Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s

Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s View ORCID Profile Christopher Michael McGraw , View ORCID Profile Cristina M. Baker , View ORCID Profile Annapurna Poduri doi: https://doi.org/10.1101/2025.01.15.633275 Christopher Michael McGraw 1 Department of Neurology, Massachusetts General Hospital, Harvard Medical School , Boston, MA 02115, USA 2 Department of Neurology, The F.M. Kirby Neurobiology Center, Boston Children’s Hospital, Harvard Medical School , Boston, MA 02115, USA 3 Department of Neurology, Feinberg School of Medicine, Northwestern University , Chicago, IL 60611, USA (current affiliation) Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christopher Michael McGraw For correspondence: christopher.mcgraw{at}northwestern.edu chris.mcgraw{at}gmail.com Cristina M. Baker 2 Department of Neurology, The F.M. Kirby Neurobiology Center, Boston Children’s Hospital, Harvard Medical School , Boston, MA 02115, USA 4 Norwegian University of Science and Technology , Trondheim, Norway (current affiliation) Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Cristina M. Baker Annapurna Poduri 2 Department of Neurology, The F.M. Kirby Neurobiology Center, Boston Children’s Hospital, Harvard Medical School , Boston, MA 02115, USA 5 National Institutes of Neurological Disorders and Stroke , NIH, Bethesda, MD (current affiliation) Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Annapurna Poduri Abstract Full Text Info/History Metrics Preview PDF Abstract Zebrafish models of genetic epilepsy benefit from the ability to assess disease-relevant knock-out alleles with numerous tools, including genetically encoded calcium indicators (GECIs) and hypopigmentation alleles to improve visualization. However, there may be unintended effects of these manipulations on the phenotypes under investigation. There is also debate regarding the use of stable loss-of-function (LoF) alleles in zebrafish, due to genetic compensation (GC). In the present study, we applied a method for combined movement and calcium fluorescence profiling to the study of a zebrafish model of SCN1A , the main gene associated with Dravet syndrome, which encodes the voltage-gated sodium channel alpha1 subunit (Nav1.1). We evaluated for spontaneous and proconvulsant-induced seizure-like activity associated with scn1lab LoF mutations in larval zebrafish expressing a neuronally-driven GECI (elavl3:GCaMP6s) and a nacre mutation causing a common pigmentation defect. In parallel studies of stable scn1lab s 552 mutant s and F0 crispant larvae generated using a CRISPR/Cas9 multi-sgRNA approach, we find that neither stable nor acute F0 larvae recapitulate the previously reported seizure-like rapid swimming phenotype nor does either group show spontaneous calcium events meeting criteria for seizure-like activity based on a logistic classifier trained on movement and fluorescence features of proconvulsant-induced seizures. This constitutes two independent lines of evidence for a suppressive effect against the scn1lab phenotype, possibly due to the GCaMP6s-derived genetic background (AB) or nacre hypopigmentation. In response to the proconvulsant pentylenetetrazole (PTZ), we see evidence of a separate suppressive effect affecting all conspecific larvae derived from the stable scn1lab s 552 line, independent of genotype, possibly related to a maternal effect of scn1lab LoF in mutant parents or the residual TL background. Nonetheless, both stable and F0 crispant fish show enhanced sensitivity to PTZ relative to conspecific larvae, suggesting that proconvulsant sensitivity provides a more robust readout of scn1lab LoF under our experimental conditions. Our study underscores the unexpected challenges associated with the combination of common zebrafish tools with disease alleles in the phenotyping of zebrafish models of genetic epilepsy. Our work further highlights the advantages of using F0 crispants and the evaluation of proconvulsant sensitivity as complementary approaches that faithfully reflect the shared gene-specific pathophysiology underlying spontaneous seizures in stable mutant lines. Future work to understand the molecular mechanisms by which scn1lab -related seizures and PTZ-related hyperexcitability are suppressed under these conditions may shed light on factors contributing to variability in preclinical models of epilepsy more generally and may identify genetic modifiers relevant to Dravet syndrome. 1. Introduction Zebrafish have emerged as a powerful model of chemical and genetic seizures 1 , 2 with many advantages, including large clutch size, rapid external development, and high genetic conservation with higher vertebrates for modeling disease. Zebrafish are amenable to genetic manipulation by CRISPR/Cas9 gene editing, enabling the study of gene-specific loss of function through the generation of stable gene knockout lines as well as acute crispant knockouts in the F0 generation. In addition, a number of tools enable the advanced study of zebrafish brain activity, such as genetically encoded calcium indicators (GECIs; for example, GCaMP6s 3 ) and pigmentation mutants (such as nacre 4 ) that improve visualization for live imaging. The small size of larval zebrafish also makes them suitable for higher throughput screening 2 , 5 . Recently we described a platform 6 that combines movement and fluorescence data from unrestrained zebrafish for the evaluation of chemically induced seizures using 96-well format, but its application to genetic models of epilepsy has not yet been reported. Despite its strengths, the study of disease in zebrafish is challenged by at least two factors. First, the genetic backgrounds of laboratory zebrafish (AB, TL, and others 7 ) are often not carefully reported or controlled across experiments by zebrafish researchers 8 . Genetic modifiers, which refer to discrete genetic factors capable of “modifying” the severity or penetrance of a phenotype, have been well-described in association with different inbred mouse strains (for example, in epilepsy models 9 ), and recognized to alter phenotypes between wild-type zebrafish lines 7 , 8 , but their significance in zebrafish models of disease or epilepsy remains considerably less well-explored. This is a critical issue for the rigor and reproducibility of zebrafish studies 8 because if genetic tools generated on one zebrafish background harbor modifiers that affect the phenotype of mutant alleles generated on a different zebrafish background, the fundamental logic by which any mechanistic claim derived from the use of these tools may be compromised. Second, whether any stable loss-of-function allele will demonstrate a phenotype in larval zebrafish is somewhat unpredictable, owing to the effects of genetic compensation (GC), about which there have been increasing reports in zebrafish 10 . GC refers to the many processes by which the effects of a genetic perturbation are functionally balanced by compensatory changes in the regulation of other genes, the details of which remain incompletely understood. One type of GC termed transcriptional adaptation (TA) has been shown to be triggered by premature termination codons (PTCs) through the nonsense mediated decay (NMD) pathway, and lead to upregulation of genes with sequence homology including paralogs 11 . The TA response appears to be epigenetically passed on to genetically wild-type offspring 12 , though other modes of GC can also exert influence on progeny independent of larval genotype if they perturb the levels of mRNA/proteins present in the maternal gametes via so-called maternal effects 13 . As an alternative to stable lines, gene-specific acute F0 crispants -- generated by microinjection of Cas9 ribonucleoproteins and guide RNA (gRNA) into fertilized embryos – are often used and in some instances appear to have stronger phenotypes than stable alleles 14 , perhaps in part by avoiding maternal effects. Here we apply the combined movement and fluorescence approach to the characterization of genetic epilepsy models through the example of the epilepsy gene SCN1A. The gene SCN1A encodes the voltage-gated sodium channel alpha1 subunit (Na v 1.1), and human variants in SCN1A are associated with Dravet syndrome (DS), a severe developmental epileptic encephalopathy characterized by drug-refractory seizures 15 . Zebrafish with disruptions in the homologous gene scn1lab have been studied as models of DS 5 , 16 – 18 and recapitulate key features of the disease, including seizures and their response to anti-seizure medication. Specifically, the homozygote larvae from the well-described scn1lab s 552 (Didy) allele (harboring a Met-to-Arg missense mutation in exon 18 16 , 19 ) have demonstrated seizure-like activity across multiple modalities including assays of locomotor behavior (bursts of rapid swimming, >20mm/sec), tectal recordings of local field potential (high amplitude frequent epileptiform discharges), as well as calcium fluorescence (seizure-like bursts 20 ). For these reasons, the phenotype associated with scn1lab fish is considered a gold-standard control for evaluating methods of seizure detection. In the present study, our goal was to benchmark the combined movement and fluorescence profiling approach 6 for identifying seizure-like activity in models of genetic epilepsy. Towards this end, we evaluated spontaneous and proconvulsant-induced seizure-like activity associated with scn1lab loss-of-function (LoF) mutations in larval zebrafish expressing a neuronally-driven, genetically encoded calcium indicator (elavl3:GCaMP6s 3 ) in combination with a common hypopigmentation defect ( nacre 4 ). We chose the stable scn1lab s 552 allele as a positive control. To assess the phenotypic similarity between scn1lab s 552 and acute CRISPR/Cas9 mediated knock-out, we also generated acute scn1lab F0 crispant larvae using a multi-sgRNA approach. We expected to recapitulate the well-documented seizure-related phenotypes associated with scn1lab LoF, but instead we observe that neither stable nor acute F0 fish recapitulate the previously reported spontaneous rapid swimming phenotype, suggesting a suppressive effect under these conditions possibly related to genetic background or other factors. Similarly, neither group showed any evidence for spontaneous calcium events meeting criteria for seizure-like activity based on a machine learning classification trained on movement and fluorescence features of proconvulsant-induced seizures 6 . In addition, we observe totally opposite effects of scn1lab LoF on several event-related parameters between the two approaches, with stable scn1lab mutant larvae showing elevations in maximum velocity, average distance, and calcium event rate versus crispant F0s showing reductions relative to their respective conspecific controls. We also see markedly reduced PTZ sensitivity in the scn1lab s 552 line, affecting mutant and wild-type conspecifics, which may be due to genetic background or a maternal effect of parental scn1lab LoF. Despite these limitations, both stable and F0 crispant fish show enhanced sensitivity to PTZ relative to conspecifics, suggesting that proconvulsant sensitivity may be a more robust readout of scn1lab LoF and perhaps other epilepsy-related genes under these conditions. 2. Materials and methods 2.1. Zebrafish maintenance GCaMP6s 22 zebrafish ( Danio rerio ) with nacre pigmentation deficit used for all experiments were obtained on AB background as TG( elav3 ::Gcamp6s); mitfa w 2 /w 2 (abbreviated, GCaMP6s ; generous gift from Florian Engert, Harvard University). Zebrafish were maintained by in-crosses, and larvae periodically selected for “high” GCaMP6s fluorescence and nacre phenotype. The scn1lab s 552 (Didy 16 ) line was obtained as a generous gift from H. Baier (Max Plank Institute of Neurobiology) on TL background. Heterozygote scn1lab s 55a /+ fish were crossed to Gcamp6s , and adult F1 fish were in-crossed to obtain F2 Gcamp6s ; nacre for experiments, and are anticipated to be roughly 50:50 AB:TL. All fish were maintained on a 14H:10H day-night cycle. All procedures were approved by BCH Animal Welfare Assurance (IACUC protocol #00001775). 2.2. Genotyping scn1lab s 552 line For scn1lab s 552 , the following primers were used for PCR to generate a 298bp fragment: scn1lab -diddy-FW, GCTGTGTGATGAGGTTTCAGT; scn1lab -diddy-RV, CTGTTAGACAGAAATTGGGGG. SnapGene was used to inspect the chromatogram from Sanger sequencing and to identify larvae with the c.T>G mutation at the sequence TTCAGATT (Supplementary Fig 1) in Exon 18 (Ensembl ID, ENSDARE00000666203). 2.3. Crispant scn1lab generation 2.3.1. sgRNA design and synthesis Three sgRNAs were designed using the online CHOPCHOP tool (V2 21 ) with default settings targeting exonic regions of the zebrafish gene scn1lab, selecting only sgRNA with no predicted off-target activity (MM0-MM3 = 0), and efficiency >0.6. The selected sgRNA corresponded to ranks 1, 3, 7, and had predicted efficiency scores of 0.74, 0.73, and 0.71, respectively. scn1lab sgRNA1 GGTTACAGTACCGATAGCGG exon 16 scn1lab sgRNA2 GTTTAGAGCCGGCCAAGAAG exon 16 scn1lab sgRNA3 TATTCGCCCCCCTGGAGAGG exon 17 Synthetic sgRNA with chemical modifications 2’-O-Methyl at 3 first and last bases and 3’ phosphorothioate bonds between first 3 and last 2 bases were ordered from Synthego (Redwood City, CA) 2.3.2. Microinjection Upon receipt, sgRNA were diluted to 1000ng/uL and mixed 1:1:1 before freezing at -80degC. For microinjection, pooled sgRNA were thawed on ice, and mixed with sterile H20 and phenol red to maintain a final gRNA concentration of 250ng/uL. Embryos were derived from timed in-cross matings from GCaMP6s; nacre parents. Microinjections (2nL, or 150 micron diameter) into yolk sac of fertilized embryos at the one-cell stage were performed with all injections completed within 20-40 minutes of fertilization. 2.3.3. Assessment of CRISPR efficiency To control for subject-specific differences in cutting efficiency, we assayed cutting at scn1lab loci by PCR amplification, followed by Sanger sequencing and ICE analysis 22 . Genomic DNA from larvae (dpf 5-6) was obtained by sodium hydroxide digestion (NaOH 50mM final concentration), heated incubation at 90degC x 1-2hrs, followed by neutralization with 1/10 th volume 1M Tris-HCl (pH 8). PCR was performed to generate amplicons with the following primer pairs corresponding to each sgRNA guide sequence. The F/R primers for each reaction are as follows: 1) “ scn1lab sgRNA1 PCR F” AAGGACTATCTGAAGGAGGGCT; “ scn1lab sgRNA1 PCR R” TCTCTCCGACACTGAAACAAGA (product size 288bp); 2) “ scn1lab sgRNA2 PCR F” ACAGAAAGGTATCGCTCTGGTC; “ scn1lab sgRNA2 PCR R” ACATGTAGTCGCCTTCCTCAAT (product size 260bp); 3) “ scn1lab sgRNA3 PCR F” ACCTGTCGATACGGTTCTCAGT; “ scn1lab sgRNA3 PCR R” CACTAAATTGGCCAGTGTTTCA (product size 268bp). Each amplicon was Sanger sequenced (GeneWiz) with F or R primer, and the percentage of cutting associated with inferred knock-out (“KO score”) obtained using the Synthego Inference of Crisper Edits (ICE) tool 22 . For simplicity, injected larvae were stratified into 3 categories, NO CUT (0%) vs LOW (0-50%) vs HIGH (>50%) based on the KO score from the first sgRNA reaction, and compared to uninjected conspecific controls. 2.4. PTZ concentration escalation PTZ (Sigma; stored -20degC) was prepared fresh in sterile fish water (Instant Ocean) to a stock concentration 26mM, then diluted to intermediate concentrations. For serial concentration escalation experiments, a standard 10uL volume from PTZ Stock 1 (25.7mM) was added to each well of a 96-well plate (100uL starting volume per well) to yield 2.5mM, followed by an additional 10uL from PTZ Stock 2 (152.5mM; 110uL starting volume per well) to yield 15mM final concentration (final well volume, 120uL). For experiments involving anti-seizure drug pretreatment, anti-seizure drugs were administered in a standard 10uL volume. Following baseline recording, a standard 10uL volume from PTZ Stock 1 (30mM) was added to each well of a 96-well plate (110uL starting volume per well) to yield 2.5mM, followed by an additional 10uL from PTZ Stock 2 (165mM; 120uL starting volume per well) to yield 15mM final concentration (final well volume, 130uL). Pipetting was performed manually with a multi-channel pipettor. Three sequential 30-minute recordings were performed during baseline, PTZ 2.5mM, and PTZ 15mM conditions, respectively. 2.5. Calcium fluorescence imaging Imaging was performed as previously reported 6 . Briefly, individual unrestrained larval zebrafish (dpf 5) are placed into wells of an optical 96-well plate (Greiner 655076) in 100uL sterile fish water (Instant Ocean) and imaged using the FDSS7000EX fluorescent plate reader (Hamamatsu; software version 2). Specimens are illuminated by a Xenon light source passed through a 480nm filter. Epifluorescence from below the specimen is filtered (540nm) and collected by EM-CCD, allowing all wells to be recorded simultaneously. Data is collected as 256×256, 16-bit image at ∼12.6 Hz (79 msec interval), 2×2 binning, sensitivity setting = 1. Image data was extracted from the .FLI file using ImageJ or MATLAB based on the following parameters: 16-bit unsigned, 256×256, offset 66809, gap 32 bytes. Analysis was performed in MATLAB to extract position, linear and angular velocity, and changes in calcium fluorescence using a moving average deltaF/F0 method. 2.6. Analysis of calcium fluorescence data Analysis was performed as previously reported 6 . Briefly, an algorithm to track changes in calcium activity using a “moving delta F/F0” was devised in MATLAB. The initial 256×256 time-series is segmented into individual wells (∼14 x 14 pixels, ∼0.513mm per pixel) based on a pre-specified plate map. For each well, the n x m x t time-series is expanded to 2n x 2m x t using bicubic interpolation before further processing. Calcium transients are detected based on the normalized instantaneous average fluorescence for the area of the fish body within the well by the following formula: (average Ffish(t) -F0)/F0, where F0 = average Ffish (averaged over each pixel, for each time sample), and smoothed with a 1000-sample (∼79 seconds) boxcar moving average. Fish x,y position is tracked based on a weighted centroid, and linear and angular velocity estimated. The minimum detectable change in the position of a larval zebrafish is estimated to be 0.256mm, corresponding to the size of one pixel after interpolation. For detecting significant fluctuations in calcium fluorescence (referred to as calcium events), the F/F0 time-series is further smoothed with a 25-sample (∼1.975 seconds) boxcar moving average. Calcium events are initially detected from the smoothed delta F/F0 time-series by identifying peaks that exceed an empirically determined permissive threshold (0.05), while the start and end of each event is identified by the zero-crossing of the smoothed 1st derivative. Subsequently, multiple per-event measurements are obtained for each event based on combined movement and fluorescence measurements, including: (1) MaxIntensity_F_centroid: the maximum fluorescence value of the detected fish during an event; (2) MaxIntensity_F_F0_centroid: the maximum delta F/F0 value within the boundary of the detected fish during an event; (3) distance_xy_mm: total distance moved during an event in millimeters; (4) duration_sec: elapsed time in seconds; and (5) total_revolutions: number of complete circles traveled by the fish during an event. In addition, multiple per-fish measurements are obtained, including: (1) maxRange_2: the maximum fluorescence value observed during the recording; (2) totalCentroidSize_mode_mm2: the total area in square millimeters of the detected fish that exceeded a hard-coded threshold above sensor noise, which relates to the brightness of the fish. 2.7. Supervised machine learning for event classification To differentiate calcium events related to seizure-like activity from other causes of calcium fluctuation, we used a previously described logistic classifier having been fit to a combination of event-level and fish-level features in R using elastic net regression via the train () function (R package, caret ) and the glmnet method (R package, glmnet ) as previously published 6 and publicly available ( http://doi.org/10.17605/OSF.IO/TNVUJ ). This model (referred to as the “PTZ M+F” model) was previously trained on calcium events from PTZ-induced seizures (15mM) versus baseline conditions, and distinguishes seizure-like activity from non-seizure-like activity with high accuracy 6 . The model was used to classify calcium events from scn1lab animals as seizure-like or non-seizure-like using R. Fish lacking minimum fluorescence criteria (mode of fluorescence area < 0.05 mm2) were excluded from analysis. 2.8. Bootstrap simulation to identify optimal replicate number Bootstrap simulations were conducted in R using custom code and the rep_sample_n() function (R package, moderndive ) as described in the main text. The robust strictly standardized mean difference (RSSMD) between target(1) and background(2) is calculated 23 as: the median absolute deviation (MAD) is defined as: MAD = Median(| X − Median(X)|). 2.9. Statistical analysis Unless otherwise indicated, the statistical significance of group-wise differences was assessed using the non-parametric Wilcoxon rank sum test in Prism (v10.0.3, GraphPad). The false discovery rate (FDR) for multiple comparisons was controlled using the two-stage linear step-up procedure of Benjamini, Krieger, and Yekutieli to maintain family-wise alpha = 0.05. Only adjusted p-values after FDR correction are reported. 3. Results 3.1. Loss-of-function mutations in the scn1lab gene are not associated with spontaneous seizure-like activity and have opposite effects on velocity, distance traveled, and event rate in scn1lab F0 versus scn1lab s 552 hypopigmented transgenic GCaMP6s zebrafish We began by looking at the pattern of movement and calcium fluorescence changes in freely moving scn1lab fish at baseline ( Fig 1A ) using a specialized fluorescent plate-reader. Stable scn1lab s 552 larvae were generated from an incross of mutant parents to yield conspecific controls (hereafter referred to as WT, HET, or HOM). Acute F0 crispant larvae were generated by CRISPR/Cas9, combining 3 sgRNA targeting exons 16-17 of scn1lab ( Fig 1B ), and stratified by cutting efficiency (NO CUT (0%) vs LOW (0-50%) vs HIGH (>50%)) versus uninjected conspecific controls. To lend insight into the presence of clutch-specific effects, we also compared these results to two separate age-matched cohorts of wild-type fish derived from incross of GCaMP6s; nacre fish (referred to as “WT1” and “WT2”). All tested larvae had nacre hypopigmentation phenotype and neuronally expressed GCaMP6s. Download figure Open in new tab Figure 1. Loss-of-function mutations in the scn1lab gene are not associated with spontaneous seizure-like activity and have opposite effects on velocity, distance traveled, and bout rate in scn1lab F0 versus scn1lab s 552 hypopigmented transgenic GCaMP6s zebrafish. ( A ) Schematic overview of experiment to observe spontaneous activity of unrestrained larvae, without classification and following classification with a logistic classifier trained to detect seizure-like activity using both movement and fluorescence related features. ( B ) Organization of the scn1lab locus in zebrafish, with numbered exons. The position of gRNA sequences used to generate scn1lab F0 crispants is shown in green. The position of the M1208R mutation in exon 18 of the scn1lab s 552 allele is shown as a red lollipop. ( C ) Cumulative distributions of cutting at scn1lab by ICE KO score, derived from Sanger sequencing. ( D-F ) Parameters from spontaneous activity of unrestrained larvae, derived from combined movement and fluorescence profiling, including maximum velocity (D), average distance (E), and maximum normalized calcium fluorescence (dF/F0; F). ( G-H ) Rate of calcium events observed without classification or filtering (G) and after applying the PTZ M+F classifier (H). Data are group-wise Tukey box-plots of subject-level averages of all subject-specific events. Animal numbers for each group are indicated in the legend. Reported p-values are derived from Wilcoxon rank sum test, and adjusted by false-discovery rate (FDR) correction. The hash (#) symbol is used to indicate comparisons with a WT control cohort (GCaMP6s; nacre ) not derived from the experimental cross. * or #, adj P<0.05. ** or ##, adj P<0.01. *** or ###, adj P<0.001. **** or ####, adj P<0.0001. First, we observed marked suppression of average maximum velocity in both lines ( Fig 1D ). Wild-type controls and mutants from acute F0 and stable s552 cohorts had significantly reduced velocity (max velocity, uninjected: median 3.87 mm/sec, IQR 2.5-4.6; WT: Median 0.81 mm/sec, IQR 0.47-1.28) relative to heterospecific wild-type controls (control WT1: median 22.07 mm/sec, IQR 17.83-27.39’; adj. P = 0.0002 (vs uninjected), adj. P <0.0001 (vs. WT), Wilcoxon rank sum with false discovery rate (FDR) correction). Prior studies regarding the scn1lab s 552 line 5 , 16 have reported that the presence of high-velocity movements (greater than or equal to 20 mm/s) are specific for paroxysmal whole body convulsions (referred to as stage III seizures) and that the activity is highly penetrant, and limited to scn1lab s 552 HOM larvae, never being observed in conspecific controls. In contrast, our data suggests that high-velocity locomotor activity does occur in unaffected animals and is not highly prevalent in scn1lab mutants, at least not on this background or under our experimental conditions. Second, in this context, we observed no rapid swimming phenotypes in LOW/HIGH F0 crispants or in stable s552 HOM fish ( Fig 1D ), either by absolute criteria (>20mm/sec) or relative to conspecific controls. In fact, there appear to be opposite effects of scn1lab LoF in each of these scenarios, with s552 HOM fish showing increased maximum velocity (median 1.87 mm/s, IQR 1.19-2.70), relative to conspecific controls (WT: 0.81 mm/s, IQR 0.48-1.30, adj P = 0.0049; HET: 0.99 mm/s, IQR 0.73-1.3, adj P = 0.014). Meanwhile, LOW/HIGH cutting F0 crispants instead show modest reductions in velocity (LOW: Median 2.39 mm/s, IQR (1.13-5.13), adj P = 0.12 (versus on injected), 0.07 (versus NO CUT); HIGH: 2.39 mm/s, IQR 0.94-5.05, adj P = 0.19 (versus injected), 0.15 (versus NO CUT)) versus conspecific controls. This observation is further corroborated by the fact that heterospecific controls are significantly different between these cohorts (uninjected versus s552 WT, adj P = 0.005) while F0 crispant and stable s552 HOM are not significantly different (LOW versus HOM: adj P = 0.228; HIGH versus HOM: adj P = 0.297). These findings are similar to those observed for average distance per bout ( Fig 1E ). The same effects are also seen in normalized calcium fluorescence ( Fig 1F ), but the differences between cohorts and that of heterospecific WT controls is less dramatic in this context. In our previous work, we have demonstrated how the rate of calcium events is a quantitative measure of seizure-like activity 6 , therefore we also assessed the rate of calcium events in scn1lab fish ( Fig 1G ). Here again, and to an even stronger degree, we observed that the effect of scn1lab loss of function on the rate of unclassified calcium events is opposite between the lines. In s552 HOM fish, the rate of events is elevated (median 1/min, IQR 0.62-1.9) versus conspecifics (WT: 0.33/min, IQR 0.067-0.467, adj P <0.0001; HET: 0.33/min, IQR 0.167-0.833, adj P <0.0001). Meanwhile, LOW and HIGH cutting F0 crispants instead showed reductions (LOW: 0.933/min, IQR 0.23-2.92; HIGH: 0.867/min, IQR 0.167-2.07) versus conspecifics (uninjected: 2.25/min, IQR 1.5-2.76, adj P = 0.0025 (versus LOW), 0.0034 (versus HIGH); NO CUT: 2.97/min, IQR 1.7-3.53, adj P = 0.001 (versus LOW), 0.006 (versus HIGH)). Nevertheless, LOW/HIGH F0 crispant and s552 HOM larvae are actually quite similar (LOW versus HOM, adj P = 0.33; HIGH versus HOM, adj P = 0.16), whereas heterospecific controls are markedly different (uninjected versus WT, adj P < 0.0001; NO CUT versus HET, adj P < 0.0001). Using a previously described logistic classifier 6 (referred to as “PTZ M+F” classifier) trained on movement- and fluorescence-related features of seizure-like events induced by the proconvulsant GABA A R antagonist pentylenetetrazole (PTZ), we also assessed the rate of calcium events classified as seizure-like in scn1lab larvae ( Fig 1H ). Virtually no events are classified as seizure-like in either F0 crispant or stable s552 larvae, suggesting that if seizure-like activity is occurring in scn1lab animals, it is distinct from that associated with PTZ. To address this possibility, we trained a classifier using elastic net logistic regression on events from s552 -HOM fish versus WT to determine whether the spontaneous unclassified calcium events in HOM animals might be comprised of events with milder “seizure-like” features ( Supplemental Methods; Supplemental Figure 2 ). This classifier did not achieve high accuracy ( SFig 2B ; AUC-ROC 0.75; AUC-PRG, 0.17; F1 score, 0.696), and although it did confirm two classes of events (type 0 vs type 1) enriched in HOM versus WT animals, respectively ( SFig 2D , F ) – the former associated with small but significant elevations in the max velocity ( SFig 2I ) and distance per event ( SFig 2G ) relative to conspecifics – the type 0 events were not sufficiently different from events observed under physiological conditions in heterospecific wild-type control animals to justify calling them “seizure-like” with confidence. In addition, applying the scn1lab s552 HOM classifier to F0 crispant animals yielded anomalous results ( SFig 2K ), with NO CUT controls showing elevated rates of type 0 events relative to LOW and HIGH groups, suggesting again that type 0 events are a variant of normal physiological events. Alternately, the features accessible by combined movement and fluorescence profiling may be insufficient to distinguish genetic seizures accurately, at least in the setting of the unexpected suppressive phenomenon that we observed here. In summary, although the mechanism for these findings remains unclear, it is surprising not to see conservation of the previously reported rapid swimming phenotype either in stable s552 line or in the acute F0 line. The observation that totally opposite gene-specific phenotypes are possible in response to scn1lab LoF – a well-characterized epilepsy gene – is also surprising and problematic, for efforts to compare phenotypes between stable and F0 crispant lines. At a minimum, we conclude that these parameters alone may be unreliable for the characterization of spontaneous seizure-like activity in the context of combined movement and fluorescence profiling in novel mutant larvae under these conditions. 3.2. Loss-of-function mutations in the scn1lab gene are associated with enhanced susceptibility to GABA A R antagonist pentylenetetrazole (PTZ) in both scn1lab F0 and scn1lab s 552 hypopigmented transgenic GCaMP6s zebrafish We asked whether scn1lab LoF affects proconvulsant sensitivity using the combined movement and fluorescence profiling approach ( Fig 2A ) and a serial concentration escalation paradigm using low-concentration PTZ (2.5mM), followed by high-concentration PTZ (15mM), as previously reported 6 . Download figure Open in new tab Figure 2. Loss-of-function mutations in the scn1lab gene are associated with enhanced susceptibility to GABA A R antagonist, pentylenetetrazole (PTZ) in both scn1lab F0 and scn1lab s 552 hypopigmented transgenic GCaMP6s zebrafish. (A) Schematic overview of PTZ-concentration escalation experiment in unrestrained larvae, followed by classification of events using the PTZ M+F classifier. (B-C) Parameters derived from proconvulsant-induced activity of unrestrained larvae at low-concentration (2.5mM; B) and high-concentration (15mM; C) PTZ. Data are group-wise Tukey box-plots of subject-level averages of all subject-specific events. Animal numbers for each group are indicated in the legend according to subpanel; only animals with detectable events were analyzed in subpanels ii-iii. Reported p-values are derived from Wilcoxon rank sum test, and adjusted by false-discovery rate (FDR) correction. The hash (#) symbol is used to indicate comparisons with a WT control cohort (GCaMP6s; nacre ) not derived from the experimental cross. * or #, adj P<0.05. ** or ##, adj P<0.01. *** or ###, adj P<0.001. **** or ####, adj P<0.0001. First, at low-concentration PTZ, we saw a clear line-specific reduction in PTZ sensitivity affecting all scn1lab s 552 conspecifics ( Fig 2B.i ), which is not observed in F0 crispant fish. For example, with respect to rate of classified seizure-like events, control animals from the s552 line are dramatically reduced (wild-type: median 0/min, IQR 0-0.867; HET, 0.03/min, IQR 0-0.567) versus heterospecific wild-type controls (WT1: median 0.483/min, IQR 0.23-0.858, adj P = 0.0001 (versus WT), adj P <0.0001 (versus HET)). Control animals from crispant experiments did not differ in their sensitivity to PTZ (uninjected, median 0.767/min, IQR 0.467-2.03; NO CUT, 0.633/min, IQR 0.467-1.73) relative to heterospecific controls (adj P = 0.2 (versus uninjected), adj P =0.087 (versus NO CUT)). Given the partially shared genetic background between these lines, the reduction in sensitivity in the scn1lab s552 conspecifics could be mediated either by a dominant effect of the previous genetic background (derived from the imported TL line) and/or parental effects of scn1lab LoF in mutant gametes. Second, we see strong evidence of an scn1lab -related enhancement in PTZ induced seizures in both F0 crispant and stable s552 fish ( Fig 2B.i ). For example, LOW/HIGH F0 crispant animals had elevated event rates (LOW, median 3.2/min, IQR 2.05-3.95; HIGH, 2.97/min, IQR 1.55-4.05) versus conspecifics (LOW versus uninjected, adj P = 0.01; HIGH versus uninjected, adj P = 0.03). Importantly, the enhanced sensitivity to PTZ in F0 crispant animals is even higher than observed in heterospecific wild-type controls (LOW versus WT1, adj P<0.0001; HIGH versus WT1, adj P = 0.0027). In contrast, s552 HOM fish showed elevated event rates (median 0.233/min, IQR 0-2.9) relative to conspecifics (HOM versus WT, adj P = 0.0077; HOM versus HET, adj P > 0.0007), but were not different from heterospecific controls (HOM versus WT1, adj P =0.07). This again corroborates that the mechanism of the suppressive effect observed in the s552 line is independent of larval genotype, and appears to attenuate the scn1lab -related phenotype in HOM animals. It is also worth mentioning that in F0 crispants, the scn1lab -related enhancement is detectable in fish with either LOW (0-50%) or HIGH (>50%) cutting, whereas only s552 HOM (not HET) larvae showed this phenotype, suggesting that high cutting is not necessary to recapitulate a phenomenon that in stable lines appears to require biallelic disruption 16 . Third, we next looked at changes in max velocity in response to low-concentration PTZ ( Fig 2B.ii ). In general, max velocity appears to be less informative than event rate, with no differences between conspecifics observed in either F0 crispant or stable s552 larvae. Of note, despite showing a suppression of velocity and distance during spontaneous activity, the s552 line shows no evidence for impairment in max velocity after exposure to PTZ, with all groups showing max velocities greater than 30 mm/s, similar to heterospecific controls. By contrast, the max velocity observed amongst F0 crispants was slightly reduced (uninjected, median 23.5 mm/s, IQR 20-32.6; LOW, 24.6 mm/s, IQR 19.2-27.6) versus heterospecific controls (uninjected versus WT1, adj P = 0.02, LOW versus WT1, adj P < 0.0001). Based on our experience with PTZ related seizures, this suggests that the seizure-like activity experienced by F0 crispants at low-concentration PTZ is in some ways similar to seizures seen in heterospecific controls at higher concentration PTZ ( cf. Fig 2C.ii ). The results of normalized calcium fluorescence per event (max deltaF/F0; Fig 2B.iii ) are similar, with reductions in F0 crispants relative to s552 and heterospecific controls and additional reductions in LOW and HIGH F0 crispants relative to conspecifics, which may reflect the higher rate of events in these larvae more typically observed at higher concentration PTZ ( cf. Fig 2C.iii ). We next asked whether scn1lab LoF would alter the response to high-concentration PTZ (15mM) ( Fig 2C ). First, regarding the rate of classified seizure-like events, s552 larvae showed the expected increase in the rate of events versus low-concentration PTZ (WT_PTZ2.5 vs. WT_PTZ15, adj P = 0.002; HET_PTZ2.5 vs. HET_PTZ15, adj P<0.0001; HOM_PTZ2.5 vs. HOM_PTZ15, adj P =0.009), but all conspecifics were still suppressed relative to heterospecific controls. In addition, the scn1lab related sensitivity in s552 HOM larvae is no longer significantly different at high concentration PTZ (WT, median 0.55/min, IQR 0.033-2.26; HET, 0.4/min, IQR 0.033-2.27; HOM, 1.73/min, IQR 0.175-2.46)). Second, in F0 crispants, conspecific controls showed the expected increase in seizure-like activity versus low-concentration PTZ (Uninjected_PTZ2.5 vs. Uninjected_PTZ15, adj P = 0.005; NO CUT_PTZ2.5 vs. NO CUT_PTZ15, adj P = 0.006), similar to heterospecific controls, but LOW and HIGH F0 crispants did not show higher rates (LOW _PTZ2.5 vs. LOW _PTZ15, adj P = 0.1889; HIGH_PTZ2.5 vs. HIGH_PTZ15, adj P = 0.185). In the case of HIGH F0 crispants, the event rates appear reduced (median 2.43/min, IQR 1.82-2.5) relative to conspecifics (uninjected: 3.067/min, IQR 2.57-3.37, adj P= 0.04; NO CUT: 3.1/min, IQR 2.13-3.7, adj P = 0.029). These observations again suggest that F0 crispant fish achieve more severe and frequent seizure-like activity at low-concentration PTZ, such that the effect is already saturated at higher PTZ concentrations, likely contributing to early lethality in these animals. Third, both F0 crispant and stable s552 lines showed scn1lab -related elevations in max velocity ( Fig 2C .ii) and normalized calcium fluorescence ( Fig 2C .iii) relative to conspecifics, which may be a mark of enhanced severity of seizures relative to conspecifics, despite similar event rates at this concentration. In summary, we demonstrate that enhanced sensitivity to low-concentration PTZ is a robust correlate of scn1lab loss-of-function in F0 crispant and stable s552 line, and show evidence for a still unexplained suppressive effect of the s552 background on this phenotype. 3.3. Bootstrap simulations provide benchmarks for detecting scn1lab-related enhanced sensitivity to low-concentration PTZ in scn1lab F0 and scn1lab s 552 in hypopigmented transgenic GCaMP6s zebrafish Given our observations that neither the well-established scn1lab s 552 line nor a separate scn1lab F0 crispant line show spontaneous seizure-like activity, further screens for spontaneous seizure-like activity under these conditions should proceed only with great caution. However, given the robust nature of the enhancement to low-concentration PTZ and its correspondence with scn1lab LoF, we foresee that reverse or forward genetic screens to detect gene-specific enhancements to low-concentration PTZ could be employed using the combined movement and fluorescence approach. To identify the optimal parameters for such screens, we performed two sets of bootstrap resampling simulations using the acquired datasets from scn1lab F0 and scn1lab s 552 zebrafish. Using the robust strictly standardized mean difference (RSSMD) as a measure of effect size and variability, these calculations (3000 iterations, with replacement) compute the RSSMD threshold for detecting the observed enhancement in the rate of seizure-like events in a target group ( scn1lab loss of function) versus a background group, as a function of bootstrap sample size (n=8-48) while maintaining 5% false positive rate (FPR). For F0 crispant simulations, we pooled all injected animals into the target group (i.e. no stratification) to mirror the real-life circumstances of an F0 screen where no filtering of the results based on the measured level of locus-specific cutting efficiency would be expected; uninjected conspecifics were defined as background. For reference, we also performed simulations with the s552 data, with HOM animals defined as the target group, while WT and HET animals were pooled to form the background group. The results are shown as dual-axis plots ( Fig 3 ) with RSSMD thresholds read as closed circles on the left axis, with associated true positive rates (TPR) read as open squares on the right axis. Download figure Open in new tab Figure 3. Bootstrap simulations provide benchmarks for detecting scn1lab -related enhanced sensitivity to low-concentration PTZ in scn1lab F0 and scn1lab s 552 hypopigmented transgenic GCaMP6s zebrafish. (A-B) Bootstrap resampling simulations (3000 iterations, with replacement) from low-concentration PTZ for scn1lab F0 (A) and scn1lab s 552 (B) zebrafish. For each bootstrap sample size N (x-axis), closed circles (left y-axis) are the robust strictly standardized mean difference (RSSMD) threshold required to limit the false positive rate (FPR) to 5% and open boxes (right y-axis) are the associated true positive rate (TPR) for detecting the scn1lab -related increase in PTZ sensitivity. Dashed reference lines indicate 80% TPR. We observed that the enhanced PTZ sensitivity by the classified seizure-like event rate is detectable in F0 crispants ( Fig 3A ) with lower replicates (e.g. n=16, TPR 80%) versus scn1lab s 552 (e.g. n=24 required to achieve TPR 80%; Fig 3B ). This is interesting considering the statistical magnitude of effect for these differences (see Fig 2Bi ), but can be explained by the fact that in F0, the control groups (uninjected and NO CUT) each had 13-15 animals, which is below the minimum sample size suggested by the analysis (N=16, at TPR 80%). In s552 larvae, the controls (WT/HET) had 31-55 animals – well above the minimum sample size suggested by the analysis (N=24 and closer to N=48, at which 100% TPR is achieved). Ultimately, both F0 crispants and stable lines appear suitable for screening at higher sample sizes using combined movement and fluorescent profiling, with crispants demonstrating a slight advantage with respect to the minimum number of replicates necessary. 4. Discussion Advanced analysis of brain activity from model organisms in states of health and disease benefits from the combination of different stable lines, including those expressing disease-relevant mutations and/or transgenic lines expressing genetically encoded calcium indicators (such as GCaMP6s) among other tools. However, the effects of these combinations or changes in genetic background on the phenotype under investigation are not always rigorously assessed or controlled in zebrafish. This is a critical issue for the rigor and reproducibility of animal studies, which undergirds the legitimacy by which the pathophysiological mechanisms associated with disease alleles may be dissected through the use of tools generated on different genetic backgrounds. Although these issues are well-known in the rodent literature 23 , comparatively little attention has been paid in the zebrafish literature 8 . In the present study, we attempted to evaluate spontaneous seizure-like activity and proconvulsant-related seizure-like activity associated with loss-of-function in the well-characterized scn1lab gene in zebrafish expressing a genetically encoded calcium indicator (elavl3:GCaMP6s) with nacre hypopigmentation phenotype using combined movement and fluorescence profiling (summarized in Table 1 ), but encountered several challenges which highlight the importance of understanding the implications of seemingly routine genetic manipulations on the phenotype under study. View this table: View inline View popup Download powerpoint Table 1. Summary of major findings 4.1. No detectable spontaneous seizure-like phenotype in scn1lab lines based on combined movement and fluorescence measurements By conducting our experiments using a GCaMP6s; nacre line, we accidentally discovered conditions that suppress the rapid swimming phenotype associated with the well-known epilepsy allele scn1lab s 552 , in addition to the effects of scn1lab LoF in F0 crispant fish, representing two independent lines of evidence. Although we do not directly model the s552 missense variant (M1208R) in scn1lab F0 crispants, the nature of the disruption in F0 crispants would be expected to be stronger than that of s552 , and yet it also does not result in spontaneous seizure-like activity. This is surprising because the phenotype associated with scn1lab s 552 has been so well-established 5 , 16 . Indeed, there are many reports in the literature affirming the locomotor phenotype of s552 24 , or in which alternative stable scn1lab LoF alleles 17 , 18 , morpholino knock-downs 24 or F0 crispants 25 are generated and shown also to display similar locomotor phenotypes. The s552 line maintained in Baraban’s group is on TL 5 , as is ours, whereas the Tiraboschi group implies that its novel scn1lab KO allele is on AB 17 ; other authors did not report the genetic background used. No authors use the GCaMP6; nacre line utilized in this study, which is maintained on AB. All lines shown to have rapid swimming or increased locomotor activity also showed other abnormalities by tectal LFP and/or calcium fluorescence. There were no reports of rapid swimming phenotype being lost after combination with other lines, though it is not clear if this was assessed in the two studies using calcium fluorescence 20 , 24 , and it is interesting to note that the Tiraboschi group did not report rapid swimming but rather increased distance traveled in scn1lab KO animals on AB background. In summary, there is incomplete information from the literature to determine the extent to which genetic background or the combination of other zebrafish transgenic or mutant lines has contributed to the rapid swimming phenotype reported by other authors in association with scn1lab LoF mutations. We speculate that our findings could be related to an effect of one or more factors unique to our study, including genetic background, nacre hypopigmentation, or the GCaMP6s transgenic line. First, a dominant suppressive effect of the AB background on which the GCaMP6s; nacre line is maintained could account for the effect in both stable s552 and F0 crispant fish. Crispant and heterospecific GCaMP6s; nacre control larvae were derived directly from this AB-derived line, while F2 scn1lab s 552 larvae used for experiments are expected to be 50:50 AB:TL, suggesting one or more genetic modifiers from AB may act to suppress scn1lab -related hyperexcitability. Second, it is possible that the nacre pigmentation defect, or the genetic processes leading to it, could play a role. It is hard to ignore that scn1lab HOM have a well-known but poorly understood hyperpigmentation phenotype (seen in multiple lines, including s552 16 , 19 , 24 and those of others 17 , 24 ), but it has never been asserted to have a causal role in scn1lab- related hyperexcitability. Naturally, neither s552 or F0 crispant animals in our study show hyperpigmentation since the nacre phenotype results from an absence of melanophores due to recessive loss-of-function in the mitfa (aka nacre ) gene 4 , suggesting that ablation of melanophores may be a candidate mechanism for suppression of scn1lab -related spontaneous seizure-like activity. Since the mitfa locus is commonly combined with other loci to generate more extensive pigmentation deficits such as casper ( mitfa w 2 /w 2 ;roy a 9 /a 9 ) and crystal ( mitfa w 2 /w 2 ;alb b 4 /b 4 ;roy a 9 /a 9 ), any undesired effects of nacre on the scn1lab phenotype may be highly relevant to other hypopigmentation combinations as well. To the best of our knowledge, no other studies involving scn1lab utilize pigmentation mutants. The use of 1-phenyl 2-thiourea (PTU)--a chemical inhibitor of tyrosinase, which inhibits melanin production but preserves melanophores 26 -- has been reported twice 20 , 24 though its effect on rapid swimming was not assessed. The use of PTU is generally regarded as having greater deleterious neurological effects 26 – 28 compared to pigmentation mutants. Meanwhile, F0 scn1lab crispants that harbor concomitant acute KO in the tyr gene still have rapid swimming 25 , suggesting that lack of functional tyrosinase enzyme is not sufficient to suppress. Third, we consider it is less likely to be related to GCaMP itself. In the mouse literature, a consistent pro-epileptic phenotype has been reported with specific GCaMP6s transgenic lines 23 , due to what the authors argue is an effect of widespread GCaMP6 expression specifically during brain development, as opposed to the genetic background or toxicity from Cre or tTA used in these lines. Perhaps if GCaMP6s can have pro-epileptic effects in one context, compensatory anti-epileptic effects may be triggered during zebrafish development, but this may be the least compelling explanation for our findings. In the context of scn1lab zebrafish, there are two other examples of scn1lab mutants with seizure-like activity of some kind in combination with elavl3:GCaMP5, suggesting that GECIs do not categorically suppress scn1lab -related seizure activity 20 , 24 . However, there are no other relevant studies reported using the transgenic GCaMP6s line (employed here), so a line-specific phenotype due to insertion effects of the transgene 29 , 30 or linked modifier loci cannot yet be excluded. Future experiments should explore the molecular mechanism of this suppression, to test its dependency on specific lines used here and to test specifically whether hypopigmentation suppresses scn1lab pathophysiology. These studies would shed more light on the factors contributing to variability in preclinical zebrafish models of epilepsy, and may identify genetic modifiers with clinical relevance to Dravet syndrome. 4.2. Enhanced sensitivity to PTZ in scn1lab lines At the same time, we also see recapitulation of enhanced susceptibility to PTZ in a manner dependent on scn1lab LoF. This is evidenced by elevated rate of PTZ-like seizure activity after exposure to acute low-concentration PTZ (2.5 mM) in both s552 -HOM and F0 crispant fish, as quantified using the combined movement and fluorescence profiling and the PTZ M+F classifier. These findings suggest that although scn1lab deficiency does not result in spontaneous PTZ-like seizures under the conditions reported, nevertheless scn1lab deficiency alters excitatory-inhibitory balance in a manner that lowers the seizure threshold provoked by GABA A R antagonism, perhaps due to impaired inhibitory versus enhanced excitatory synaptic transmission. This finding is consistent with other reports of enhanced sensitivity to PTZ in a model of scn1lab 18 , in addition to evidence of reduced whole organism GABA levels in scn1lab zebrafish 18 . Meanwhile, we show remarkably low percentage of measured cutting (0-50%) in scn1lab was sufficient to generate a prominent PTZ phenotype in F0 crispants, justifying the use of F0 crispants in reverse genetic screening for seizure-related phenotypes. 4.3. Could scn1lab lines still have spontaneous seizures that are less severe? Taking both findings (4.1 and 4.2) together, we concede that it is possible that scn1lab LoF mutants in this study may yet have evidence of spontaneous seizures – perhaps less severe, and with minimal movement -- by other modalities not assessed here, such as tectal LFP. We expected to be able to detect milder seizures using movement or calcium fluorescence by way of a HOM-specific classifier, and we did demonstrate type 0 events detected by this classifier occur at elevated rates compared to conspecific controls. However, these events are not easily distinguished by movement and fluorescence criteria from physiological events, at least under the conditions reported here, limiting their utility as a read-out on this platform. Of note, we can confidently exclude the possibility that suppression of rapid swimming occurs due to a deficit in movement generation, as both s552 and F0 crispants are capable of rapid movements (>20mm/sec) in response to PTZ. Future investigations should determine whether genetic mutants on different background lines may have seizure-like activity that is more amenable to detection on this platform. 4.4. Genetic suppression of PTZ sensitivity in larvae derived from scn1lab s 552 /+ matings Last, we also report evidence for a second mode of suppression in the scn1lab - s552 line. This phenomenon is expressed as a reduction in the rate of seizure-like calcium events induced by low-concentration PTZ (2.5mM) and high-concentration PTZ (15mM) across conspecific animals generated from scn1lab s 552 /+ parents. We believe this is distinct from the mechanism suppressing the rapid swimming phenotype in s552 and F0 crispants, since conspecific control larvae from F0 crispant experiments and heterospecific controls did not show reduced PTZ sensitivity. The mechanism is also unclear. A dominant effect of the 50% TL genetic background remaining from the imported s552 line (see Section 4.1 ) could explain why the phenotype is only observed in larvae derived from scn1lab s 552 parents. A transcriptional adaptation (TA) response 12 (see Introduction ) is unlikely as s552 is a missense variant and not anticipated to induce NMD. Another possibility is a maternal effect due to scn1lab -related misregulation of paralogous sodium channel genes in the maternal zygote. Sodium channel expression and function are well-known to be subject to homeostatic regulation during development 31 . Based on publicly available mRNA expression data from zebrafish development 32 , transcripts from several voltage-gated sodium genes are present at the earliest zygotic time-points (including scn1bb , scn1laa and others, but not scn1lab itself; Supplemental Fig 3 ) and might be candidate genes whose putative misregulation in the setting of maternal scn1lab LoF alters larval sensitivity to PTZ. In support of this possibility, an experimental over-expression of the paralogous scn1laa only during the first 24hrs of development was sufficient to cause an epileptiform phenotype at later time-points and to worsen the phenotype of scn1lab LoF larvae 33 , demonstrating that early regulation of voltage-gated sodium channel genes is highly influential on later seizure-related phenotypes. Future work should explore the molecular mechanism of this suppression and whether it relates to misregulation of sodium channels in the context of scn1lab LoF. To the best of our knowledge, this is the first report of a suppressive phenomenon related to the scn1lab s 552 allele affecting WT offspring. One reason it has not been previously reported may be because the use of both conspecific and heterospecific controls is not routine. It is also an anti-epileptic phenotype, which requires proconvulsant exposure to detect in WT offspring, due to the lack of spontaneous seizure-like activity. Nevertheless, data from Griffin et al 34 suggest that the prevalence of parental (likely maternal) effects in association with putative epilepsy genes in zebrafish may be greater than has been formally recognized. In this paper, the authors generated 40 lines via CRISPR/Cas9 corresponding to homologs of human epilepsy genes, and reported a low prevalence of spontaneous seizure-like activity among HOM animals (compared to conspecifics), but widely divergent findings between the WT conspecifics of different presumably congenic stable lines. Some WT animals showed a greater amount of epileptiform abnormality from tectal electrophysiological recordings than conspecific homozygotes or heterospecific WTs (for example, scn1ba , scn8aa, and several others 34 ). Limited explanation for the WT phenotypes is offered by the authors, but an effect of GC may be a compelling explanation that should be assessed in future endeavors to model genetic epilepsy in zebrafish using stable alleles. 5. Data and code availability statement All of the data generated in the present study and MATLAB/R code are available upon request. 7. Author contributions using the CRediT taxonomy CM: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Software, Visualization, Supervision, Writing – original draft, Writing – review and editing. CB: Investigation, Writing – review. AP: Funding acquisition, Supervision, Writing – review and editing. 8. Funding information This work was supported by grants from the Epilepsy Study Consortium (CMM); CURE Taking Flight Award (CMM); and NIH / NINDS K08NS118107 (CMM). AP was supported by the Diamond Blackfan Chair in Neuroscience Research and the Robinson Fund for Transformative Research in Epilepsy. 9. Competing interests The authors have no competing interests to declare. 11. Supplementary Material 11.1. Supplementary Methods 10.1.1. Supervised machine learning for event classification in scn1lab s 552 HOM fish To evaluate whether calcium events from scn1lab s 552 HOM fish might have unique features that distinguish them from events occurring in WT fish, a logistic classifier was trained using the same approach as in Section 2.7 . using events from all s552 HOM animals versus s552 WT controls, 70:30 train:test split, and 5-fold cross-validation. The model formula for the classifier (referred to as the “scn1lab M+F” model) was identical to that of the previously described “PTZ M+F” classifier 6 . Specifically, the model formula used was: Conditions_names ∼ (MaxIntensity_F_centroid + MaxIntensity_F_F0_centroid + distance_xy_mm + duration_sec) * (maxRange_2 + totalCentroidSize_mode_mm2). Data were divided into 70:30 train:test split, with 5-fold cross validation, alpha range: 0,0.5, 1, lambda range: 0.1, 1, 10, and metric = “accuracy”. Model performance was evaluated using package MLeval. 11.2. Supplemental Figures Download figure Open in new tab Supplementary Figure 1. Generation of scn1lab s 552 larvae. (A) Representative example of Sanger sequencing from PCR genotyping of scn1lab s 552 larvae, demonstrating the expected c.T>G variant in a heterozygote larvae (lower) vs wildtype (middle) compared to reference sequence (upper) Download figure Open in new tab Supplementary Figure 2. Elastic net logistic classifier trained on scn1lab s 552 HOM larvae weakly detects an event type enriched in s552 HOM larvae. (A) Overview of approach and figure. (B) Comparison of performance metrics from scn1lab M+F classifier versus the previously published PTZ M+F classifier trained on PTZ-induced seizure activity. ( C ) Parameter tuning from scn1lab M+F classifier. (D-E) Uniform manifold approximation and projection (UMAP) representation of pooled individual events from scn1lab s 552 conspecifics, color coded by classification (D) or average distance (E). (F-G) Group-wise quantification of event rate (F) and average distance (G) from larvae in (D-E), stratified by classified event type (Type 0 vs Type 1). (H-J) Group-wise quantification of normalized calcium fluorescence (H), max velocity (I), and total revolutions (J) for scn1lab s 552 larvae, stratified by classified event type. ( K ) Event rates derived from events classified as Type 0 by the scn1lab M+F classifier in scn1lab F0 crispant fish. Data are group-wise Tukey box-plots of subject-level averages of all subject-specific events. Reported p-values are derived from Wilcoxon rank sum test, and adjusted by false-discovery rate (FDR) correction. *, adj P<0.05. **, adj P<0.01. ***, adj P<0.001. ****, adj P<0.0001. Download figure Open in new tab Supplementary Figure 3. Expression of sodium channels genes across larval zebrafish developmental stages Data are transcripts per million (TPM) derived from mRNA-seq, as reported by White RJ, Collins JE, Sealy IM, Wali N, Dooley CM et al. (2017) A high-resolution mRNA expression time course of embryonic development in zebrafish. Colors are scaled continuously from minimum (red), median (yellow), to max (green). 6. Acknowledgements The authors would like to thank Lee Barrett for technical assistance with the FDSS7000EX, Guoqi Zhang for assistance in zebrafish husbandry, and members of the Poduri lab including Christopher LaCoursiere for helpful discussions. References 1. ↵ Gawel , K. , Langlois , M. , Martins , T. , van der Ent , W. , Tiraboschi , E. , Jacmin , M. , Crawford , A.D. , and Esguerra , C.V. ( 2020 ). Seizing the moment: Zebrafish epilepsy models . Neurosci. Biobehav. Rev . 116 , 1 – 20 . doi: 10.1016/j.neubiorev.2020.06.010 . OpenUrl CrossRef PubMed 2. ↵ LaCoursiere , C.M. , Ullmann , J.F.P. , Koh , H.Y. , Turner , L. , Baker , C.M. , Robens , B. , Shao , W. , Rotenberg , A. , McGraw , C.M. , and Poduri , A . ( 2024 ). Zebrafish models of candidate human epilepsy-associated genes provide evidence of hyperexcitability . Preprint at bioRxiv , doi: 10.1101/2024.02.07.579190 . OpenUrl Abstract / FREE Full Text 3. ↵ Vladimirov , N. , Mu , Y. , Kawashima , T. , Bennett , D.V. , Yang , C.-T. , Looger , L.L. , Keller , P.J. , Freeman , J. , and Ahrens , M.B . ( 2014 ). Light-sheet functional imaging in fictively behaving zebrafish . Nat. Methods 11 , 883 – 884 . doi: 10.1038/nmeth.3040 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Lister , J.A. , Robertson , C.P. , Lepage , T. , Johnson , S.L. , and Raible , D.W . ( 1999 ). nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate . Development 126 , 3757 – 3767 . doi: 10.1242/dev.126.17.3757 . OpenUrl Abstract 5. ↵ Dinday , M.T. , and Baraban , S.C . ( 2015 ). Large-Scale Phenotype-Based Antiepileptic Drug Screening in a Zebrafish Model of Dravet Syndrome . eNeuro 2 . doi: 10.1523/ENEURO.0068-15.2015 . OpenUrl Abstract / FREE Full Text 6. ↵ McGraw , C.M. , and Poduri , A . ( 2024 ). Machine learning enables high-throughput, low-replicate screening for novel anti-seizure targets and compounds using combined movement and calcium fluorescence in larval zebrafish . Preprint at bioRxiv , doi: 10.1101/2024.08.01.606228 . OpenUrl Abstract / FREE Full Text 7. ↵ Trevarrow , B. , and Robison , B. ( 2004 ). Genetic Backgrounds, Standard Lines, and Husbandry of Zebrafish . In Methods in Cell Biology The Zebrafish: Genetics, Genomics, and Informatics . ( Academic Press ), pp. 599 – 616 . doi: 10.1016/S0091-679X(04)77032-6 . OpenUrl CrossRef PubMed 8. ↵ Crim , M.J. , and Lawrence , C . ( 2021 ). A fish is not a mouse: understanding differences in background genetics is critical for reproducibility . Lab Anim . 50 , 19 – 25 . doi: 10.1038/s41684-020-00683-x . OpenUrl CrossRef 9. ↵ Löscher , W. , Ferland , R.J. , and Ferraro , T.N . ( 2017 ). The relevance of inter- and intrastrain differences in mice and rats and their implications for models of seizures and epilepsy . Epilepsy Behav . 73 , 214 – 235 . doi: 10.1016/j.yebeh.2017.05.040 . OpenUrl CrossRef PubMed 10. ↵ El-Brolosy , M.A. , and Stainier , D.Y.R . ( 2017 ). Genetic compensation: A phenomenon in search of mechanisms . PLOS Genet . 13 , e1006780 . doi: 10.1371/journal.pgen.1006780 . OpenUrl CrossRef PubMed 11. ↵ El-Brolosy , M.A. , Kontarakis , Z. , Rossi , A. , Kuenne , C. , Günther , S. , Fukuda , N. , Kikhi , K. , Boezio , G.L.M. , Takacs , C. , Lai , S.-L. , et al. ( 2019 ). Genetic compensation triggered by mutant mRNA degradation . Nature 568 , 193 – 197 . doi: 10.1038/s41586-019-1064-z . OpenUrl CrossRef PubMed 12. ↵ Jiang , Z. , El-Brolosy , M.A. , Serobyan , V. , Welker , J.M. , Retzer , N. , Dooley , C.M. , Jakutis , G. , Juan , T. , Fukuda , N. , Maischein , H.-M. , et al. ( 2022 ). Parental mutations influence wild-type offspring via transcriptional adaptation . Sci. Adv . 8 , eabj2029 . doi: 10.1126/sciadv.abj2029 . OpenUrl CrossRef 13. ↵ Pelegri , F . ( 2003 ). Maternal factors in zebrafish development . Dev. Dyn . 228 , 535 – 554 . doi: 10.1002/dvdy.10390 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Buglo , E. , Sarmiento , E. , Martuscelli , N.B. , Sant , D.W. , Danzi , M.C. , Abrams , A.J. , Dallman , J.E. , and Züchner , S . ( 2020 ). Genetic compensation in a stable slc25a46 mutant zebrafish: A case for using F0 CRISPR mutagenesis to study phenotypes caused by inherited disease . PLOS ONE 15 , e0230566 . doi: 10.1371/journal.pone.0230566 . OpenUrl CrossRef PubMed 15. ↵ Dravet , C . ( 2011 ). The core Dravet syndrome phenotype . Epilepsia 52 , 3 – 9 . doi: 10.1111/j.1528-1167.2011.02994.x . OpenUrl CrossRef PubMed 16. ↵ Baraban , S.C. , Dinday , M.T. , and Hortopan , G.A . ( 2013 ). Drug screening in Scn1a zebrafish mutant identifies clemizole as a potential Dravet syndrome treatment . Nat. Commun . 4 , 2410 . doi: 10.1038/ncomms3410 . OpenUrl CrossRef PubMed 17. ↵ Tiraboschi , E. , Martina , S. , van der Ent , W. , Grzyb , K. , Gawel , K. , Cordero-Maldonado , M.L. , Poovathingal , S.K. , Heintz , S. , Satheesh , S.V. , Brattespe , J. , et al. ( 2020 ). New insights into the early mechanisms of epileptogenesis in a zebrafish model of Dravet syndrome . Epilepsia 61 , 549 – 560 . doi: 10.1111/epi.16456 . OpenUrl CrossRef 18. ↵ Weuring , W.J. , Singh , S. , Volkers , L. , Rook , M.B. , Slot, R.H. van ‘t, Bosma , M. , Inserra , M. , Vetter , I. , Verhoeven-Duif , N.M. , Braun , K.P.J. , et al. ( 2020 ). NaV1.1 and NaV1.6 selective compounds reduce the behavior phenotype and epileptiform activity in a novel zebrafish model for Dravet Syndrome . PLOS ONE 15 , e0219106 . doi: 10.1371/journal.pone.0219106 . OpenUrl CrossRef 19. ↵ Schoonheim , P.J. , Arrenberg , A.B. , Bene , F.D. , and Baier , H . ( 2010 ). Optogenetic Localization and Genetic Perturbation of Saccade-Generating Neurons in Zebrafish . J. Neurosci . 30 , 7111 – 7120 . doi: 10.1523/JNEUROSCI.5193-09.2010 . OpenUrl Abstract / FREE Full Text 20. ↵ Ghannad-Rezaie , M. , Eimon , P.M. , Wu , Y. , and Yanik , M.F . ( 2019 ). Engineering brain activity patterns by neuromodulator polytherapy for treatment of disorders . Nat. Commun . 10 , 2620 . doi: 10.1038/s41467-019-10541-1 . OpenUrl CrossRef 21. ↵ Labun , K. , Montague , T.G. , Krause , M. , Torres Cleuren , Y.N. , Tjeldnes , H. , and Valen , E . ( 2019 ). CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing . Nucleic Acids Res . 47 , W171 – W174 . doi: 10.1093/nar/gkz365 . OpenUrl CrossRef PubMed 22. ↵ Conant , D. , Hsiau , T. , Rossi , N. , Oki , J. , Maures , T. , Waite , K. , Yang , J. , Joshi , S. , Kelso , R. , Holden , K. , et al. ( 2022 ). Inference of CRISPR Edits from Sanger Trace Data . CRISPR J . 5 , 123 – 130 . doi: 10.1089/crispr.2021.0113 . OpenUrl CrossRef PubMed 23. ↵ Steinmetz , N.A. , Buetfering , C. , Lecoq , J. , Lee , C.R. , Peters , A.J. , Jacobs , E.A.K. , Coen , P. , Ollerenshaw , D.R. , Valley , M.T. , Vries, S.E.J. de, et al. ( 2017 ). Aberrant Cortical Activity in Multiple GCaMP6-Expressing Transgenic Mouse Lines . eNeuro 4 . doi: 10.1523/ENEURO.0207-17.2017 . OpenUrl Abstract / FREE Full Text 24. ↵ Brenet , A. , Hassan-Abdi , R. , Somkhit , J. , Yanicostas , C. , and Soussi-Yanicostas , N . ( 2019 ). Defective Excitatory/Inhibitory Synaptic Balance and Increased Neuron Apoptosis in a Zebrafish Model of Dravet Syndrome . Cells 8 , 1199 . doi: 10.3390/cells8101199 . OpenUrl CrossRef 25. ↵ Locubiche , S. , Ordóñez , V. , Abad , E. , Scotto di Mase , M. , Di Donato , V. , and De Santis , F. ( 2024 ). A Zebrafish-Based Platform for High-Throughput Epilepsy Modeling and Drug Screening in F0 . Int. J. Mol. Sci . 25 , 2991 . doi: 10.3390/ijms25052991 . OpenUrl CrossRef 26. ↵ Li , Z. , Ptak , D. , Zhang , L. , Walls , E.K. , Zhong , W. , and Leung , Y.F . ( 2012 ). Phenylthiourea Specifically Reduces Zebrafish Eye Size . PLOS ONE 7 , e40132 . doi: 10.1371/journal.pone.0040132 . OpenUrl CrossRef PubMed 27. Antinucci , P. , and Hindges , R . ( 2016 ). A crystal-clear zebrafish for in vivo imaging . Sci. Rep . 6 , 29490 . doi: 10.1038/srep29490 . OpenUrl CrossRef 28. ↵ Chen , X.-K. , Kwan , J.S.-K. , Chang , R.C.-C. , and Ma , A.C.-H . ( 2021 ). 1-phenyl 2-thiourea (PTU) activates autophagy in zebrafish embryos . Autophagy 17 , 1222 – 1231 . doi: 10.1080/15548627.2020.1755119 . OpenUrl CrossRef 29. ↵ Goodwin , L.O. , Splinter , E. , Davis , T.L. , Urban , R. , He , H. , Braun , R.E. , Chesler , E.J. , Kumar , V. , Min, M. van, Ndukum, J., et al. ( 2019 ). Large-scale discovery of mouse transgenic integration sites reveals frequent structural variation and insertional mutagenesis . Genome Res . 29 , 494 – 505 . doi: 10.1101/gr.233866.117 . OpenUrl Abstract / FREE Full Text 30. ↵ Jacobsen , J.C. , Erdin , S. , Chiang , C. , Hanscom , C. , Handley , R.R. , Barker , D.D. , Stortchevoi , A. , Blumenthal , I. , Reid , S.J. , Snell , R.G. , et al. ( 2017 ). Potential molecular consequences of transgene integration: The R6/2 mouse example . Sci. Rep . 7 , 41120 . doi: 10.1038/srep41120 . OpenUrl CrossRef 31. ↵ Schulz , D.J. , Temporal , S. , Barry , D.M. , and Garcia , M.L . ( 2008 ). Mechanisms of voltage-gated ion channel regulation: from gene expression to localization . Cell. Mol. Life Sci . 65 , 2215 – 2231 . doi: 10.1007/s00018-008-8060-z . OpenUrl CrossRef PubMed Web of Science 32. ↵ White , R.J. , Collins , J.E. , Sealy , I.M. , Wali , N. , Dooley , C.M. , Digby , Z. , Stemple , D.L. , Murphy , D.N. , Billis , K. , Hourlier , T. , et al. ( 2017 ). A high-resolution mRNA expression time course of embryonic development in zebrafish . eLife 6 , e30860 . doi: 10.7554/elife.30860 . OpenUrl CrossRef PubMed 33. ↵ Weuring , W.J. , Dilevska , I. , Hoekman , J. , van de Vondervoort , J. , Koetsier , M. , van ’t Slot, R.H., Braun , K.P.J. , and Koeleman , B.P.C. ( 2021 ). CRISPRa-Mediated Upregulation of scn1laa During Early Development Causes Epileptiform Activity and dCas9-Associated Toxicity . CRISPR J . 4 , 575 – 582 . doi: 10.1089/crispr.2021.0013 . OpenUrl CrossRef 34. ↵ Griffin , A. , Carpenter , C. , Liu , J. , Paterno , R. , Grone , B. , Hamling , K. , Moog , M. , Dinday , M.T. , Figueroa , F. , Anvar , M. , et al. ( 2021 ). Phenotypic analysis of catastrophic childhood epilepsy genes. Commun . Biol . 4 , 1 – 13 . doi: 10.1038/s42003-021-02221-y . OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted January 16, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s Christopher Michael McGraw , Cristina M. Baker , Annapurna Poduri bioRxiv 2025.01.15.633275; doi: https://doi.org/10.1101/2025.01.15.633275 Share This Article: Copy Citation Tools Enhanced proconvulsant sensitivity, not spontaneous rapid swimming activity, is a robust correlate of scn1lab loss-of-function in stable mutant and F0 crispant hypopigmented zebrafish expressing GCaMP6s Christopher Michael McGraw , Cristina M. Baker , Annapurna Poduri bioRxiv 2025.01.15.633275; doi: https://doi.org/10.1101/2025.01.15.633275 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7634) Biochemistry (17690) Bioengineering (13892) Bioinformatics (41935) Biophysics (21451) Cancer Biology (18587) Cell Biology (25499) Clinical Trials (138) Developmental Biology (13375) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24316) Genetics (15609) Genomics (22505) Immunology (17736) Microbiology (40393) Molecular Biology (17180) Neuroscience (88598) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15151) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9824) Zoology (2271)