Lactobacillus paracasei LCQ-1 Exhibits Good Safety and Effectively Prevents Escherichia coli K99-Induced Diarrhea in Mice

preprint OA: closed CC-BY-4.0

Abstract

Abstract Escherichia coli is a common pathogen causing diarrhea in livestock and poultry, posing a serious threat to intestinal health and leading to significant economic losses in the animal husbandry industry. While antibiotics have been used to treat Escherichia coli diarrhea, their numerous drawbacks have led to increasing attention on probiotic interventions. In this study, Lactobacillus paracasei LCQ-1 was isolated from fresh cow dung, and its in vitro and in vivo safety and probiotic properties were evaluated. In vitro experiments demonstrated that Lactobacillus paracasei LCQ-1 exhibited good antimicrobial activity against Escherichia coli K99, along with key probiotic characteristics such as acid production, acid and bile salt tolerance, high-temperature resistance, hydrophobicity, and cell adhesion. Furthermore, it showed no hemolytic activity, gelatinase activity, or mucin-degrading activity, and it only exhibited decarboxylase activity for histamine. While resistant to certain antibiotics, no significant resistance genes were detected, indicating favorable probiotic and safety profiles. In vivo, acute toxicity tests in mice revealed no signs of acute poisoning after 14 days of high-dose oral administration. A 28-day oral toxicity test showed that different doses did not affect organ indices, cause bacterial translocation, alter blood biochemical parameters, or damage the ileum. In the infection protection experiment, oral administration of Lactobacillus paracasei LCQ-1 significantly increased the survival rate of Escherichia coli K99-infected mice from 50–80%. In conclusion, Lactobacillus paracasei LCQ-1 demonstrated excellent safety and probiotic properties both in vitro and in vivo, and shows promising potential in preventing and treating Escherichia coli K99 infections, with possible applications in animal health management.
Full text 240,623 characters · extracted from preprint-html · click to expand
Lactobacillus paracasei LCQ-1 Exhibits Good Safety and Effectively Prevents Escherichia coli K99-Induced Diarrhea in Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lactobacillus paracasei LCQ-1 Exhibits Good Safety and Effectively Prevents Escherichia coli K99-Induced Diarrhea in Mice Fengjie Wang, Li Chen, Yang Li, Guangping Gao, Yanan Wang, Ruili Shi, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5742040/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Apr, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted 9 You are reading this latest preprint version Abstract Escherichia coli is a common pathogen causing diarrhea in livestock and poultry, posing a serious threat to intestinal health and leading to significant economic losses in the animal husbandry industry. While antibiotics have been used to treat Escherichia coli diarrhea, their numerous drawbacks have led to increasing attention on probiotic interventions. In this study, Lactobacillus paracasei LCQ-1 was isolated from fresh cow dung, and its in vitro and in vivo safety and probiotic properties were evaluated. In vitro experiments demonstrated that Lactobacillus paracasei LCQ-1 exhibited good antimicrobial activity against Escherichia coli K99, along with key probiotic characteristics such as acid production, acid and bile salt tolerance, high-temperature resistance, hydrophobicity, and cell adhesion. Furthermore, it showed no hemolytic activity, gelatinase activity, or mucin-degrading activity, and it only exhibited decarboxylase activity for histamine. While resistant to certain antibiotics, no significant resistance genes were detected, indicating favorable probiotic and safety profiles. In vivo, acute toxicity tests in mice revealed no signs of acute poisoning after 14 days of high-dose oral administration. A 28-day oral toxicity test showed that different doses did not affect organ indices, cause bacterial translocation, alter blood biochemical parameters, or damage the ileum. In the infection protection experiment, oral administration of Lactobacillus paracasei LCQ-1 significantly increased the survival rate of Escherichia coli K99-infected mice from 50–80%. In conclusion, Lactobacillus paracasei LCQ-1 demonstrated excellent safety and probiotic properties both in vitro and in vivo, and shows promising potential in preventing and treating Escherichia coli K99 infections, with possible applications in animal health management. Lactobacillus paracasei Escherichia coli Probiotic properties K99 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Escherichia coli ( E.coli ) is one of the common pathogenic bacteria causing diarrhea in livestock and poultry, posing a serious threat to the intestinal health of livestock and poultry[ 1 ]. Diarrhea caused by E.coli is particularly common among young livestock and poultry such as piglets, calves, and poultry. This is because their immune systems are not yet fully developed, making them vulnerable to infection[ 2 ]. Diarrhea caused by E.coli can lead to dehydration, impaired nutrient absorption, weakened immunity, and even death in livestock and poultry, thereby bringing huge economic losses to the livestock industry. The K99 strain is a serotype of enterotoxigenic E.coli (ETEC) and is one of the main pathogens causing diarrhea in young livestock and poultry such as piglets and calves[ 3 ]. The K99 strain has unique adhesion factors and the ability to produce toxins. It can colonize in the host's intestine and cause severe watery diarrhea, especially being highly pathogenic to young animals aged 1 to 3 weeks. Antibiotics were once the preferred measure for preventing and controlling diarrhea caused by E.coli K99[ 4 ]. However, the overuse of antibiotics poses a potential threat to both public health and animal health. Therefore, it is necessary to explore new treatment methods. Numerous studies have shown that probiotics are effective in regulating intestinal flora and inhibiting the colonization of pathogenic bacteria[ 5 , 6 ]. It is worth noting that the use of probiotics has also attracted attention in the prevention and control of calf diarrhea[ 7 ]. Probiotics can regulate the balance of intestinal flora, inhibit the colonization of pathogenic bacteria, and enhance the immunity of livestock and poultry, thereby reducing the risk of E.coli K99 infection. This probiotic intervention method has gradually been regarded as an effective measure to reduce the use of antibiotics and improve the health level of animals. Lactic acid bacteria, as beneficial microorganisms widely distributed in nature and closely related to human and animal health, exhibit unique biological characteristics and functions in promoting digestion, enhancing immunity, and preventing and treating diseases through antibacterial activities[ 8 ]. In recent years, with the in-depth research, the species of lactic acid bacteria have become more abundant, and their functions have been more comprehensively elucidated. Besides the common Lactobacillus genus, it also includes multiple genera such as Bifidobacterium and Streptococcus . Among them, Lactobacillus paracasei ( L.paracasei ), as a crucial member of the Lactobacillus family, occupies an important position in the field of probiotic research due to its remarkable probiotic effects[ 9 , 10 ]. Especially in the currently highly concerned fields of antibiotic-free farming and functional food development, it has extremely broad application potential and prospects[ 11 ]. Numerous studies have shown that L.paracasei has the ability to colonize successfully in the host intestine. By secreting a series of antibacterial substances such as lactic acid, hydrogen peroxide, and bacteriocin[ 12 , 13 ], it effectively reduces the pH value inside the intestine, thereby significantly inhibiting the growth of harmful bacteria and powerfully maintaining the balanced and stable state of the intestinal microbiota. At the same time, L.paracasei can also actively participate in the regulation process of the host immune system, significantly promote the activity enhancement of immune cells, greatly enhance the body's resistance to various pathogens, and play a positive and beneficial role in multiple physiological processes such as alleviating the body's inflammatory response and reducing blood lipid levels[ 14 ]. In animal health management and breeding industry practice, due to its natural and safe characteristics, L.paracasei is widely used in the breeding and production processes of poultry, pigs, and ruminants[ 15 ]. It can effectively improve the utilization rate of feed, significantly reduce the amount of antibiotic use, and thus decrease the frequency of animal diseases. Especially under the background of the vigorous promotion of the antibiotic-free farming policy, L.paracasei provides a valuable alternative strategy and approach for ensuring the intestinal health of animals and enhancing the immunity of animal bodies, laying a solid foundation for the construction of a sustainable and healthy breeding model[ 16 ]. However, although most lactic acid bacteria show beneficial characteristics, in specific situations, some lactic acid bacteria may transform into opportunistic pathogenic bacteria, causing diseases such as Lactobacillus bacteremia and other infectious diseases. Previous studies have confirmed that certain strains of lactic acid bacteria carry virulence factors such as hemolysin and gelatinase. These virulence factors can decompose mucoproteins in parts such as the intestinal mucosa, thereby causing damage to body tissues[ 17 ]. Some strains have amino acid decarboxylase activity and can convert amino acids in food into biogenic amines, and excessive biogenic amines will have toxic effects on the host[ 18 ]. When the intervention dose of lactic acid bacteria in animals is too high, it will lead to abnormal changes in the biochemical indexes in animals and cause damage to organs such as the liver. In addition, some lactic acid bacteria can migrate to other organs after entering the intestine, causing local or systemic infections. Therefore, before a new probiotic candidate strain is put into practical application, a comprehensive and rigorous safety assessment must be carried out. Our research group successfully isolated a strain of L.paracasei LCQ-1 from a fresh cow feces sample. To deeply explore the probiotic characteristics and safety level of this strain, we carried out systematic experimental analyses from both in vivo and in vitro experimental dimensions and conducted a challenge protection experimental study using a mouse diarrhea model. The results obtained in this study have laid a crucial foundation for the application of L.paracasei LCQ-1 in the prevention and control of animal diarrhea diseases caused by the E.coli K99 strain. Materials and Methods Strains and Cells L.paracasei (LCQ-1) was preserved at the Key Laboratory of Veterinary Preventive Medicine of Hebei Province. Lactobacillus rhamnosus ( L.rhamnosus ) ATCC53103, Staphylococcus aureus ( S.aureus ) CMCC(B)26003 was obtained from Wuhan Mioling Biotechnology Co., LTD. Pseudomonas aeruginosa ( P.aeruginosa) ATCC9027 were obtained from Shanghai Bioresource Collection Center. Salmonella typhimurium ( S.typhimurium ) ATCC25241 was obtained from Beijing BIOBOV Biotechnology Co., LTD. Salmonella enteritidis ( S.enteritidis ) C50336 was purchased from the China Institute of Veterinary Drug Control. E.coli K99 was isolated from a beef cattle farm. L.paracasei LCQ-1 and L.rhamnosus ATCC53013 were cultured in MRS liquid medium and on MRS agar plates under anaerobic conditions at 37 ℃. The other strains were cultured in BHI liquid medium and on BHI agar plates at 37 ℃. The Caco-2 BBE cell line, derived from human colorectal carcinoma epithelial cells, was obtained from the BeNa Culture Collection (Shanghai, China). Cells were cultured in DMEM supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Co., Ltd., China). Antibiotics were added as needed, including either 50 µg/mL streptomycin with 50 U/mL penicillin, or 50 µg/mL gentamicin. Cultures were maintained at 37°C in a humidified atmosphere containing 5% CO 2 . Experimental animal Female Kunming (KM) mice, aged 6–8 weeks, were selected for this study. The mice were kept in a sterile environment under standard feeding conditions. Housing parameters were strictly controlled, with a temperature of 22.0°C (± 0.5°C), relative humidity of 60% (± 10%), and a 12-hour light/dark cycle. The animals were obtained from Spay (Beijing) Biotechnology Co., Ltd., Beijing, China. All experimental procedures complied with the Experimental Animal Regulation Ordinances of the Hebei Provincial Department of Science and Technology. Ethical approval was granted by the Animal Ethics Committee of Hebei Normal University of Science and Technology (permit number 2020-17). Analysis of Probiotic Properties of L.paracasei LCQ-1 in vitro Antimicrobial Activity Analysis The antimicrobial activity of L.paracasei against E.coli K99 was assessed using the well-diffusion method as described previously[ 19 ]. E.coli K99 at the logarithmic phase of growth was adjusted to a concentration of 1×10 7 CFU/mL, and 200 µL of this suspension was evenly spread on BHI agar plates. A single colony of L.paracasei LCQ-1 from MRS agar plates was inoculated into MRS liquid medium and cultured anaerobically at 37 ℃ overnight. The next day, the culture was sub-cultured in fresh MRS liquid medium at a 1:50 ratio and incubated anaerobically at 37 ℃ for 2 days. The culture was then centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatant was collected. The supernatant was filtered through a 0.22 µm micropore filter to remove any remaining cells, resulting in a cell-free supernatant (CFS) of L.paracasei LCQ-1, which was stored at 4 ℃ for later use. Using the well-diffusion method, 200 µL of the CFS was added to wells on BHI agar plates, and the plates were incubated at 37 ℃ for 12 hours. The diameter of the inhibition zone was measured and recorded. Similarly, a CFS of L.rhamnosus ATCC 53013 was prepared as a positive control, and PBS was used as a negative control. Production of Organic Acids and Hydrogen Peroxide by L.paracasei LCQ-1 Organic acids and hydrogen peroxide (H 2 O 2 ) are key antimicrobial substances produced by lactic acid bacteria. The production of acids was measured as follows: L.paracasei LCQ-1 and L.rhamnosus ATCC 53013 were each cultured on MRS agar plates, and the CFS were prepared every 8 hours. pH values of the CFS were measured using a pH meter, and the monitoring was continued for 48 hours. Sterile MRS liquid medium served as the negative control. H 2 O 2 production was assessed according to a previously described method. MRS agar plates supplemented with horseradish peroxidase and TMB (3,3',5,5'-tetramethylbenzidine) were used to evaluate and quantify hydrogen peroxide production by the L.paracasei . A single colony of each strain was streaked onto the modified MRS agar and incubated under micro-aerobic conditions at 37 ℃ for 48 hours. After incubation, the plates were exposed to air, and H 2 O 2 production was determined by the time required for blue coloration to develop. The following scoring criteria were used: 0 (no coloration), 1 (low, > 20 min), 2 (moderate, 10–20 min), and 3 (high, < 10 min). Hydrophobicity, Autoaggregation, and Coaggregation Assays The surface hydrophobicity of L.paracasei LCQ-1 was determined using the xylene assay. The procedure was as follows: L.paracasei LCQ-1 and L.rhamnosus ATCC53013 were inoculated into MRS liquid medium and cultured anaerobically at 37°C overnight. After incubation, the cultures were centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatants were discarded. The pellets were washed twice with PBS and resuspended, adjusting OD 600 to 0.6. L.rhamnosus ATCC53013 was used as a positive control. (1) For the hydrophobicity test: 1 mL of xylene was mixed with 3 mL of bacterial suspension (OD 600 = 0.6) in a centrifuge tube, thoroughly mixed, and left to stand for 1 hour. When phase separation occurred, the OD 600 of the aqueous phase was measured. For the control group, 1 mL of xylene was mixed with 3 mL of PBS buffer. L.rhamnosus ATCC53013 served as the positive control. The Surface Hydrophobicity Rate was calculated using the following formula: Surface Hydrophobicity Rate (%) = (A 0 –A 1 )/A 0 ×100% Where A 0 is the OD 600 of the bacterial suspension immediately after mixing, and A 1 is the OD 600 after standing for 1 hour. (2) For the autoaggregation assay: 5 mL of bacterial suspension (OD 600 = 0.6) was left to stand at room temperature for 2 hours. Then, 3 mL of the upper phase was removed, and OD 600 was measured. The Autoaggregation Rate was calculated using the following formula: Autoaggregation Rate (%) =(A 0 –A 2 )/A 0 ×100% Where A 0 is the OD 600 of the bacterial suspension immediately after mixing, and A 2 is the OD 600 of the suspension after 2 hours. (3) For the coaggregation assay: E. coli K99 and S.enterica C50336 were inoculated into BHI liquid medium and cultured overnight at 37 ℃. After incubation, the cultures were centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatants were discarded. The bacterial pellets were washed with PBS and resuspended to an OD 600 of 0.6. Equal volumes (2 mL each) of E.coli K99 and S.enterica C50336 were mixed with 2 mL of L.paracasei LCQ-1 (OD 600 = 0.6) and incubated at room temperature for 2 hours. After incubation, 3 mL of the upper phase was removed, and the OD 600 was measured. L.rhamnosus ATCC53013 served as a positive control. The Coaggregation Rate was calculated using the following formula: Coaggregation Rate (%) = (A 0 –A 3 )/A 0 ×100% Where A 0 is the OD 600 of the mixed bacterial suspension immediately after mixing, and A 3 is the OD 600 after 2 hours of incubation. Cell Adhesion Assay The cell adhesion ability of L.paracasei LCQ-1 was evaluated using Caco-2 cells. Caco-2 cells were adjusted to a concentration of 8×10 5 cells/mL, and 1 mL of the cell suspension was added to each well of a 12-well cell culture plate. L.paracasei LCQ-1, L.rhamnosus ATCC53013, E.coli K99, and S.enterica C50336 were adjusted to 8×10 7 CFU/mL and added to the cells at a multiplicity of infection (MOI) of 100:1. The plate was centrifuged at 1,000 rpm for 5 minutes and incubated in a 37 ℃, 5% CO₂ incubator for 2 hours. After incubation, the cells were washed three times with PBS. The cells were then lysed with 1 mL of 1% Triton X-100, and bacterial counts were determined using the serial dilution method. The Cell Adhesion Rate for each strain was calculated using the following formula: Cell Adhesion Rate=(Adherent Bacteria Count/Initial Inoculated Bacteria Count)×100% Acid, Bile Salt, and Heat Resistance Assays Tolerance to acid, bile salts, and high temperatures is a crucial prerequisite for the probiotic efficacy of lactic acid bacteria. (1) Acid Tolerance Assay: L.paracasei LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37 ℃ overnight. The following day, a 1:50 dilution (1 mL) of the overnight culture was transferred into MRS medium adjusted to pH 3 and pH 4, and incubated anaerobically at 37 ℃ for 4 hours. Bacterial counts of L.paracasei LCQ-1 were performed at 0 and 4 hours using the drop plate method. L.rhamnosus ATCC53013 was used as a positive control. (2) Bile Salt Tolerance Assay: The overnight culture of L.paracasei LCQ-1 was inoculated into MRS liquid medium containing bile salts at concentrations of 0.1%, 0.2%, and 0.3% (w/v), at a 1:50 dilution (1 mL). The cultures were incubated anaerobically at 37 ℃ for 4 hours, and bacterial counts were taken at 0 and 4 hours using the drop plate method. L.rhamnosus ATCC53013 served as a positive control. (3) Heat Resistance Assay: L.paracasei LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37°C overnight. The next day, a 1:50 dilution (1 mL) of the overnight culture was inoculated into 50 mL of fresh MRS medium and incubated anaerobically at 37 ℃ for 4 hours. The cultures were then exposed to high temperatures in a thermostatic water bath at 50 ℃, 60 ℃, and 70 ℃ for 5, 10, and 15 minutes. Bacterial counts were determined at each time point using the drop plate method. L.rhamnosus ATCC53013 was used as a positive control. In vitro Safety Evaluation of L.paracasei LCQ-1 (1) Hemolytic Activity and Gelatinase Assay A single colony of L.paracasei LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37 ℃ overnight. The next day, 5 µL of the culture was spotted onto blood agar and gelatin agar plates, followed by incubation anaerobically at 37 ℃ for 24 hours. The presence of hemolytic zones or clear areas around the colonies was observed. S.aureus CMCC(B)26003 was used as the positive control for hemolysis, and P.aeruginosa , ATCC9027 was used as the positive control for gelatinase activity. (2) Mucin Degradation Assay A 5 µL aliquot of the overnight culture of L.paracasei LCQ-1 was spotted onto MRS agar plates containing 0.3% (w/v) mucin and incubated anaerobically at 37 ℃ for 24 hours. The plates were stained with Coomassie Brilliant Blue for 30 minutes, then washed with 1.2 M acetic acid[ 20 ]. A mucin degradation zone around the colony was considered positive, while the absence of such a zone was considered negative. S.typhimurium ATCC25241was used as the positive control. (3) Biogenic Amine Production Assay Biogenic amines such as tyramine, histamine, and putrescine were assessed using amino acid decarboxylase agar media. A 5 µL aliquot of the overnight culture of L.paracasei LCQ-1 was spotted onto decarboxylase agar plates containing tyrosine, histidine, and ornithine, respectively. After the liquid had absorbed, the plates were incubated anaerobically at 37 ℃ for 24 hours. If L. paracasei LCQ-1 cannot produce decarboxylase, the organic acids produced during its metabolism will cause bromocresol purple in the medium to turn yellow, resulting in a yellowish medium. If L. paracasei LCQ-1 produces decarboxylase, the enzyme facilitates the decarboxylation of amino acids, generating amines that are alkaline. These can neutralize or partially neutralize the acidic substances produced by the metabolism of lactic acid bacteria, and the medium will remain purple or slightly yellow. Therefore, colonies that turned yellow from purple were considered negative, while colonies that remained purple were considered positive. Plates without the respective decarboxylase substrates served as negative controls. (4) Antibiotic Susceptibility Testing: Antibiotic resistance of L.paracasei LCQ-1 was determined by the Kirby-Bauer disk diffusion method. A total of 18 antibiotic discs (purchased from Hangzhou Microbial Reagents Co., Hangzhou, China) were tested: streptomycin, lincomycin, ampicillin, gentamicin, ampicillin, amikacin, kanamycin, polymyxin B, cefotaxime, cefepime, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, vancomycin, cefazolin, and minocycline. A 200 µL aliquot of the overnight culture of L.paracasei LCQ-1 was evenly spread onto MRS agar plates, and antibiotic discs were placed on the plates. The plates were incubated anaerobically at 37 ℃ for 24 hours, and the inhibition zone diameter was measured according to National Committee for Clinical Laboratory Standards (NCCLS)[ 21 ]. The susceptibility of the strains was classified as sensitive (S), intermediate (I), or resistant (R). (5) PCR Detection of Antibiotic Resistance, Virulence, and Decarboxylase Genes: The primer sequences and annealing temperatures for antibiotic resistance, virulence, and decarboxylase genes are shown in Table 1 . PCR was performed using the genomic DNA of L.paracasei LCQ-1 as the template to detect these genes. The PCR reaction was conducted in a 25 µL mixture containing 0.4 µM of each primer (Table 1 ), 2 µL template DNA, 12.5 µL of 2 × Taq Master Mix (Jiangsu Kangwei Century Biotechnology Co., Jiangsu, China), and nuclease-free water to a final volume of 25 µL. The PCR conditions were as follows: initial denaturation at 95 ℃ for 10 minutes, followed by 30 cycles of denaturation at 95 ℃ for 30 seconds, annealing at the corresponding temperature for 30 seconds, and extension at 72 ℃ for 30 seconds, with a final extension at 72°C for 5 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel. Table 1 Primers in this study Primers Sequence (5’-3’) Product size (bp) Annealing temperature(°C) blaI -for TGKCGAGATAGGAAGTGTGC 526 56 blaI -rev ACTGTCGGCGAAGGTAAGTTG vanI -for ACGCCATGTTCAGGTAGAT 252 54 vanI -rev GAGCACCGTCAACAATTT vanII -for GGGAAGTTTAACGATGATTTC 657 52 vanII -rev ATCACCAACTCAATTTAGC erm -for GCTAAGCATAATACCGAAACT 853 52 erm -rev GCTAAGCATAATACCGAAACT tet -for CTGAACAATGGGATACRGTAAT 589 54 tet -rev GTAGAAGSGGATCACTATC ant(6) -for CCWTTYTGTTTCAGGATTTTAG 402 54 ant(6) -rev GCAGAGGTAACGAAAGCAA aacI -for GCGTTTCAAATCCTCATCAA 485 56 aacI -rev ATTACCCCGCGGCTGTTGT aacII -for GCCAKGCTGCTWTTACCAT 702 56 aacII -rev TTGACCGGGGATGAGCTTAA apH -for GKATGTGCTTGTTCAACGAT 406/350 54 apH -rev TTGCTTCGACGTCGCCAT blaII -for GAGTACTCACCAGTCACAGAAAAGC 490 58 blaII -rev GACTTCCCGTCGTGTAGATAAC sul -for CCTGTTTCGTCCGACACAGA 435 57 sul -rev GAAGCGCAGCCGCAATTCAT qnr -for ATGACGCCATTACTGTATAA 562 50 qnr -rev GATCGCAATGTGTGAAGTTT hdcJV16HC -for AGATGGTATTGTTTCTTATG 367 50 hdcJV16HC -rev AGACCATACACCATAACCTTG hdcPHDC -for CCAAACACCAGCATCTTCA 497 56 hdcPHDC -rev CCGTGCGGAAACAAAGAAT hdcZu -for CCTTGATGGTATTGTTTGG 327 53 hdcZu -rev ATTCTTTGGACGTTCTGC tdcTD -for ACATAGTCAACCATRTTGAA 1100 50 tdcTD -rev CAAATGGAAGAAGAAGTAGG tdcLao -for CGGGCATAGTTCTTGGAG 156 56 tdcLao -rev GCCGCATAGACTTCTGGTTT tdcTDC -for TGGYTNGTNCCNCARACNAARCAYTA 825 59 tdcTDC -rev ACRTARTCNACCATRTTRAARTCNGG gelE -for ACCCCGTATCATTGGTTT 419 52 gelE -rev ACGCATTGCTTTTCCATC cylA -for TGGATGATAGTGATAGGAAGT 517 51 cylA -rev TCTACAGTAAATCTTTCGTCA cylB -for ATTCCTACCTATGTTCTGTTA 843 49 cylB -rev AATAAACTCTCTTTTCCAAC CylM -for CTGATGGAAAGAAGATAGTAT 742 50 CylM -rev TGAGTTGGTCTGATTACATTT asal -for AAGAAAAAGAAGTAGACCAAC 1553 50 asal -rev AAACGGCAAGACAAGTAAATA ace -for GAATTGAGCAAAAGTTCAATC 320 51 ace -rev GTCTGTCTTTTCACTTGTTTC esp -for TTGCTAATGCTAGTCCACGAC 932 58 esp -rev GCGTCAACACTTGCATTGCCG In Vivo Safety Evaluation of L.paracasei LCQ-1 Acute Oral Toxicity Test The acute oral toxicity test was performed according to the method described in GB15193.3-2014, "Acute Oral Toxicity Test." Ten female Kunming mice (6–8 weeks old) were randomly divided into two groups (n = 5). Group A was orally administered L.paracasei LCQ-1 at a dose of 2×10 9 CFU/mouse, while Group B was administered 200 µL of PBS. The animals were treated for 14 consecutive days, and their clinical manifestations were observed and recorded daily. 28-Day Oral Toxicity Test The 28-day oral toxicity test followed the guidelines in GB15193.22-2014, "28-Day Oral Toxicity Test." Twenty female Kunming mice (6–8 weeks old) were randomly divided into four groups (n = 5). Mice in groups A, B, and C were orally administered L.paracasei LCQ-1 at doses of 200 µL/mouse, with concentrations of 1×10 8 CFU/mL, 1×10 9 CFU/mL, and 1×10 10 CFU/mL, respectively. Group D served as the control group, receiving an equal volume of physiological saline. The treatment lasted for 28 days, and the following assessments were performed to evaluate the safety of the probiotics: organ index, probiotic translocation, bacterial infection analysis, blood biochemical indices, and histopathological observations. (1) Organ Index Measurement Mice were euthanized, and the heart, liver, spleen, lungs, and kidneys were collected under sterile conditions. The organ weight was measured, and the organ index was calculated using the formula Organ Index(%) = Organ Weight(g)/Body Weight(g)×100% (2) Probiotic Translocation and Infection Analysis Mice were euthanized, and the heart, liver, spleen, lungs, and kidneys were collected under sterile conditions. Tissue samples from each organ were streaked onto MRS agar plates, incubated anaerobically at 37 ℃ for 24 hours, and observed for bacterial colony growth, which would indicate the translocation of probiotics. (3) Blood Biochemical Analysis Tail vein blood was collected, and serum was separated. Liver function, kidney function, blood glucose, blood lipids, and cholesterol levels were analyzed using an automatic biochemical analyzer (Jiangsu Su-Lian Ke Biological Technology Co., Jiangsu, China). (4) Histopathological Analysis Mice were euthanized, and 1 cm segments of the ileum were immediately fixed in pre-cooled 4% paraformaldehyde for 24 hours. The fixed tissue was dehydrated in a series of ethanol solutions (70%, 80%, 90%, 100%), followed by infiltration with xylene and embedding in paraffin. Sections were cut to 4–6 µm thickness using a microtome and stained with hematoxylin and eosin (H&E). The slides were observed under a microscope for histopathological changes. In Vivo Probiotic Efficacy Assessment The toxicity of E.coli K99 was evaluated in mice to determine the infection dose. Thirty female Kunming mice (6–8 weeks old) were randomly divided into six groups (n = 5). The first five groups received intraperitoneal injections of E.coli K99 at doses of 5.56×10 8 CFU/mouse, 5.56×10 7 CFU/mouse, 5.56×10 6 CFU/mouse, 5.56×10 5 CFU/mouse, and 5.56×10 4 CFU/mouse. The sixth group received an equal volume of PBS. Mice were observed for 14 days, and the number of deaths was recorded. The LD 50 of E.coli K99 was calculated using the Spearman-Karber method: logLD 50 = X k -i(∑p-0.5), Where X_k is the highest logarithmic dose, i is the difference between two consecutive logarithmic doses, and ∑p is the total mortality rate across all groups. To assess the protective effect of L.paracasei LCQ-1, twenty female Kunming mice (6–8 weeks old) were randomly divided into two groups (n = 10). The mice from Group A received continuous oral administration of L.paracasei LCQ-1 (200 µL/mouse, 1×10 10 CFU/mL) for 14 days. The mice from Group B received 200 µL of PBS as the control. On day 14, both groups were intraperitoneally injected with E.coli K99 at the dose corresponding to 1×LD 50 . Mice were observed for another 14 days, and morbidity and mortality were recorded. Statistical Analysis Statistical analyses were conducted using IBM SPSS Statistics 26, with one-way analysis of variance (ANOVA) followed by LSD-mean multiple comparison tests. The data are presented as mean ± standard error of the mean (SEM). Statistically significant differences were indicated with asterisks (*), where * p < 0.05, ** p < 0.01, and *** p < 0.001 denote significant differences in mean values. Results In Vitro Experiments Demonstrate Probiotic Characteristics of L.paracasei LCQ-1 L.paracasei LCQ-1 Exhibits Antibacterial Activity Against E.coli K99 The antimicrobial activity of L.paracasei LCQ-1 and L.rhamnosus ATCC53013 was assessed by the well diffusion method using their respective CFS. The results, shown in (Fig. 1 ), indicated that the CFS of L.paracasei LCQ-1 exhibited a larger inhibition zone (18 mm) against E.coli K99 compared to the CFS of L.rhamnosus ATCC53013, which showed an inhibition zone of 7 mm. These findings suggest that L.paracasei LCQ-1 possesses significantly stronger antibacterial activity against E.coli K99 than L.rhamnosus ATCC53013. Thus, L.paracasei LCQ-1 demonstrates excellent antimicrobial properties against E.coli K99. Acid Production by L.paracasei LCQ-1 and Hydrogen Peroxide Absence The acid production ability of L.paracasei LCQ-1 was assessed by measuring the pH of its CFS. The results (Table 2 ) show that as the incubation time increased, the pH of the CFS gradually decreased. After 40 hours of incubation, the pH stabilized, with no significant further decrease. Additionally, no significant difference was observed between L.paracasei LCQ-1 and the control strain L.rhamnosus ATCC53013, indicating a strong acid production capacity. To evaluate hydrogen peroxide (H₂O₂) production, MRS agar medium supplemented with horseradish peroxidase and TMB was used. The results (Fig. 2 ) showed that even after extending the exposure time to air for more than 20 minutes, no blue coloration developed around the colonies of L.paracasei LCQ-1, indicating that it does not produce hydrogen peroxide. Similarly, no blue coloration was observed for L.rhamnosus ATCC53013 colonies. These results demonstrate that L.paracasei LCQ-1 exhibits strong acid production ability but does not produce hydrogen peroxide. Table 2 pH of CFS from L.paracasei LCQ-1 at Different Time Points Strain 8h 16h 24h 32h 40h 48h 56h L.paracasei LCQ-1 4.96 ± 0.19 4.67 ± 0.11 4.21 ± 0.13 4.08 ± 0.11 3.67 ± 0.02 3.61 ± 0.06 3.61 ± 0.01 L.rhamnosus ATCC53013 4.87 ± 0.2 4.62 ± 0.12 4.36 ± 0.09 3.89 ± 0.14 3.66 ± 0.07 3.57 ± 0.09 3.52 ± 0.02 MRS 5.44 ± 0.02 5.44 ± 0.02 5.44 ± 0.02 5.44 ± 0.02 5.44 ± 0.02 5.44 ± 0.02 5.44 ± 0.02 L.paracasei LCQ-1 Exhibits Strong Hydrophobicity, Self-Aggregation, and Co-Aggregation Capabilities Hydrophobicity, self-aggregation, and co-aggregation abilities are important indicators for assessing the probiotic potential of lactic acid bacteria. The experimental results demonstrated (Table 3 ) that the hydrophobicity of L.paracasei LCQ-1 was 57 ± 2.67%, significantly higher than the 27 ± 2.44% hydrophobicity observed for L.rhamnosus ATCC53013. Furthermore, L.paracasei LCQ-1 exhibited a self-aggregation rate of 50 ± 2.04%, which was significantly higher than the 38 ± 1.71% self-aggregation rate of L.rhamnosus ATCC53013. In co-aggregation experiments, L.paracasei LCQ-1 showed co-aggregation rates of 21 ± 0.13% with E.coli K99 and 16 ± 0.13% with S.enteritis C50336. In contrast, L.rhamnosus ATCC53013 exhibited co-aggregation rates of 13 ± 0.22% with E.coli K99 and 2 ± 0.1% with S.enteritis C50336. These results demonstrate that L.paracasei LCQ-1 has significantly higher co-aggregation capabilities compared to L.rhamnosus ATCC53013.The results indicate that L.paracasei LCQ-1 possesses excellent hydrophobicity, self-aggregation, and co-aggregation abilities, which are important features for its probiotic potential. Table 3 Hydrophobicity, Self-Aggregation, and Co-Aggregation Rates of L.paracasei LCQ-1 Strain Hydrophobicity (%) Auto‑aggregation(%) Co‑aggregation(%) Xylene 2 h E.coli K99 S.enteritis C50336 L.paracasei LCQ-1 57 ± 2.67 50 ± 2.04 21 ± 0.13 16 ± 0.13 L.rhamnosus ATCC53013 27 ± 2.44 38 ± 1.71 13 ± 0.22 2 ± 0.10 PBS 21 ± 1.54 L.paracasei LCQ-1 Exhibits Strong Adhesion Capability This study evaluated the adhesion capabilities of L.paracasei LCQ-1, L.rhamnosus ATCC53013, E. coli K99, and S.enteritidis C50336 to human colorectal adenocarcinoma Caco-2 cells. The results (Fig. 3 ) showed that the adhesion rate of L.paracasei LCQ-1, L. rhamnosus ATCC53013, E. coli K99 and S. enteritidis C50336 to Caco-2 cells was 41.33 ± 0.58%, 37.14 ± 1.29%, 32.67 ± 2.08% and 27.33 ± 1.15%, respectively. Both L. paracasei LCQ-1 and L. rhamnosus ATCC53013 demonstrated significantly higher adhesion rates compared to the pathogenic bacteria E. coli K99 and S. enteritidis C50336. Furthermore, the adhesion rate of L. paracasei LCQ-1 was significantly higher than that of L. rhamnosus ATCC53013. These findings indicate that L. paracasei LCQ-1 possesses strong cell adhesion capability. L.paracasei LCQ-1 Exhibits Acid, Bile Salt, and Heat Tolerance Characteristics This study evaluated the acid, bile salt, and heat tolerance of L.paracasei LCQ-1 using the drop plate counting method. The results of the acid tolerance test (Fig. 4 A) showed that the survival rate of L.paracasei LCQ-1 at pH 3 and pH 4 was not significantly different from that of L.rhamnosus ATCC 53013. In the bile salt tolerance experiment (Fig. 4 B), the survival rate of L.paracasei LCQ-1 was significantly lower than that of L.rhamnosus ATCC 53013 in 0.1% (w/v) bile salt conditions. Both strains exhibited zero survival at 0.2% (w/v) and 0.3% (w/v) bile salt concentrations. The results of the heat tolerance test (Fig. 4 C) indicated a gradual decrease in survival rates of both L.paracasei LCQ-1 and L.rhamnosus ATCC53013 with increasing temperature and exposure time. At 50°C, L.paracasei LCQ-1 exhibited significantly higher survival rates than L.rhamnosus ATCC53013 after 5, 10, and 15 minutes of exposure. At 60°C, no significant difference in survival rate was observed between the two strains after 5, 10, and 15 minutes of exposure. At 70°C, L.paracasei LCQ-1 had significantly higher survival rates than L.rhamnosus ATCC53013 at all time points (5, 10, and 15 minutes). Notably, L.rhamnosus ATCC53013 was unable to survive after 15 minutes at 70°C, while L.rhamnosus LCQ-1 remained viable, indicating superior heat tolerance. In conclusion, L.paracasei LCQ-1 demonstrates significant acid, bile salt, and heat tolerance, suggesting its potential as a robust strain for further applications. In Vitro Experiments Demonstrate the Good Safety Profile of L.paracasei LCQ-1 To further evaluate the in vitro safety characteristics of L.paracasei LCQ-1, a series of tests were conducted, including hemolysis, gelatinase, mucin degradation, biogenic amine production and drug resistance. The hemolysis assay (Fig. 5 A) showed that no hemolytic zone was observed around the colonies of L.paracasei LCQ-1, indicating that the strain does not possess hemolytic activity. The gelatinase assay (Fig. 5 B) revealed no clear zones around the colonies of L.paracasei LCQ-1, suggesting that it does not produce gelatinase. The mucin degradation assay (Fig. 5 C) showed no decolorized area around the colonies of L.paracasei LCQ-1, indicating that the strain does not possess mucin-degrading activity. The results of the biogenic amine production assay (Fig. 5 D-F) demonstrated that L.paracasei LCQ-1 did not produce tyramine, putrescine, or histamine. Specifically, yellow coloration was observed around colonies on the tyrosine decarboxylase agar and ornithine decarboxylase agar(Fig. 5 D and 5 F), indicating an absence of tyrosine and ornithine decarboxylase activity. However, no color change was observed on the histidine decarboxylase agar (Fig. 5 F), confirming the presence of histidine decarboxylase activity. The antibiotic susceptibility of L.paracasei LCQ-1 was assessed using the K-B method against 18 antibiotics. The results (Table 4 ) showed that L.paracasei LCQ-1 was resistant to 6 antibiotics, including gentamicin, ampicillin, amikacin, kanamycin, polymyxin B, and vancomycin; intermediate resistance was observed to 3 antibiotics, including lincomycin, cefotaxime, and ceftazidime; and sensitivity was observed to 9 antibiotics, including streptomycin, ampicillin, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, cefazolin, and minocycline. PCR analysis using primers specific to resistance genes, virulence genes, and amino acid decarboxylase genes was performed on the genomic DNA of L.paracasei LCQ-1. The results (Fig. 6 A-B) indicated the absence of amino acid decarboxylase and virulence genes, while one resistance gene ( aph1 ) was detected (Fig. 6 C). In conclusion, the in vitro experimental results indicate that L.paracasei LCQ-1 exhibits a good safety profile. Table 4 Antimicrobial susceptibility profile of L.paracasei LCQ-1 Antibiotic Drug content (µg/ tablet) Standard inhibition circle diameter (mm) L.paracasei LCQ-1 Sensitive (S) Intermediate-resistant (I) Resistant (R) 1 Streptomycin (S) 10 ≥ 15 12–14 ≤ 11 S 2 Lincomycin (MY) 2 ≥ 20 11–19 ≤ 10 I 3 Ampicillin (AMP) 10 ≥ 17 13–16 ≤ 12 S 4 Gentamicin (GEN) 10 ≥ 15 13–14 ≤ 12 R 5 Cephalexin (CN) 30 ≥ 18 15–17 ≤ 14 R 6 Amikacin (AMK) 30 ≥ 17 15–16 ≤ 14 R 7 Kanamycin (KAN) 30 ≥ 18 14–17 ≤ 13 R 8 Polymixin B (PB) 300 ≥ 12 9–11 ≤ 8 R 9 Ceftriaxone (CRO) 30 ≥ 21 14–20 ≤ 13 I 10 Ceftazidime (CAZ) 30 ≥ 18 15–17 ≤ 14 I 11 Tetracycline (TET) 30 ≥ 19 15–18 ≤ 14 S 12 Cefuroxime sodium (CXM) 30 ≥ 20 11–19 ≤ 10 S 13 Penicillin (PEN) 10 ≥ 23 20–22 ≤ 19 S 14 Cefoperazone (CPZ) 75 ≥ 21 16–20 ≤ 15 S 15 Erythromycin (E) 15 ≥ 23 14–22 ≤ 13 S 16 Vancomycin (VAN) 30 ≥ 12 10–11 ≤ 9 R 17 Cefazolin (CZ) 30 ≥ 18 15–17 ≤ 14 S 18 Minocycline (MIN) ≥ 30 19 15–18 ≤ 14 S S: sensitive, I: intermediate, R: resistant. The in vivo experiment demonstrated that L.paracasei LCQ-1 has favorable safety characteristics. Gastric gavage in mice are important methods for evaluating the safety of probiotics in vivo. In this study, different doses of L.paracasei LCQ-1 were administered via gavage to mice, followed by the acute bacterial challenge and continuous gavage experiments. Acute Bacterial Challenge Experiment The results of the acute bacterial challenge experiment showed that after a 14 day-gavage of the highest dose (2×10 9 CFU/mouse) of L.paracasei LCQ-1, no deaths occurred in the mice, and during the gavage period, the visual, digestive, nervous, and respiratory systems, as well as other organ systems, remained normal (Table 5 ). This indicates that L.paracasei LCQ-1 does not cause acute toxicity in mice. Table 5 Clinical Manifestations of Mice Undergoing Acute Bacterial Challenge with L.paracasei LCQ-1 Organ/System Inspection Item Trait Manifestation Hair Coat Color Normal Integrity Not loose Skin and Mucosa Mucosa No mucus discharge Eye Oral Cavity Normal Pupil Normal, without dilation or constriction Eyeball Normal, without protrusion Eyelid Normal Secretions and Excretions Periorbital Secretions No tearing Fecal Color and Consistency Feces formed, normal color Abdominal Shape No diarrhea or constipation Respiratory System Nostril Normal, no runny nose Respiratory Rate Normal breathing Nervous System Motor Behavior Normal body position, normal vocalization, no abnormal postures Behavioral Manifestations Presence of Tonic or Clonic Activities None Presence of Abnormal Behaviors None Response to Stimuli Normal stress response 28-Day Oral Toxicity Test (1) Organ Index Measurement The organ index measurements (Table 6 ) showed no significant differences in the heart-to-body ratio, liver-to-body ratio, spleen-to-body ratio, lung-to-body ratio, or kidney-to-body ratio in the L.paracasei LCQ-1-gavaged groups (Groups A, B, and C) compared to the control group (Group D). This indicates that gavage administration of different doses of L.paracasei LCQ-1 does not affect the organ weights of mice. (2) Bacterial Translocation Experiment The results of the bacterial translocation experiment demonstrated that after scraping internal tissues from the organs of mice in the gavaged groups (Groups A, B, and C) and the control group (Group D), no bacterial colonies were observed in any of the samples. This suggests that gavage of different doses of L.paracasei LCQ-1 does not result in bacterial translocation or infection in other organs of the mice. (3) Blood Biochemical Analysis: Blood biochemical markers are important for evaluating the safety of probiotics . (Fig. 7 A) shows that, compared to the control group (Group D), there were no significant changes in the concentrations of direct bilirubin (D-BII), total bilirubin (T-BIL), and alanine aminotransferase (ALT) in the gavaged groups (Groups A, B, and C). These results suggest that L.paracasei LCQ-1 does not impair liver cell integrity or liver function in mice. (Fig. 7 B ) shows that, compared to the control group (Group D), there were no significant changes in the concentrations of blood urea nitrogen (BUN), uric acid (UA), and creatinine (CREA) in the gavaged groups (Groups A, B, and C), indicating that L.paracasei LCQ-1 does not affect nitrogen metabolism or renal excretion function in mice. (Fig. 7 C ) shows that, compared to the control group (Group D), there were no significant changes in the concentrations of total cholesterol (TC), glucose (GLU), and triglycerides (TG) in the gavaged groups (Groups A, B, and C), suggesting that L.paracasei LCQ-1 do not induce any adverse effects on blood sugar or lipid metabolism in mice. (4) Histological Examination of the Ileum The histological examination of ileum portions aimed to assess the effect of L.paracasei LCQ-1 on the integrity of the intestinal mucosa. The results (Fig. 8 ) showed no significant changes in the intestinal morphology of the ileum in the gavaged groups (Groups A, B, and C) compared to the control group (Group D), and no pathological findings were observed in any of the groups. These results indicate that L.paracasei LCQ-1 does not cause damage to the ileum in mice. Taken together, the results of the in vivo safety assessments suggest that L.paracasei LCQ-1 demonstrates a favorable safety profile. Table 6 Organ Index of Mice Administered Different Doses of L.paracasei LCQ-1 via Gavage Group heart-to-body ratio/% liver-to-body ratio/% spleen-to-body/% lung-to-body ratio/% kidney-to-body/% A 0.63 ± 0.11 5.52 ± 0.61 0.43 ± 0.09 0.91 ± 0.09 1.78 ± 0.11 B 0.60 ± 0.04 5.67 ± 0.42 0.45 ± 0.07 0.92 ± 0.05 1.69 ± 0.08 C 0.63 ± 0.02 5.56 ± 0.41 0.40 ± 0.07 0.89 ± 0.10 1.73 ± 0.08 D 0.59 ± 0.02 5.22 ± 0.58 0.46 ± 0.04 0.95 ± 0.12 1.70 ± 0.04 Protection Against E.coli K99 Infection in Mice Demonstrates the Probiotic Properties of L.paracasei LCQ-1 To assess the protective effect of L.paracasei LCQ-1 against E.coli K99 infection, the median lethal dose (LD 50 ) of E. coli K99 was first determined. Mice were infected with E. coli K99 via intraperitoneal injection, exhibiting symptoms such as tremors, arched back, eyelid swelling with increased secretion, fecal contamination around the anus, and the expulsion of gray-green, pasty diarrhea (Fig. 9 ). Mortality was observed starting on day 1. The LD 50 calculation indicated that the LD 50 of E. coli K99 was 4.4×10⁷ CFU/mouse (Table 7 ). To further evaluate the protective effect of L.paracasei LCQ-1, mice were gavaged with L.paracasei LCQ-1 for 14 days, then intraperitoneally injected with E. coli K99. The survival was recorded to generate a survival curve. The results (Fig. 10 ) showed that the survival rate of Group A mice was 80%, while that of Group B mice was 50%. These findings indicate that gavage administration of L.paracasei LCQ-1 significantly reduces mortality caused by E. coli K99 infection in mice. Table 7 LD 50 of E. coli K99 in KM mice Strain Inoculation dose(CFU/mouse) No. of deaths/total no. of mice LD 50 (CFU/mouse) E. coli K99 5.56×10 8 5/5 4.4×10 7 5.56×10 7 3/5 5.56×10 6 0/5 5.56×10 5 0/5 5.56×10 4 0/5 Discussion Neonatal livestock often suffer from severe watery diarrhea and dehydration leading to mortality due to E. coli infections[ 22 , 23 ]. In recent years, there has been considerable attention on the use of probiotics as an alternative to antibiotics for preventing and treating diarrhea caused by enterotoxigenic E.coli (ETEC)[ 24 ].Lactic acid bacteria (LAB), including Lactobacillus species, are beneficial microorganisms that confer health benefits to the host. The World Health Organization (WHO) defines probiotics as “live microorganisms which, when administered in adequate amounts, confer a health benefit on the host.” [ 25 ] Numerous studies have highlighted that certain Lactobacillus strains, such as L.plantarum , play a beneficial role in alleviating ETEC-induced diarrhea[ 26 – 28 ]. Our research group previously isolated a strain of L.paracasei from fresh feces of healthy cattle, named L.paracasei LCQ-1, and performed whole genome sequencing, with the data uploaded to NCBI (accession number PRJNA1175393). In this study, we conducted in vitro and in vivo evaluations of its safety and probiotic properties. The results showed that L.paracasei LCQ-1 exhibited strong antimicrobial activity against E.coli K99, robust acid production capacity, and favorable hydrophobicity, autoaggregation, coaggregation, and cell adhesion abilities. It did not show hemolytic activity, gelatinase production, or mucin-degrading activity. In oral administration tests, L.paracasei LCQ-1 did not cause acute toxicity or clinical infections in mice and significantly reduced the mortality rate in a pathogenic E.coli K99 challenge model. These findings suggest that L.paracasei LCQ-1 has good safety and probiotic potential in mice and could be further developed as a probiotic product to prevent E.coli -induced diarrhea in animals. Probiotic strains must meet certain criteria to be considered potential candidates for probiotic applications: they must withstand low pH, bile salts, and high temperatures to survive in the gut; adhere to intestinal cells; prevent or reduce the adhesion of pathogenic microorganisms; produce acids and hydrogen peroxide to inhibit pathogen growth[ 29 ]; and form clusters to maintain a balanced gut microbiota. The beneficial properties of LAB need to be thoroughly evaluated. Our study showed that L.paracasei LCQ-1 demonstrated moderate tolerance to acid and bile salts, with bile salt tolerance slightly lower than that of L.rhamnosus ATCC53013. The autoaggregation and surface hydrophobicity of probiotics are positively correlated with their adhesion to intestinal epithelial cells. Coaggregation with pathogens reflects the antimicrobial ability of probiotics and inhibits the attachment of pathogens to the intestinal mucosa[ 30 ]. In this study, L.paracasei LCQ-1 exhibited a hydrophobicity of 57 ± 2.67%, autoaggregation of 50 ± 2.04%, and coaggregation with E. coli K99 and S.enteritidis C50336 at 21 ± 0.13% and 16 ± 0.13%, respectively, which were higher than the control strain L.rhamnosus ATCC53013. Adhesion to the intestinal epithelial cell mucosal surface is a desired characteristic for probiotics as it promotes colonization and persistence while inhibiting pathogen colonization and contributing to mucosal healing[ 12 ]. Previous results showed that L.paracasei LCQ-1 demonstrated good hydrophobicity and autoaggregation, suggesting that it may effectively adhere to intestinal epithelial cells. To verify this, we assessed the cell adhesion properties of L.paracasei LCQ-1 using the Caco-2 BBE cell, and found that L.paracasei LCQ-1 adhered to cells at a rate of 41.33 ± 0.58%, significantly higher than the control strain L.rhamnosus ATCC53103. These results demonstrate the excellent probiotic properties of L.paracasei LCQ-1 in vitro. Pathogenicity is another critical factor to assess during the screening of new probiotics. Some probiotic strains may harbor hemolysin, posing a potential risk to the host. Hemolytic bacteria produce hemolysins that rupture erythrocytes, leading to sepsis. In this study, we tested the hemolytic activity of L.paracasei LCQ-1 using the spot inoculation method, and no hemolysis zone was observed around the colony, indicating it lacks hemolytic activity. Similar results were reported by Liu et al. and Toropov et al., who found that both Blautia producta DSM 2950[ 31 ], L.helveticus D75[ 32 ], and L.delbrueckii subsp. Lactis CIDCA 133 did not exhibit hemolytic activity. Gelatinase is a type of protease that hydrolyzes structural components of connective tissue, facilitating the invasion of pathogenic bacteria into the host’s intestinal mucosa, leading to intestinal diseases[ 33 ]. Our study showed that no zones of gelatin hydrolysis were detected after flooding gelatin agar plates with saturated ammonium sulfate solution, indicating that L.paracasei LCQ-1 does not produce gelatinase. This finding is consistent with previous studies on strains such as L.crispatus UBLCp01, L.gasseri UBLG36, and L.johnsonii UBLJ01[ 34 ]. Mucin degradation is a virulence factor for several enteropathogens. In this study, we found that L.paracasei LCQ-1 does not exhibit mucin-degrading activity, as no discolored zones were observed after coomassie blue staining. Additionally, the strain exhibited decarboxylase activity only against histidine. Regarding antibiotic resistance, multidrug-resistant strains can pose a significant threat to the treatment of bacterial infections. Therefore, probiotic candidates should be evaluated for their antibiotic resistance profiles. Our results showed that L.paracasei LCQ-1 was sensitive to 18 commonly used antibiotics, including streptomycin, ampicillin, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, cefazolin, and minocycline. PCR analysis revealed no presence of resistance genes, including β-lactamase ( bla1 , bla-l1 ), aminoglycoside ( aac1 , aac1I , aph , ant(6) ), macrolide ( erm ), sulfonamide ( sul ), quinolone ( qnr ), tetracycline ( tet ), or vancomycin ( van1 , van1I ). These results confirm that L.paracasei LCQ-1 has a favorable safety profile in terms of antibiotic resistance. To further evaluate the application potential of L.paracasei LCQ-1, we performed an in vivo safety evaluation using a mouse model. No acute toxicity, clinical infections, or adverse effects on growth were observed. Serum biochemical parameters, which are indicative of host health, showed no significant changes in mice after oral administration of L.paracasei LCQ-1. These results are consistent with studies involving other probiotic strains such as L.rhamnosus HN001, L.acidophilus HN017, and Bifidobacterium HN019, which did not significantly affect serum biochemical indicators in mice[ 35 ]. Additionally, histopathological analysis of ileum tissues from mice treated with L.paracasei LCQ-1 showed no evidence of ulcers, inflammatory cell infiltration, or mucosal degeneration. These results indicate that L.paracasei LCQ-1 does not negatively impact intestinal morphology and may even promote recovery from intestinal damage[ 36 ]. Finally, to assess the probiotic characteristics in vivo, we administered L.paracasei LCQ-1 orally to mice for 14 days and then challenged them with E. coli K99. The survival rate of mice in the L.paracasei LCQ-1 treatment group was 80%, significantly higher than the 50% survival rate in the untreated group, with noticeable improvements in diarrhea symptoms. Similar results were observed with Enterococcus faecalis NCIMB 10415 in neonatal piglets challenged with enterotoxigenic E. coli K88, where probiotic treatment alleviated diarrhea and reduced mortality[ 37 ]. In conclusion, L.paracasei LCQ-1 demonstrated strong antibacterial activity against E.coli K99, good cell adhesion properties, and an absence of hemolytic, gelatinase, and mucin-degrading activities. Oral administration of L.paracasei LCQ-1 did not cause acute toxicity or clinical infections in mice, significantly improved survival rates in E.coli K99-infected mice, and exhibited excellent safety and probiotic properties in vitro and in vivo. Further studies on the prevention of E. coli infections in larger animals, such as cattle and sheep, are essential for evaluating the broader application potential of L.paracasei LCQ-1. Declarations Author Contribution Conceived and designed the experiments: TLW. Performed the experiments: FJW, LC, and YL. Analyzed the data: GPG, YNW, RLS and YYC. Wrote the paper: FJW, LC and TLW. Reviewed and edited the paper: TLW, HJZ, RC and QMS. Funding Weichang Manchu and Mongolian Autonomous County Science and Technology Program Project, Central Government Guides Local Projects, Hebei Province, Department of Science and Technology (23626604G), Hebei Province key research and development plan project (22326612D), and Chengde City Basic Research Project (202404B099) provided funding for this work. Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethics approval The animal study was reviewed and approved by the Experimental Animal Regulation Ordinances defined by Hebei Provincial Department of Science and Technology (HPDST2020-17). Conflict of interest The authors declare no conflicts of interest. References Geurtsen J, de Been M, Weerdenburg E, Zomer A, McNally A, Poolman J (2022) Genomics and pathotypes of the many faces of Escherichia coli . FEMS Microbiol Rev 46(6):fuac031. https://doi.org/10.1186/s13028-020-00543-1 Xu H, Gong J, Lu P, Azevedo P, Li L, Yu H, Yang C (2024) Functional evaluation of Bacillus licheniformis PF9 for its potential in controlling enterotoxigenic Escherichia coli in weaned piglets. Translational Anim Sci 8:txae050. https://doi.org/10.1093/tas/txae050 Zhang Y, Tan P, Zhao Y, Ma X (2022) Enterotoxigenic Escherichia coli : intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 14(1):2055943. https://doi.org/10.1080/19490976.2022.2055943 Brown K, Uwiera RR, Kalmokoff ML, Brooks SP, Inglis GD (2017) Antimicrobial growth promoter use in livestock: a requirement to understand their modes of action to develop effective alternatives. Int J Antimicrob Agents 49(1):12–24. https://doi.org/10.1016/j.ijantimicag.2016.08.006 Wang W, Ma H, Yu H, Qin G, Tan Z, Wang Y, Pang H (2020) Screening of Lactobacillus plantarum subsp. plantarum with potential probiotic activities for inhibiting ETEC K88 in weaned piglets. Molecules 25(19):4481. https://doi.org/10.3390/molecules25194481 Li Y, Jia D, Wang J, Li H, Yin X, Liu J, Wang J, Guan G, Luo J, Yin H (2021) Probiotics isolated from animals in Northwest China improve the intestinal performance of mice. Front veterinary Sci 8:750895. https://doi.org/10.3389/fvets.2021.750895 Du W, Wang X, Hu M, Hou J, Du Y, Si W, Yang L, Xu L, Xu Q (2023) Modulating gastrointestinal microbiota to alleviate diarrhea in calves. Front Microbiol 14:1181545. https://doi.org/10.3389/fmicb.2023.1181545 Levit R, Cortes-Perez NG, de Moreno de Leblanc A, Loiseau J, Aucouturier A, Langella P, LeBlanc JG, Bermúdez-Humarán (2022) Use of genetically modified lactic acid bacteria and bifidobacteria as live delivery vectors for human and animal health. Gut Microbes LG(1):2110821. https://doi.org/10.1080/19490976.2022.2110821 Chen T, Li B, Zheng K, Liu Y, Zhang Z, Hu H, Qian G, Jiang J (2024) Lactobacillus paracasei R3 Alleviates Tumor Progression in Mice with Colorectal Cancer. Curr Microbiol 81(1):38. https://doi.org/10.1007/s00284-023-03525-4 Hill D, Sugrue I, Tobin C, Hill C, Stanton C, Ross R (2018) The Lactobacillus casei group: history and health related applications. Front Microbiol 9:2107. https://doi.org/10.3389/fvets.2021.750895 de Souza BMS, Guerra LHA, Varallo GR, Taboga SR, Penna ALB (2023) The Impact in Intestines and Microbiota in BALB/c Mice Through Consumption of Milk Fermented by Potentially Probiotic Lacticaseibacillus casei SJRP38 and Limosilactobacillus fermentum SJRP43. Probiotics Antimicrob Proteins 1–17. https://doi.org/10.1007/s12602-023-10158-3 Jankowska A, Laubitz D, Antushevich H, Zabielski R, Grzesiuk E (2008) Competition of Lactobacillus paracasei with Salmonella enterica for adhesion to Caco-2 cells. J Biomed Biotechnol 2008:357964. https://doi.org/10.1155/2008/357964 Mokoena MP (2017) Lactic acid bacteria and their bacteriocins: classification, biosynthesis and applications against uropathogens: a mini-review. Molecules 22(8):1255. https://doi.org/10.3390/molecules22081255 Icer MA, Özbay S, Ağagündüz D, Kelle B, Bartkiene E, Rocha JMF, Ozogul F (2023) The impacts of acidophilic lactic acid Bacteria on food and human health: a review of the current knowledge. Foods 12(15):2965. https://doi.org/10.3390/foods12152965 Awad WS, El-Sayed AA, Mohammed FF, Bakry NM, Abdou NEM, Kamel MS (2020) Molecular characterization of pathogenic Escherichia coli isolated from diarrheic and in-contact cattle and buffalo calves. Trop Anim Health Prod 52:3173–3185. https://doi.org/10.1007/s11250-020-02343-1 Plessas S, Kiousi DE, Rathosi M, Alexopoulos A, Kourkoutas Y, Mantzourani I, Galanis A, Bezirtzoglou E (2020) Isolation of a Lactobacillus paracasei strain with probiotic attributes from kefir grains. Biomedicines 8(12):594. https://doi.org/10.3390/biomedicines8120594 Monteagudo-Mera A, Rodríguez-Aparicio L, Rúa J, Martínez-Blanco H, Navasa N, García-Armesto MR, Ferrero MÁ (2012) In vitro evaluation of physiological probiotic properties of different lactic acid bacteria strains of dairy and human origin. J Funct Foods 4(2):531–541. https://doi.org/10.1016/j.jff.2012.02.014 Alvarez MA, Moreno-Arribas MV (2014) The problem of biogenic amines in fermented foods and the use of potential biogenic amine-degrading microorganisms as a solution. Trends Food Sci Technol 39(2):146–155. https://doi.org/10.1016/j.tifs.2014.07.007 Davoodabadi A, Dallal MMS, Foroushani AR, Douraghi M, Harati FA (2015) Antibacterial activity of Lactobacillus spp . isolated from the feces of healthy infants against enteropathogenic bacteria. Anaerobe 34:53–58. https://doi.org/10.1016/j.anaerobe.2015.04.014 Ahire J, Jakkamsetty C, Kashikar M, Lakshmi S, Madempudi R (2021) In vitro evaluation of probiotic properties of Lactobacillus plantarum UBLP40 isolated from traditional indigenous fermented food. Probiotics Antimicrob Proteins 13(5):1413–1424. https://doi.org/10.1007/s12602-021-09775-7 McDermott PF, White DG, Zhao S, Simjee S, Walker RD (2004) Antimicrobial Susceptibility Testing. Preharvest and Postharvest Food Safety: Contemporary Issues and Future Directions 189–200. https://doi.org/10.1128/9781555817435.ch5 García V, Gambino M, Pedersen K, Haugegaard S, Olsen JE, Herrero-Fresno A (2020) F4-and F18-positive enterotoxigenic Escherichia coli isolates from diarrhea of postweaning pigs: genomic characterization. Appl Environ Microbiol 86(23):e01913–01920. https://doi.org/10.1128/AEM.01913-20 Ryu JH, Kim S, Park J, Choi KS (2020) Characterization of virulence genes in Escherichia coli strains isolated from pre-weaned calves in the Republic of Korea. Acta Vet Scand 62:1–7. https://doi.org/10.1186/s13028-020-00543-1 Vieco-Saiz N, Belguesmia Y, Raspoet R, Auclair E, Gancel F, Kempf I, Drider D (2019) Benefits and inputs from lactic acid bacteria and their bacteriocins as alternatives to antibiotic growth promoters during food-animal production. Front Microbiol 10:57. https://doi.org/10.3389/fmicb.2019.00057 Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, Morelli L, Canani RB, Flint HJ, Salminen S (2014) Expert consensus document: The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat reviews Gastroenterol Hepatol 11(8):506–514. https://doi.org/10.1038/nrgastro.2014.66 Yan Z, Liu Z, Ma Y, Yang Z, Liu G, Fang J (2023) Effects of Lactobacillus plantarum and Weissella viridescens on the Gut Microbiota and Serum Metabolites of Mice with Antibiotic-Associated Diarrhea. Nutrients 15(21):4603. https://doi.org/10.3390/nu15214603 Bao W, He Y, Yu J, Liu M, Yang X, Ta N, Zhang E, Liang C (2022) Regulatory effect of Lactiplantibacillus plantarum 2–33 on intestinal microbiota of mice with antibiotic-associated diarrhea. Front Nutr 9:921875. https://doi.org/10.3389/fnut.2022.921875 Han X, Ding S, Ma Y, Fang J, Jiang H, Li Y, Liu G (2021) Lactobacillus plantarum and Lactobacillus brevis alleviate intestinal inflammation and microbial disorder induced by ETEC in a murine model. Oxidative Med Cell Longev 2021(1):6867962. https://doi.org/10.1155/2021/6867962 Rubio R, Jofré A, Martín B, Aymerich T, Garriga (2014) M Characterization of lactic acid bacteria isolated from infant faeces as potential probiotic starter cultures for fermented sausages. Food microbiology 38: 303–311. https://doi.org/10.1016/j.fm.2013.07.015 Berkes E, Liao Y-H, Neef D, Grandalski M, Monsul N (2020) Potentiated in vitro probiotic activities of Lactobacillus fermentum LfQi6 biofilm biomass versus planktonic culture. Probiotics Antimicrob Proteins 12(3):1097–1114. https://doi.org/10.1007/s12602-019-09624-8 Liu X, Guo W, Cui S, Tang X, Zhao J, Zhang H, Mao B, Chen W (2021) A Comprehensive Assessment of the Safety of Blautia producta DSM 2950. Microorganisms 9(5):908. https://doi.org/10.3390/microorganisms9050908 Toropov V, Demyanova E, Shalaeva O, Sitkin S, Vakhitov T (2020) Whole-genome sequencing of Lactobacillus helveticus D75 and D76 confirms safety and probiotic potential. Microorganisms 8(3):329. https://doi.org/10.3390/microorganisms8030329 Bindu A, Lakshmidevi N (2021) Identification and in vitro evaluation of probiotic attributes of lactic acid bacteria isolated from fermented food sources. Arch Microbiol 203:579–595. https://doi.org/10.1007/s00203-020-02037-0 Ahire J, Sahoo S, Kashikar M, Heerekar A, Lakshmi S, Madempudi R (2023) In vitro assessment of Lactobacillus crispatus UBLCp01, Lactobacillus gasseri UBLG36, and Lactobacillus johnsonii UBLJ01 as a potential vaginal probiotic candidate. Probiotics Antimicrob Proteins 15(2):275–286. https://doi.org/10.1007/s12602-021-09838-9 Gill HS, Rutherfurd KJ, Prasad J, Gopal PK (2000) Enhancement of natural and acquired immunity by Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019). Br J Nutr 83(2):167–176. https://doi.org/10.1017/S0007114500000210 Nami Y, Haghshenas B, Khosroushahi AY (2018) Molecular identification and probiotic potential characterization of lactic acid bacteria isolated from human vaginal microbiota. Adv Pharm Bull 8(4):683. https://doi.org/10.15171/apb.2018.077 Peng X, Wang R, Hu L, Zhou Q, Liu Y, Yang M, Fang Z, Lin Y, Xu S, Feng B (2019) Enterococcus faecium NCIMB 10415 administration improves the intestinal health and immunity in neonatal piglets infected by enterotoxigenic Escherichia coli K88. J Anim Sci Biotechnol 10:1–15. https://doi.org/10.1186/s40104-019-0376-z Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 28 Apr, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted Editorial decision: Revision requested 10 Apr, 2025 Reviewers agreed at journal 26 Mar, 2025 Reviews received at journal 21 Feb, 2025 Reviewers agreed at journal 29 Jan, 2025 Reviewers agreed at journal 28 Jan, 2025 Reviewers invited by journal 28 Jan, 2025 Editor assigned by journal 07 Jan, 2025 Submission checks completed at journal 07 Jan, 2025 First submitted to journal 31 Dec, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5742040","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":398764641,"identity":"ea5e5b86-be17-4036-b9ba-ef0528cf1022","order_by":0,"name":"Fengjie Wang","email":"","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Fengjie","middleName":"","lastName":"Wang","suffix":""},{"id":398764642,"identity":"09bcd4b2-a4b2-435f-8c49-401d425fcd7f","order_by":1,"name":"Li Chen","email":"","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Chen","suffix":""},{"id":398764643,"identity":"6f007c9d-895b-4989-b72f-e89c4aded1d1","order_by":2,"name":"Yang Li","email":"","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Li","suffix":""},{"id":398764644,"identity":"0f3f0c33-a24a-4daa-bd3a-803520b1b3e9","order_by":3,"name":"Guangping Gao","email":"","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Guangping","middleName":"","lastName":"Gao","suffix":""},{"id":398764645,"identity":"18024470-6ae9-4202-b8cb-5cb7e2986871","order_by":4,"name":"Yanan Wang","email":"","orcid":"","institution":"Chengde City Academy of Agricultural and Forestry Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yanan","middleName":"","lastName":"Wang","suffix":""},{"id":398764646,"identity":"5b9797db-9a05-48ac-b0ae-9f6a8ee5680a","order_by":5,"name":"Ruili Shi","email":"","orcid":"","institution":"Weichang Manchu and Mongolian Autonomous County Animal Epidemic Control Center","correspondingAuthor":false,"prefix":"","firstName":"Ruili","middleName":"","lastName":"Shi","suffix":""},{"id":398764647,"identity":"996caca3-2130-47d5-b928-a93719276e56","order_by":6,"name":"Hongjun Zhang","email":"","orcid":"","institution":"Weichang Manchu and Mongolian Autonomous County Animal Epidemic Control Center","correspondingAuthor":false,"prefix":"","firstName":"Hongjun","middleName":"","lastName":"Zhang","suffix":""},{"id":398764648,"identity":"80804bb0-01e8-443c-a702-f6404216bb96","order_by":7,"name":"Yingyu Chen","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingyu","middleName":"","lastName":"Chen","suffix":""},{"id":398764649,"identity":"0771e957-aba7-4736-a35a-b6fb340d4992","order_by":8,"name":"Rui Cao","email":"","orcid":"","institution":"Qingdao Realvet Bio-Technology Co.,Ltd","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Cao","suffix":""},{"id":398764650,"identity":"f016a2fd-244a-4f59-a688-0d99942fda41","order_by":9,"name":"Qiumei Shi","email":"","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Qiumei","middleName":"","lastName":"Shi","suffix":""},{"id":398764651,"identity":"ecba532e-ec16-4259-99ae-0f4ba7081536","order_by":10,"name":"Tonglei Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYBAC+/7mgw8+VNjU87M3Nj78QIwWA4ljyYYzzqQlSPYcbjaWIEoLQ46ZNGfL4QSDG+ltAjzEaDFnOGAmzdhwOI/h5sM2BgkGOzndBgJaLJsbkq0Ld6QXM85ObHtQwJBsbHaAkDUHDhy8PfOMNWOzdGK7gQTDgcRthLUkNkjztjEztkkebJPgIUaLwYFkJqAW58QeCUYitUjOOMYMCmRjCZ5EYCAbEOEXfv7+j6ColLM/fvzhww8VdnKEvY/mTtKUj4JRMApGwSjAAQCrWUlZ2PdETwAAAABJRU5ErkJggg==","orcid":"","institution":"Hebei Normal University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Tonglei","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2024-12-31 12:53:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5742040/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5742040/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12602-025-10552-z","type":"published","date":"2025-04-28T15:57:44+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":73385298,"identity":"94b6aab7-ec5a-4d4d-b989-b94395a03df6","added_by":"auto","created_at":"2025-01-09 11:54:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5483705,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial Activity of CFS from \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1. The well diffusion method was used by adding 200 μL of CFS to each well, followed by incubation at 37 °C for 12 hours. The diameter of the inhibition zones was measured and recorded. (A) \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1; (B) \u003cem\u003eL.rhamnosus\u003c/em\u003eATCC53013\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/75b53e4918b72dc255e111d0.png"},{"id":73385420,"identity":"46487369-993d-4cd4-91d7-d3e194fbc583","added_by":"auto","created_at":"2025-01-09 11:54:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11224357,"visible":true,"origin":"","legend":"\u003cp\u003eHydrogen Peroxide Production by \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1. \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003eATCC53013 were streaked on modified MRS agar plates. After 48 hours of anaerobic incubation at 37 °C, the plates were exposed to air for more than 20 minutes to observe any blue coloration around the colonies. (A) \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 (B) \u003cem\u003eL.rhamnosus\u003c/em\u003eATCC53013.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/8511d4d9840a1422d2764848.png"},{"id":73385446,"identity":"27e309d7-a8b8-4d5a-9b01-f8164e398f63","added_by":"auto","created_at":"2025-01-09 11:54:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":822559,"visible":true,"origin":"","legend":"\u003cp\u003eAdhesion of bacteria to Caco-2 cells.\u0026nbsp; Bacteria were cultured to the appropriate concentration and added to Caco-2 cells at a multiplicity of infection (MOI) of 100:1. The mixture was centrifuged at 1,000 rpm for 5 minutes and incubated for 2 hours in a 37 ℃ incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. After incubation, the cells were washed three times with PBS and lysed with 1 mL of 1% Triton X-100. Bacterial counts were determined using a serial dilution method. The data represents the average of 3 replicates. (*\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ns means not significant difference)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/283225dace492a0ee9a5ec25.png"},{"id":73386093,"identity":"544bd91f-e990-448f-8e4d-e11033456d97","added_by":"auto","created_at":"2025-01-09 12:02:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":785287,"visible":true,"origin":"","legend":"\u003cp\u003eAcid, Bile Salt, and Heat Tolerance of \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e LCQ-1 (A) Survival rate of \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eLCQ-1 in MRS liquid medium at pH 3 and pH 4. (B) Survival rate of \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e LCQ-1 in MRS liquid medium containing 0.1% (w/v), 0.2% (w/v), and 0.3% (w/v) bile salts. (C) Survival rate of \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eLCQ-1 at different temperatures and exposure times. The data represent the average of three replicates. (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ns indicates no significant difference).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/246032935ad96f1615f2e5a1.png"},{"id":73385303,"identity":"e29f1afc-f611-481b-a14d-ea96f251d043","added_by":"auto","created_at":"2025-01-09 11:54:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":14485066,"visible":true,"origin":"","legend":"\u003cp\u003eIn vitro safety experiments of \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003eLCQ-1. (A) Hemolysis test: Left: \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e LCQ-1; Right: \u003cem\u003eS.aureus\u003c/em\u003e CMCC(B) 26003; (B) Gelatinase test: Left: \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e LCQ-1; Right: \u003cem\u003eP.aeruginosa \u003c/em\u003eATCC9027; (C) Mucin degradation test: Left: \u003cem\u003e\u003cstrong\u003eL.paracasei\u003c/strong\u003e\u003c/em\u003e LCQ-1; Right: \u003cem\u003eS.typhimurium\u003c/em\u003eATCC25241; (D) Tyrosine decarboxylase assay: Left: Tyrosine-free agar plate; Right: Tyrosine-supplemented agar plate; (E) Ornithine decarboxylase assay: Left: Ornithine-free agar plate; Right: Ornithine-supplemented agar plate; (F) Histidine decarboxylase assay: Left: Histidine-free agar plate; Right: Histidine-supplemented agar plate.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/da0f94ca75189b10c33c5dce.png"},{"id":73385419,"identity":"6103cb0d-cadb-4c1c-8dda-e48f728228d7","added_by":"auto","created_at":"2025-01-09 11:54:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3248471,"visible":true,"origin":"","legend":"\u003cp\u003ePCR Detection of Antibiotic Resistance Genes, Virulence Genes, and Amino Acid Decarboxylase Genes in\u003cem\u003e L.paracasei\u003c/em\u003e LCQ-1. (A) Electrophoresis image of amino acid decarboxylase genes. M: Marker DL2000; lanes 1-6 correspond to the \u003cem\u003ehdc1\u003c/em\u003e, \u003cem\u003ehdc2\u003c/em\u003e, \u003cem\u003ehdc3\u003c/em\u003e, \u003cem\u003etdc1\u003c/em\u003e, \u003cem\u003etdc2\u003c/em\u003e, and \u003cem\u003etdc3\u003c/em\u003e genes, respectively. (B) Electrophoresis image of virulence genes. M: Marker DL2000; lanes 1-7 correspond to the \u003cem\u003egelE\u003c/em\u003e, \u003cem\u003ecylA\u003c/em\u003e, \u003cem\u003ecylB\u003c/em\u003e, \u003cem\u003ecylM\u003c/em\u003e, \u003cem\u003easal\u003c/em\u003e, \u003cem\u003eace\u003c/em\u003e, and \u003cem\u003eesp\u003c/em\u003e genes, respectively. (C) Electrophoresis image of antibiotic resistance genes: M:Marker DL2000; lanes 1-12 correspond to the \u003cem\u003eaph\u003c/em\u003e, \u003cem\u003eant(6)\u003c/em\u003e, \u003cem\u003eaacI\u003c/em\u003e, \u003cem\u003eaccII\u003c/em\u003e, \u003cem\u003etet\u003c/em\u003e, \u003cem\u003evanI\u003c/em\u003e, \u003cem\u003evanII\u003c/em\u003e, \u003cem\u003eerm\u003c/em\u003e, \u003cem\u003ebla1\u003c/em\u003e, \u003cem\u003eblal1\u003c/em\u003e, \u003cem\u003esuI\u003c/em\u003e, and \u003cem\u003eqnr\u003c/em\u003e genes, respectively.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/2ef617353018847fc195f2d5.png"},{"id":73385432,"identity":"6cd85565-b1d8-4ca7-9ac2-d8ad4762351d","added_by":"auto","created_at":"2025-01-09 11:54:26","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1428106,"visible":true,"origin":"","legend":"\u003cp\u003eSerum Biochemical Analysis of Mice Administered Different Doses of \u003cem\u003eL.paracasei\u003c/em\u003eLCQ-1 via Gavage. (A) Liver function markers: DBIL-Z represents direct bilirubin; TBIL-Z represents total bilirubin; ALT represents alanine aminotransferase. (B) Kidney function markers: CREA represents creatinine; UA represents uric acid; BUN represents blood urea nitrogen. (C) Blood glucose, lipid, and cholesterol markers: TG represents triglycerides; GLU-YA represents glucose; TC represents total cholesterol. The data represents the average of 3 replicates. (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ns means not significant difference).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/0bf73c4aea26a03145411498.png"},{"id":73385418,"identity":"ba3e0c4f-3a2c-434c-8f7f-193338274241","added_by":"auto","created_at":"2025-01-09 11:54:25","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":23843165,"visible":true,"origin":"","legend":"\u003cp\u003eHistopathological Examination of the Ileum in Mice Administered \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 via Gavage (200×) (A) Group A: Mice gavaged with 2×10⁷ CFU/mouse. (B) Group B: Mice gavaged with 2×10⁸ CFU/mouse. (C) Group C: Mice gavaged with 2×10⁹ CFU/mouse. (D) Group D: Mice gavaged with 200 μL of PBS.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/bfbef0947e69b0fea0b45b82.png"},{"id":73385449,"identity":"24a7fb64-d97e-472f-95d7-fe23fce9d638","added_by":"auto","created_at":"2025-01-09 11:54:28","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":15930818,"visible":true,"origin":"","legend":"\u003cp\u003eClinical symptoms of mice infected with \u003cem\u003eE.coli\u003c/em\u003eK99. (A) Swelling of the mouse eyelids with increased secretion; (B) Fecal contamination around the mouse anus; (C) Gray-green, pasty, loose stool excreted by the mouse.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/d4cb59210e03c9908a5bcca9.png"},{"id":73386924,"identity":"c0fc7748-c0e6-4018-bbb1-7c2a6f7e14ce","added_by":"auto","created_at":"2025-01-09 12:10:19","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":292512,"visible":true,"origin":"","legend":"\u003cp\u003eSurvival rate after intraperitoneal challenge with\u003cem\u003e E.coli\u003c/em\u003e K99.\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/9652f366bc415b0c397ca2c4.png"},{"id":81988207,"identity":"899e6f8a-417e-4da5-a5e3-2dde33496c84","added_by":"auto","created_at":"2025-05-05 16:08:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":73300549,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5742040/v1/f5f5ff16-862f-46b0-99bc-265669846be4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Lactobacillus paracasei LCQ-1 Exhibits Good Safety and Effectively Prevents Escherichia coli K99-Induced Diarrhea in Mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e (\u003cem\u003eE.coli\u003c/em\u003e) is one of the common pathogenic bacteria causing diarrhea in livestock and poultry, posing a serious threat to the intestinal health of livestock and poultry[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Diarrhea caused by \u003cem\u003eE.coli\u003c/em\u003e is particularly common among young livestock and poultry such as piglets, calves, and poultry. This is because their immune systems are not yet fully developed, making them vulnerable to infection[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Diarrhea caused by \u003cem\u003eE.coli\u003c/em\u003e can lead to dehydration, impaired nutrient absorption, weakened immunity, and even death in livestock and poultry, thereby bringing huge economic losses to the livestock industry. The K99 strain is a serotype of enterotoxigenic \u003cem\u003eE.coli\u003c/em\u003e (ETEC) and is one of the main pathogens causing diarrhea in young livestock and poultry such as piglets and calves[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The K99 strain has unique adhesion factors and the ability to produce toxins. It can colonize in the host's intestine and cause severe watery diarrhea, especially being highly pathogenic to young animals aged 1 to 3 weeks.\u003c/p\u003e \u003cp\u003eAntibiotics were once the preferred measure for preventing and controlling diarrhea caused by \u003cem\u003eE.coli\u003c/em\u003e K99[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the overuse of antibiotics poses a potential threat to both public health and animal health. Therefore, it is necessary to explore new treatment methods. Numerous studies have shown that probiotics are effective in regulating intestinal flora and inhibiting the colonization of pathogenic bacteria[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. It is worth noting that the use of probiotics has also attracted attention in the prevention and control of calf diarrhea[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Probiotics can regulate the balance of intestinal flora, inhibit the colonization of pathogenic bacteria, and enhance the immunity of livestock and poultry, thereby reducing the risk of \u003cem\u003eE.coli\u003c/em\u003e K99 infection. This probiotic intervention method has gradually been regarded as an effective measure to reduce the use of antibiotics and improve the health level of animals.\u003c/p\u003e \u003cp\u003eLactic acid bacteria, as beneficial microorganisms widely distributed in nature and closely related to human and animal health, exhibit unique biological characteristics and functions in promoting digestion, enhancing immunity, and preventing and treating diseases through antibacterial activities[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In recent years, with the in-depth research, the species of lactic acid bacteria have become more abundant, and their functions have been more comprehensively elucidated. Besides the common Lactobacillus genus, it also includes multiple genera such as \u003cem\u003eBifidobacterium\u003c/em\u003e and \u003cem\u003eStreptococcus\u003c/em\u003e. Among them, \u003cem\u003eLactobacillus paracasei\u003c/em\u003e (\u003cem\u003eL.paracasei\u003c/em\u003e), as a crucial member of the Lactobacillus family, occupies an important position in the field of probiotic research due to its remarkable probiotic effects[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Especially in the currently highly concerned fields of antibiotic-free farming and functional food development, it has extremely broad application potential and prospects[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Numerous studies have shown that \u003cem\u003eL.paracasei\u003c/em\u003e has the ability to colonize successfully in the host intestine. By secreting a series of antibacterial substances such as lactic acid, hydrogen peroxide, and bacteriocin[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], it effectively reduces the pH value inside the intestine, thereby significantly inhibiting the growth of harmful bacteria and powerfully maintaining the balanced and stable state of the intestinal microbiota. At the same time, \u003cem\u003eL.paracasei\u003c/em\u003e can also actively participate in the regulation process of the host immune system, significantly promote the activity enhancement of immune cells, greatly enhance the body's resistance to various pathogens, and play a positive and beneficial role in multiple physiological processes such as alleviating the body's inflammatory response and reducing blood lipid levels[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In animal health management and breeding industry practice, due to its natural and safe characteristics, \u003cem\u003eL.paracasei\u003c/em\u003e is widely used in the breeding and production processes of poultry, pigs, and ruminants[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It can effectively improve the utilization rate of feed, significantly reduce the amount of antibiotic use, and thus decrease the frequency of animal diseases. Especially under the background of the vigorous promotion of the antibiotic-free farming policy, \u003cem\u003eL.paracasei\u003c/em\u003e provides a valuable alternative strategy and approach for ensuring the intestinal health of animals and enhancing the immunity of animal bodies, laying a solid foundation for the construction of a sustainable and healthy breeding model[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, although most lactic acid bacteria show beneficial characteristics, in specific situations, some lactic acid bacteria may transform into opportunistic pathogenic bacteria, causing diseases such as Lactobacillus bacteremia and other infectious diseases. Previous studies have confirmed that certain strains of lactic acid bacteria carry virulence factors such as hemolysin and gelatinase. These virulence factors can decompose mucoproteins in parts such as the intestinal mucosa, thereby causing damage to body tissues[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Some strains have amino acid decarboxylase activity and can convert amino acids in food into biogenic amines, and excessive biogenic amines will have toxic effects on the host[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. When the intervention dose of lactic acid bacteria in animals is too high, it will lead to abnormal changes in the biochemical indexes in animals and cause damage to organs such as the liver. In addition, some lactic acid bacteria can migrate to other organs after entering the intestine, causing local or systemic infections. Therefore, before a new probiotic candidate strain is put into practical application, a comprehensive and rigorous safety assessment must be carried out.\u003c/p\u003e \u003cp\u003eOur research group successfully isolated a strain of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 from a fresh cow feces sample. To deeply explore the probiotic characteristics and safety level of this strain, we carried out systematic experimental analyses from both in vivo and in vitro experimental dimensions and conducted a challenge protection experimental study using a mouse diarrhea model. The results obtained in this study have laid a crucial foundation for the application of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 in the prevention and control of animal diarrhea diseases caused by the \u003cem\u003eE.coli\u003c/em\u003e K99 strain.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStrains and Cells\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL.paracasei\u003c/em\u003e (LCQ-1) was preserved at the Key Laboratory of Veterinary Preventive Medicine of Hebei Province. \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e (\u003cem\u003eL.rhamnosus\u003c/em\u003e) ATCC53103, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS.aureus\u003c/em\u003e) CMCC(B)26003 was obtained from Wuhan Mioling Biotechnology Co., LTD. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e (\u003cem\u003eP.aeruginosa)\u003c/em\u003e ATCC9027 were obtained from Shanghai Bioresource Collection Center. \u003cem\u003eSalmonella typhimurium\u003c/em\u003e (\u003cem\u003eS.typhimurium\u003c/em\u003e) ATCC25241 was obtained from Beijing BIOBOV Biotechnology Co., LTD. \u003cem\u003eSalmonella enteritidis\u003c/em\u003e (\u003cem\u003eS.enteritidis\u003c/em\u003e) C50336 was purchased from the China Institute of Veterinary Drug Control. \u003cem\u003eE.coli\u003c/em\u003e K99 was isolated from a beef cattle farm. \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 were cultured in MRS liquid medium and on MRS agar plates under anaerobic conditions at 37 ℃. The other strains were cultured in BHI liquid medium and on BHI agar plates at 37 ℃. The Caco-2 BBE cell line, derived from human colorectal carcinoma epithelial cells, was obtained from the BeNa Culture Collection (Shanghai, China). Cells were cultured in DMEM supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Co., Ltd., China). Antibiotics were added as needed, including either 50 \u0026micro;g/mL streptomycin with 50 U/mL penicillin, or 50 \u0026micro;g/mL gentamicin. Cultures were maintained at 37\u0026deg;C in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExperimental animal\u003c/h3\u003e\n\u003cp\u003eFemale Kunming (KM) mice, aged 6\u0026ndash;8 weeks, were selected for this study. The mice were kept in a sterile environment under standard feeding conditions. Housing parameters were strictly controlled, with a temperature of 22.0\u0026deg;C (\u0026plusmn;\u0026thinsp;0.5\u0026deg;C), relative humidity of 60% (\u0026plusmn;\u0026thinsp;10%), and a 12-hour light/dark cycle. The animals were obtained from Spay (Beijing) Biotechnology Co., Ltd., Beijing, China. All experimental procedures complied with the Experimental Animal Regulation Ordinances of the Hebei Provincial Department of Science and Technology. Ethical approval was granted by the Animal Ethics Committee of Hebei Normal University of Science and Technology (permit number 2020-17).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of Probiotic Properties of\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1 in vitro\u003c/b\u003e\u003c/p\u003e\n\u003ch3\u003eAntimicrobial Activity Analysis\u003c/h3\u003e\n\u003cp\u003eThe antimicrobial activity of \u003cem\u003eL.paracasei\u003c/em\u003e against \u003cem\u003eE.coli\u003c/em\u003e K99 was assessed using the well-diffusion method as described previously[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. \u003cem\u003eE.coli\u003c/em\u003e K99 at the logarithmic phase of growth was adjusted to a concentration of 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mL, and 200 \u0026micro;L of this suspension was evenly spread on BHI agar plates. A single colony of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 from MRS agar plates was inoculated into MRS liquid medium and cultured anaerobically at 37 ℃ overnight. The next day, the culture was sub-cultured in fresh MRS liquid medium at a 1:50 ratio and incubated anaerobically at 37 ℃ for 2 days. The culture was then centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatant was collected. The supernatant was filtered through a 0.22 \u0026micro;m micropore filter to remove any remaining cells, resulting in a cell-free supernatant (CFS) of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, which was stored at 4 ℃ for later use. Using the well-diffusion method, 200 \u0026micro;L of the CFS was added to wells on BHI agar plates, and the plates were incubated at 37 ℃ for 12 hours. The diameter of the inhibition zone was measured and recorded. Similarly, a CFS of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC 53013 was prepared as a positive control, and PBS was used as a negative control.\u003c/p\u003e\n\u003ch3\u003eProduction of Organic Acids and Hydrogen Peroxide by L.paracasei LCQ-1\u003c/h3\u003e\n\u003cp\u003eOrganic acids and hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) are key antimicrobial substances produced by lactic acid bacteria. The production of acids was measured as follows: \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC 53013 were each cultured on MRS agar plates, and the CFS were prepared every 8 hours. pH values of the CFS were measured using a pH meter, and the monitoring was continued for 48 hours. Sterile MRS liquid medium served as the negative control.\u003c/p\u003e \u003cp\u003eH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e production was assessed according to a previously described method. MRS agar plates supplemented with horseradish peroxidase and TMB (3,3',5,5'-tetramethylbenzidine) were used to evaluate and quantify hydrogen peroxide production by the \u003cem\u003eL.paracasei\u003c/em\u003e. A single colony of each strain was streaked onto the modified MRS agar and incubated under micro-aerobic conditions at 37 ℃ for 48 hours. After incubation, the plates were exposed to air, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e production was determined by the time required for blue coloration to develop. The following scoring criteria were used: 0 (no coloration), 1 (low, \u0026gt;\u0026thinsp;20 min), 2 (moderate, 10\u0026ndash;20 min), and 3 (high, \u0026lt;\u0026thinsp;10 min).\u003c/p\u003e\n\u003ch3\u003eHydrophobicity, Autoaggregation, and Coaggregation Assays\u003c/h3\u003e\n\u003cp\u003eThe surface hydrophobicity of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was determined using the xylene assay. The procedure was as follows: \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 were inoculated into MRS liquid medium and cultured anaerobically at 37\u0026deg;C overnight. After incubation, the cultures were centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatants were discarded. The pellets were washed twice with PBS and resuspended, adjusting OD\u003csub\u003e600\u003c/sub\u003e to 0.6. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 was used as a positive control.\u003c/p\u003e \u003cp\u003e(1) For the hydrophobicity test: 1 mL of xylene was mixed with 3 mL of bacterial suspension (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.6) in a centrifuge tube, thoroughly mixed, and left to stand for 1 hour. When phase separation occurred, the OD\u003csub\u003e600\u003c/sub\u003e of the aqueous phase was measured. For the control group, 1 mL of xylene was mixed with 3 mL of PBS buffer. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 served as the positive control. The Surface Hydrophobicity Rate was calculated using the following formula:\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eSurface Hydrophobicity Rate (%) = (A\u003csub\u003e0\u003c/sub\u003e\u0026ndash;A\u003csub\u003e1\u003c/sub\u003e)/A\u003csub\u003e0\u003c/sub\u003e\u0026times;100%\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eWhere A\u003csub\u003e0\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e of the bacterial suspension immediately after mixing, and A\u003csub\u003e1\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e after standing for 1 hour.\u003c/p\u003e \u003cp\u003e(2) For the autoaggregation assay: 5 mL of bacterial suspension (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.6) was left to stand at room temperature for 2 hours. Then, 3 mL of the upper phase was removed, and OD\u003csub\u003e600\u003c/sub\u003e was measured. The Autoaggregation Rate was calculated using the following formula:\u003c/p\u003e \u003cp\u003eAutoaggregation Rate (%) =(A\u003csub\u003e0\u003c/sub\u003e\u0026ndash;A\u003csub\u003e2\u003c/sub\u003e)/A\u003csub\u003e0\u003c/sub\u003e\u0026times;100%\u003c/p\u003e \u003cp\u003eWhere A\u003csub\u003e0\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e of the bacterial suspension immediately after mixing, and A\u003csub\u003e2\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e of the suspension after 2 hours.\u003c/p\u003e \u003cp\u003e(3) For the coaggregation assay: \u003cem\u003eE. coli\u003c/em\u003e K99 and \u003cem\u003eS.enterica\u003c/em\u003e C50336 were inoculated into BHI liquid medium and cultured overnight at 37 ℃. After incubation, the cultures were centrifuged at 8,000 rpm for 15 minutes at 4 ℃, and the supernatants were discarded. The bacterial pellets were washed with PBS and resuspended to an OD\u003csub\u003e600\u003c/sub\u003e of 0.6. Equal volumes (2 mL each) of \u003cem\u003eE.coli\u003c/em\u003e K99 and \u003cem\u003eS.enterica\u003c/em\u003e C50336 were mixed with 2 mL of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.6) and incubated at room temperature for 2 hours. After incubation, 3 mL of the upper phase was removed, and the OD\u003csub\u003e600\u003c/sub\u003e was measured. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 served as a positive control. The Coaggregation Rate was calculated using the following formula:\u003c/p\u003e \u003cp\u003eCoaggregation Rate (%) = (A\u003csub\u003e0\u003c/sub\u003e\u0026ndash;A\u003csub\u003e3\u003c/sub\u003e)/A\u003csub\u003e0\u003c/sub\u003e\u0026times;100%\u003c/p\u003e \u003cp\u003eWhere A\u003csub\u003e0\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e of the mixed bacterial suspension immediately after mixing, and A\u003csub\u003e3\u003c/sub\u003e is the OD\u003csub\u003e600\u003c/sub\u003e after 2 hours of incubation.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell Adhesion Assay\u003c/h2\u003e \u003cp\u003eThe cell adhesion ability of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was evaluated using Caco-2 cells. Caco-2 cells were adjusted to a concentration of 8\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL, and 1 mL of the cell suspension was added to each well of a 12-well cell culture plate. \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013, \u003cem\u003eE.coli\u003c/em\u003e K99, and \u003cem\u003eS.enterica\u003c/em\u003e C50336 were adjusted to 8\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mL and added to the cells at a multiplicity of infection (MOI) of 100:1. The plate was centrifuged at 1,000 rpm for 5 minutes and incubated in a 37 ℃, 5% CO₂ incubator for 2 hours. After incubation, the cells were washed three times with PBS. The cells were then lysed with 1 mL of 1% Triton X-100, and bacterial counts were determined using the serial dilution method. The Cell Adhesion Rate for each strain was calculated using the following formula:\u003c/p\u003e \u003cp\u003eCell Adhesion Rate=(Adherent Bacteria Count/Initial Inoculated Bacteria Count)\u0026times;100%\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAcid, Bile Salt, and Heat Resistance Assays\u003c/h3\u003e\n\u003cp\u003eTolerance to acid, bile salts, and high temperatures is a crucial prerequisite for the probiotic efficacy of lactic acid bacteria.\u003c/p\u003e \u003cp\u003e(1) Acid Tolerance Assay: \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37 ℃ overnight. The following day, a 1:50 dilution (1 mL) of the overnight culture was transferred into MRS medium adjusted to pH 3 and pH 4, and incubated anaerobically at 37 ℃ for 4 hours. Bacterial counts of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 were performed at 0 and 4 hours using the drop plate method. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 was used as a positive control.\u003c/p\u003e \u003cp\u003e(2) Bile Salt Tolerance Assay: The overnight culture of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was inoculated into MRS liquid medium containing bile salts at concentrations of 0.1%, 0.2%, and 0.3% (w/v), at a 1:50 dilution (1 mL). The cultures were incubated anaerobically at 37 ℃ for 4 hours, and bacterial counts were taken at 0 and 4 hours using the drop plate method. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 served as a positive control.\u003c/p\u003e \u003cp\u003e(3) Heat Resistance Assay: \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37\u0026deg;C overnight. The next day, a 1:50 dilution (1 mL) of the overnight culture was inoculated into 50 mL of fresh MRS medium and incubated anaerobically at 37 ℃ for 4 hours. The cultures were then exposed to high temperatures in a thermostatic water bath at 50 ℃, 60 ℃, and 70 ℃ for 5, 10, and 15 minutes. Bacterial counts were determined at each time point using the drop plate method. \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 was used as a positive control.\u003c/p\u003e\n\u003ch3\u003eIn vitro Safety Evaluation of L.paracasei LCQ-1\u003c/h3\u003e\n\u003cp\u003e \u003cstrong\u003e(1) Hemolytic Activity and Gelatinase Assay\u003c/strong\u003e \u003cp\u003eA single colony of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was inoculated into MRS liquid medium and incubated anaerobically at 37 ℃ overnight. The next day, 5 \u0026micro;L of the culture was spotted onto blood agar and gelatin agar plates, followed by incubation anaerobically at 37 ℃ for 24 hours. The presence of hemolytic zones or clear areas around the colonies was observed. \u003cem\u003eS.aureus\u003c/em\u003e CMCC(B)26003 was used as the positive control for hemolysis, and \u003cem\u003eP.aeruginosa\u003c/em\u003e, ATCC9027 was used as the positive control for gelatinase activity.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(2) Mucin Degradation Assay\u003c/strong\u003e \u003cp\u003eA 5 \u0026micro;L aliquot of the overnight culture of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was spotted onto MRS agar plates containing 0.3% (w/v) mucin and incubated anaerobically at 37 ℃ for 24 hours. The plates were stained with Coomassie Brilliant Blue for 30 minutes, then washed with 1.2 M acetic acid[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A mucin degradation zone around the colony was considered positive, while the absence of such a zone was considered negative. \u003cem\u003eS.typhimurium\u003c/em\u003e ATCC25241was used as the positive control.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(3) Biogenic Amine Production Assay\u003c/strong\u003e \u003cp\u003eBiogenic amines such as tyramine, histamine, and putrescine were assessed using amino acid decarboxylase agar media. A 5 \u0026micro;L aliquot of the overnight culture of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was spotted onto decarboxylase agar plates containing tyrosine, histidine, and ornithine, respectively. After the liquid had absorbed, the plates were incubated anaerobically at 37 ℃ for 24 hours. If \u003cem\u003eL. paracasei\u003c/em\u003e LCQ-1 cannot produce decarboxylase, the organic acids produced during its metabolism will cause bromocresol purple in the medium to turn yellow, resulting in a yellowish medium. If \u003cem\u003eL. paracasei\u003c/em\u003e LCQ-1 produces decarboxylase, the enzyme facilitates the decarboxylation of amino acids, generating amines that are alkaline. These can neutralize or partially neutralize the acidic substances produced by the metabolism of lactic acid bacteria, and the medium will remain purple or slightly yellow. Therefore, colonies that turned yellow from purple were considered negative, while colonies that remained purple were considered positive. Plates without the respective decarboxylase substrates served as negative controls.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e(4) Antibiotic Susceptibility Testing: Antibiotic resistance of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was determined by the Kirby-Bauer disk diffusion method. A total of 18 antibiotic discs (purchased from Hangzhou Microbial Reagents Co., Hangzhou, China) were tested: streptomycin, lincomycin, ampicillin, gentamicin, ampicillin, amikacin, kanamycin, polymyxin B, cefotaxime, cefepime, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, vancomycin, cefazolin, and minocycline. A 200 \u0026micro;L aliquot of the overnight culture of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was evenly spread onto MRS agar plates, and antibiotic discs were placed on the plates. The plates were incubated anaerobically at 37 ℃ for 24 hours, and the inhibition zone diameter was measured according to National Committee for Clinical Laboratory Standards (NCCLS)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The susceptibility of the strains was classified as sensitive (S), intermediate (I), or resistant (R).\u003c/p\u003e \u003cp\u003e(5) PCR Detection of Antibiotic Resistance, Virulence, and Decarboxylase Genes: The primer sequences and annealing temperatures for antibiotic resistance, virulence, and decarboxylase genes are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR was performed using the genomic DNA of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 as the template to detect these genes. The PCR reaction was conducted in a 25 \u0026micro;L mixture containing 0.4 \u0026micro;M of each primer (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 2 \u0026micro;L template DNA, 12.5 \u0026micro;L of 2 \u0026times; Taq Master Mix (Jiangsu Kangwei Century Biotechnology Co., Jiangsu, China), and nuclease-free water to a final volume of 25 \u0026micro;L. The PCR conditions were as follows: initial denaturation at 95 ℃ for 10 minutes, followed by 30 cycles of denaturation at 95 ℃ for 30 seconds, annealing at the corresponding temperature for 30 seconds, and extension at 72 ℃ for 30 seconds, with a final extension at 72\u0026deg;C for 5 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnnealing temperature(\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaI\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGKCGAGATAGGAAGTGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e526\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaI\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGTCGGCGAAGGTAAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanI\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGCCATGTTCAGGTAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e252\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanI\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCACCGTCAACAATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanII\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGAAGTTTAACGATGATTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evanII\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCACCAACTCAATTTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eerm\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTAAGCATAATACCGAAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e853\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eerm\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTAAGCATAATACCGAAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etet\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGAACAATGGGATACRGTAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e589\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etet\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTAGAAGSGGATCACTATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eant(6)\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCWTTYTGTTTCAGGATTTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e402\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eant(6)\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGAGGTAACGAAAGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaacI\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGTTTCAAATCCTCATCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e485\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaacI\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTACCCCGCGGCTGTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaacII\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAKGCTGCTWTTACCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e702\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaacII\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGACCGGGGATGAGCTTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eapH\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGKATGTGCTTGTTCAACGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e406/350\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eapH\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGCTTCGACGTCGCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaII\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTACTCACCAGTCACAGAAAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eblaII\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACTTCCCGTCGTGTAGATAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003esul\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTTTCGTCCGACACAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e57\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003esul\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGCGCAGCCGCAATTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqnr\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGACGCCATTACTGTATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e562\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqnr\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCGCAATGTGTGAAGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcJV16HC\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGATGGTATTGTTTCTTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e367\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcJV16HC\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACCATACACCATAACCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcPHDC\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAAACACCAGCATCTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e497\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcPHDC\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTGCGGAAACAAAGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcZu\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTGATGGTATTGTTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e327\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehdcZu\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCTTTGGACGTTCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcTD\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACATAGTCAACCATRTTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcTD\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAATGGAAGAAGAAGTAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcLao\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGGCATAGTTCTTGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e156\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcLao\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCGCATAGACTTCTGGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcTDC\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGYTNGTNCCNCARACNAARCAYTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e825\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etdcTDC\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACRTARTCNACCATRTTRAARTCNGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egelE\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCCGTATCATTGGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e419\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egelE\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGCATTGCTTTTCCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecylA\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGATGATAGTGATAGGAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e517\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecylA\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTACAGTAAATCTTTCGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecylB\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCCTACCTATGTTCTGTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e843\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecylB\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATAAACTCTCTTTTCCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCylM\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGATGGAAAGAAGATAGTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e742\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCylM\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAGTTGGTCTGATTACATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003easal\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGAAAAAGAAGTAGACCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1553\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003easal\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACGGCAAGACAAGTAAATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eace\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAATTGAGCAAAAGTTCAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eace\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTGTCTTTTCACTTGTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eesp\u003c/em\u003e-for\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGCTAATGCTAGTCCACGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e932\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eesp\u003c/em\u003e-rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGTCAACACTTGCATTGCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eIn Vivo Safety Evaluation of\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAcute Oral Toxicity Test\u003c/h2\u003e \u003cp\u003e The acute oral toxicity test was performed according to the method described in GB15193.3-2014, \"Acute Oral Toxicity Test.\" Ten female Kunming mice (6\u0026ndash;8 weeks old) were randomly divided into two groups (n\u0026thinsp;=\u0026thinsp;5). Group A was orally administered \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 at a dose of 2\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/mouse, while Group B was administered 200 \u0026micro;L of PBS. The animals were treated for 14 consecutive days, and their clinical manifestations were observed and recorded daily.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e28-Day Oral Toxicity Test\u003c/h2\u003e \u003cp\u003eThe 28-day oral toxicity test followed the guidelines in GB15193.22-2014, \"28-Day Oral Toxicity Test.\" Twenty female Kunming mice (6\u0026ndash;8 weeks old) were randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;5). Mice in groups A, B, and C were orally administered \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 at doses of 200 \u0026micro;L/mouse, with concentrations of 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mL, 1\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/mL, and 1\u0026times;10\u003csup\u003e10\u003c/sup\u003e CFU/mL, respectively. Group D served as the control group, receiving an equal volume of physiological saline. The treatment lasted for 28 days, and the following assessments were performed to evaluate the safety of the probiotics: organ index, probiotic translocation, bacterial infection analysis, blood biochemical indices, and histopathological observations.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(1) Organ Index Measurement\u003c/strong\u003e \u003cp\u003eMice were euthanized, and the heart, liver, spleen, lungs, and kidneys were collected under sterile conditions. The organ weight was measured, and the organ index was calculated using the formula\u003c/p\u003e \u003c/p\u003e \u003cp\u003eOrgan Index(%)\u0026thinsp;=\u0026thinsp;Organ Weight(g)/Body Weight(g)\u0026times;100%\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(2) Probiotic Translocation and Infection Analysis\u003c/strong\u003e \u003cp\u003eMice were euthanized, and the heart, liver, spleen, lungs, and kidneys were collected under sterile conditions. Tissue samples from each organ were streaked onto MRS agar plates, incubated anaerobically at 37 ℃ for 24 hours, and observed for bacterial colony growth, which would indicate the translocation of probiotics.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(3) Blood Biochemical Analysis\u003c/strong\u003e \u003cp\u003eTail vein blood was collected, and serum was separated. Liver function, kidney function, blood glucose, blood lipids, and cholesterol levels were analyzed using an automatic biochemical analyzer (Jiangsu Su-Lian Ke Biological Technology Co., Jiangsu, China).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(4) Histopathological Analysis\u003c/strong\u003e \u003cp\u003eMice were euthanized, and 1 cm segments of the ileum were immediately fixed in pre-cooled 4% paraformaldehyde for 24 hours. The fixed tissue was dehydrated in a series of ethanol solutions (70%, 80%, 90%, 100%), followed by infiltration with xylene and embedding in paraffin. Sections were cut to 4\u0026ndash;6 \u0026micro;m thickness using a microtome and stained with hematoxylin and eosin (H\u0026amp;E). The slides were observed under a microscope for histopathological changes.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIn Vivo Probiotic Efficacy Assessment\u003c/h2\u003e \u003cp\u003eThe toxicity of \u003cem\u003eE.coli\u003c/em\u003e K99 was evaluated in mice to determine the infection dose. Thirty female Kunming mice (6\u0026ndash;8 weeks old) were randomly divided into six groups (n\u0026thinsp;=\u0026thinsp;5). The first five groups received intraperitoneal injections of \u003cem\u003eE.coli\u003c/em\u003e K99 at doses of 5.56\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mouse, 5.56\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mouse, 5.56\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mouse, 5.56\u0026times;10\u003csup\u003e5\u003c/sup\u003e CFU/mouse, and 5.56\u0026times;10\u003csup\u003e4\u003c/sup\u003e CFU/mouse. The sixth group received an equal volume of PBS. Mice were observed for 14 days, and the number of deaths was recorded. The LD\u003csub\u003e50\u003c/sub\u003e of \u003cem\u003eE.coli\u003c/em\u003e K99 was calculated using the Spearman-Karber method:\u003c/p\u003e \u003cp\u003elogLD\u003csub\u003e50\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;X\u003csub\u003ek\u003c/sub\u003e-i(\u0026sum;p-0.5), Where X_k is the highest logarithmic dose, i is the difference between two consecutive logarithmic doses, and \u0026sum;p is the total mortality rate across all groups.\u003c/p\u003e \u003cp\u003eTo assess the protective effect of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, twenty female Kunming mice (6\u0026ndash;8 weeks old) were randomly divided into two groups (n\u0026thinsp;=\u0026thinsp;10). The mice from Group A received continuous oral administration of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 (200 \u0026micro;L/mouse, 1\u0026times;10\u003csup\u003e10\u003c/sup\u003e CFU/mL) for 14 days. The mice from Group B received 200 \u0026micro;L of PBS as the control. On day 14, both groups were intraperitoneally injected with \u003cem\u003eE.coli\u003c/em\u003e K99 at the dose corresponding to 1\u0026times;LD\u003csub\u003e50\u003c/sub\u003e. Mice were observed for another 14 days, and morbidity and mortality were recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003e Statistical analyses were conducted using IBM SPSS Statistics 26, with one-way analysis of variance (ANOVA) followed by LSD-mean multiple comparison tests. The data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistically significant differences were indicated with asterisks (*), where *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 denote significant differences in mean values.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIn Vitro Experiments Demonstrate Probiotic Characteristics of\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1\u003c/b\u003e\u003c/p\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eL.paracasei LCQ-1 Exhibits Antibacterial Activity Against E.coli K99\u003c/h2\u003e \u003cp\u003eThe antimicrobial activity of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 was assessed by the well diffusion method using their respective CFS. The results, shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), indicated that the CFS of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibited a larger inhibition zone (18 mm) against \u003cem\u003eE.coli\u003c/em\u003e K99 compared to the CFS of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013, which showed an inhibition zone of 7 mm. These findings suggest that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 possesses significantly stronger antibacterial activity against \u003cem\u003eE.coli\u003c/em\u003e K99 than \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013. Thus, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrates excellent antimicrobial properties against \u003cem\u003eE.coli\u003c/em\u003e K99.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAcid Production by L.paracasei LCQ-1 and Hydrogen Peroxide Absence\u003c/h2\u003e \u003cp\u003eThe acid production ability of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was assessed by measuring the pH of its CFS. The results (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) show that as the incubation time increased, the pH of the CFS gradually decreased. After 40 hours of incubation, the pH stabilized, with no significant further decrease. Additionally, no significant difference was observed between \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and the control strain \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013, indicating a strong acid production capacity. To evaluate hydrogen peroxide (H₂O₂) production, MRS agar medium supplemented with horseradish peroxidase and TMB was used. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) showed that even after extending the exposure time to air for more than 20 minutes, no blue coloration developed around the colonies of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, indicating that it does not produce hydrogen peroxide. Similarly, no blue coloration was observed for \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 colonies. These results demonstrate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibits strong acid production ability but does not produce hydrogen peroxide.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003epH of CFS from \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 at Different Time Points\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e48h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e56h\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL.paracasei\u003c/em\u003eLCQ-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e4.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e3.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e3.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL.rhamnosus\u003c/em\u003eATCC53013\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e3.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e3.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e3.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMRS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e5.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eL.paracasei LCQ-1 Exhibits Strong Hydrophobicity, Self-Aggregation, and Co-Aggregation Capabilities\u003c/h2\u003e \u003cp\u003eHydrophobicity, self-aggregation, and co-aggregation abilities are important indicators for assessing the probiotic potential of lactic acid bacteria. The experimental results demonstrated (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) that the hydrophobicity of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was 57\u0026thinsp;\u0026plusmn;\u0026thinsp;2.67%, significantly higher than the 27\u0026thinsp;\u0026plusmn;\u0026thinsp;2.44% hydrophobicity observed for \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013. Furthermore, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibited a self-aggregation rate of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.04%, which was significantly higher than the 38\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71% self-aggregation rate of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013. In co-aggregation experiments, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 showed co-aggregation rates of 21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13% with \u003cem\u003eE.coli\u003c/em\u003e K99 and 16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13% with \u003cem\u003eS.enteritis\u003c/em\u003e C50336. In contrast, \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 exhibited co-aggregation rates of 13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22% with \u003cem\u003eE.coli\u003c/em\u003e K99 and 2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1% with \u003cem\u003eS.enteritis\u003c/em\u003e C50336. These results demonstrate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 has significantly higher co-aggregation capabilities compared to \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013.The results indicate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 possesses excellent hydrophobicity, self-aggregation, and co-aggregation abilities, which are important features for its probiotic potential.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHydrophobicity, Self-Aggregation, and Co-Aggregation Rates of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHydrophobicity (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAuto‑aggregation(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eCo‑aggregation(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXylene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eE.coli\u003c/em\u003e K99\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eS.enteritis\u003c/em\u003e C50336\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e57\u0026thinsp;\u0026plusmn;\u0026thinsp;2.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e27\u0026thinsp;\u0026plusmn;\u0026thinsp;2.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e38\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePBS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e21\u0026thinsp;\u0026plusmn;\u0026thinsp;1.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eL.paracasei LCQ-1 Exhibits Strong Adhesion Capability\u003c/h2\u003e \u003cp\u003eThis study evaluated the adhesion capabilities of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013, \u003cem\u003eE. coli\u003c/em\u003e K99, and \u003cem\u003eS.enteritidis\u003c/em\u003e C50336 to human colorectal adenocarcinoma Caco-2 cells. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) showed that the adhesion rate of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, \u003cem\u003eL. rhamnosus\u003c/em\u003e ATCC53013, \u003cem\u003eE. coli\u003c/em\u003e K99 and \u003cem\u003eS. enteritidis\u003c/em\u003e C50336 to Caco-2 cells was 41.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58%, 37.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.29%, 32.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08% and 27.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15%, respectively. Both \u003cem\u003eL. paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL. rhamnosus\u003c/em\u003e ATCC53013 demonstrated significantly higher adhesion rates compared to the pathogenic bacteria \u003cem\u003eE. coli\u003c/em\u003e K99 and \u003cem\u003eS. enteritidis\u003c/em\u003e C50336. Furthermore, the adhesion rate of \u003cem\u003eL. paracasei\u003c/em\u003e LCQ-1 was significantly higher than that of \u003cem\u003eL. rhamnosus\u003c/em\u003e ATCC53013. These findings indicate that \u003cem\u003eL. paracasei\u003c/em\u003e LCQ-1 possesses strong cell adhesion capability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eL.paracasei LCQ-1 Exhibits Acid, Bile Salt, and Heat Tolerance Characteristics\u003c/h2\u003e \u003cp\u003eThis study evaluated the acid, bile salt, and heat tolerance of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 using the drop plate counting method. The results of the acid tolerance test (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) showed that the survival rate of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 at pH 3 and pH 4 was not significantly different from that of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC 53013. In the bile salt tolerance experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), the survival rate of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was significantly lower than that of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC 53013 in 0.1% (w/v) bile salt conditions. Both strains exhibited zero survival at 0.2% (w/v) and 0.3% (w/v) bile salt concentrations. The results of the heat tolerance test (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) indicated a gradual decrease in survival rates of both \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 and \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 with increasing temperature and exposure time. At 50\u0026deg;C, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibited significantly higher survival rates than \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 after 5, 10, and 15 minutes of exposure. At 60\u0026deg;C, no significant difference in survival rate was observed between the two strains after 5, 10, and 15 minutes of exposure. At 70\u0026deg;C, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 had significantly higher survival rates than \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 at all time points (5, 10, and 15 minutes). Notably, \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013 was unable to survive after 15 minutes at 70\u0026deg;C, while \u003cem\u003eL.rhamnosus\u003c/em\u003e LCQ-1 remained viable, indicating superior heat tolerance. In conclusion, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrates significant acid, bile salt, and heat tolerance, suggesting its potential as a robust strain for further applications.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vitro Experiments Demonstrate the Good Safety Profile of\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further evaluate the in vitro safety characteristics of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, a series of tests were conducted, including hemolysis, gelatinase, mucin degradation, biogenic amine production and drug resistance. The hemolysis assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) showed that no hemolytic zone was observed around the colonies of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, indicating that the strain does not possess hemolytic activity. The gelatinase assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) revealed no clear zones around the colonies of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, suggesting that it does not produce gelatinase. The mucin degradation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) showed no decolorized area around the colonies of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, indicating that the strain does not possess mucin-degrading activity. The results of the biogenic amine production assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-F) demonstrated that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 did not produce tyramine, putrescine, or histamine. Specifically, yellow coloration was observed around colonies on the tyrosine decarboxylase agar and ornithine decarboxylase agar(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), indicating an absence of tyrosine and ornithine decarboxylase activity. However, no color change was observed on the histidine decarboxylase agar (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), confirming the presence of histidine decarboxylase activity.\u003c/p\u003e \u003cp\u003eThe antibiotic susceptibility of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was assessed using the K-B method against 18 antibiotics. The results (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) showed that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was resistant to 6 antibiotics, including gentamicin, ampicillin, amikacin, kanamycin, polymyxin B, and vancomycin; intermediate resistance was observed to 3 antibiotics, including lincomycin, cefotaxime, and ceftazidime; and sensitivity was observed to 9 antibiotics, including streptomycin, ampicillin, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, cefazolin, and minocycline. PCR analysis using primers specific to resistance genes, virulence genes, and amino acid decarboxylase genes was performed on the genomic DNA of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B) indicated the absence of amino acid decarboxylase and virulence genes, while one resistance gene (\u003cem\u003eaph1\u003c/em\u003e) was detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). In conclusion, the in vitro experimental results indicate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibits a good safety profile.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntimicrobial susceptibility profile of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e \u003cp\u003eAntibiotic\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDrug content (\u0026micro;g/ tablet)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eStandard inhibition circle diameter (mm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSensitive (S)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIntermediate-resistant (I)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eResistant (R)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStreptomycin (S)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12\u0026ndash;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLincomycin (MY)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11\u0026ndash;19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmpicillin (AMP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u0026ndash;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGentamicin (GEN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u0026ndash;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCephalexin (CN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmikacin (AMK)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKanamycin (KAN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePolymixin B (PB)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u0026ndash;11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCeftriaxone (CRO)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u0026ndash;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCeftazidime (CAZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTetracycline (TET)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCefuroxime sodium (CXM)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11\u0026ndash;19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePenicillin (PEN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u0026ndash;22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCefoperazone (CPZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u0026ndash;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eErythromycin (E)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u0026ndash;22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVancomycin (VAN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u0026ndash;11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCefazolin (CZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMinocycline (MIN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026ndash;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eS: sensitive, I: intermediate, R: resistant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe in vivo experiment demonstrated that\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1 has favorable safety characteristics.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGastric gavage in mice are important methods for evaluating the safety of probiotics in vivo. In this study, different doses of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 were administered via gavage to mice, followed by the acute bacterial challenge and continuous gavage experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eAcute Bacterial Challenge Experiment\u003c/h2\u003e \u003cp\u003eThe results of the acute bacterial challenge experiment showed that after a 14 day-gavage of the highest dose (2\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/mouse) of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, no deaths occurred in the mice, and during the gavage period, the visual, digestive, nervous, and respiratory systems, as well as other organ systems, remained normal (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This indicates that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not cause acute toxicity in mice.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical Manifestations of Mice Undergoing Acute Bacterial Challenge with \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrgan/System\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInspection Item\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTrait Manifestation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHair Coat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eColor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIntegrity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNot loose\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin and Mucosa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMucosa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo mucus discharge\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eEye\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOral Cavity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePupil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal, without dilation or constriction\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEyeball\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal, without protrusion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEyelid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSecretions and Excretions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePeriorbital Secretions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo tearing\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFecal Color and Consistency\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFeces formed, normal color\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbdominal Shape\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo diarrhea or constipation\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRespiratory System\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNostril\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal, no runny nose\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRespiratory Rate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal breathing\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNervous System\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMotor Behavior\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal body position, normal vocalization, no abnormal postures\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eBehavioral Manifestations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresence of Tonic or Clonic Activities\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePresence of Abnormal Behaviors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResponse to Stimuli\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal stress response\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e28-Day Oral Toxicity Test\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003e(1) Organ Index Measurement\u003c/strong\u003e \u003cp\u003eThe organ index measurements (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) showed no significant differences in the heart-to-body ratio, liver-to-body ratio, spleen-to-body ratio, lung-to-body ratio, or kidney-to-body ratio in the \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1-gavaged groups (Groups A, B, and C) compared to the control group (Group D). This indicates that gavage administration of different doses of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not affect the organ weights of mice.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(2) Bacterial Translocation Experiment\u003c/strong\u003e \u003cp\u003eThe results of the bacterial translocation experiment demonstrated that after scraping internal tissues from the organs of mice in the gavaged groups (Groups A, B, and C) and the control group (Group D), no bacterial colonies were observed in any of the samples. This suggests that gavage of different doses of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not result in bacterial translocation or infection in other organs of the mice.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e(3) Blood Biochemical Analysis: Blood biochemical markers are important for evaluating the safety of \u003cem\u003eprobiotics\u003c/em\u003e. (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) shows that, compared to the control group (Group D), there were no significant changes in the concentrations of direct bilirubin (D-BII), total bilirubin (T-BIL), and alanine aminotransferase (ALT) in the gavaged groups (Groups A, B, and C). These results suggest that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not impair liver cell integrity or liver function in mice. (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e shows that, compared to the control group (Group D), there were no significant changes in the concentrations of blood urea nitrogen (BUN), uric acid (UA), and creatinine (CREA) in the gavaged groups (Groups A, B, and C), indicating that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not affect nitrogen metabolism or renal excretion function in mice. (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e shows that, compared to the control group (Group D), there were no significant changes in the concentrations of total cholesterol (TC), glucose (GLU), and triglycerides (TG) in the gavaged groups (Groups A, B, and C), suggesting that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 do not induce any adverse effects on blood sugar or lipid metabolism in mice.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(4) Histological Examination of the Ileum\u003c/strong\u003e \u003cp\u003eThe histological examination of ileum portions aimed to assess the effect of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 on the integrity of the intestinal mucosa. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e) showed no significant changes in the intestinal morphology of the ileum in the gavaged groups (Groups A, B, and C) compared to the control group (Group D), and no pathological findings were observed in any of the groups. These results indicate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not cause damage to the ileum in mice.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eTaken together, the results of the in vivo safety assessments suggest that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrates a favorable safety profile.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOrgan Index of Mice Administered Different Doses of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 via Gavage\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eheart-to-body ratio/%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eliver-to-body ratio/%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003espleen-to-body/%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003elung-to-body ratio/%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ekidney-to-body/%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eProtection Against\u003c/b\u003e \u003cb\u003eE.coli\u003c/b\u003e \u003cb\u003eK99 Infection in Mice Demonstrates the Probiotic Properties of\u003c/b\u003e \u003cb\u003eL.paracasei\u003c/b\u003e \u003cb\u003eLCQ-1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo assess the protective effect of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 against \u003cem\u003eE.coli\u003c/em\u003e K99 infection, the median lethal dose (LD\u003csub\u003e50\u003c/sub\u003e) of \u003cem\u003eE. coli\u003c/em\u003e K99 was first determined. Mice were infected with \u003cem\u003eE. coli\u003c/em\u003e K99 via intraperitoneal injection, exhibiting symptoms such as tremors, arched back, eyelid swelling with increased secretion, fecal contamination around the anus, and the expulsion of gray-green, pasty diarrhea (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Mortality was observed starting on day 1. The LD\u003csub\u003e50\u003c/sub\u003e calculation indicated that the LD\u003csub\u003e50\u003c/sub\u003e of \u003cem\u003eE. coli\u003c/em\u003e K99 was 4.4\u0026times;10⁷ CFU/mouse (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo further evaluate the protective effect of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, mice were gavaged with \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 for 14 days, then intraperitoneally injected with \u003cem\u003eE. coli\u003c/em\u003e K99. The survival was recorded to generate a survival curve. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e) showed that the survival rate of Group A mice was 80%, while that of Group B mice was 50%. These findings indicate that gavage administration of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 significantly reduces mortality caused by \u003cem\u003eE. coli\u003c/em\u003e K99 infection in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLD\u003csub\u003e50\u003c/sub\u003e of \u003cem\u003eE. coli\u003c/em\u003e K99 in KM mice\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026times;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInoculation dose(CFU/mouse)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo. of deaths/total no. of mice\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLD\u003csub\u003e50\u003c/sub\u003e(CFU/mouse)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"4\" rowspan=\"5\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e K99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c2\"\u003e \u003cp\u003e5.56\u0026times;10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5/5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\" morerows=\"4\" rowspan=\"5\"\u003e \u003cp\u003e4.4\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c2\"\u003e \u003cp\u003e5.56\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3/5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c2\"\u003e \u003cp\u003e5.56\u0026times;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c2\"\u003e \u003cp\u003e5.56\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c2\"\u003e \u003cp\u003e5.56\u0026times;10\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNeonatal livestock often suffer from severe watery diarrhea and dehydration leading to mortality due to \u003cem\u003eE. coli\u003c/em\u003e infections[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In recent years, there has been considerable attention on the use of probiotics as an alternative to antibiotics for preventing and treating diarrhea caused by enterotoxigenic \u003cem\u003eE.coli\u003c/em\u003e (ETEC)[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].Lactic acid bacteria (LAB), including \u003cem\u003eLactobacillus\u003c/em\u003e species, are beneficial microorganisms that confer health benefits to the host. The World Health Organization (WHO) defines probiotics as \u0026ldquo;live microorganisms which, when administered in adequate amounts, confer a health benefit on the host.\u0026rdquo; [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] Numerous studies have highlighted that certain \u003cem\u003eLactobacillus\u003c/em\u003e strains, such as \u003cem\u003eL.plantarum\u003c/em\u003e, play a beneficial role in alleviating ETEC-induced diarrhea[\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Our research group previously isolated a strain of \u003cem\u003eL.paracasei\u003c/em\u003e from fresh feces of healthy cattle, named \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, and performed whole genome sequencing, with the data uploaded to NCBI (accession number PRJNA1175393). In this study, we conducted in vitro and in vivo evaluations of its safety and probiotic properties. The results showed that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibited strong antimicrobial activity against \u003cem\u003eE.coli\u003c/em\u003e K99, robust acid production capacity, and favorable hydrophobicity, autoaggregation, coaggregation, and cell adhesion abilities. It did not show hemolytic activity, gelatinase production, or mucin-degrading activity. In oral administration tests, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 did not cause acute toxicity or clinical infections in mice and significantly reduced the mortality rate in a pathogenic \u003cem\u003eE.coli\u003c/em\u003e K99 challenge model. These findings suggest that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 has good safety and probiotic potential in mice and could be further developed as a probiotic product to prevent \u003cem\u003eE.coli\u003c/em\u003e-induced diarrhea in animals.\u003c/p\u003e \u003cp\u003eProbiotic strains must meet certain criteria to be considered potential candidates for probiotic applications: they must withstand low pH, bile salts, and high temperatures to survive in the gut; adhere to intestinal cells; prevent or reduce the adhesion of pathogenic microorganisms; produce acids and hydrogen peroxide to inhibit pathogen growth[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]; and form clusters to maintain a balanced gut microbiota. The beneficial properties of LAB need to be thoroughly evaluated. Our study showed that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrated moderate tolerance to acid and bile salts, with bile salt tolerance slightly lower than that of \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013. The autoaggregation and surface hydrophobicity of probiotics are positively correlated with their adhesion to intestinal epithelial cells. Coaggregation with pathogens reflects the antimicrobial ability of probiotics and inhibits the attachment of pathogens to the intestinal mucosa[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In this study, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 exhibited a hydrophobicity of 57\u0026thinsp;\u0026plusmn;\u0026thinsp;2.67%, autoaggregation of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.04%, and coaggregation with \u003cem\u003eE. coli\u003c/em\u003e K99 and \u003cem\u003eS.enteritidis\u003c/em\u003e C50336 at 21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13% and 16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13%, respectively, which were higher than the control strain \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53013. Adhesion to the intestinal epithelial cell mucosal surface is a desired characteristic for probiotics as it promotes colonization and persistence while inhibiting pathogen colonization and contributing to mucosal healing[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Previous results showed that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrated good hydrophobicity and autoaggregation, suggesting that it may effectively adhere to intestinal epithelial cells. To verify this, we assessed the cell adhesion properties of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 using the Caco-2 BBE cell, and found that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 adhered to cells at a rate of 41.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58%, significantly higher than the control strain \u003cem\u003eL.rhamnosus\u003c/em\u003e ATCC53103. These results demonstrate the excellent probiotic properties of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 in vitro.\u003c/p\u003e \u003cp\u003ePathogenicity is another critical factor to assess during the screening of new probiotics. Some probiotic strains may harbor hemolysin, posing a potential risk to the host. Hemolytic bacteria produce hemolysins that rupture erythrocytes, leading to sepsis. In this study, we tested the hemolytic activity of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 using the spot inoculation method, and no hemolysis zone was observed around the colony, indicating it lacks hemolytic activity. Similar results were reported by Liu et al. and Toropov et al., who found that both \u003cem\u003eBlautia producta\u003c/em\u003e DSM 2950[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], \u003cem\u003eL.helveticus\u003c/em\u003e D75[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], and \u003cem\u003eL.delbrueckii\u003c/em\u003e subsp. \u003cem\u003eLactis\u003c/em\u003e CIDCA 133 did not exhibit hemolytic activity. Gelatinase is a type of protease that hydrolyzes structural components of connective tissue, facilitating the invasion of pathogenic bacteria into the host\u0026rsquo;s intestinal mucosa, leading to intestinal diseases[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Our study showed that no zones of gelatin hydrolysis were detected after flooding gelatin agar plates with saturated ammonium sulfate solution, indicating that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not produce gelatinase. This finding is consistent with previous studies on strains such as \u003cem\u003eL.crispatus\u003c/em\u003e UBLCp01, \u003cem\u003eL.gasseri\u003c/em\u003e UBLG36, and \u003cem\u003eL.johnsonii\u003c/em\u003e UBLJ01[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Mucin degradation is a virulence factor for several enteropathogens. In this study, we found that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not exhibit mucin-degrading activity, as no discolored zones were observed after coomassie blue staining. Additionally, the strain exhibited decarboxylase activity only against histidine.\u003c/p\u003e \u003cp\u003eRegarding antibiotic resistance, multidrug-resistant strains can pose a significant threat to the treatment of bacterial infections. Therefore, probiotic candidates should be evaluated for their antibiotic resistance profiles. Our results showed that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 was sensitive to 18 commonly used antibiotics, including streptomycin, ampicillin, tetracycline, cefuroxime, penicillin, cefoperazone, erythromycin, cefazolin, and minocycline. PCR analysis revealed no presence of resistance genes, including β-lactamase (\u003cem\u003ebla1\u003c/em\u003e, \u003cem\u003ebla-l1\u003c/em\u003e), aminoglycoside (\u003cem\u003eaac1\u003c/em\u003e, \u003cem\u003eaac1I\u003c/em\u003e, \u003cem\u003eaph\u003c/em\u003e, \u003cem\u003eant(6)\u003c/em\u003e), macrolide (\u003cem\u003eerm\u003c/em\u003e), sulfonamide (\u003cem\u003esul\u003c/em\u003e), quinolone (\u003cem\u003eqnr\u003c/em\u003e), tetracycline (\u003cem\u003etet\u003c/em\u003e), or vancomycin (\u003cem\u003evan1\u003c/em\u003e, \u003cem\u003evan1I\u003c/em\u003e). These results confirm that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 has a favorable safety profile in terms of antibiotic resistance.\u003c/p\u003e \u003cp\u003eTo further evaluate the application potential of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1, we performed an in vivo safety evaluation using a mouse model. No acute toxicity, clinical infections, or adverse effects on growth were observed. Serum biochemical parameters, which are indicative of host health, showed no significant changes in mice after oral administration of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1. These results are consistent with studies involving other probiotic strains such as \u003cem\u003eL.rhamnosus\u003c/em\u003e HN001, \u003cem\u003eL.acidophilus\u003c/em\u003e HN017, and \u003cem\u003eBifidobacterium\u003c/em\u003e HN019, which did not significantly affect serum biochemical indicators in mice[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, histopathological analysis of ileum tissues from mice treated with \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 showed no evidence of ulcers, inflammatory cell infiltration, or mucosal degeneration. These results indicate that \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 does not negatively impact intestinal morphology and may even promote recovery from intestinal damage[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFinally, to assess the probiotic characteristics in vivo, we administered \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 orally to mice for 14 days and then challenged them with \u003cem\u003eE. coli\u003c/em\u003e K99. The survival rate of mice in the \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 treatment group was 80%, significantly higher than the 50% survival rate in the untreated group, with noticeable improvements in diarrhea symptoms. Similar results were observed with \u003cem\u003eEnterococcus faecalis\u003c/em\u003e NCIMB 10415 in neonatal piglets challenged with enterotoxigenic \u003cem\u003eE. coli\u003c/em\u003e K88, where probiotic treatment alleviated diarrhea and reduced mortality[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn conclusion, \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 demonstrated strong antibacterial activity against \u003cem\u003eE.coli\u003c/em\u003e K99, good cell adhesion properties, and an absence of hemolytic, gelatinase, and mucin-degrading activities. Oral administration of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1 did not cause acute toxicity or clinical infections in mice, significantly improved survival rates in \u003cem\u003eE.coli\u003c/em\u003e K99-infected mice, and exhibited excellent safety and probiotic properties in vitro and in vivo. Further studies on the prevention of \u003cem\u003eE. coli\u003c/em\u003e infections in larger animals, such as cattle and sheep, are essential for evaluating the broader application potential of \u003cem\u003eL.paracasei\u003c/em\u003e LCQ-1.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u0026nbsp;\u003c/strong\u003eConceived and designed the experiments: TLW. Performed the experiments: FJW, LC, and YL. Analyzed the data: GPG, YNW, RLS and YYC. Wrote the paper: FJW, LC and TLW. Reviewed and edited the paper: TLW, HJZ, RC and QMS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eWeichang Manchu and Mongolian Autonomous County Science and Technology Program Project, Central Government Guides Local Projects, Hebei Province, Department of Science and Technology (23626604G), Hebei Province key research and development plan project (22326612D), and Chengde City Basic Research Project (202404B099) provided funding for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003eThe animal study was reviewed and approved by the Experimental Animal Regulation Ordinances defined by Hebei Provincial Department of Science and Technology (HPDST2020-17).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGeurtsen J, de Been M, Weerdenburg E, Zomer A, McNally A, Poolman J (2022) Genomics and pathotypes of the many faces of \u003cem\u003eEscherichia coli\u003c/em\u003e. FEMS Microbiol Rev 46(6):fuac031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13028-020-00543-1\u003c/span\u003e\u003cspan address=\"10.1186/s13028-020-00543-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Gong J, Lu P, Azevedo P, Li L, Yu H, Yang C (2024) Functional evaluation of \u003cem\u003eBacillus licheniformis\u003c/em\u003e PF9 for its potential in controlling enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e in weaned piglets. Translational Anim Sci 8:txae050. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/tas/txae050\u003c/span\u003e\u003cspan address=\"10.1093/tas/txae050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Tan P, Zhao Y, Ma X (2022) Enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e: intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 14(1):2055943. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/19490976.2022.2055943\u003c/span\u003e\u003cspan address=\"10.1080/19490976.2022.2055943\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown K, Uwiera RR, Kalmokoff ML, Brooks SP, Inglis GD (2017) Antimicrobial growth promoter use in livestock: a requirement to understand their modes of action to develop effective alternatives. Int J Antimicrob Agents 49(1):12\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijantimicag.2016.08.006\u003c/span\u003e\u003cspan address=\"10.1016/j.ijantimicag.2016.08.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Ma H, Yu H, Qin G, Tan Z, Wang Y, Pang H (2020) Screening of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e subsp. plantarum with potential probiotic activities for inhibiting ETEC K88 in weaned piglets. Molecules 25(19):4481. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules25194481\u003c/span\u003e\u003cspan address=\"10.3390/molecules25194481\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Jia D, Wang J, Li H, Yin X, Liu J, Wang J, Guan G, Luo J, Yin H (2021) Probiotics isolated from animals in Northwest China improve the intestinal performance of mice. Front veterinary Sci 8:750895. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2021.750895\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2021.750895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu W, Wang X, Hu M, Hou J, Du Y, Si W, Yang L, Xu L, Xu Q (2023) Modulating gastrointestinal microbiota to alleviate diarrhea in calves. Front Microbiol 14:1181545. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2023.1181545\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2023.1181545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevit R, Cortes-Perez NG, de Moreno de Leblanc A, Loiseau J, Aucouturier A, Langella P, LeBlanc JG, Berm\u0026uacute;dez-Humar\u0026aacute;n (2022) Use of genetically modified lactic acid bacteria and bifidobacteria as live delivery vectors for human and animal health. Gut Microbes LG(1):2110821. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/19490976.2022.2110821\u003c/span\u003e\u003cspan address=\"10.1080/19490976.2022.2110821\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Li B, Zheng K, Liu Y, Zhang Z, Hu H, Qian G, Jiang J (2024) \u003cem\u003eLactobacillus paracasei\u003c/em\u003e R3 Alleviates Tumor Progression in Mice with Colorectal Cancer. Curr Microbiol 81(1):38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00284-023-03525-4\u003c/span\u003e\u003cspan address=\"10.1007/s00284-023-03525-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill D, Sugrue I, Tobin C, Hill C, Stanton C, Ross R (2018) The Lactobacillus casei group: history and health related applications. Front Microbiol 9:2107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2021.750895\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2021.750895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Souza BMS, Guerra LHA, Varallo GR, Taboga SR, Penna ALB (2023) The Impact in Intestines and Microbiota in BALB/c Mice Through Consumption of Milk Fermented by Potentially Probiotic \u003cem\u003eLacticaseibacillus casei\u003c/em\u003e SJRP38 and \u003cem\u003eLimosilactobacillus fermentum\u003c/em\u003e SJRP43. Probiotics Antimicrob Proteins 1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-023-10158-3\u003c/span\u003e\u003cspan address=\"10.1007/s12602-023-10158-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJankowska A, Laubitz D, Antushevich H, Zabielski R, Grzesiuk E (2008) Competition of \u003cem\u003eLactobacillus paracasei\u003c/em\u003e with \u003cem\u003eSalmonella enterica\u003c/em\u003e for adhesion to Caco-2 cells. J Biomed Biotechnol 2008:357964. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2008/357964\u003c/span\u003e\u003cspan address=\"10.1155/2008/357964\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMokoena MP (2017) Lactic acid bacteria and their bacteriocins: classification, biosynthesis and applications against uropathogens: a mini-review. Molecules 22(8):1255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules22081255\u003c/span\u003e\u003cspan address=\"10.3390/molecules22081255\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIcer MA, \u0026Ouml;zbay S, Ağag\u0026uuml;nd\u0026uuml;z D, Kelle B, Bartkiene E, Rocha JMF, Ozogul F (2023) The impacts of acidophilic lactic acid Bacteria on food and human health: a review of the current knowledge. Foods 12(15):2965. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/foods12152965\u003c/span\u003e\u003cspan address=\"10.3390/foods12152965\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwad WS, El-Sayed AA, Mohammed FF, Bakry NM, Abdou NEM, Kamel MS (2020) Molecular characterization of pathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e isolated from diarrheic and in-contact cattle and buffalo calves. Trop Anim Health Prod 52:3173\u0026ndash;3185. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11250-020-02343-1\u003c/span\u003e\u003cspan address=\"10.1007/s11250-020-02343-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlessas S, Kiousi DE, Rathosi M, Alexopoulos A, Kourkoutas Y, Mantzourani I, Galanis A, Bezirtzoglou E (2020) Isolation of a \u003cem\u003eLactobacillus paracasei\u003c/em\u003e strain with probiotic attributes from kefir grains. Biomedicines 8(12):594. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biomedicines8120594\u003c/span\u003e\u003cspan address=\"10.3390/biomedicines8120594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteagudo-Mera A, Rodr\u0026iacute;guez-Aparicio L, R\u0026uacute;a J, Mart\u0026iacute;nez-Blanco H, Navasa N, Garc\u0026iacute;a-Armesto MR, Ferrero M\u0026Aacute; (2012) In vitro evaluation of physiological probiotic properties of different lactic acid bacteria strains of dairy and human origin. J Funct Foods 4(2):531\u0026ndash;541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jff.2012.02.014\u003c/span\u003e\u003cspan address=\"10.1016/j.jff.2012.02.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarez MA, Moreno-Arribas MV (2014) The problem of biogenic amines in fermented foods and the use of potential biogenic amine-degrading microorganisms as a solution. Trends Food Sci Technol 39(2):146\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tifs.2014.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.tifs.2014.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavoodabadi A, Dallal MMS, Foroushani AR, Douraghi M, Harati FA (2015) Antibacterial activity of \u003cem\u003eLactobacillus spp\u003c/em\u003e. isolated from the feces of healthy infants against enteropathogenic bacteria. Anaerobe 34:53\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.anaerobe.2015.04.014\u003c/span\u003e\u003cspan address=\"10.1016/j.anaerobe.2015.04.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhire J, Jakkamsetty C, Kashikar M, Lakshmi S, Madempudi R (2021) In vitro evaluation of probiotic properties of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e UBLP40 isolated from traditional indigenous fermented food. Probiotics Antimicrob Proteins 13(5):1413\u0026ndash;1424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-021-09775-7\u003c/span\u003e\u003cspan address=\"10.1007/s12602-021-09775-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDermott PF, White DG, Zhao S, Simjee S, Walker RD (2004) Antimicrobial Susceptibility Testing. Preharvest and Postharvest Food Safety: Contemporary Issues and Future Directions 189\u0026ndash;200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/9781555817435.ch5\u003c/span\u003e\u003cspan address=\"10.1128/9781555817435.ch5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a V, Gambino M, Pedersen K, Haugegaard S, Olsen JE, Herrero-Fresno A (2020) F4-and F18-positive enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e isolates from diarrhea of postweaning pigs: genomic characterization. Appl Environ Microbiol 86(23):e01913\u0026ndash;01920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.01913-20\u003c/span\u003e\u003cspan address=\"10.1128/AEM.01913-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyu JH, Kim S, Park J, Choi KS (2020) Characterization of virulence genes in \u003cem\u003eEscherichia coli\u003c/em\u003e strains isolated from pre-weaned calves in the Republic of Korea. Acta Vet Scand 62:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13028-020-00543-1\u003c/span\u003e\u003cspan address=\"10.1186/s13028-020-00543-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVieco-Saiz N, Belguesmia Y, Raspoet R, Auclair E, Gancel F, Kempf I, Drider D (2019) Benefits and inputs from lactic acid bacteria and their bacteriocins as alternatives to antibiotic growth promoters during food-animal production. Front Microbiol 10:57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2019.00057\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2019.00057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, Morelli L, Canani RB, Flint HJ, Salminen S (2014) Expert consensus document: The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat reviews Gastroenterol Hepatol 11(8):506\u0026ndash;514. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrgastro.2014.66\u003c/span\u003e\u003cspan address=\"10.1038/nrgastro.2014.66\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Z, Liu Z, Ma Y, Yang Z, Liu G, Fang J (2023) Effects of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and Weissella viridescens on the Gut Microbiota and Serum Metabolites of Mice with Antibiotic-Associated Diarrhea. Nutrients 15(21):4603. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/nu15214603\u003c/span\u003e\u003cspan address=\"10.3390/nu15214603\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao W, He Y, Yu J, Liu M, Yang X, Ta N, Zhang E, Liang C (2022) Regulatory effect of \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e 2\u0026ndash;33 on intestinal microbiota of mice with antibiotic-associated diarrhea. Front Nutr 9:921875. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnut.2022.921875\u003c/span\u003e\u003cspan address=\"10.3389/fnut.2022.921875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan X, Ding S, Ma Y, Fang J, Jiang H, Li Y, Liu G (2021) \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus brevis\u003c/em\u003e alleviate intestinal inflammation and microbial disorder induced by ETEC in a murine model. Oxidative Med Cell Longev 2021(1):6867962. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2021/6867962\u003c/span\u003e\u003cspan address=\"10.1155/2021/6867962\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubio R, Jofr\u0026eacute; A, Mart\u0026iacute;n B, Aymerich T, Garriga (2014) M Characterization of lactic acid bacteria isolated from infant faeces as potential probiotic starter cultures for fermented sausages. Food microbiology 38: 303\u0026ndash;311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fm.2013.07.015\u003c/span\u003e\u003cspan address=\"10.1016/j.fm.2013.07.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerkes E, Liao Y-H, Neef D, Grandalski M, Monsul N (2020) Potentiated in vitro probiotic activities of \u003cem\u003eLactobacillus fermentum\u003c/em\u003e LfQi6 biofilm biomass versus planktonic culture. Probiotics Antimicrob Proteins 12(3):1097\u0026ndash;1114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-019-09624-8\u003c/span\u003e\u003cspan address=\"10.1007/s12602-019-09624-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Guo W, Cui S, Tang X, Zhao J, Zhang H, Mao B, Chen W (2021) A Comprehensive Assessment of the Safety of Blautia producta DSM 2950. Microorganisms 9(5):908. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms9050908\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9050908\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToropov V, Demyanova E, Shalaeva O, Sitkin S, Vakhitov T (2020) Whole-genome sequencing of \u003cem\u003eLactobacillus helveticus\u003c/em\u003e D75 and D76 confirms safety and probiotic potential. Microorganisms 8(3):329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms8030329\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8030329\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBindu A, Lakshmidevi N (2021) Identification and in vitro evaluation of probiotic attributes of lactic acid bacteria isolated from fermented food sources. Arch Microbiol 203:579\u0026ndash;595. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00203-020-02037-0\u003c/span\u003e\u003cspan address=\"10.1007/s00203-020-02037-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhire J, Sahoo S, Kashikar M, Heerekar A, Lakshmi S, Madempudi R (2023) In vitro assessment of \u003cem\u003eLactobacillus crispatus\u003c/em\u003e UBLCp01, \u003cem\u003eLactobacillus gasseri\u003c/em\u003e UBLG36, and \u003cem\u003eLactobacillus johnsonii\u003c/em\u003e UBLJ01 as a potential vaginal probiotic candidate. Probiotics Antimicrob Proteins 15(2):275\u0026ndash;286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-021-09838-9\u003c/span\u003e\u003cspan address=\"10.1007/s12602-021-09838-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGill HS, Rutherfurd KJ, Prasad J, Gopal PK (2000) Enhancement of natural and acquired immunity by \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e (HN001), \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e (HN017) and \u003cem\u003eBifidobacterium lactis\u003c/em\u003e (HN019). Br J Nutr 83(2):167\u0026ndash;176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0007114500000210\u003c/span\u003e\u003cspan address=\"10.1017/S0007114500000210\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNami Y, Haghshenas B, Khosroushahi AY (2018) Molecular identification and probiotic potential characterization of lactic acid bacteria isolated from human vaginal microbiota. Adv Pharm Bull 8(4):683. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15171/apb.2018.077\u003c/span\u003e\u003cspan address=\"10.15171/apb.2018.077\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng X, Wang R, Hu L, Zhou Q, Liu Y, Yang M, Fang Z, Lin Y, Xu S, Feng B (2019) \u003cem\u003eEnterococcus faecium\u003c/em\u003e NCIMB 10415 administration improves the intestinal health and immunity in neonatal piglets infected by enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e K88. J Anim Sci Biotechnol 10:1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40104-019-0376-z\u003c/span\u003e\u003cspan address=\"10.1186/s40104-019-0376-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Lactobacillus paracasei, Escherichia coli, Probiotic properties, K99","lastPublishedDoi":"10.21203/rs.3.rs-5742040/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5742040/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e is a common pathogen causing diarrhea in livestock and poultry, posing a serious threat to intestinal health and leading to significant economic losses in the animal husbandry industry. While antibiotics have been used to treat \u003cem\u003eEscherichia coli\u003c/em\u003e diarrhea, their numerous drawbacks have led to increasing attention on probiotic interventions. In this study, \u003cem\u003eLactobacillus paracasei\u003c/em\u003e LCQ-1 was isolated from fresh cow dung, and its in vitro and in vivo safety and probiotic properties were evaluated. In vitro experiments demonstrated that \u003cem\u003eLactobacillus paracasei\u003c/em\u003e LCQ-1 exhibited good antimicrobial activity against \u003cem\u003eEscherichia coli\u003c/em\u003e K99, along with key probiotic characteristics such as acid production, acid and bile salt tolerance, high-temperature resistance, hydrophobicity, and cell adhesion. Furthermore, it showed no hemolytic activity, gelatinase activity, or mucin-degrading activity, and it only exhibited decarboxylase activity for histamine. While resistant to certain antibiotics, no significant resistance genes were detected, indicating favorable probiotic and safety profiles. In vivo, acute toxicity tests in mice revealed no signs of acute poisoning after 14 days of high-dose oral administration. A 28-day oral toxicity test showed that different doses did not affect organ indices, cause bacterial translocation, alter blood biochemical parameters, or damage the ileum. In the infection protection experiment, oral administration of \u003cem\u003eLactobacillus paracasei\u003c/em\u003e LCQ-1 significantly increased the survival rate of \u003cem\u003eEscherichia coli\u003c/em\u003e K99-infected mice from 50\u0026ndash;80%. In conclusion, \u003cem\u003eLactobacillus paracasei\u003c/em\u003e LCQ-1 demonstrated excellent safety and probiotic properties both in vitro and in vivo, and shows promising potential in preventing and treating \u003cem\u003eEscherichia coli\u003c/em\u003e K99 infections, with possible applications in animal health management.\u003c/p\u003e","manuscriptTitle":"Lactobacillus paracasei LCQ-1 Exhibits Good Safety and Effectively Prevents Escherichia coli K99-Induced Diarrhea in Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-09 11:53:57","doi":"10.21203/rs.3.rs-5742040/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-10T09:21:11+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"286924094021933155821784986406401449136","date":"2025-03-26T10:06:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-02-21T20:16:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"226706659684986226494487002118548816442","date":"2025-01-29T16:28:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59417592175715887785401548414387446668","date":"2025-01-29T04:09:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-01-28T12:25:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-01-07T09:17:46+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-01-07T09:16:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2024-12-31T12:39:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"ec672088-dfc7-40d9-8950-fea04c1bff73","owner":[],"postedDate":"January 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-05-05T16:06:03+00:00","versionOfRecord":{"articleIdentity":"rs-5742040","link":"https://doi.org/10.1007/s12602-025-10552-z","journal":{"identity":"probiotics-and-antimicrobial-proteins","isVorOnly":false,"title":"Probiotics and Antimicrobial Proteins"},"publishedOn":"2025-04-28 15:57:44","publishedOnDateReadable":"April 28th, 2025"},"versionCreatedAt":"2025-01-09 11:53:57","video":"","vorDoi":"10.1007/s12602-025-10552-z","vorDoiUrl":"https://doi.org/10.1007/s12602-025-10552-z","workflowStages":[]},"version":"v1","identity":"rs-5742040","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5742040","identity":"rs-5742040","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0