manuscript. Yumin Wu performed the data analysis and supervised all the studies. All authors reviewed, edited, and approved the final content of the manuscript. Competing interests The authors declare that they have no competing interests. Consent for publication All patients consent to publish patient-identifiable information and the obtained data. Ethics approval and consent participate This study was conducted in accordance with the Declaration of Helsinki. This study was conducted with approval from the Ethics Committee of the Third Affiliated Hospital of Soochow University. Written informed consent to participate was obtained from all the participants. References Kannus P and Natri A. Etiology and pathophysiology of tendon ruptures in sports. Scand J Med Sci Sports 1997; 7: 107-112. Inamo J, Kaneko Y and Takeuchi T. Inflammatory tenosynovitis and enthesitis induced by immune checkpoint inhibitor treatment. Clin Rheumatol 2018; 37: 1107-1110. Tsuzaki M, Guyton G, Garrett W, Archambault JM, Herzog W, Almekinders L, Bynum D, Yang X and Banes AJ. IL-1 beta induces COX2, MMP-1, -3 and -13, ADAMTS-4, IL-1 beta and IL-6 in human tendon cells. J Orthop Res 2003; 21: 256-264. John T, Lodka D, Kohl B, Ertel W, Jammrath J, Conrad C, Stoll C, Busch C and Schulze-Tanzil G. Effect of pro-inflammatory and immunoregulatory cytokines on human tenocytes. J Orthop Res 2010; 28: 1071-1077. Blake SJ and Teng MW. Role of IL-17 and IL-22 in autoimmunity and cancer. Actas Dermosifiliogr 2014; 105 Suppl 1: 41-50. Millar NL, Akbar M, Campbell AL, Reilly JH, Kerr SC, McLean M, Frleta-Gilchrist M, Fazzi UG, Leach WJ, Rooney BP, Crowe LA, Murrell GA and McInnes IB. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy. Sci Rep 2016; 6: 27149. Liu Y, Song Y, Lin D, Lei L, Mei Y, Jin Z, Gong H, Zhu Y, Hu B, Zhang Y, Zhao L, Teo HY, Qiu J, Jiang W, Dong C, Wu D, Huang Y and Liu H. NCR(-) group 3 innate lymphoid cells orchestrate IL-23/IL-17 axis to promote hepatocellular carcinoma development. EBioMedicine 2019; 41: 333-344. McKenzie ANJ, Spits H and Eberl G. Innate lymphoid cells in inflammation and immunity. Immunity 2014; 41: 366-374. Klose CSN, Flach M, Möhle L, Rogell L, Hoyler T, Ebert K, Fabiunke C, Pfeifer D, Sexl V, Fonseca-Pereira D, Domingues RG, Veiga-Fernandes H, Arnold SJ, Busslinger M, Dunay IR, Tanriver Y and Diefenbach A. Differentiation of type 1 ILCs from a common progenitor to all helper-like innate lymphoid cell lineages. Cell 2014; 157: 340-356. Drake LY, Iijima K, Bartemes K and Kita H. Group 2 Innate Lymphoid Cells Promote an Early Antibody Response to a Respiratory Antigen in Mice. J Immunol 2016; 197: 1335-1342. Cuthbert RJ, Fragkakis EM, Dunsmuir R, Li Z, Coles M, Marzo-Ortega H, Giannoudis PV, Jones E, El-Sherbiny YM and McGonagle D. Brief Report: Group 3 Innate Lymphoid Cells in Human Enthesis. Arthritis Rheumatol 2017; 69: 1816-1822. Wang S, Xia P, Chen Y, Qu Y, Xiong Z, Ye B, Du Y, Tian Y, Yin Z, Xu Z and Fan Z. Regulatory Innate Lymphoid Cells Control Innate Intestinal Inflammation. Cell 2017; 171: 201-216.e218. Engelbertsen D and Lichtman AH. Innate lymphoid cells in atherosclerosis. Eur J Pharmacol 2017; 816: 32-36. Geremia A, Arancibia-Cárcamo CV, Fleming MP, Rust N, Singh B, Mortensen NJ, Travis SP and Powrie F. IL-23-responsive innate lymphoid cells are increased in inflammatory bowel disease. J Exp Med 2011; 208: 1127-1133. Forkel M, Berglin L, Kekäläinen E, Carlsson A, Svedin E, Michaëlsson J, Nagasawa M, Erjefält JS, Mori M, Flodström-Tullberg M, Bergquist A, Ljunggren HG, Westgren M, Lindforss U, Friberg D, Jorns C, Ellis E, Björkström NK and Mjösberg J. Composition and functionality of the intrahepatic innate lymphoid cell-compartment in human nonfibrotic and fibrotic livers. Eur J Immunol 2017; 47: 1280-1294. Varacallo M, Seaman TJ and Mair SD. Biceps Tendon Dislocation and Instability. In: editors. StatPearls. Treasure Island (FL): StatPearls Publishing Copyright © 2020, StatPearls Publishing LLC.; 2020. p. D'Addona A, Maffulli N, Formisano S and Rosa D. Inflammation in tendinopathy. Surgeon 2017; 15: 297-302. Horiguchi H, Loftus TJ, Hawkins RB, Raymond SL, Stortz JA, Hollen MK, Weiss BP, Miller ES, Bihorac A, Larson SD, Mohr AM, Brakenridge SC, Tsujimoto H, Ueno H, Moore FA, Moldawer LL and Efron PA. Innate Immunity in the Persistent Inflammation, Immunosuppression, and Catabolism Syndrome and Its Implications for Therapy. Front Immunol 2018; 9: 595. Takaki-Kuwahara A, Arinobu Y, Miyawaki K, Yamada H, Tsuzuki H, Irino K, Ayano M, Kimoto Y, Mitoma H, Akahoshi M, Tsukamoto H, Horiuchi T, Niiro H and Akashi K. CCR6+ group 3 innate lymphoid cells accumulate in inflamed joints in rheumatoid arthritis and produce Th17 cytokines. Arthritis Res Ther 2019; 21: 198. Spits H, Bernink JH and Lanier L. NK cells and type 1 innate lymphoid cells: partners in host defense. Nat Immunol 2016; 17: 758-764. Klein Wolterink RG, Kleinjan A, van Nimwegen M, Bergen I, de Bruijn M, Levani Y and Hendriks RW. Pulmonary innate lymphoid cells are major producers of IL-5 and IL-13 in murine models of allergic asthma. Eur J Immunol 2012; 42: 1106-1116. Schulz-Kuhnt A, Wirtz S, Neurath MF and Atreya I. Regulation of Human Innate Lymphoid Cells in the Context of Mucosal Inflammation. Front Immunol 2020; 11: 1062. Supplementary Files Cover.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-72214","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":2270744,"identity":"d54d5d30-2c4f-4cee-81d2-db01ca83b274","order_by":0,"name":"Peng Xu","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Xu","suffix":""},{"id":2270745,"identity":"25ad2572-5d4d-4a24-8cbb-9f6abf8bec87","order_by":1,"name":"Jiawei Yue","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University: Changzhou First People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiawei","middleName":"","lastName":"Yue","suffix":""},{"id":2270746,"identity":"fd94da8d-324b-48ec-ba65-c668a6b9beaf","order_by":2,"name":"Xu Xu","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University: Changzhou First People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Xu","suffix":""},{"id":2270747,"identity":"26fcc916-4358-4976-98c6-ab42b1dcf227","order_by":3,"name":"Yumin Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYNACAwYeNmbmgw+AzASitcjwsbMlG0C1MDYQo8lGjp9HTYIoLQY3csykbhTcATqMh62ap8Iuj0G6+fgDQlqkcwyeAbXwHrvNcya5mEHmWCJeW8wgWg4DtfCl3eZtY05skMgxJFYLj1kx7796oJb8j8RrYeZtOAyyBb/37c88K7aGaGFLlpxz7Hhim0Sa4Qx8WiTbkzfezvlz2F6+//DBD29qqhP7JZIffMCnhYGBwwDOZOIBEmz4lYMA+wM4k/EHYeWjYBSMglEwAgEA/bBEz0sQOAAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-0917-9919","institution":"The Third Affiliated Hospital of Soochow University, Changzhou","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yumin","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2020-09-04 10:51:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-72214/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-72214/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":2418721,"identity":"b06df785-203e-40ff-813b-92e764807197","added_by":"auto","created_at":"2020-09-15 17:13:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":605334,"visible":true,"origin":"","legend":"Lesion tendons show infiltration of inflammatory cells compared to control tendons. ","description":"","filename":"Onlinefigure1.Png","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/Onlinefigure1.Png"},{"id":2418722,"identity":"6b1e0eeb-6ead-4b11-91eb-ebd14f463823","added_by":"auto","created_at":"2020-09-15 17:13:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":123397,"visible":true,"origin":"","legend":"No significant difference in the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy compared with controls. (A) Representative diagrams of flow cytometry analysis for circulating ILC3s. (B) The frequency of ILC3s in Lin- cells (B), lymphocytes (C) and PBMC (D) from patients tendinopathy has no significant difference compared to healthy controls. ","description":"","filename":"Onlinefigure2.Png","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/Onlinefigure2.Png"},{"id":2418723,"identity":"7044c3c5-d24e-4801-9836-96bd1ab117a9","added_by":"auto","created_at":"2020-09-15 17:13:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":77113,"visible":true,"origin":"","legend":"Expression levels of ILC3s-Associated surface Markers in tendon samples. (A) The mRNA expression level of CD45 was upregulated in the diseased tendons compared to healthy controls. (B) The mRNA expression level of IL-23R was upregulated in the diseased tendons compared to healthy controls. (C) The mRNA expression level of ICOS in diseased tendons was upregulated relative to healthy controls. (D) The mRNA expression level of IL-23 in diseased tendons was upregulated relative to healthy controls.","description":"","filename":"OnlineFigure3.Png","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/OnlineFigure3.Png"},{"id":2418724,"identity":"acd680e7-38c7-4dec-ae61-f34abbecba49","added_by":"auto","created_at":"2020-09-15 17:13:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":60026,"visible":true,"origin":"","legend":"Expression levels of ILC3s-related inflammatory factors and transcription factors in tendon samples. (A) The mRNA expression level of IL-17A in diseased tendons was upregulated relative to healthy controls. (B) No significant difference was found of the expression of IL-22 between diseased tendons and healthy controls. (C) The mRNA expression level of RORC in diseased tendons was upregulated relative to healthy controls.","description":"","filename":"OnlineFigure4.Png","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/OnlineFigure4.Png"},{"id":13593625,"identity":"f3326d25-8388-427f-8273-f7551dc1cb41","added_by":"auto","created_at":"2021-09-17 05:16:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2271021,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/80e5f756-fd51-4f22-ace2-3a349948e2de.pdf"},{"id":2418726,"identity":"df284a2c-cab3-44a4-83dc-faddc3bf1c7d","added_by":"auto","created_at":"2020-09-15 17:13:30","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":104333,"visible":true,"origin":"","legend":"","description":"","filename":"Cover.pdf","url":"https://assets-eu.researchsquare.com/files/rs-72214/v1/Cover.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eElevated ILC3s-related Inflammatory Factors may Promote Tendinopathy\u003c/p\u003e","fulltext":[{"header":"Introduction","content":" \u003cp\u003eShoulder pain is a common and serious orthopedic problem in sports injuries and the elderly population and is caused by overuse of tendon injuries, i.e., tendinopathy[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although it has been shown that proinflammatory mediators, such as immune cells[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], play an important role in tendon diseases, their intrinsic pathogenesis remains unclear. In particular, the interaction between immune cells and the initiation and development of tendon injury has not yet been fully elucidated.\u003c/p\u003e \u003cp\u003eThe development and progression of tendon sheath lesions is associated with an imbalance of inflammatory factors, immune cells, and chemical mediators. Previous studies have shown that vigorous immune cells infiltrate the site of tendon injury, and these immune cells subsequently release cytokines, such as IL-1β, IL-6 and TNF-α, which are involved in the processes of tendon injury and repair[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. IL-17A, a member of the IL-17 cytokine family, is a proinflammatory mediator involved in the development of a variety of immune-related diseases[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. It has been reported that IL-17A expression is increased in \"early tendinopathy\" compared to control samples. Additionally, after IL-17A treatment, tenocytes secreted more proinflammatory cytokines and produced more type III collagen[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe previous concept suggested that IL-17A is mainly secreted by Th17 cells; however, newly discovered Group 3 Innate Lymphoid Cells (ILC3s), which are a type of non-B, non-T innate lymphocytes, can also secrete large amounts of IL-17A, and their immune response process is earlier than the adaptive immune response[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Innate lymphocytes play important roles in tissue homeostasis, repair and remodeling[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Unlike adaptive immune cells, ILCs are nonspecific antigens, lack recombinant antigen-specific receptors, and lack dendritic cell phenotypic markers and myeloid cell markers[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. ILCs can be divided into three groups and are based on the designations of helper T cells: (1) Group 1 ILCs (ILC1s) that produce IFN-γ predominately[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]; (2) Group 2 ILCs (ILC2s) that produce type 2 cytokines, especially IL-5 and IL-13 predominately[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]; (3) Group 3 ILCs (ILC3s) that produce IL-17 and/or IL-22 predominately[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]; and regulatory ILCs (ILCreg) that produce IL-10 and TGF-β[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. As a counterpart of Th17 cells, ILC3s have also been confirmed to be involved in the development and progression of various diseases, such as atherosclerosis and inflammatory bowel disease [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In addition, there has been evidence that ILC3s are closely associated with fibrosis[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Interestingly, in donors without systemic inflammatory diseases, the proportion of ILC3s in tendon soft tissue was higher than its proportion in peripheral blood, and this portion of ILC3s secreted large amounts of IL-17 and IL-22 under the stimulation of IL-23[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], creating conditions for the involvement of ILC3s in the process of tendinopathy. However, no article has reported that the process of tendinopathy is associated with ILC3s. In this study, we aimed to test our hypothesis that ILC3s in peripheral blood and related factors of ILC3s in tendon tissue are associated with tendinopathy.\u003c/p\u003e "},{"header":"Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients\u003c/h2\u003e \u003cp\u003eThis study was conducted at the Third Affiliated Hospital of Soochow University (Changzhou, China). It was reviewed and approved by the Ethics Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China) and was conducted according to standard surgical procedures with informed consent. Fifteen tendon samples were collected from patients with shoulder cuff tears undergoing shoulder surgery. The mean age was 52\u0026nbsp;years (range, 35\u0026ndash;67). Only patients with no clinical evidence of subscapularis tendinopathy on preoperative MRI scans or macroscopic subscapularis tendon injury on arthroscopy were included \u0026mdash; they represent a true preclinical cohort according to these criteria. All patients in this cohort met the following criteria: 1) a history of shoulder pain and dysfunction, 2) no history of surgery in the affected shoulder; 3) no imaging signs of fracture in the shoulder, and 4) no history of rheumatoid or osteoarthritis. Another independent control package consisted of 10 subscapularis tendon samples from patients undergoing shoulder arthroscopy for stabilization of the shoulder, with arthroscopic confirmation of no tendon tear, no history of shoulder surgery, no previous history of rheumatoid or osteoarthritis, no radiographic evidence of shoulder fracture, and a control mean age of 32\u0026nbsp;years (25\u0026ndash;42).\u003c/p\u003e \u003c/div\u003e \n\u003ch2\u003eCell preparation and flow cytometry quantification\u003c/h2\u003e\n \u003cp\u003ePeripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque density gradient centrifugation (GE Healthcare, Tokyo, Japan) and immediately quantified by flow cytometry, and for flow cytometry quantification, the cells were stained with fluorescein-conjugated monoclonal antibodies against the following in strict accordance with the instructions. The following antibodies were used in this study: Anti-Lineage-FITC CD2, CD3, CD14, CD16, CD19, CD56, and CD235a (eBioscience (San Diego, CA, USA), Anti-IL-23R-PE (BioLegend), and Anti-IL-2R-APC (BD Biosciences). After incubation, the samples were washed twice with phosphate-buffered saline (PBS) and resuspended with 300 microliters of PBS. For the control group, the corresponding isotype-matched antibody was used for each staining. Labeled cells were quantified by flow cytometry (BD Biosciences). Flow cytometry data were analyzed with Flowjo10 software.\u003c/p\u003e \n\u003ch2\u003eTissue collection and preparation \u003c/h2\u003e\n \u003cp\u003eArthroscopic tendon repair was performed using a standard three-door technique as previously described. The subscapularis tendon was collected arthroscopically from the superior border of the tendon 1\u0026nbsp;cm lateral to the glenoid cavity, and the suprascapular tendon was removed 1.5\u0026nbsp;cm from the tear edge before surgical repair. The tissues were divided into two aliquots, and one of the tissue specimens was placed in 4% formalin and fixed for 4 to 6 hours, followed by paraffin embedding for HampE staining. One milliliter of TRIzol (Invitrogen, USA) was then added to another specimen, which was cryopreserved at \u0026minus;\u0026thinsp;80 \u0026deg; C for extraction of total RNA.\u003c/p\u003e \n\u003ch2\u003eHistological examination\u003c/h2\u003e\n \u003cp\u003eThe tendons were fixed in 4% paraformaldehyde, dehydrated and embedded in paraffin. The tissue was cut into 4-\u0026micro;m-thick sections and stained with hematoxylin and eosin (H\u0026amp;E) for evaluation of inflammation. Inflammation in H\u0026amp;E-stained tendon sections was evaluated by five independent, blinded readers according to a semiquantitative scoring system. The results were calculated as the percentage of positive cells in each group. Data are presented as medians (range). All experiments were performed three times.\u003c/p\u003e \n\u003ch2\u003eRNA extraction and fluorescence quantitative PCR \u003c/h2\u003e\n \u003cp\u003eTotal RNA from tendon tissue was extracted with TRIzol in strict accordance with the instructions, and the concentration and purity of RNA were measured by a NanoDrop 2000c and diluted to 500\u0026nbsp;ng/microliter per specimen with RNase-free water. Subsequently, equal amounts of RNA were analyzed by quantitative fluorescence PCR using the SYBR Green Premix EX Taq kit. Each RNA sample was tested for relative expression of CD45, RORC, IL-23, IL-22, and IL-17A mRNA and normalized to \u003cem\u003eβ\u003c/em\u003e-actin as a housekeeping gene, with comparative threshold cycles calculated with the Ct value method. All sequences of primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each sample was analyzed in duplicate with the CFXA96 Cycler (Thermal).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences for RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eD45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: GTGAGGCGTCTGTACTGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_002838\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: ACGGCTGACTTCCAGATATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eICOS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: GGCATGAGAATGGTCCAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_012092\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: CATGAAGTCAGGCCTCTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-23R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: TGATGGATGCTAFGAGTATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAF461422.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: -AGTCT TCTGGGTGGCA GTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: ACAGAGAGAATCAGGCTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_016584.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: GGTACACAGGGTGATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: CAGGCTCAGCAACAGGCTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_020525.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: TGATCTCTCCACTCTCTCCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: CCTGGAGGCCATAGTGAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_002190.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: TTCCGGTTATGGATGTTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRORC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: CCGAGATGCTGTCAAGTTCG G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001001523.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: GTTCCTGTTGCTGCTGTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFwd: TGGCACCCAGCACAATGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_005249820.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRev: TAAGTCATAGTCCGCCTAGAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \n\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data were statistically analyzed using Prism 5 (Graph Pad Software, La Jolla, CA, USA), and the data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Student's unpaired t-test was used for difference analysis, Spearman's analysis was used for correlation analysis between two variables, and the difference was statistically significant when the p value was less than 0.05.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eLesion tendons show infiltration of inflammatory cells compared to control tendons\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify the infiltration of inflammatory cells in the diseased tendons, H\u0026amp;E staining was performed on the tendons of healthy controls and patients with tendinopathy in this study, and the results are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The tendons of patients with tendinopathy showed more significant infiltration of inflammatory cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThere was no significant difference in the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy compared with controls\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify whether ILC3s differ in the peripheral blood of patients with tendinopathy, we examined the relative and absolute numbers of ILC3s in the periphery circulation of 15 patients with tendinopathy and 10 healthy controls. The gating strategy of ILC3s in PBMCs is shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA. In this study, the proportion of ILC3s was expressed by the percentage of Lin\u003csup\u003e\u0026minus;\u003c/sup\u003eIL2R \u003csup\u003e+\u003c/sup\u003e IL-23R \u003csup\u003e+\u003c/sup\u003e. Our findings show that ILC3s are associated with Lin\u003csup\u003e\u0026minus;\u003c/sup\u003e(B) relative to healthy controls, there were no significant differences in the proportions of lymphocytes (C) and total PBMCs (D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression levels of ILC3s-Associated surface Markers in tendon samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe then examined the expression of CD45 antigen on all leukocytes, and the results are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA, where the mRNA expression level of CD45 was upregulated in the diseased tendons relative to healthy controls. Additionally, the expression of IL-23R, the surface marker receptor of ILC3s, was also consistent with CD45, showing a trend of upregulation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). We also examined the expression of ICOS, a marker associated with lymphocyte activation, and showed that the mRNA expression level of ICOS in diseased tendons was also upregulated relative to healthy controls. Since IL-23 is considered to be an activator of ILC3s, we also examined the expression levels of IL-23, consistent with the expression of its receptor IL-23R, and showed that the mRNA expression levels of IL-23 were upregulated in diseased tendons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression levels of ILC3s-related inflammatory factors and transcription factors in tendon samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince IL-17A and IL-22 are characteristic inflammatory factors secreted by ILC3s, RORC is a characteristic transcription factor of ILC3s. We then examined the mRNA expression levels of IL-17A, IL-22, and RORC, and the results showed that the expression levels of IL-17A (A), IL-22 (B), and RORC (C) in the diseased tendons showed a tendency to be upregulated compared with healthy controls.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we observed that although the proportion of ILC3s in the peripheral blood circulation of tendinopathy patients was not significantly different from that of healthy controls, the expression levels of surface molecules characteristic of ILC3s (CD45, ICOS, IL-23R), related inflammatory factors (IL-17A and IL-22), and their characteristic transcription factors (RORC) tended to be upregulated in diseased tendon tissues.\u003c/p\u003e\n\u003cp\u003eSoft tissue lesions of the shoulder such as tendinopathy cause pain, loss of function, joint failure, and the development of secondary osteoarthritis, resulting in a huge social and economic burden[\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]. Identification of key immune cell populations that act as master regulators in this inflammatory process will advance our understanding of its pathogenic mechanisms. Accumulating evidence supports the contribution of inflammation in the development of tendinopathy[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]. Recent studies have highlighted the importance of the innate immune response during the persistence of inflammation[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. As a newly discovered class of innate immune cells, the role of ILC3s in the development of tendinopathy remains to be examined.\u003c/p\u003e\n\u003cp\u003eResearchers have found that ILC3s are involved in promoting the development of rheumatoid arthritis[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]. IL-17A secreted by Th17 cells is also a characteristic cytokine of ILC3s, and when IL-17A stimulates tenocytes, tenocytes produce large amounts of TNF-\u0026alpha;, MIP-1\u0026alpha;, IL-6, IL-8 and MCP-1, and tenocyte apoptosis is increased[\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]. Meanwhile, ILC3s have been found to be present in tendon soft tissues.\u003c/p\u003e\n\u003cp\u003eWe collected peripheral blood and tendon tissues from patients who met the diagnostic criteria for tendinopathy and control patients and then examined the infiltration of inflammatory cells in tendon tissues from these tendinopathy patients and control patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) and the proportion of ILC3s in the peripheral blood circulation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Interestingly, although the proportion of ILC3s in the peripheral blood circulation of tendinopathy patients was not significantly different from that of control patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB-D), HampE sections showed that more inflammatory cells were infiltrated in the tendon tissue of tendinopathy patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Considering that tendinopathy is a local inflammatory response, and previous inflammation suggested that the proportion of ILC3s in tendon soft tissue was higher than its proportion in the peripheral blood, we then examined the relevant surface markers of ILC3s in tendon tissue. ILC is defined by characteristic antigens expressed on its surface, characteristic cytokines secreted by it, and specific transcription factors. For example, human ILC1s express CD56 to secrete IFN-\u0026gamma;, and their transcription factor is T-beta [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]; ILC2s express CRTH2 to secrete IL-13, and their transcription factor is RORA [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]; and ILC3s express IL-23R, secrete IL-17A, and their transcription factor is RORC [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and B, the expression of CD45, a common leukocyte differentiation marker, was upregulated; additionally, the expression of IL-23R, a surface marker of ILC3s, was also upregulated relative to tendon tissues from control patients. Furthermore, as an activation marker of leukocytes, the expression of ICOS in tendon tissues from tendinopathy patients also tended to be consistent with that of IL-23R (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). The expression of IL-23, a cytokine that activates ILC3s, was also upregulated in tendon tissues from patients with tendinopathy (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003eThe flow staining protocol for ILC3s consists of a variety of protocols. In this study, our staining protocol defines ILC3s as Lin\u003csup\u003e\u0026minus;\u003c/sup\u003eIL-2R\u003csup\u003e+\u003c/sup\u003eIL-23R\u003csup\u003e+\u003c/sup\u003e, which is commonly used in the flow cytometry detection of ILC3s[\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. These Lin\u003csup\u003e\u0026minus;\u003c/sup\u003eIL-2R\u003csup\u003e+\u003c/sup\u003eIL-23R\u003csup\u003e+\u003c/sup\u003ecells may include two populations of cells, namely, NKp44\u003csup\u003e+\u003c/sup\u003e ILC3s and NKp44\u003csup\u003e\u0026minus;\u003c/sup\u003e ILC3s; however, according to previous studies, NKp44\u003csup\u003e+\u003c/sup\u003e mainly secretes IL-17A, and NKp44\u003csup\u003e\u0026minus;\u003c/sup\u003e ILC3s mainly secretes IL-22. Therefore, we then examined the expression of these two cytokines. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B, the expression levels of IL-17A and IL-22 were upregulated in the tendon tissue of patients with tendinopathy, suggesting that both NKp44\u003csup\u003e+\u003c/sup\u003e ILC3s and NKp44\u003csup\u003e\u0026minus;\u003c/sup\u003e ILC3s were upregulated in the tendon tissue of patients with tendinopathy. As a characteristic transcription factor of ILC3s, RORC also maintained a consistent trend of upregulation with IL-17A and IL-22 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\n\u003cp\u003eBased on these results, we propose that ILC3s are potential immune factors for tendon sheath lesions. A better insight into the mechanisms by which ILC3s are involved in lesion development may advance the development of cell-targeted therapeutic modalities for early tendon disorders in humans.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eILC3s: Group 3 Innate Lymphoid Cells; IL-23: Interleukin-23; IL-17A: Interleukin-17A; IL-22: Interleukin-22; RORC: RAR Related Orphan Receptor C; ICOS: Inducible T Cell Costimulator.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (grant 81801568), the National\u0026nbsp;Science\u0026nbsp;Foundation\u0026nbsp;for\u0026nbsp;Post-doctoral Scientists\u0026nbsp;of\u0026nbsp;China\u0026nbsp;(grant 2018M642314), the Postdoctoral Science Foundation of Jiangsu Province (grant 2018K235C), the Changzhou Science and Technology Project (Applied Based Research, No. CJ20180035), and the Young Talent Development Plan of Changzhou Health Commission(CZQM2020009).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated/analyzed during the current study are available\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeng Xu performed all the experiments and prepared the initial draft of the manuscript. Yumin Wu performed the data analysis and supervised all the studies. All authors reviewed, edited, and approved the final content of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll patients consent to publish patient-identifiable information and the obtained data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in accordance with the Declaration of Helsinki. This study was conducted with approval from the Ethics Committee of the Third Affiliated Hospital of Soochow University. Written informed consent to participate was obtained from all the participants.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKannus P and Natri A. Etiology and pathophysiology of tendon ruptures in sports. Scand J Med Sci Sports 1997; 7: 107-112.\u003c/li\u003e\n\u003cli\u003eInamo J, Kaneko Y and Takeuchi T. Inflammatory tenosynovitis and enthesitis induced by immune checkpoint inhibitor treatment. Clin Rheumatol 2018; 37: 1107-1110.\u003c/li\u003e\n\u003cli\u003eTsuzaki M, Guyton G, Garrett W, Archambault JM, Herzog W, Almekinders L, Bynum D, Yang X and Banes AJ. IL-1 beta induces COX2, MMP-1, -3 and -13, ADAMTS-4, IL-1 beta and IL-6 in human tendon cells. J Orthop Res 2003; 21: 256-264.\u003c/li\u003e\n\u003cli\u003eJohn T, Lodka D, Kohl B, Ertel W, Jammrath J, Conrad C, Stoll C, Busch C and Schulze-Tanzil G. Effect of pro-inflammatory and immunoregulatory cytokines on human tenocytes. J Orthop Res 2010; 28: 1071-1077.\u003c/li\u003e\n\u003cli\u003eBlake SJ and Teng MW. Role of IL-17 and IL-22 in autoimmunity and cancer. Actas Dermosifiliogr 2014; 105 Suppl 1: 41-50.\u003c/li\u003e\n\u003cli\u003eMillar NL, Akbar M, Campbell AL, Reilly JH, Kerr SC, McLean M, Frleta-Gilchrist M, Fazzi UG, Leach WJ, Rooney BP, Crowe LA, Murrell GA and McInnes IB. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy. Sci Rep 2016; 6: 27149.\u003c/li\u003e\n\u003cli\u003eLiu Y, Song Y, Lin D, Lei L, Mei Y, Jin Z, Gong H, Zhu Y, Hu B, Zhang Y, Zhao L, Teo HY, Qiu J, Jiang W, Dong C, Wu D, Huang Y and Liu H. NCR(-) group 3 innate lymphoid cells orchestrate IL-23/IL-17 axis to promote hepatocellular carcinoma development. EBioMedicine 2019; 41: 333-344.\u003c/li\u003e\n\u003cli\u003eMcKenzie ANJ, Spits H and Eberl G. Innate lymphoid cells in inflammation and immunity. Immunity 2014; 41: 366-374.\u003c/li\u003e\n\u003cli\u003eKlose CSN, Flach M, M\u0026ouml;hle L, Rogell L, Hoyler T, Ebert K, Fabiunke C, Pfeifer D, Sexl V, Fonseca-Pereira D, Domingues RG, Veiga-Fernandes H, Arnold SJ, Busslinger M, Dunay IR, Tanriver Y and Diefenbach A. Differentiation of type 1 ILCs from a common progenitor to all helper-like innate lymphoid cell lineages. Cell 2014; 157: 340-356.\u003c/li\u003e\n\u003cli\u003eDrake LY, Iijima K, Bartemes K and Kita H. Group 2 Innate Lymphoid Cells Promote an Early Antibody Response to a Respiratory Antigen in Mice. J Immunol 2016; 197: 1335-1342.\u003c/li\u003e\n\u003cli\u003eCuthbert RJ, Fragkakis EM, Dunsmuir R, Li Z, Coles M, Marzo-Ortega H, Giannoudis PV, Jones E, El-Sherbiny YM and McGonagle D. Brief Report: Group 3 Innate Lymphoid Cells in Human Enthesis. Arthritis Rheumatol 2017; 69: 1816-1822.\u003c/li\u003e\n\u003cli\u003eWang S, Xia P, Chen Y, Qu Y, Xiong Z, Ye B, Du Y, Tian Y, Yin Z, Xu Z and Fan Z. Regulatory Innate Lymphoid Cells Control Innate Intestinal Inflammation. Cell 2017; 171: 201-216.e218.\u003c/li\u003e\n\u003cli\u003eEngelbertsen D and Lichtman AH. Innate lymphoid cells in atherosclerosis. Eur J Pharmacol 2017; 816: 32-36.\u003c/li\u003e\n\u003cli\u003eGeremia A, Arancibia-C\u0026aacute;rcamo CV, Fleming MP, Rust N, Singh B, Mortensen NJ, Travis SP and Powrie F. IL-23-responsive innate lymphoid cells are increased in inflammatory bowel disease. J Exp Med 2011; 208: 1127-1133.\u003c/li\u003e\n\u003cli\u003eForkel M, Berglin L, Kek\u0026auml;l\u0026auml;inen E, Carlsson A, Svedin E, Micha\u0026euml;lsson J, Nagasawa M, Erjef\u0026auml;lt JS, Mori M, Flodstr\u0026ouml;m-Tullberg M, Bergquist A, Ljunggren HG, Westgren M, Lindforss U, Friberg D, Jorns C, Ellis E, Bj\u0026ouml;rkstr\u0026ouml;m NK and Mj\u0026ouml;sberg J. Composition and functionality of the intrahepatic innate lymphoid cell-compartment in human nonfibrotic and fibrotic livers. Eur J Immunol 2017; 47: 1280-1294.\u003c/li\u003e\n\u003cli\u003eVaracallo M, Seaman TJ and Mair SD. Biceps Tendon Dislocation and Instability. In: editors. StatPearls.\u0026nbsp; Treasure Island (FL): StatPearls Publishing\u0026nbsp;Copyright \u0026copy; 2020, StatPearls Publishing LLC.; 2020. p.\u003c/li\u003e\n\u003cli\u003eD'Addona A, Maffulli N, Formisano S and Rosa D. Inflammation in tendinopathy. Surgeon 2017; 15: 297-302.\u003c/li\u003e\n\u003cli\u003eHoriguchi H, Loftus TJ, Hawkins RB, Raymond SL, Stortz JA, Hollen MK, Weiss BP, Miller ES, Bihorac A, Larson SD, Mohr AM, Brakenridge SC, Tsujimoto H, Ueno H, Moore FA, Moldawer LL and Efron PA. Innate Immunity in the Persistent Inflammation, Immunosuppression, and Catabolism Syndrome and Its Implications for Therapy. Front Immunol 2018; 9: 595.\u003c/li\u003e\n\u003cli\u003eTakaki-Kuwahara A, Arinobu Y, Miyawaki K, Yamada H, Tsuzuki H, Irino K, Ayano M, Kimoto Y, Mitoma H, Akahoshi M, Tsukamoto H, Horiuchi T, Niiro H and Akashi K. CCR6+ group 3 innate lymphoid cells accumulate in inflamed joints in rheumatoid arthritis and produce Th17 cytokines. Arthritis Res Ther 2019; 21: 198.\u003c/li\u003e\n\u003cli\u003eSpits H, Bernink JH and Lanier L. NK cells and type 1 innate lymphoid cells: partners in host defense. Nat Immunol 2016; 17: 758-764.\u003c/li\u003e\n\u003cli\u003eKlein Wolterink RG, Kleinjan A, van Nimwegen M, Bergen I, de Bruijn M, Levani Y and Hendriks RW. Pulmonary innate lymphoid cells are major producers of IL-5 and IL-13 in murine models of allergic asthma. Eur J Immunol 2012; 42: 1106-1116.\u003c/li\u003e\n\u003cli\u003eSchulz-Kuhnt A, Wirtz S, Neurath MF and Atreya I. Regulation of Human Innate Lymphoid Cells in the Context of Mucosal Inflammation. Front Immunol 2020; 11: 1062.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Tendinopathy, ILC3s, IL-17A, IL-22","lastPublishedDoi":"10.21203/rs.3.rs-72214/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-72214/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The prevalence of tendinopathy has risen dramatically over the last few decades and has become a common and serious orthopedic problem in sports injury and elderly populations. Immune cells have been shown to be associated with tendinopathy, with the percentage of Group 3 Innate Lymphoid Cells (ILC3s) having been shown to be upregulated in tendon tissue compared with peripheral blood. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eWe used flow cytometry to investigate the percentage of circulating ILC3s in patients with tendinopathy and controls patients; Realtime-PCR was performed to detect the mRNA levels of ILC3s surface markers, CD45, IL-23R, ICOS and ILC3s-related inflammatory factors and transcription factors IL-17A, IL-22 and RORC in tendon samples. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eOur results showed that the proportion of ILC3s in the peripheral blood circulation of patients with tendinopathy has no significant difference from that of controls by flow cytometry for Lin\u003csup\u003e‑\u003c/sup\u003eIL-2R\u003csup\u003e+\u003c/sup\u003eIL-23R\u003csup\u003e + \u003c/sup\u003ecells; however, the surface marker of ILC3s was upregulated in tendon tissue. In addition, IL-23, a characteristic activating factor of ILC3s, was also upregulated. Relative mRNA expression levels of IL-17A and IL-22 were also upregulated in tendinopathy tendon tissue compared to control patients. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThese results suggest that ILC3s may be a potential immune factor for tendinopathy.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Elevated ILC3s-related Inflammatory Factors may Promote Tendinopathy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-09-15 17:13:27","doi":"10.21203/rs.3.rs-72214/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"79ab4055-f128-49ae-b796-9c52cc20931f","owner":[],"postedDate":"September 15th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":515913,"name":"Orthopedics"},{"id":515914,"name":"Orthopedic Surgery"}],"tags":[],"updatedAt":"2020-09-24T22:29:46+00:00","versionOfRecord":[],"versionCreatedAt":"2020-09-15 17:13:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-72214","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-72214","identity":"rs-72214","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0