Distinct Developmental Outcomes in DNA repair-deficient FANCC c.67delG Mutant and FANCC-/- Mice

Distinct Developmental Outcomes in DNA repair-deficient FANCC c.67delG Mutant and FANCC-/- Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Distinct Developmental Outcomes in DNA repair-deficient FANCC c.67delG Mutant and FANCC-/- Mice Douglas Green, swarna beesetti, Cliff Guy, Shyam Sirasanagandla, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4921572/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Cell Death & Differentiation → Version 1 posted 9 You are reading this latest preprint version Abstract Fanconi Anemia (FA) is an autosomal recessive disorder characterized by diverse clinical manifestations such as aplastic anemia, cancer predisposition, and developmental defects including hypogonadism, microcephaly, organ dysfunction, infertility, hyperpigmentation, microphthalmia, and skeletal defects. In addition to the well described defects in DNA repair, mitochondrial dysfunction due to defects in mitochondrial autophagy (mitophagy) is also associated with FA, although its contribution to FA phenotypes is unknown. This study focused on the FANCC gene, which, alongside other FA genes, is integral to DNA repair and mitochondrial quality control. In the present study, we created a FANCC mutant mouse model (FANCC c.67delG) that is defective in DNA repair but proficient in mitophagy. We found that the FANCC c.67delG mutant mouse model recapitulates some phenotypes observed in FA patients, such as cellular hypersensitivity to DNA cross linking agents and hematopoietic defects. In contrast, FA phenotypes such as microphthalmia, hypogonadism, and infertility, present in FANCC-deficient mice, were absent in the FANCC c.67delG mice, suggesting that the N-terminal 55 amino acids of FANCC are dispensable for these developmental processes. Furthermore, the FANCC c.67delG mutation preserved mitophagy, unlike the FANCC null mutation, leading to the accumulation of damaged mitochondria. This study highlights the multifaceted nature of the FANCC protein, with distinct domains responsible for DNA repair and mitophagy. Our results suggest that developmental defects in FA may not solely stem from DNA repair deficiencies but could also involve other functions, such as mitochondrial quality control. Overall, our findings provide insight into the mechanistic underpinnings of the FA disorder in humans and FA-like syndromes in cattle, such as Brachyspina syndrome. We suggest that this model will be a useful tool for the investigation of FA and for the development of new therapeutic strategies of inherited hematopoietic diseases. Biological sciences/Genetics/Development Biological sciences/Genetics Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Fanconi Anemia (FA) is an autosomal recessive disorder characterized by highly variable clinical manifestations that include aplastic anemia, cancer predisposition and developmental defects including short stature, growth retardation, thumb and radial ray defects, hypogonadism, microcephaly, organ dysfunction, infertility, hyperpigmentation, microphthalmia, and skeletal defects ( 1 , 2 ). Currently, more than 22 complementation groups have been identified ( 3 ). FA is often considered as a genomic instability syndrome, as FA proteins are involved in a DNA cross-link repair pathway ( 4 ). Mice lacking FANCC, FANCA, FANCG, FANCL/POG, FANCD2 and FANCM are well established models of FA, but none of these fully mimic the gross developmental abnormalities of FA patients ( 5 – 8 ). In common with FA patients, all of these animals display gonadal abnormalities, reduced fertility, and microphthalmia, and develop bone marrow failure in response to genomic or cellular insult ( 5 ). The FA pathway is important for normal embryonic development, the maintenance of genomic stability, and the preservation of several types of stem cells as evident from FA patient phenotypes ( 3 , 9 ). Different strains of mice with targeted deletions of FA nuclear core complex component genes generated FANCA, FANCC, FANCG & FANCD2 have very similar phenotypes ( 7 , 8 , 10 – 14 ) supporting a model in which the components of the complex participate in a common function. However, growing literature points towards multifunctional role of these proteins ( 15 ). FANCC is a well-characterized core member of the FA nuclear complex, alongside FANCA, B, E, F, G, L, and M, orchestrating downstream DNA repair process ( 24 ). In addition to its role in DNA repair, cytoplasmic functions of FANCC have been described. These include a role in mitophagy ( 16 ), protection from proinflammatory cytokine-induced cell death ( 17 ), suppression of intracellular ROS levels ( 18 ), maintenance of mitochondrial respiratory function and reduction of inflammasome activity ( 19 ). To what extent each of these functions mediate FA phenotypes is a major question in the FA field. Mutations within the FANCC gene account for approximately 14% of diagnosed FA cases. The phenotypic variations of FANCC patients depends on the specific mutation. The IVS4 + 4 splice mutation and the L554P C-terminal mutation lead to a severe phenotype, with congenital malformations and early hematological failure, whereas mutations in exon 1 (delG322 or FANCC (c.67delG)) and Ql3X, lead to milder phenotypes, with few malformations and later onset of hematological failure ( 20 ). The FANCC c.67delG mutation is a prevalent founder mutation in Fanconi anemia (FA), particularly in Dutch populations, where it accounts for a significant proportion of FANCC mutant alleles ( 21 , 22 ). The FANCC c.67delG mutation has been identified in Dutch, Italian, Australian, and Mennonite populations with Fanconi anemia ( 23 , 24 ). In the Dutch population, the carrier frequency of this mutation is estimated to be around 1 in 300 individuals, likely due to a founder effect ( 21 ). While widespread across different ethnic groups the exact prevalence varies ( 22 ). The FANCC (c.67delG) mutation leads to the production of a truncated protein lacking the N-terminal 55 amino acids. This variant has been shown to fully complement cytoprotective functions such as mitophagy, while lacking genomic DNA repair functions in FANCC null mutant patient cells and FANCC-modulated HeLa cells ( 10 , 25 ). The FANCC c.67delG protein differs in activity from other FANCC mutants, for example, FANCC S249A and E251A mutations impair STAT1 activation and cytokine signaling, while the del322G mutation maintains STAT1 activation ( 25 ). This suggests that distinct structural elements in FANCC regulate its interactions and resistance mechanisms. Despite existing therapies the morbidity and mortality of FA remains high, with an average life expectancy of only ~ 20 years ( 26 ). In the present study, we created a FANCC67delG mutant mouse model to investigate the physiological functions of FANCC and to decipher whether FA phenotypes depend on DNA repair defects or other functions of FANCC. We found that our FANCC67delG mutant mouse model recapitulates some but not all phenotypes observed in FANCC-deficient mice and FA patients, highlighting the multifunctionality of FANCC. RESULTS & DISCUSSION Cellular Sensitivity to DNA Damage in FANCC c.67delG Homozygous Mutant Mice Resembles that Observed in FANCC c.67delG Patient-Derived Cell Line Models. Given the limitations of studying most FA phenotypes in cell lines, we generated a FANCC c.67delG homozygous mouse model, where the truncated protein product is initiated from an alternate start codon (Figure S1 ). The murine FANCC gene, located on chromosome 13, consists of 13 exons and shares 66% identity with the human FANCC sequence. FANCC c.67delG heterozygous mice exhibited no discernible abnormalities and were utilized as breeders to generate homozygous mutant animals on a C57BL/6J strain background. To ascertain the functional equivalence of the generated mutation to the human FANCC c.67delG mutation ( 10 , 25 ), we evaluated the cellular phenotype of cells derived from these mutant mice. A characteristic trait of FA pathway mutants is their heightened sensitivity to DNA crosslinking agents. We treated bone marrow cells with varying doses of the DNA-damaging agent mitomycin C (MMC) and assessed their sensitivity using a cell viability assay. As anticipated, FANCC-deficient bone marrow cells displayed increased susceptibility to MMC-induced DNA damage compared to their wild-type counterparts, and this same increased susceptibility was observed (Fig. 1 A). Similarly, Mouse Embryonic Fibroblasts (MEFs) from FANCC null and FANCC c.67delG mice showed increased cell death in response to MMC as compared to WT MEFs (Fig. 1 B). Moreover, both FANCC and FANCC c.67delG mutant MEFs exhibited elevated expression of gamma H2AX following MMC treatment (Fig. 1 C). These results support the idea that the truncated FANCC c.67delG mutant protein is defective in cross-linked DNA repair, a hallmark feature of FA cells ( 4 ). These observations support the idea that the FA DNA repair pathway in FANCC c.67delG mutant cells is functionally impaired. FANCC c.67delG Mutant Mice Maintain Normal Ocular and Reproductive Health Despite Sharing Hematopoietic Abnormalities with FANCC Null Mice The occurrence of eye abnormalities, including microphthalmia, is a common feature observed in various FA mouse models, such as FANCC, FANCG, FANCA, and FANCD2 ( 5 ), mirroring findings in humans. Consistent with previous studies ( 5 ), FANCC null mice exhibited a high incidence of microphthalmia characterized by impaired development of the lens and retina. In contrast, FANCC c.67delG mutant mice displayed minimal incidence of such abnormalities, suggesting that a critical function of FANCC, present in the c.67delG protein, may play a pivotal role in eye development (Fig. 2 A & 2 B). Unlike other FA mouse models (FANCC, FANCG, FANCA & FANCD2) that yielded a small number of adult homozygous knockout animals with a significant sub-Mendelian distribution at weaning age ( 5 ), mating heterozygous FANCC c.67delG mutant mice resulted in 25% of pups bearing homozygous mutants, consistent with Mendelian distribution. This suggests that these mice neither experienced delayed development in utero nor were lost during gestation ( 6 ). Both male and female FANCC c.67delG mutant mice exhibited apparent fertility. In contrast to FANCC null mice, which did not breed, FANCC c.67delG mutant mice displayed uninterrupted breeding activity throughout the observation period (Fig. 2 C & 2 D). The number of pups per litter was higher in FANCC c.67delG mutant mice compared to FANCC heterozygous mice and comparable to controls. Upon gross examination, FANCC c.67delG homozygous mutant mice exhibited sizes and weights similar to littermate controls, with no macroscopic developmental abnormalities detected in the limbs or other organ systems. Examination of spleen, mammary glands, lymph nodes, brain, heart, thymus, and kidneys displayed no consistent evidence of abnormalities. A characteristic phenotype shared by all FA mouse models (FANCA, C, G & D2) analogous to humans is the occurrence of gonadal abnormalities associated with reduced fertility ( 6 ). Histological examinations of reproductive organs in 10–12-week-old male and female mice were conducted. Notably, FANCC null males, but not FANCC c.67delG males, displayed infertility. Gross morphology of testes and ovaries appeared normal in both mutant mice. However, histological examination of adult FANCC-deficient testes, unlike FANCC c.67delG mutant mice, revealed abnormal tubules devoid of all germ cells (Fig. 2 E (upper panel)). This absence of germ cells in the testes of FANCC null mice aligns with previous reports ( 8 ). In contrast, FANCC c.67delG mutant mice exhibited healthy testes. The epididymides of FANCC null male mice contained minimal normal spermatozoa and debris, alongside degraded spermatozoa, while the epididymides of control and FANCC c.67delG mutant mice contained apparently functional spermatozoa (Fig. 2 E (lower Panel)). These findings underscore that FANCC c.67delG mutant mice do not exhibit gonadal abnormalities and fertility akin to other FA mouse models. Therefore, FANCC c.67delG mutant mice displayed minimal eye abnormalities and preserved fertility, suggesting that the N-terminal 55 amino acids of FANCC are dispensable for these developmental processes. This observation implies that the critical function of FANCC in eye and gonadal development may be independent of its DNA repair role. Microphthalmia transcription factor (MiTF) regulates gene expression of FANCA, FANCD2, FANCC AND FANCG ( 27 ). The increased susceptibility of FA cells to apoptotic cell death after DNA damage is often given as the explanation for the observed FA phenotypes ( 14 ), but our data support the idea that the germ-cell deficiency, microphthalmia, and perinatal lethality seen in FANCC-deficient animals is independent of DNA repair defects. We then conducted hematological assays with FANCC null and FANCC c.67delG mutant mice to assess the development of anemia throughout their lifespan. Various hematological parameters were measured from 8 weeks to 1-year post-birth. Hematocrit, hemoglobin levels, erythrocyte, and platelet counts were determined using peripheral blood obtained from mutant and control animals via either inferior vena cava puncture (at sacrifice) or retroorbital puncture (for live animals). In line with previously established FA mouse models ( 6 ) (Fig S2 A-H), no significant differences were observed between the different genotypes in any of the parameters. Despite the average onset age of anemia in FA patients being 4–6 years, early abnormalities are detectable in cultured bone marrow (BM) cells prior to clinical manifestation. Therefore, we evaluated the colony forming capability of BM cells isolated from the mice, cultured on methylcellulose supplemented with IL-3, IL-11, and c-kit-ligand. Intriguingly, bone marrow progenitor cells from both FANCC null and FANCC c.67delG mutant mice exhibited impaired proliferation in vitro (Fig. 2 F), with a similar phenotype observed in younger mice. FANCC c67delG mutant bone marrow cells formed fewer colonies, akin to FANCC null mice ( 9 ), indicating a progressive yet subclinical hematopoietic defect. We then assessed stress-induced survival in these mice by challenging them with lipopolysaccharide (LPS). Both FANCC null and FANCC c.67delG mutant mice displayed similar sensitivity to the LPS challenge (Fig. 2 G). Collectively, our findings indicate that FANCC c.67delG mutant mice exhibit hematopoietic defects comparable to those observed in FANCC null mice. Despite the absence of overt anemia based on blood counts, both FANCC null and FANCC c.67delG mutant mice exhibited impaired proliferation of bone marrow progenitor cells in vitro and increased sensitivity to LPS challenge, indicative of hematopoietic defects. These findings align with the well-established bone marrow failure phenotype observed in Fanconi anemia patients. Overall, the phenotype of FANCC c.67delG mutant mice establishes the existence of multiple functional domains in the FANCC protein. Although human patients with FA develop a variety of cancers, tumors have rarely been reported in FA deficient mice even when followed to very late ages. Further FA patients with a hypomorphic mutation in FANCC, such as FANCC c.67delG, are at a lower risk of cancer predisposition ( 23 ). It is therefore possible that cancer predisposition in patients, like the developmental defects in FANCC-deficient mice, is due to loss of functions of FA proteins other than DNA repair. FANCC null but not FANCC c.67delG cells display defective mitophagy. Mitophagy is a process whereby defective mitochondria are isolated and degraded by selective autophagy ( 28 ). Dysfunctions in mitophagy regulated by FANCC may contribute to the broader mitochondrial impairments in FA ( 29 ). A previous study found that FANCC is essential for Parkin-mediated mitophagy and mitochondrial quality control, evidenced by deficits in FANCC knockout cells ( 16 ). Cells from FA patients show accumulation of dysfunctional mitochondria, altered mtDNA, and deregulation of key mitophagy genes (ATG, Beclin-1, MAP1-LC3) ( 30 , 31 ).. The removal of mitochondria by mitophagy can be assessed by the use of a fluorescent probe consisting of mCherry and GFP, mt-Kiema, which loses GFP fluorescence as autophagocytosed mitochondria are degraded in lysosomes ( 32 ). We expressed Parkin in mouse embryonic fibroblasts (MEFs) derived from FANCC null and FANCC c.67delG mutant mice, and induced mitophagy by treatment with Oligomycin and Antimycin A ( 16 ). We assessed mitophagy using mt-Kiema (Fig. 3 A) or by Western blot for mitochondrial proteins (Fig. 3 B). While FANCC-deficient MEFs exhibited defective clearance of mitochondria under these conditions, MEFs from FANCC c.67delG were not significantly different from those from WT mice. Bone marrow cells and splenocytes obtained from 3–6-month-old FANCC null and FANCC c.67delG mutant mice harboring an endogenous mt-keima reporter transgene ( 19 ) were utilized for the analysis of basal mitophagy in vivo . In the absence of FANCC, mitophagy levels in cells derived from both bone marrow and spleen were notably diminished, albeit not entirely abolished. Specifically, FANCC null mice manifested a discernible defect in mitophagy, whereas FANCC c.67delG mutant mice exhibited mitophagy levels comparable to those observed in wild-type mice, thereby suggesting that the N-terminal 55 amino acids absent in this mutant are dispensable for mitophagy (Fig. 3 C & 3 D). To further assess mitochondrial quality control in tissues, we examined testes and livers of mice lacking FANCC or carrying the FANCC c.67delG mutation, focusing on mitochondrial abundance as determined by TOMM20 staining (Fig. 3 E & 3 G). We observed increased mitochondria in the tissues of FANCC null mice, while those in tissues of FANCC c.67delG mice were similar to those of WT controls. Despite the heightened mitochondrial abundance observed in tissues from FANCC null mice, examination of mRNA levels of PGC1α, a pivotal driver of mitochondrial biogenesis, indicated no significant differences among FANCC wild-type, null, and mutant mice (Fig. 3 F). This suggests that the increased mitochondrial mass observed in FANCC null tissues may be due to decreased mitophagy rather than increased mitochondrial biogenesis. Primary open-angle glaucoma, diabetic retinopathy, age-related macular degeneration, Fuchs endothelial corneal dystrophy and other related ocular diseases are associated with impaired mitophagy ( 33 ). It is not uncommon to observe an overlap of ocular phenotypes in primary mitochondrial diseases such as mitochondrial encephalopathy lactic acidosis stroke, Leber hereditary optic neuropathy, and chronic progressive external ophthalmoplegia, supporting the idea that impairment in mitophagy is an important feature of ophthalmic disease pathology ( 34 ). Our study uncovered a striking divergence in the mitophagy function between FANCC null and FANCC c.67delG mutant mice. While FANCC null mice exhibited defective mitophagy and accumulation of damaged mitochondria in various tissues, FANCC c.67delG mutant mice displayed normal mitophagy levels akin to wild-type mice. This dissociation between the DNA repair and mitophagy functions of FANCC suggests that the N-terminal 55 amino acids are dispensable for mitophagy but essential for the DNA repair function. The observed defects in mitophagy and accumulation of damaged mitochondria in FANCC null mice may contribute to the pathogenesis of FA, particularly in tissues with high metabolic demands, such as the testes. Collectively, our findings highlight the multifunctional nature of the FANCC protein, with distinct domains responsible for DNA repair and mitophagy. Further, FA like syndromes is not uncommon in cattle like brachy spina syndrome and bovine anemia in cows ( 35 ) showing similar phenotypic defects suggesting the conservative role of mitophagy and DNA repair functions across the species. Clearly, the study of distinct functions is relevant for the diagnosis of cattle to diminish infertility or stillbirth cases. The FANCC c.67delG mutation selectively impairs the DNA repair function while preserving mitophagy, providing a valuable tool for dissecting the contributions of these processes to the diverse phenotypes observed in Fanconi anemia. In Fanconi anemia, the FA proteins help counteract aldehyde-induced genotoxicity in hematopoietic stem cells (HSCs). However, deficiencies in the mitochondrial enzyme ALDH2, which detoxifies reactive aldehydes that damage mitochondria, can exacerbate bone marrow failure in FA patients ( 36 , 37 ). ALDH2 activity is enhanced by phosphorylation by the enzyme ePKC, protecting it from inactivation ( 37 ). Impaired mitophagy, the clearance of damaged mitochondria, prevents efficient removal of dysfunctional mitochondria in HSCs ( 37 ). This leads to accumulation of mitochondria with reduced membrane potential, disrupting import of ALDH2 into the mitochondrial matrix where it requires NADP + as a cofactor. Defective mitophagy may exacerbate FA DNA repair deficiencies by preventing efficient clearance of damaged mitochondria in HSCs, leading to mitochondrial dysfunction, oxidative stress, and inflammatory responses, contributing to bone marrow failure. In our studies, however, we observed no differences between FANCC null and FANCC c.67delG mutant mice with respect to LPS endotoxicity or proliferation of HSCs. Nevertheless, these animals may prove useful for dissecting the possible role of defects in mitophagy versus DNA repair in bone marrow failure in FA. MATERIALS & METHODS Chemicals &Antibodies: Antimycin A and Oligomycin (OA, Santa Cruz) were resuspended in DMSO and stored in small aliquots at -80 C. Mitomycin C (Sigma) was resuspended in water and stored at -80 C. The following antibodies were used for western blot analyses: rabbit anti-FANCA (Novus NBP1- 18977, 1:500 dilution), HRP-conjugated anti-Flag (Sigma A8592, 1:2000 dilution) and anti-FANCG antibody (ab54645). gamma H2AX (pSer139) 613405 from Biolegend is used for flow analysis. Mice: Fancc-/- mice have been previously described ( 16 , 17 ). The mt-Keima mice, generously donated by Dr. Nuo Sun, were used in this study ( 32 ). To generate FANCC heterozygous (het) mice expressing mt-Keima, mt-Keima mice were crossed with FANCC het mice. The resultant offspring were further crossed to produce FANCC wild-type (WT) or knockout (KO) mice expressing mt-Keima. Additionally, mt-Keima mice were crossed with FANCC c.67delG homozygous mutant mice to generate FANCC c.67delG homozygous mice expressing mt-Keima. These breeding strategies enabled the study of mitochondrial dynamics and DNA repair-independent functions of FANCC in various genetic backgrounds. All procedures were approved by our institutional Animal Care Committee. Generation of FANCC c67delG mutant mice: Fancc67delG mice were generated through the co-injection of Cas9 mRNA transcripts, a single guide RNA targeting exon 2 of the FANCC gene, and a homology-directed repair (HDR) template consisting of a single-stranded DNA molecule encoding the desired genetic alterations. Founder animals were subjected to genomic characterization using PCR amplification followed by Sanger sequencing. The guide sequence employed for inducing a DNA double-strand break within exon 2 of the FANCC gene was as follows: 5’-GAAGCTTTCTGCATGGGAAC-3’. The HDR template utilized in conjunction with the guide sequence was: CAGAGATGGCTCAGGAGTCTGCAGACCTTGCTTCTGACTGTCAGTCTTGGCTGCAGAAGCTTTCTGC T T_GGAACAGGCCTCTTCTGA GGAAACCCAGAAGGACACTTGTCTTCACTTGTCCGGGTTCCAGGAGTTCCTGAGG. Bold nucleotides denote silent mutations, while "_" represents the missing G (Figure S1 A & B). Cas9 mRNA and single guide RNA were synthesized as previously described ( 18 ). For genomic PCR analysis of Fancc67delG mice: Genomic DNA from mice or cells was extracted according to established protocols ( 19 ). PCR was conducted using the following primers: forward primer 5’-GGGCTTTTTGTCCACCGTTA-3’ and reverse primer 5’-CCCTGGGTTCAATTCCAAACAC-3’. PCR conditions comprised an initial denaturation step at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55.7°C for 30 seconds, and extension at 72°C for 60 seconds, with a final extension step at 72°C for 10 minutes. PCR products were subjected to ExoSAP-IT digestion and analyzed via Sanger sequencing. The inbred colony of FANCC and FANCC67delG mutants was expanded for subsequent experiments. mt-Keima transgenic mouse lines, previously published and generously provided by Dr. Nuo Sun (The Ohio State University), were utilized ( 20 ). Genotyping of mt-Keima mice was performed using the forward primer 5′-GAG CAG ACC GTG AAG CTG AC-3′ and reverse primer 5′-GCC ATG TAG TCG TTG CCG AT-3′. For this study, the mt-Keima mouse model was crossbred with FANCC heterozygote animals and Fancc c67delG mutant mice to generate WT and KO animals with endogenous mt-Keima reporter. All experimental procedures were conducted in accordance with the guidelines approved by the Animal Care and Use Committee of St. Jude Children’s Research Hospital. In vitro models: Primary murine Bone Marrow cells were obtained from mouse femurs and tibiae. For experiments involving primary murine embryonic fibroblasts (MEFs), embryos were derived from time-mated pregnant females at embryonic days E12-E16.5. Primary MEFs were then generated from mt-Kiema Fancc and mt-Kiema Fancc c67delG embryos (sex unknown) using standard protocols. DNA Damage Detection Assay: Mouse Embryonic Fibroblasts (MEFs) were cultured in 12-well plates and treated with 0.5 µM Mitomycin C (MMC) for 24 hours to induce DNA damage. Following treatment, cell lysates were collected, and immunoblotting was conducted to quantify the levels of γ-H2AX (phosphorylated histone H2AX) and total H2AX. Cell Death Assays: For the measurement of Mitomycin C-induced cell death, bone marrow cells were seeded at a concentration of 2 × 105 cells/mL into 96-well flat-bottomed tissue culture plates. Cells were then either mock-treated or treated with Mitomycin C (1 µM) for 24 hours. Subsequently, 10 µL of MTS reagent was added to each well, and the absorbance was assessed at 490 nm using a microplate reader after a 4-hour incubation with MTS. For quantifying cell death in MEFs, an IncuCyte Zoom in-incubator Imaging System (Sartorius) was utilized. The percentage of cell death was determined by normalizing the count of dead cells, as indicated by uptake of 1 µg/ml of the cell-impermeable dye propidium iodine (PI) (Sigma-Aldrich, P4170), with the total cell count determined by phase contrast cell confluency. Assessment of Mitophagy by mt-mKeima Flow Cytometry Assay: Mitophagy was evaluated using flow cytometry with the mt-mKeima fluorophore, which exhibits bimodal excitation under neutral (440 nm) and acidic (586 nm) conditions. Bone marrow cells and spleenocytes were harvested from Fancc WT, KO, or Fancc67delG mutant mice expressing endogenous mt-kiema. The cells were then resuspended in FACS buffer (PBS with 1% BSA and 1 mM EDTA), and mitophagy-positive cells were quantified by detecting lysosomal mt-mKeima using dual-excitation ratiometric pH measurements at 488- or 405-nm (pH 7) and 561-nm (pH 4) lasers. Data analysis was performed using FlowJo (v10; Tree Star), following previously established protocols ( 18 – 20 ). Assessment of Mitophagy in MEFs Overexpressing Parkin: Primary MEFs were generated from the mating of FANCC heterozygous or FANCC c67delG mutant mice expressing mt-Kiema. Embryos were harvested at embryonic day 12 to 14 (E12–E14) based on palpation. After the removal of the head and blood organs, the remaining tissue was minced and dispersed in 0.1% trypsin at 37°C for 30 minutes. The cells were then plated in T75 flasks and maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 10 U/ml penicillin, 100 µg/ml streptomycin, 1 mM nonessential amino acids, and 0.1 mM β-mercaptoethanol. MEFs were immortalized by transfection with the SV40 large T antigen using the pBabe-Neo-SV40-LTA plasmid. Cell lines were routinely tested for mycoplasma contamination using the MycoAlert™ Plus Mycoplasma Detection Kit (Lonza). MEFs overexpressing Parkin were seeded in 24-well plates at a density of 5 × 10 4 cells per well. The following day, cells were treated with a combination of oligomycin (2.5 µM) and antimycin (250 nM) for 16 hours. Mitophagy was evaluated by probing for mitochondrial proteins by immunoblot. Hematopoietic Colony Growth Assays: Mice aged between 3 to 6 months were analyzed in a blinded manner. Femoral bone marrow samples were collected from the mice following cervical dislocation, and total viable cell counts were determined. Unfractionated murine bone marrow cells (1 × 10 5 ) were then cultured in a 35-mm tissue culture dish containing 1.5 ml of MethoCult M 3434 (Stem Cell Technologies). After 10 days of plating, the colonies were enumerated using an inverted microscope. Results of colony growth are presented as the mean (from triplicate plates) ± standard deviation. Western Blotting and Antibodies: Cells were lysed using radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, and 0.1% SDS], supplemented with complete protease inhibitors (Roche, 11836153001) or phosphatase inhibitors (Roche, 04906837001). Protein concentration was determined using the bicinchoninic acid (BCA) assay (Pierce, 23225) and normalized prior to Western blotting. Samples were loaded onto 4–12% Criterion XT Bis-Tris Precast Gels (Bio-Rad) and subsequently transferred to Hybond-C Extra membranes (GE Healthcare). Following antibody incubation and exposure to homemade enhanced chemiluminescent (ECL) substrate, membranes were imaged using a ChemiDoc Touch Imaging System (Bio-Rad) and analyzed with Image Lab software (Bio-Rad). The following antibodies were employed for immunoblotting: anti-Parkin (Santa Cruz Biotechnology, sc32282), anti-COX Vb (Abcam, ab110263), anti-HSP60 (Santa Cruz sc1052), anti-TOMM20 (Santa Cruz sc-11415), anti-gamma H2AX (Cell Signaling Technology mAb9718), anti-total H2AX (Cell Signaling Technology 2595), anti-Phospho p53 (Cell Signaling Technology 9284), anti-total p53 (Cell Signaling Technology 9282), and anti-beta Actin (Santa Cruz sc-47778). Histological examination and immunohistochemistry: During necropsy, organs were excised, fixed in formalin, dehydrated using 100% ethanol, and subsequently embedded in paraffin wax at 58°C. Sections were then rehydrated and stained with Hematoxylin-Eosin for histological examination. The mice were anesthetized and perfused with phosphate-buffered saline (1× PBS) followed by a perfusion with 4% PFA for fixation of the tissues. The liver and testis were harvested and post-fixed overnight in 4% PFA before they were sliced with a vibratome (100 µm thickness). For immunohistochemistry, anti-TOMM20 (1:100; Abcam, ab186735,), anti-DDX4 (1:100; Abcam, AB13840, Cambridge, UK), Tomato lectin and WGA Lectin were used for staining. All images were captured using a microscope (Nikon Eclipse microscope) equipped with a digital camera. Real-time PCR RNA isolation, Reverse transcription quantitative polymerase chain reaction (RT-qPCR): RNA extraction was conducted using TRIzol (Thermo Fisher Scientific, catalog no. 15596026). Complementary DNA synthesis was done by using the First Strand cDNA Synthesis Kit (Applied Biosystems, catalog no. 4368814) according to the manufacturer’s instructions. Real-time (RT)-PCR was performed with 2× SYBR Green (Applied Biosystems, catalog no. 4368706) on an ABI 7500 fast RT–PCR machine. Primers used were as follows: PPARGC1A: 5′- TATGGAGTGACATAGAGTGTGCT − 3′, 5′- GTCGCTACACCACTTCAATCC − 3′; GAPDH : 5′- AGGTCGGTGTGAACGGATTTG-3′, 5′- GGGGTCGTTGATGGCAACA-3′. Statistics: Each experiment was performed three times. Data are represented as means ± the standard errors of the mean. The difference between different groups were analyzed using GraphPad Prism Program. Student’s T test or two-way ANOVA was used to calculate the P value of two groups, or three groups compared. Values of P < 0.05 were statistically significant, NS denotes non-significant difference. *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001 are considered as statistically significant differences. Declarations Declaration of Interests During the course of this research DRG consulted for or received support from Amgen, Ventus, ASHA, Boerhinger Ingleheim, Mirumus, and Sonata. The authors declare no conflicts of interest. Funding: This work was supported by Supported by NCI R35231620 (DRG) and the John H Sununu named Fellowship (S.B). Author contributions: S.B: Conceptualization, Formal analysis, Investigation, Methodology, Visualization, Writing—original draft, Writing—review & editing, C.G: Investigation, S.S: Investigation, M.Y: Investigation, R.S: Conceptualization, Investigation, Project administration, Resources, Supervision. H.T: Investigation, S.P: Methodology, M.W: Reviewing, D.R.G: Conceptualization, Funding, Investigation, Project administration, Resources, Supervision, Validation, Visualization, Writing—review & editing. Acknowledgments: We would like to thank the Transgenic and Gene Knockout Shared Resource at St. Jude Children’s Research Hospital, Memphis, TN, for technical assistance. References Alter BP. Fanconi's anaemia and its variability. Br J Haematol. 1993;85(1):9–14. D'Andrea AD, Grompe M. The Fanconi anaemia/BRCA pathway. Nat Rev Cancer. 2003;3(1):23–34. Moldovan GL, D'Andrea AD. How the fanconi anemia pathway guards the genome. Annu Rev Genet. 2009;43:223–49. Kim H, D'Andrea AD. Regulation of DNA cross-link repair by the Fanconi anemia/BRCA pathway. Genes Dev. 2012;26(13):1393–408. Parmar K, D'Andrea A, Niedernhofer LJ. Mouse models of Fanconi anemia. Mutat Res. 2009;668(1–2):133–40. Bakker ST, van de Vrugt HJ, Rooimans MA, Oostra AB, Steltenpool J, Delzenne-Goette E, et al. Fancm-deficient mice reveal unique features of Fanconi anemia complementation group M. Hum Mol Genet. 2009;18(18):3484–95. Whitney MA, Royle G, Low MJ, Kelly MA, Axthelm MK, Reifsteck C, et al. Germ cell defects and hematopoietic hypersensitivity to gamma-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood. 1996;88(1):49–58. Chen M, Tomkins DJ, Auerbach W, McKerlie C, Youssoufian H, Liu L, et al. Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nat Genet. 1996;12(4):448–51. Niraj J, Färkkilä A, D'Andrea AD. The Fanconi Anemia Pathway in Cancer. Annu Rev Cancer Biol. 2019;3:457–78. Noll M, Battaile KP, Bateman R, Lax TP, Rathbun K, Reifsteck C, et al. Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex. Exp Hematol. 2002;30(7):679–88. Koomen M, Cheng NC, van de Vrugt HJ, Godthelp BC, van der Valk MA, Oostra AB, et al. Reduced fertility and hypersensitivity to mitomycin C characterize Fancg/Xrcc9 null mice. Hum Mol Genet. 2002;11(3):273–81. Yang Y, Kuang Y, Montes De Oca R, Hays T, Moreau L, Lu N, et al. Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9. Blood. 2001;98(12):3435–40. Cheng NC, van de Vrugt HJ, van der Valk MA, Oostra AB, Krimpenfort P, de Vries Y, et al. Mice with a targeted disruption of the Fanconi anemia homolog Fanca. Hum Mol Genet. 2000;9(12):1805–11. Houghtaling S, Timmers C, Noll M, Finegold MJ, Jones SN, Meyn MS, Grompe M. Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice. Genes Dev. 2003;17(16):2021–35. Pagano G, Tiano L, Pallardó FV, Lyakhovich A, Mukhopadhyay SS, Di Bartolomeo P, et al. Re-definition and supporting evidence toward Fanconi Anemia as a mitochondrial disease: Prospects for new design in clinical management. Redox Biol. 2021;40:101860. Sumpter R, Jr., Sirasanagandla S, Fernandez AF, Wei Y, Dong X, Franco L, et al. Fanconi Anemia Proteins Function in Mitophagy and Immunity. Cell. 2016;165(4):867–81. Haneline LS, Broxmeyer HE, Cooper S, Hangoc G, Carreau M, Buchwald M, Clapp DW. Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice. Blood. 1998;91(11):4092–8. Pagano G, Talamanca AA, Castello G, d'Ischia M, Pallardó FV, Petrović S, et al. From clinical description, to in vitro and animal studies, and backward to patients: oxidative stress and mitochondrial dysfunction in Fanconi anemia. Free Radic Biol Med. 2013;58:118–25. Garbati MR, Hays LE, Keeble W, Yates JE, Rathbun RK, Bagby GC. FANCA and FANCC modulate TLR and p38 MAPK-dependent expression of IL-1β in macrophages. Blood. 2013;122(18):3197–205. Yamashita T, Wu N, Kupfer G, Corless C, Joenje H, Grompe M, D'Andrea AD. Clinical variability of Fanconi anemia (type C) results from expression of an amino terminal truncated Fanconi anemia complementation group C polypeptide with partial activity. Blood. 1996;87(10):4424–32. García-de Teresa B, Frias S, Molina B, Villarreal MT, Rodriguez A, Carnevale A, et al. FANCC Dutch founder mutation in a Mennonite family from Tamaulipas, México. Mol Genet Genomic Med. 2019;7(6):e710. de Vries Y, Lwiwski N, Levitus M, Kuyt B, Israels SJ, Arwert F, et al. A Dutch Fanconi Anemia FANCC Founder Mutation in Canadian Manitoba Mennonites. Anemia. 2012;2012:865170. Thompson ER, Doyle MA, Ryland GL, Rowley SM, Choong DY, Tothill RW, et al. Exome sequencing identifies rare deleterious mutations in DNA repair genes FANCC and BLM as potential breast cancer susceptibility alleles. PLoS Genet. 2012;8(9):e1002894. Information. NNCfB. ClinVar; [VCV000012049.45], [National Center for Biotechnology Information. ClinVar; [VCV000012049.45], https://www.ncbi.nlm.nih.gov/clinvar/variation/VCV.45 (accessed May 13, 2024).]. Pang Q, Christianson TA, Keeble W, Diaz J, Faulkner GR, Reifsteck C, et al. The Fanconi anemia complementation group C gene product: structural evidence of multifunctionality. Blood. 2001;98(5):1392–401. Calado RT, Clé DV. Treatment of inherited bone marrow failure syndromes beyond transplantation. Hematology Am Soc Hematol Educ Program. 2017;2017(1):96–101. Oppezzo A, Bourseguin J, Renaud E, Pawlikowska P, Rosselli F. Microphthalmia transcription factor expression contributes to bone marrow failure in Fanconi anemia. J Clin Invest. 2020;130(3):1377–91. Youle RJ, Narendra DP. Mechanisms of mitophagy. Nat Rev Mol Cell Biol. 2011;12(1):9–14. Bagby GC. Multifunctional Fanconi proteins, inflammation and the Fanconi phenotype. EBioMedicine. 2016;8:10–1. Shyamsunder P, Esner M, Barvalia M, Wu YJ, Loja T, Boon HB, et al. Impaired mitophagy in Fanconi anemia is dependent on mitochondrial fission. Oncotarget. 2016;7(36):58065–74. Solanki A, Rajendran A, Mohan S, Raj R, Vundinti BR. Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia. PLoS One. 2020;15(1):e0227603. Sun N, Yun J, Liu J, Malide D, Liu C, Rovira, II, et al. Measuring In Vivo Mitophagy. Mol Cell. 2015;60(4):685–96. Skeie JM, Nishimura DY, Wang CL, Schmidt GA, Aldrich BT, Greiner MA. Mitophagy: An Emerging Target in Ocular Pathology. Invest Ophthalmol Vis Sci. 2021;62(3):22. Fraser JA, Biousse V, Newman NJ. The neuro-ophthalmology of mitochondrial disease. Surv Ophthalmol. 2010;55(4):299–334. Agerholm JS, DeLay J, Hicks B, Fredholm M. First confirmed case of the bovine brachyspina syndrome in Canada. Can Vet J. 2010;51(12):1349–50. Peake JD, Noguchi C, Lin B, Theriault A, O'Connor M, Sheth S, et al. FANCD2 limits acetaldehyde-induced genomic instability during DNA replication in esophageal keratinocytes. Mol Oncol. 2021;15(11):3109–24. Garaycoechea JI, Crossan GP, Langevin F, Daly M, Arends MJ, Patel KJ. Genotoxic consequences of endogenous aldehydes on mouse haematopoietic stem cell function. Nature. 2012;489(7417):571–5. Additional Declarations There is no duality of interest Supplementary Files SupplementaryFigureS1XS2.pdf Supplementarydatawesternuncropped.pdf Cite Share Download PDF Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Cell Death & Differentiation → Version 1 posted Editorial decision: revise 27 Sep, 2024 Review # 1 received at journal 20 Sep, 2024 Review # 2 received at journal 07 Sep, 2024 Reviewer # 2 agreed at journal 28 Aug, 2024 Reviewer # 1 agreed at journal 28 Aug, 2024 Reviewers invited by journal 18 Aug, 2024 Submission checks completed at journal 16 Aug, 2024 First submitted to journal 15 Aug, 2024 Editor assigned by journal 15 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4921572","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":341696276,"identity":"92cc615e-4858-4fda-8782-7fc8ffc80a9a","order_by":0,"name":"Douglas Green","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABF0lEQVRIiWNgGAWjYDCCA0D8AM6rYGBgbGAwIKwlAc47wyBBohbGNgYJIIVfC9/xHuMXCTV1DPLRhw8+LpxXV8c8I3njA4aKe3YNOLRInjljZpFw7DCD4bm0ZOOZ2w5LMM5IKzZgOFOcjEuLwY0cM4MEtgMMhj08ZtK82w4AteSYSTC2JSTjchhEy786oBb+779559SBtJj/IKDF+EFiGzODPA8PGzNvAzPYFmA4JNjh0iJ55lgZQ2LfYR4DHjZjaZ5jhyUbe54VSyScSUjApYXvePPmDx++1cnJ9zA//MxTU8dv2J688cOHigR7XFqAgA0UFTwGB6BcwwYGcEwlNuDWwvwBRMrDVMhDaXy2jIJRMApGwcgCAIGlWFqFjHWAAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-7332-1417","institution":"St. Jude Children's Research Hospital","correspondingAuthor":true,"prefix":"","firstName":"Douglas","middleName":"","lastName":"Green","suffix":""},{"id":341696277,"identity":"b13210ba-f053-40a1-9b55-89c8193fb6f8","order_by":1,"name":"swarna beesetti","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"swarna","middleName":"","lastName":"beesetti","suffix":""},{"id":341696278,"identity":"a8a8764c-a8b9-496e-ae2c-7b6957012fba","order_by":2,"name":"Cliff Guy","email":"","orcid":"","institution":"St. Jude Children's Research Hospital","correspondingAuthor":false,"prefix":"","firstName":"Cliff","middleName":"","lastName":"Guy","suffix":""},{"id":341696279,"identity":"697c5458-f67b-46c2-a741-501a262b5ef0","order_by":3,"name":"Shyam Sirasanagandla","email":"","orcid":"","institution":"University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Shyam","middleName":"","lastName":"Sirasanagandla","suffix":""},{"id":341696280,"identity":"5ca60f19-07f1-4e1b-a3e6-6e0112a50f48","order_by":4,"name":"Mao Yang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Mao","middleName":"","lastName":"Yang","suffix":""},{"id":341696281,"identity":"2ca7a244-dc12-473b-8048-5a3ed3391097","order_by":5,"name":"Rhea Sumpter","email":"","orcid":"","institution":"St Jude Children’s Research Hospital","correspondingAuthor":false,"prefix":"","firstName":"Rhea","middleName":"","lastName":"Sumpter","suffix":""},{"id":341696282,"identity":"699746c0-ac2a-4a9e-8e7e-348d3b903f1b","order_by":6,"name":"Heather Tillman","email":"","orcid":"","institution":"St Jude Children’s Research Hospital","correspondingAuthor":false,"prefix":"","firstName":"Heather","middleName":"","lastName":"Tillman","suffix":""},{"id":341696283,"identity":"60fb9b00-2ad7-4ce3-85a8-6ce29fa256a0","order_by":7,"name":"Stephane Pelletier","email":"","orcid":"https://orcid.org/0000-0002-1127-0212","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Stephane","middleName":"","lastName":"Pelletier","suffix":""},{"id":341696284,"identity":"1169c443-dfd9-4a4a-b208-8f3ffe5029fd","order_by":8,"name":"Marcin Wlodarski","email":"","orcid":"","institution":"St Jude Children’s Research Hospital","correspondingAuthor":false,"prefix":"","firstName":"Marcin","middleName":"","lastName":"Wlodarski","suffix":""}],"badges":[],"createdAt":"2024-08-15 23:30:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4921572/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4921572/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41418-025-01461-3","type":"published","date":"2025-02-17T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66550966,"identity":"54c84aa2-bb8b-489d-8d3f-e4939dc53c76","added_by":"auto","created_at":"2024-10-14 09:05:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":290858,"visible":true,"origin":"","legend":"\u003cp\u003eCellular Sensitivity to DNA Damage in FANCC c.67delG Homozygous Mutant Mice Resembles that Observed in FANCC c.67delG Patient-Derived Cell Line Models. (A) Cell survival determined by the MTS assay at different Mitomycin C concentrations in Bone marrow cells of FANCC wild type, null and FANCCc.67delG mutant mice at 24 hrs. (B) Kinetics of cell death as analyzed by incucyte in Mouse embryonic fibroblasts derived from FANCC wild type, null and FANCCc.67delG mutant mice treated with 30nM Mitomycin C. (C) MEFs were incubated with 50nM Mitomycin C for 4hrs, cells were then harvested to perform western blotting for phospho H2AX and phospho p53, total H2AX and total p53 were used as controls. Data are expressed as the mean ± SEM. Statistical analysis was performed using two-way ANOVA followed by Tukey’s multiple comparisons test, *P\u0026lt; 0.05, **P \u0026lt;0.01, ***P\u0026lt; 0.001 and ****P\u0026lt; 0.0001 (A \u0026amp; B), images are representative of 3 independent experiments.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/434fe5326ac32727afa6d999.jpg"},{"id":66550967,"identity":"6c20d37f-8fda-4226-bc13-10dbcc1e7bf3","added_by":"auto","created_at":"2024-10-14 09:05:20","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":628819,"visible":true,"origin":"","legend":"\u003cp\u003eFANCC c.67delG Mutant Mice Maintain Normal Ocular and Reproductive Health Despite Sharing Hematopoietic Abnormalities with FANCC Null Mice: \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e(A) Mice images showing eye abnormality like microphthalmia and Anophthalmia in FANCC null mice but not in FANCC c.67delG mutant mice. Images are representative of mouse groups. (B) Quantification of eye abnormality (n=30). (C) \u0026nbsp;Reproductive performance of four pairs of mice per group was followed over time. The number of litters as a function of age. Knock-out male and female mice are infertile and the FANCC Heterozygous mice produced less litters over time compared to the control animals and ceased breeding before 36 weeks of age. (D) The number of pups per litter for each group. \u0026nbsp;FANCC heterozygous mice produced less pups per litter over time than control animals. Mutant mice produced approximately the same numbers of pups over time and seemed less infertile than FANCC KO mice, but clearly affected compared to control animals. (E) Histological analysis of Epididymis and testis paraffin sections from FANCC wildtype, null and FANCCc.67delG mutant mice. Hematoxylin and eosin-stained corpus epididymis sections (upper panel, Scale bar = 50um), testis sections (lower panel, Scale bar = 5um) Images are representative of mouse groups (n=3). (F) Total numbers of colony-forming units (CFU) per 10\u003csup\u003e6\u003c/sup\u003e\u0026nbsp;BM cells from FANCC wildtype, null and FANCC c.67delG mutant mice (n=4). (G) Survival rate of FANCC wildtype, null and FANCC c.67delG mutant mice administrated with LPS (25mg/kg) (n=7). Statistical analysis was performed using two-way ANOVA followed by Tukey’s multiple comparisons test, *P\u0026lt; 0.05, **P \u0026lt;0.01, ***P\u0026lt; 0.001 and ****P\u0026lt; 0.0001 (B, C \u0026amp; D). One-way ANOVA followed by Tukey’s multiple comparisons test, *P\u0026lt; 0.05, **P \u0026lt;0.01, ***P\u0026lt; 0.001 and ****P\u0026lt; 0.0001 (F) and Log-rank (Mantel-Cox) test was used for the analysis of pooled data from two independent experiments (G).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/055d53e8e7c2c007c6a3d880.jpg"},{"id":66550968,"identity":"79455de6-08f0-4d00-8314-73d09b90ad57","added_by":"auto","created_at":"2024-10-14 09:05:20","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":486363,"visible":true,"origin":"","legend":"\u003cp\u003eFANCC null but not FANCC c.67delG cells display defective mitophagy. (A, B) Mitophagy was stimulated in mt-mKeima-expressing MEFs (Mouse Embryonic Fibroblasts) overexpressing Parkin by treatment with a combination of Oligomycin, 2.5 μM and Antimycin A, 250 nM. Following a 16-hour incubation period, cells were harvested for (A) mitophagy analysis by flow cytometry for mt-mkeima, quantification of % mitophagy (Left, representative FACS profiles are shown on the right) and (B) Western blot analysis targeting mitochondrial proteins localized in the outer membrane (TOMM20), intermembrane space (HSP60), and inner membrane (COX IV). Basal mitophagy was analyzed by flow cytometry for mt-mKeima in (C) Bone marrow cells and (D) Splenocytes, quantification of % mitophagy (n=8) (E) Quantification of mitochondrial TOMM20 from immunofluorescence-stained cryosections prepared from mice testis, stained with DDX4, TOMM20, tomato lectin and DAPI (n=3) (F) PPARGC1A or PGC-1α (Peroxisome proliferator-activated receptor gamma coactivator 1-alpha) mRNA levels as assessed by qPCR (n=3). (G) Quantification of mitochondrial TOMM20 from confocal images of mouse liver sections histologically stained with WGA lectin (Red), TOMM20 (Green) and DAPI (blue), (n=3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s multiple comparisons test, *P\u0026lt; 0.05, **P \u0026lt;0.01, ***P\u0026lt; 0.001 and ****P\u0026lt; 0.0001 (A, C, D, E, F \u0026amp; G).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/06ccc5254f4e0bea5ed14f65.jpg"},{"id":76539906,"identity":"41adbd33-d05b-428d-9c0a-a3c0d0fbb765","added_by":"auto","created_at":"2025-02-18 08:11:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1977825,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/1fea992e-b935-4715-b1ba-cfbf14664a90.pdf"},{"id":66553580,"identity":"1ac0447f-cb09-4758-9be9-e82c5a92c4bf","added_by":"auto","created_at":"2024-10-14 09:13:20","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":343443,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"SupplementaryFigureS1XS2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/6f67569a6302db0de0385fbe.pdf"},{"id":66550969,"identity":"46b4d954-a1b4-4e7a-9a54-74a6f1756217","added_by":"auto","created_at":"2024-10-14 09:05:20","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":193505,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarydatawesternuncropped.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4921572/v1/32c3a336fc2eb11d6538bf51.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"Distinct Developmental Outcomes in DNA repair-deficient FANCC c.67delG Mutant and FANCC-/- Mice","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eFanconi Anemia (FA) is an autosomal recessive disorder characterized by highly variable clinical manifestations that include aplastic anemia, cancer predisposition and developmental defects including short stature, growth retardation, thumb and radial ray defects, hypogonadism, microcephaly, organ dysfunction, infertility, hyperpigmentation, microphthalmia, and skeletal defects (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Currently, more than 22 complementation groups have been identified (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). FA is often considered as a genomic instability syndrome, as FA proteins are involved in a DNA cross-link repair pathway (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Mice lacking FANCC, FANCA, FANCG, FANCL/POG, FANCD2 and FANCM are well established models of FA, but none of these fully mimic the gross developmental abnormalities of FA patients (\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In common with FA patients, all of these animals display gonadal abnormalities, reduced fertility, and microphthalmia, and develop bone marrow failure in response to genomic or cellular insult (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). The FA pathway is important for normal embryonic development, the maintenance of genomic stability, and the preservation of several types of stem cells as evident from FA patient phenotypes (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Different strains of mice with targeted deletions of FA nuclear core complex component genes generated FANCA, FANCC, FANCG \u0026amp; FANCD2 have very similar phenotypes (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e) supporting a model in which the components of the complex participate in a common function. However, growing literature points towards multifunctional role of these proteins (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFANCC is a well-characterized core member of the FA nuclear complex, alongside FANCA, B, E, F, G, L, and M, orchestrating downstream DNA repair process (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In addition to its role in DNA repair, cytoplasmic functions of FANCC have been described. These include a role in mitophagy (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), protection from proinflammatory cytokine-induced cell death (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), suppression of intracellular ROS levels (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), maintenance of mitochondrial respiratory function and reduction of inflammasome activity (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). To what extent each of these functions mediate FA phenotypes is a major question in the FA field. Mutations within the FANCC gene account for approximately 14% of diagnosed FA cases. The phenotypic variations of FANCC patients depends on the specific mutation. The IVS4\u0026thinsp;+\u0026thinsp;4 splice mutation and the L554P C-terminal mutation lead to a severe phenotype, with congenital malformations and early hematological failure, whereas mutations in exon 1 (delG322 or FANCC (c.67delG)) and Ql3X, lead to milder phenotypes, with few malformations and later onset of hematological failure (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The FANCC c.67delG mutation is a prevalent founder mutation in Fanconi anemia (FA), particularly in Dutch populations, where it accounts for a significant proportion of FANCC mutant alleles (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). The FANCC c.67delG mutation has been identified in Dutch, Italian, Australian, and Mennonite populations with Fanconi anemia (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In the Dutch population, the carrier frequency of this mutation is estimated to be around 1 in 300 individuals, likely due to a founder effect (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). While widespread across different ethnic groups the exact prevalence varies (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe FANCC (c.67delG) mutation leads to the production of a truncated protein lacking the N-terminal 55 amino acids. This variant has been shown to fully complement cytoprotective functions such as mitophagy, while lacking genomic DNA repair functions in FANCC null mutant patient cells and FANCC-modulated HeLa cells (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). The FANCC c.67delG protein differs in activity from other FANCC mutants, for example, FANCC S249A and E251A mutations impair STAT1 activation and cytokine signaling, while the del322G mutation maintains STAT1 activation (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). This suggests that distinct structural elements in FANCC regulate its interactions and resistance mechanisms.\u003c/p\u003e \u003cp\u003eDespite existing therapies the morbidity and mortality of FA remains high, with an average life expectancy of only\u0026thinsp;~\u0026thinsp;20 years (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In the present study, we created a FANCC67delG mutant mouse model to investigate the physiological functions of FANCC and to decipher whether FA phenotypes depend on DNA repair defects or other functions of FANCC. We found that our FANCC67delG mutant mouse model recapitulates some but not all phenotypes observed in FANCC-deficient mice and FA patients, highlighting the multifunctionality of FANCC.\u003c/p\u003e"},{"header":"RESULTS \u0026 DISCUSSION","content":"\u003cp\u003e \u003cb\u003eCellular Sensitivity to DNA Damage in FANCC c.67delG Homozygous Mutant Mice Resembles that Observed in FANCC c.67delG Patient-Derived Cell Line Models.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGiven the limitations of studying most FA phenotypes in cell lines, we generated a FANCC c.67delG homozygous mouse model, where the truncated protein product is initiated from an alternate start codon (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The murine FANCC gene, located on chromosome 13, consists of 13 exons and shares 66% identity with the human FANCC sequence. FANCC c.67delG heterozygous mice exhibited no discernible abnormalities and were utilized as breeders to generate homozygous mutant animals on a C57BL/6J strain background. To ascertain the functional equivalence of the generated mutation to the human FANCC c.67delG mutation (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), we evaluated the cellular phenotype of cells derived from these mutant mice. A characteristic trait of FA pathway mutants is their heightened sensitivity to DNA crosslinking agents. We treated bone marrow cells with varying doses of the DNA-damaging agent mitomycin C (MMC) and assessed their sensitivity using a cell viability assay. As anticipated, FANCC-deficient bone marrow cells displayed increased susceptibility to MMC-induced DNA damage compared to their wild-type counterparts, and this same increased susceptibility was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Similarly, Mouse Embryonic Fibroblasts (MEFs) from FANCC null and FANCC c.67delG mice showed increased cell death in response to MMC as compared to WT MEFs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Moreover, both FANCC and FANCC c.67delG mutant MEFs exhibited elevated expression of gamma H2AX following MMC treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These results support the idea that the truncated FANCC c.67delG mutant protein is defective in cross-linked DNA repair, a hallmark feature of FA cells (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). These observations support the idea that the FA DNA repair pathway in FANCC c.67delG mutant cells is functionally impaired.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFANCC c.67delG Mutant Mice Maintain Normal Ocular and Reproductive Health Despite Sharing Hematopoietic Abnormalities with FANCC Null Mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe occurrence of eye abnormalities, including microphthalmia, is a common feature observed in various FA mouse models, such as FANCC, FANCG, FANCA, and FANCD2 (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), mirroring findings in humans. Consistent with previous studies (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), FANCC null mice exhibited a high incidence of microphthalmia characterized by impaired development of the lens and retina. In contrast, FANCC c.67delG mutant mice displayed minimal incidence of such abnormalities, suggesting that a critical function of FANCC, present in the c.67delG protein, may play a pivotal role in eye development (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnlike other FA mouse models (FANCC, FANCG, FANCA \u0026amp; FANCD2) that yielded a small number of adult homozygous knockout animals with a significant sub-Mendelian distribution at weaning age (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), mating heterozygous FANCC c.67delG mutant mice resulted in 25% of pups bearing homozygous mutants, consistent with Mendelian distribution. This suggests that these mice neither experienced delayed development in utero nor were lost during gestation (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Both male and female FANCC c.67delG mutant mice exhibited apparent fertility. In contrast to FANCC null mice, which did not breed, FANCC c.67delG mutant mice displayed uninterrupted breeding activity throughout the observation period (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The number of pups per litter was higher in FANCC c.67delG mutant mice compared to FANCC heterozygous mice and comparable to controls. Upon gross examination, FANCC c.67delG homozygous mutant mice exhibited sizes and weights similar to littermate controls, with no macroscopic developmental abnormalities detected in the limbs or other organ systems. Examination of spleen, mammary glands, lymph nodes, brain, heart, thymus, and kidneys displayed no consistent evidence of abnormalities.\u003c/p\u003e \u003cp\u003eA characteristic phenotype shared by all FA mouse models (FANCA, C, G \u0026amp; D2) analogous to humans is the occurrence of gonadal abnormalities associated with reduced fertility (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Histological examinations of reproductive organs in 10\u0026ndash;12-week-old male and female mice were conducted. Notably, FANCC null males, but not FANCC c.67delG males, displayed infertility. Gross morphology of testes and ovaries appeared normal in both mutant mice. However, histological examination of adult FANCC-deficient testes, unlike FANCC c.67delG mutant mice, revealed abnormal tubules devoid of all germ cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE (upper panel)). This absence of germ cells in the testes of FANCC null mice aligns with previous reports (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In contrast, FANCC c.67delG mutant mice exhibited healthy testes. The epididymides of FANCC null male mice contained minimal normal spermatozoa and debris, alongside degraded spermatozoa, while the epididymides of control and FANCC c.67delG mutant mice contained apparently functional spermatozoa (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE (lower Panel)). These findings underscore that FANCC c.67delG mutant mice do not exhibit gonadal abnormalities and fertility akin to other FA mouse models. Therefore, FANCC c.67delG mutant mice displayed minimal eye abnormalities and preserved fertility, suggesting that the N-terminal 55 amino acids of FANCC are dispensable for these developmental processes.\u003c/p\u003e \u003cp\u003eThis observation implies that the critical function of FANCC in eye and gonadal development may be independent of its DNA repair role. Microphthalmia transcription factor (MiTF) regulates gene expression of FANCA, FANCD2, FANCC AND FANCG (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). The increased susceptibility of FA cells to apoptotic cell death after DNA damage is often given as the explanation for the observed FA phenotypes (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), but our data support the idea that the germ-cell deficiency, microphthalmia, and perinatal lethality seen in FANCC-deficient animals is independent of DNA repair defects.\u003c/p\u003e \u003cp\u003eWe then conducted hematological assays with FANCC null and FANCC c.67delG mutant mice to assess the development of anemia throughout their lifespan. Various hematological parameters were measured from 8 weeks to 1-year post-birth. Hematocrit, hemoglobin levels, erythrocyte, and platelet counts were determined using peripheral blood obtained from mutant and control animals via either inferior vena cava puncture (at sacrifice) or retroorbital puncture (for live animals). In line with previously established FA mouse models (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) (Fig \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e A-H), no significant differences were observed between the different genotypes in any of the parameters.\u003c/p\u003e \u003cp\u003eDespite the average onset age of anemia in FA patients being 4\u0026ndash;6 years, early abnormalities are detectable in cultured bone marrow (BM) cells prior to clinical manifestation. Therefore, we evaluated the colony forming capability of BM cells isolated from the mice, cultured on methylcellulose supplemented with IL-3, IL-11, and c-kit-ligand. Intriguingly, bone marrow progenitor cells from both FANCC null and FANCC c.67delG mutant mice exhibited impaired proliferation in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), with a similar phenotype observed in younger mice. FANCC c67delG mutant bone marrow cells formed fewer colonies, akin to FANCC null mice (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e), indicating a progressive yet subclinical hematopoietic defect. We then assessed stress-induced survival in these mice by challenging them with lipopolysaccharide (LPS). Both FANCC null and FANCC c.67delG mutant mice displayed similar sensitivity to the LPS challenge (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Collectively, our findings indicate that FANCC c.67delG mutant mice exhibit hematopoietic defects comparable to those observed in FANCC null mice. Despite the absence of overt anemia based on blood counts, both FANCC null and FANCC c.67delG mutant mice exhibited impaired proliferation of bone marrow progenitor cells in vitro and increased sensitivity to LPS challenge, indicative of hematopoietic defects. These findings align with the well-established bone marrow failure phenotype observed in Fanconi anemia patients.\u003c/p\u003e \u003cp\u003eOverall, the phenotype of FANCC c.67delG mutant mice establishes the existence of multiple functional domains in the FANCC protein. Although human patients with FA develop a variety of cancers, tumors have rarely been reported in FA deficient mice even when followed to very late ages. Further FA patients with a hypomorphic mutation in FANCC, such as FANCC c.67delG, are at a lower risk of cancer predisposition (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). It is therefore possible that cancer predisposition in patients, like the developmental defects in FANCC-deficient mice, is due to loss of functions of FA proteins other than DNA repair.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFANCC null but not FANCC c.67delG cells display defective mitophagy.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMitophagy is a process whereby defective mitochondria are isolated and degraded by selective autophagy (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Dysfunctions in mitophagy regulated by FANCC may contribute to the broader mitochondrial impairments in FA (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). A previous study found that FANCC is essential for Parkin-mediated mitophagy and mitochondrial quality control, evidenced by deficits in FANCC knockout cells (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Cells from FA patients show accumulation of dysfunctional mitochondria, altered mtDNA, and deregulation of key mitophagy genes (ATG, Beclin-1, MAP1-LC3) (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e).. The removal of mitochondria by mitophagy can be assessed by the use of a fluorescent probe consisting of mCherry and GFP, mt-Kiema, which loses GFP fluorescence as autophagocytosed mitochondria are degraded in lysosomes (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). We expressed Parkin in mouse embryonic fibroblasts (MEFs) derived from FANCC null and FANCC c.67delG mutant mice, and induced mitophagy by treatment with Oligomycin and Antimycin A (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). We assessed mitophagy using mt-Kiema (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) or by Western blot for mitochondrial proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). While FANCC-deficient MEFs exhibited defective clearance of mitochondria under these conditions, MEFs from FANCC c.67delG were not significantly different from those from WT mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBone marrow cells and splenocytes obtained from 3\u0026ndash;6-month-old FANCC null and FANCC c.67delG mutant mice harboring an endogenous mt-keima reporter transgene (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) were utilized for the analysis of basal mitophagy \u003cem\u003ein vivo\u003c/em\u003e. In the absence of FANCC, mitophagy levels in cells derived from both bone marrow and spleen were notably diminished, albeit not entirely abolished. Specifically, FANCC null mice manifested a discernible defect in mitophagy, whereas FANCC c.67delG mutant mice exhibited mitophagy levels comparable to those observed in wild-type mice, thereby suggesting that the N-terminal 55 amino acids absent in this mutant are dispensable for mitophagy (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC \u0026amp; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eTo further assess mitochondrial quality control in tissues, we examined testes and livers of mice lacking FANCC or carrying the FANCC c.67delG mutation, focusing on mitochondrial abundance as determined by TOMM20 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE \u0026amp; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). We observed increased mitochondria in the tissues of FANCC null mice, while those in tissues of FANCC c.67delG mice were similar to those of WT controls. Despite the heightened mitochondrial abundance observed in tissues from FANCC null mice, examination of mRNA levels of PGC1α, a pivotal driver of mitochondrial biogenesis, indicated no significant differences among FANCC wild-type, null, and mutant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). This suggests that the increased mitochondrial mass observed in FANCC null tissues may be due to decreased mitophagy rather than increased mitochondrial biogenesis.\u003c/p\u003e \u003cp\u003ePrimary open-angle glaucoma, diabetic retinopathy, age-related macular degeneration, Fuchs endothelial corneal dystrophy and other related ocular diseases are associated with impaired mitophagy (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). It is not uncommon to observe an overlap of ocular phenotypes in primary mitochondrial diseases such as mitochondrial encephalopathy lactic acidosis stroke, Leber hereditary optic neuropathy, and chronic progressive external ophthalmoplegia, supporting the idea that impairment in mitophagy is an important feature of ophthalmic disease pathology (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Our study uncovered a striking divergence in the mitophagy function between FANCC null and FANCC c.67delG mutant mice. While FANCC null mice exhibited defective mitophagy and accumulation of damaged mitochondria in various tissues, FANCC c.67delG mutant mice displayed normal mitophagy levels akin to wild-type mice. This dissociation between the DNA repair and mitophagy functions of FANCC suggests that the N-terminal 55 amino acids are dispensable for mitophagy but essential for the DNA repair function. The observed defects in mitophagy and accumulation of damaged mitochondria in FANCC null mice may contribute to the pathogenesis of FA, particularly in tissues with high metabolic demands, such as the testes. Collectively, our findings highlight the multifunctional nature of the FANCC protein, with distinct domains responsible for DNA repair and mitophagy. Further, FA like syndromes is not uncommon in cattle like brachy spina syndrome and bovine anemia in cows (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) showing similar phenotypic defects suggesting the conservative role of mitophagy and DNA repair functions across the species. Clearly, the study of distinct functions is relevant for the diagnosis of cattle to diminish infertility or stillbirth cases. The FANCC c.67delG mutation selectively impairs the DNA repair function while preserving mitophagy, providing a valuable tool for dissecting the contributions of these processes to the diverse phenotypes observed in Fanconi anemia.\u003c/p\u003e \u003cp\u003eIn Fanconi anemia, the FA proteins help counteract aldehyde-induced genotoxicity in hematopoietic stem cells (HSCs). However, deficiencies in the mitochondrial enzyme ALDH2, which detoxifies reactive aldehydes that damage mitochondria, can exacerbate bone marrow failure in FA patients (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). ALDH2 activity is enhanced by phosphorylation by the enzyme ePKC, protecting it from inactivation (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Impaired mitophagy, the clearance of damaged mitochondria, prevents efficient removal of dysfunctional mitochondria in HSCs (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). This leads to accumulation of mitochondria with reduced membrane potential, disrupting import of ALDH2 into the mitochondrial matrix where it requires NADP\u0026thinsp;+\u0026thinsp;as a cofactor. Defective mitophagy may exacerbate FA DNA repair deficiencies by preventing efficient clearance of damaged mitochondria in HSCs, leading to mitochondrial dysfunction, oxidative stress, and inflammatory responses, contributing to bone marrow failure. In our studies, however, we observed no differences between FANCC null and FANCC c.67delG mutant mice with respect to LPS endotoxicity or proliferation of HSCs. Nevertheless, these animals may prove useful for dissecting the possible role of defects in mitophagy versus DNA repair in bone marrow failure in FA.\u003c/p\u003e"},{"header":"MATERIALS \u0026 METHODS","content":"\u003cp\u003eChemicals \u0026amp;Antibodies: Antimycin A and Oligomycin (OA, Santa Cruz) were resuspended in DMSO and stored in small aliquots at -80 C. Mitomycin C (Sigma) was resuspended in water and stored at -80 C. The following antibodies were used for western blot analyses: rabbit anti-FANCA (Novus NBP1- 18977, 1:500 dilution), HRP-conjugated anti-Flag (Sigma A8592, 1:2000 dilution) and anti-FANCG antibody (ab54645). gamma H2AX (pSer139) 613405 from Biolegend is used for flow analysis.\u003c/p\u003e \u003cp\u003eMice:\u003c/p\u003e \u003cp\u003eFancc-/- mice have been previously described (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The mt-Keima mice, generously donated by Dr. Nuo Sun, were used in this study (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). To generate FANCC heterozygous (het) mice expressing mt-Keima, mt-Keima mice were crossed with FANCC het mice. The resultant offspring were further crossed to produce FANCC wild-type (WT) or knockout (KO) mice expressing mt-Keima. Additionally, mt-Keima mice were crossed with FANCC c.67delG homozygous mutant mice to generate FANCC c.67delG homozygous mice expressing mt-Keima. These breeding strategies enabled the study of mitochondrial dynamics and DNA repair-independent functions of FANCC in various genetic backgrounds. All procedures were approved by our institutional Animal Care Committee.\u003c/p\u003e \u003cp\u003eGeneration of FANCC c67delG mutant mice:\u003c/p\u003e \u003cp\u003eFancc67delG mice were generated through the co-injection of Cas9 mRNA transcripts, a single guide RNA targeting exon 2 of the FANCC gene, and a homology-directed repair (HDR) template consisting of a single-stranded DNA molecule encoding the desired genetic alterations. Founder animals were subjected to genomic characterization using PCR amplification followed by Sanger sequencing. The guide sequence employed for inducing a DNA double-strand break within exon 2 of the FANCC gene was as follows: 5\u0026rsquo;-GAAGCTTTCTGCATGGGAAC-3\u0026rsquo;. The HDR template utilized in conjunction with the guide sequence was: CAGAGATGGCTCAGGAGTCTGCAGACCTTGCTTCTGACTGTCAGTCTTGGCTGCAGAAGCTTTCTGC\u003cb\u003eT\u003c/b\u003eT_GGAACAGGCCTCTTCTGA\u003cbr\u003eGGAAACCCAGAAGGACACTTGTCTTCACTTGTCCGGGTTCCAGGAGTTCCTGAGG. Bold nucleotides denote silent mutations, while \"_\" represents the missing G (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e A \u0026amp; B). Cas9 mRNA and single guide RNA were synthesized as previously described (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor genomic PCR analysis of Fancc67delG mice:\u003c/p\u003e \u003cp\u003eGenomic DNA from mice or cells was extracted according to established protocols (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). PCR was conducted using the following primers: forward primer 5\u0026rsquo;-GGGCTTTTTGTCCACCGTTA-3\u0026rsquo; and reverse primer 5\u0026rsquo;-CCCTGGGTTCAATTCCAAACAC-3\u0026rsquo;. PCR conditions comprised an initial denaturation step at 95\u0026deg;C for 5 minutes, followed by 35 cycles of denaturation at 95\u0026deg;C for 30 seconds, annealing at 55.7\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 60 seconds, with a final extension step at 72\u0026deg;C for 10 minutes. PCR products were subjected to ExoSAP-IT digestion and analyzed via Sanger sequencing. The inbred colony of FANCC and FANCC67delG mutants was expanded for subsequent experiments.\u003c/p\u003e \u003cp\u003emt-Keima transgenic mouse lines, previously published and generously provided by Dr. Nuo Sun (The Ohio State University), were utilized (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Genotyping of mt-Keima mice was performed using the forward primer 5\u0026prime;-GAG CAG ACC GTG AAG CTG AC-3\u0026prime; and reverse primer 5\u0026prime;-GCC ATG TAG TCG TTG CCG AT-3\u0026prime;. For this study, the mt-Keima mouse model was crossbred with FANCC heterozygote animals and Fancc c67delG mutant mice to generate WT and KO animals with endogenous mt-Keima reporter. All experimental procedures were conducted in accordance with the guidelines approved by the Animal Care and Use Committee of St. Jude Children\u0026rsquo;s Research Hospital.\u003c/p\u003e \u003cp\u003eIn vitro models:\u003c/p\u003e \u003cp\u003ePrimary murine Bone Marrow cells were obtained from mouse femurs and tibiae.\u003c/p\u003e \u003cp\u003eFor experiments involving primary murine embryonic fibroblasts (MEFs), embryos were derived from time-mated pregnant females at embryonic days E12-E16.5. Primary MEFs were then generated from mt-Kiema Fancc and mt-Kiema Fancc c67delG embryos (sex unknown) using standard protocols.\u003c/p\u003e \u003cp\u003eDNA Damage Detection Assay:\u003c/p\u003e \u003cp\u003eMouse Embryonic Fibroblasts (MEFs) were cultured in 12-well plates and treated with 0.5 \u0026micro;M Mitomycin C (MMC) for 24 hours to induce DNA damage. Following treatment, cell lysates were collected, and immunoblotting was conducted to quantify the levels of γ-H2AX (phosphorylated histone H2AX) and total H2AX.\u003c/p\u003e \u003cp\u003eCell Death Assays:\u003c/p\u003e \u003cp\u003eFor the measurement of Mitomycin C-induced cell death, bone marrow cells were seeded at a concentration of 2 \u0026times; 105 cells/mL into 96-well flat-bottomed tissue culture plates. Cells were then either mock-treated or treated with Mitomycin C (1 \u0026micro;M) for 24 hours. Subsequently, 10 \u0026micro;L of MTS reagent was added to each well, and the absorbance was assessed at 490 nm using a microplate reader after a 4-hour incubation with MTS.\u003c/p\u003e \u003cp\u003eFor quantifying cell death in MEFs, an IncuCyte Zoom in-incubator Imaging System (Sartorius) was utilized. The percentage of cell death was determined by normalizing the count of dead cells, as indicated by uptake of 1 \u0026micro;g/ml of the cell-impermeable dye propidium iodine (PI) (Sigma-Aldrich, P4170), with the total cell count determined by phase contrast cell confluency.\u003c/p\u003e \u003cp\u003eAssessment of Mitophagy by mt-mKeima Flow Cytometry Assay:\u003c/p\u003e \u003cp\u003eMitophagy was evaluated using flow cytometry with the mt-mKeima fluorophore, which exhibits bimodal excitation under neutral (440 nm) and acidic (586 nm) conditions. Bone marrow cells and spleenocytes were harvested from Fancc WT, KO, or Fancc67delG mutant mice expressing endogenous mt-kiema. The cells were then resuspended in FACS buffer (PBS with 1% BSA and 1 mM EDTA), and mitophagy-positive cells were quantified by detecting lysosomal mt-mKeima using dual-excitation ratiometric pH measurements at 488- or 405-nm (pH 7) and 561-nm (pH 4) lasers. Data analysis was performed using FlowJo (v10; Tree Star), following previously established protocols (\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAssessment of Mitophagy in MEFs Overexpressing Parkin:\u003c/p\u003e \u003cp\u003ePrimary MEFs were generated from the mating of FANCC heterozygous or FANCC c67delG mutant mice expressing mt-Kiema. Embryos were harvested at embryonic day 12 to 14 (E12\u0026ndash;E14) based on palpation. After the removal of the head and blood organs, the remaining tissue was minced and dispersed in 0.1% trypsin at 37\u0026deg;C for 30 minutes. The cells were then plated in T75 flasks and maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 10 U/ml penicillin, 100 \u0026micro;g/ml streptomycin, 1 mM nonessential amino acids, and 0.1 mM β-mercaptoethanol.\u003c/p\u003e \u003cp\u003eMEFs were immortalized by transfection with the SV40 large T antigen using the pBabe-Neo-SV40-LTA plasmid. Cell lines were routinely tested for mycoplasma contamination using the MycoAlert\u0026trade; Plus Mycoplasma Detection Kit (Lonza). MEFs overexpressing Parkin were seeded in 24-well plates at a density of 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells per well. The following day, cells were treated with a combination of oligomycin (2.5 \u0026micro;M) and antimycin (250 nM) for 16 hours. Mitophagy was evaluated by probing for mitochondrial proteins by immunoblot.\u003c/p\u003e \u003cp\u003eHematopoietic Colony Growth Assays:\u003c/p\u003e \u003cp\u003eMice aged between 3 to 6 months were analyzed in a blinded manner. Femoral bone marrow samples were collected from the mice following cervical dislocation, and total viable cell counts were determined. Unfractionated murine bone marrow cells (1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e) were then cultured in a 35-mm tissue culture dish containing 1.5 ml of MethoCult M 3434 (Stem Cell Technologies).\u003c/p\u003e \u003cp\u003eAfter 10 days of plating, the colonies were enumerated using an inverted microscope. Results of colony growth are presented as the mean (from triplicate plates)\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation.\u003c/p\u003e \u003cp\u003eWestern Blotting and Antibodies:\u003c/p\u003e \u003cp\u003eCells were lysed using radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, and 0.1% SDS], supplemented with complete protease inhibitors (Roche, 11836153001) or phosphatase inhibitors (Roche, 04906837001). Protein concentration was determined using the bicinchoninic acid (BCA) assay (Pierce, 23225) and normalized prior to Western blotting.\u003c/p\u003e \u003cp\u003eSamples were loaded onto 4\u0026ndash;12% Criterion XT Bis-Tris Precast Gels (Bio-Rad) and subsequently transferred to Hybond-C Extra membranes (GE Healthcare). Following antibody incubation and exposure to homemade enhanced chemiluminescent (ECL) substrate, membranes were imaged using a ChemiDoc Touch Imaging System (Bio-Rad) and analyzed with Image Lab software (Bio-Rad).\u003c/p\u003e \u003cp\u003eThe following antibodies were employed for immunoblotting: anti-Parkin (Santa Cruz Biotechnology, sc32282), anti-COX Vb (Abcam, ab110263), anti-HSP60 (Santa Cruz sc1052), anti-TOMM20 (Santa Cruz sc-11415), anti-gamma H2AX (Cell Signaling Technology mAb9718), anti-total H2AX (Cell Signaling Technology 2595), anti-Phospho p53 (Cell Signaling Technology 9284), anti-total p53 (Cell Signaling Technology 9282), and anti-beta Actin (Santa Cruz sc-47778).\u003c/p\u003e \u003cp\u003eHistological examination and immunohistochemistry:\u003c/p\u003e \u003cp\u003eDuring necropsy, organs were excised, fixed in formalin, dehydrated using 100% ethanol, and subsequently embedded in paraffin wax at 58\u0026deg;C. Sections were then rehydrated and stained with Hematoxylin-Eosin for histological examination.\u003c/p\u003e \u003cp\u003eThe mice were anesthetized and perfused with phosphate-buffered saline (1\u0026times; PBS) followed by a perfusion with 4% PFA for fixation of the tissues. The liver and testis were harvested and post-fixed overnight in 4% PFA before they were sliced with a vibratome (100 \u0026micro;m thickness). For immunohistochemistry, anti-TOMM20 (1:100; Abcam, ab186735,), anti-DDX4 (1:100; Abcam, AB13840, Cambridge, UK), Tomato lectin and WGA Lectin were used for staining. All images were captured using a microscope (Nikon Eclipse microscope) equipped with a digital camera.\u003c/p\u003e \u003cp\u003eReal-time PCR\u003c/p\u003e \u003cp\u003eRNA isolation, Reverse transcription quantitative polymerase chain reaction (RT-qPCR):\u003c/p\u003e \u003cp\u003eRNA extraction was conducted using TRIzol (Thermo Fisher Scientific, catalog no. 15596026). Complementary DNA synthesis was done by using the First Strand cDNA Synthesis Kit (Applied Biosystems, catalog no. 4368814) according to the manufacturer\u0026rsquo;s instructions. Real-time (RT)-PCR was performed with 2\u0026times; SYBR Green (Applied Biosystems, catalog no. 4368706) on an ABI 7500 fast RT\u0026ndash;PCR machine. Primers used were as follows: PPARGC1A: 5\u0026prime;- TATGGAGTGACATAGAGTGTGCT \u0026minus;\u0026thinsp;3\u0026prime;, 5\u0026prime;- GTCGCTACACCACTTCAATCC \u0026minus;\u0026thinsp;3\u0026prime;; \u003cem\u003eGAPDH\u003c/em\u003e: 5\u0026prime;- AGGTCGGTGTGAACGGATTTG-3\u0026prime;, 5\u0026prime;- GGGGTCGTTGATGGCAACA-3\u0026prime;.\u003c/p\u003e \u003cp\u003eStatistics:\u003c/p\u003e \u003cp\u003eEach experiment was performed three times. Data are represented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;the standard errors of the mean. The difference between different groups were analyzed using GraphPad Prism Program. Student\u0026rsquo;s T test or two-way ANOVA was used to calculate the P value of two groups, or three groups compared. Values of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were statistically significant, NS denotes non-significant difference. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 are considered as statistically significant differences.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of Interests\u003c/h2\u003e \u003cp\u003eDuring the course of this research DRG consulted for or received support from Amgen, Ventus, ASHA, Boerhinger Ingleheim, Mirumus, and Sonata. The authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis work was supported by Supported by NCI R35231620 (DRG) and the John H Sununu named Fellowship (S.B).\u003c/p\u003e\u003ch2\u003eAuthor contributions:\u003c/h2\u003e \u003cp\u003eS.B: Conceptualization, Formal analysis, Investigation, Methodology, Visualization, Writing\u0026mdash;original draft, Writing\u0026mdash;review \u0026amp; editing, C.G: Investigation, S.S: Investigation, M.Y: Investigation, R.S: Conceptualization, Investigation, Project administration, Resources, Supervision. H.T: Investigation, S.P: Methodology, M.W: Reviewing, D.R.G: Conceptualization, Funding, Investigation, Project administration, Resources, Supervision, Validation, Visualization, Writing\u0026mdash;review \u0026amp; editing.\u003c/p\u003e\u003ch2\u003eAcknowledgments:\u003c/h2\u003e \u003cp\u003eWe would like to thank the Transgenic and Gene Knockout Shared Resource at St. Jude Children\u0026rsquo;s Research Hospital, Memphis, TN, for technical assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlter BP. Fanconi's anaemia and its variability. Br J Haematol. 1993;85(1):9\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Andrea AD, Grompe M. The Fanconi anaemia/BRCA pathway. Nat Rev Cancer. 2003;3(1):23\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoldovan GL, D'Andrea AD. How the fanconi anemia pathway guards the genome. Annu Rev Genet. 2009;43:223\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim H, D'Andrea AD. Regulation of DNA cross-link repair by the Fanconi anemia/BRCA pathway. Genes Dev. 2012;26(13):1393\u0026ndash;408.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParmar K, D'Andrea A, Niedernhofer LJ. Mouse models of Fanconi anemia. Mutat Res. 2009;668(1\u0026ndash;2):133\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakker ST, van de Vrugt HJ, Rooimans MA, Oostra AB, Steltenpool J, Delzenne-Goette E, et al. Fancm-deficient mice reveal unique features of Fanconi anemia complementation group M. Hum Mol Genet. 2009;18(18):3484\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitney MA, Royle G, Low MJ, Kelly MA, Axthelm MK, Reifsteck C, et al. Germ cell defects and hematopoietic hypersensitivity to gamma-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood. 1996;88(1):49\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen M, Tomkins DJ, Auerbach W, McKerlie C, Youssoufian H, Liu L, et al. Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nat Genet. 1996;12(4):448\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiraj J, F\u0026auml;rkkil\u0026auml; A, D'Andrea AD. The Fanconi Anemia Pathway in Cancer. Annu Rev Cancer Biol. 2019;3:457\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoll M, Battaile KP, Bateman R, Lax TP, Rathbun K, Reifsteck C, et al. Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex. Exp Hematol. 2002;30(7):679\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoomen M, Cheng NC, van de Vrugt HJ, Godthelp BC, van der Valk MA, Oostra AB, et al. Reduced fertility and hypersensitivity to mitomycin C characterize Fancg/Xrcc9 null mice. Hum Mol Genet. 2002;11(3):273\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Kuang Y, Montes De Oca R, Hays T, Moreau L, Lu N, et al. Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9. Blood. 2001;98(12):3435\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng NC, van de Vrugt HJ, van der Valk MA, Oostra AB, Krimpenfort P, de Vries Y, et al. Mice with a targeted disruption of the Fanconi anemia homolog Fanca. Hum Mol Genet. 2000;9(12):1805\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoughtaling S, Timmers C, Noll M, Finegold MJ, Jones SN, Meyn MS, Grompe M. Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice. Genes Dev. 2003;17(16):2021\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagano G, Tiano L, Pallard\u0026oacute; FV, Lyakhovich A, Mukhopadhyay SS, Di Bartolomeo P, et al. Re-definition and supporting evidence toward Fanconi Anemia as a mitochondrial disease: Prospects for new design in clinical management. Redox Biol. 2021;40:101860.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSumpter R, Jr., Sirasanagandla S, Fernandez AF, Wei Y, Dong X, Franco L, et al. Fanconi Anemia Proteins Function in Mitophagy and Immunity. Cell. 2016;165(4):867\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaneline LS, Broxmeyer HE, Cooper S, Hangoc G, Carreau M, Buchwald M, Clapp DW. Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice. Blood. 1998;91(11):4092\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagano G, Talamanca AA, Castello G, d'Ischia M, Pallard\u0026oacute; FV, Petrović S, et al. From clinical description, to in vitro and animal studies, and backward to patients: oxidative stress and mitochondrial dysfunction in Fanconi anemia. Free Radic Biol Med. 2013;58:118\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarbati MR, Hays LE, Keeble W, Yates JE, Rathbun RK, Bagby GC. FANCA and FANCC modulate TLR and p38 MAPK-dependent expression of IL-1β in macrophages. Blood. 2013;122(18):3197\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamashita T, Wu N, Kupfer G, Corless C, Joenje H, Grompe M, D'Andrea AD. Clinical variability of Fanconi anemia (type C) results from expression of an amino terminal truncated Fanconi anemia complementation group C polypeptide with partial activity. Blood. 1996;87(10):4424\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-de Teresa B, Frias S, Molina B, Villarreal MT, Rodriguez A, Carnevale A, et al. FANCC Dutch founder mutation in a Mennonite family from Tamaulipas, M\u0026eacute;xico. Mol Genet Genomic Med. 2019;7(6):e710.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Vries Y, Lwiwski N, Levitus M, Kuyt B, Israels SJ, Arwert F, et al. A Dutch Fanconi Anemia FANCC Founder Mutation in Canadian Manitoba Mennonites. Anemia. 2012;2012:865170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson ER, Doyle MA, Ryland GL, Rowley SM, Choong DY, Tothill RW, et al. Exome sequencing identifies rare deleterious mutations in DNA repair genes FANCC and BLM as potential breast cancer susceptibility alleles. PLoS Genet. 2012;8(9):e1002894.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInformation. NNCfB. ClinVar; [VCV000012049.45], [National Center for Biotechnology Information. ClinVar; [VCV000012049.45], \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/clinvar/variation/VCV.45\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/clinvar/variation/VCV.45\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (accessed May 13, 2024).].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePang Q, Christianson TA, Keeble W, Diaz J, Faulkner GR, Reifsteck C, et al. The Fanconi anemia complementation group C gene product: structural evidence of multifunctionality. Blood. 2001;98(5):1392\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalado RT, Cl\u0026eacute; DV. Treatment of inherited bone marrow failure syndromes beyond transplantation. Hematology Am Soc Hematol Educ Program. 2017;2017(1):96\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOppezzo A, Bourseguin J, Renaud E, Pawlikowska P, Rosselli F. Microphthalmia transcription factor expression contributes to bone marrow failure in Fanconi anemia. J Clin Invest. 2020;130(3):1377\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoule RJ, Narendra DP. Mechanisms of mitophagy. Nat Rev Mol Cell Biol. 2011;12(1):9\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBagby GC. Multifunctional Fanconi proteins, inflammation and the Fanconi phenotype. EBioMedicine. 2016;8:10\u0026ndash;1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShyamsunder P, Esner M, Barvalia M, Wu YJ, Loja T, Boon HB, et al. Impaired mitophagy in Fanconi anemia is dependent on mitochondrial fission. Oncotarget. 2016;7(36):58065\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolanki A, Rajendran A, Mohan S, Raj R, Vundinti BR. Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia. PLoS One. 2020;15(1):e0227603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun N, Yun J, Liu J, Malide D, Liu C, Rovira, II, et al. Measuring In Vivo Mitophagy. Mol Cell. 2015;60(4):685\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkeie JM, Nishimura DY, Wang CL, Schmidt GA, Aldrich BT, Greiner MA. Mitophagy: An Emerging Target in Ocular Pathology. Invest Ophthalmol Vis Sci. 2021;62(3):22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraser JA, Biousse V, Newman NJ. The neuro-ophthalmology of mitochondrial disease. Surv Ophthalmol. 2010;55(4):299\u0026ndash;334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgerholm JS, DeLay J, Hicks B, Fredholm M. First confirmed case of the bovine brachyspina syndrome in Canada. Can Vet J. 2010;51(12):1349\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeake JD, Noguchi C, Lin B, Theriault A, O'Connor M, Sheth S, et al. FANCD2 limits acetaldehyde-induced genomic instability during DNA replication in esophageal keratinocytes. Mol Oncol. 2021;15(11):3109\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaraycoechea JI, Crossan GP, Langevin F, Daly M, Arends MJ, Patel KJ. Genotoxic consequences of endogenous aldehydes on mouse haematopoietic stem cell function. Nature. 2012;489(7417):571\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4921572/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4921572/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFanconi Anemia (FA) is an autosomal recessive disorder characterized by diverse clinical manifestations such as aplastic anemia, cancer predisposition, and developmental defects including hypogonadism, microcephaly, organ dysfunction, infertility, hyperpigmentation, microphthalmia, and skeletal defects. In addition to the well described defects in DNA repair, mitochondrial dysfunction due to defects in mitochondrial autophagy (mitophagy) is also associated with FA, although its contribution to FA phenotypes is unknown. This study focused on the FANCC gene, which, alongside other FA genes, is integral to DNA repair and mitochondrial quality control. In the present study, we created a FANCC mutant mouse model (FANCC c.67delG) that is defective in DNA repair but proficient in mitophagy. We found that the FANCC c.67delG mutant mouse model recapitulates some phenotypes observed in FA patients, such as cellular hypersensitivity to DNA cross linking agents and hematopoietic defects. In contrast, FA phenotypes such as microphthalmia, hypogonadism, and infertility, present in FANCC-deficient mice, were absent in the FANCC c.67delG mice, suggesting that the N-terminal 55 amino acids of FANCC are dispensable for these developmental processes. Furthermore, the FANCC c.67delG mutation preserved mitophagy, unlike the FANCC null mutation, leading to the accumulation of damaged mitochondria. This study highlights the multifaceted nature of the FANCC protein, with distinct domains responsible for DNA repair and mitophagy. Our results suggest that developmental defects in FA may not solely stem from DNA repair deficiencies but could also involve other functions, such as mitochondrial quality control. Overall, our findings provide insight into the mechanistic underpinnings of the FA disorder in humans and FA-like syndromes in cattle, such as Brachyspina syndrome. We suggest that this model will be a useful tool for the investigation of FA and for the development of new therapeutic strategies of inherited hematopoietic diseases.\u003c/p\u003e","manuscriptTitle":"Distinct Developmental Outcomes in DNA repair-deficient FANCC c.67delG Mutant and FANCC-/- Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-14 09:05:15","doi":"10.21203/rs.3.rs-4921572/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-09-27T10:26:30+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-09-20T17:59:41+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-09-07T19:38:32+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-08-28T15:47:41+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-08-28T15:40:13+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-08-18T12:26:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-16T10:28:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Differentiation","date":"2024-08-15T23:26:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-15T23:26:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"ca76f52f-7a92-4eb6-b89b-09d34fe622ba","owner":[],"postedDate":"October 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":36202505,"name":"Biological sciences/Genetics/Development"},{"id":36202506,"name":"Biological sciences/Genetics"}],"tags":[],"updatedAt":"2025-02-18T08:11:28+00:00","versionOfRecord":{"articleIdentity":"rs-4921572","link":"https://doi.org/10.1038/s41418-025-01461-3","journal":{"identity":"cell-death-and-differentiation","isVorOnly":false,"title":"Cell Death \u0026 Differentiation"},"publishedOn":"2025-02-17 05:00:00","publishedOnDateReadable":"February 17th, 2025"},"versionCreatedAt":"2024-10-14 09:05:15","video":"","vorDoi":"10.1038/s41418-025-01461-3","vorDoiUrl":"https://doi.org/10.1038/s41418-025-01461-3","workflowStages":[]},"version":"v1","identity":"rs-4921572","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4921572","identity":"rs-4921572","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}