Activation of endothelial GABA A α1 receptor protects against barrier dysfunction in acute lung injury

Activation of endothelial GABA A α1 receptor protects against barrier dysfunction in acute lung injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Activation of endothelial GABA A α1 receptor protects against barrier dysfunction in acute lung injury Shuting Zhou, Xudong He, Xinzhe Ni, Aizhong Wang, Xiaotao Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9007304/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Apr, 2026 Read the published version in BMC Pulmonary Medicine → Version 1 posted 12 You are reading this latest preprint version Abstract Vascular hyperpermeability drives the pathogenesis of acute lung injury (ALI) during sepsis. Although γ-aminobutyric acid type A receptors (GABAARs) are classically recognized as central nervous system ion channels, we identified an unexpected, essential requirement for the GABA A α 1 subunit (GABRA1) in preserving pulmonary endothelial integrity. Analysis of pulmonary microvascular endothelial cells (PMVECs) isolated from mice with polymicrobial sepsis (CLP) revealed a profound depletion of GABRA1. This suppression was faithfully mirrored in cultured endothelial cells following endotoxin (LPS) challenge. Crucially, targeted silencing of GABRA1 in HUVECs severely aggravated LPS-triggered barrier dysfunction, characterized by a precipitous drop in transendothelial electrical resistance and exaggerated upregulation of adhesion molecules (ICAM-1, VCAM-1). These results re-define GABRA1 as a vital structural gatekeeper in the pulmonary vasculature, offering a non-canonical therapeutic avenue for managing septic endothelial leakage. GABAA α1 receptor Endothelial cells Acute lung injury Figures Figure 1 Figure 2 Figure 3 Highlights What is the central question of this study? Two primary objectives guide this research on sepsis-induced ALI: first, to characterize the expression profile of GABAA receptor subunits (with a focus on α1) in endothelial cells; and second, to delineate the functional role of the α1 subunit in preserving endothelial barrier integrity and controlling the inflammatory response. What is the main finding and its importance? We observed a significant downregulation of GABA A α1 in PMVECs during sepsis. Consequently, knocking down this subunit in endothelial cells worsened LPS-induced injury, manifesting as impaired barrier function (lower TEER) and enhanced inflammation (elevated ICAM-1/VCAM-1). These data collectively identify endothelial GABA A α1 as a novel protector in septic ALI and a promising target for therapeutic intervention. 1 INTRODUCTION The profound mortality associated with septic acute lung injury (ALI) is fundamentally driven by the structural collapse of the pulmonary microvascular endothelium(Singer et al., 2016 ). This loss of barrier integrity triggers massive plasma extravasation, inundating alveolar compartments with proteinaceous exudate and severely impairing respiratory function(Ware & Matthay, 2000 ). Consequently, targeting and restoring endothelial stability represents a critical imperative for future sepsis interventions. Beyond the classical myeloid-driven cytokine storm, sepsis profoundly dysregulates the vascular endothelium(Ward, 2012 ). Rather than functioning as mere passive conduits, endothelial cells (ECs) act as innate immune sentinels at the blood-tissue interface(Joffre et al., 2020 ). During early infection, this endothelial activation is an adaptive mechanism- shifting toward a pro-coagulant and adhesive phenotype to orchestrate leukocyte trafficking for pathogen clearance. However, in severe sepsis, this response rapidly becomes maladaptive. Rampant, unchecked endothelial hyperactivation inevitably compromises structural integrity, thereby amplifying collateral tissue injury and local inflammation(Guazzi et al., 2015 ). Consequently, preserving endothelial homeostasis has emerged as a paramount therapeutic strategy for septic ALI. Historically, γ-aminobutyric acid type A receptors (GABAARs) have been almost exclusively characterized as the primary inhibitory gatekeepers of the central nervous system (CNS) (Farrant & Nusser, 2005 ). Defective GABAAR signaling is fundamentally linked to epileptic pathogenesis(Macdonald et al., 2010 ; Ohkawa et al., 1988 ; Shi et al., 2019 ). While its functional restoration offers cognitive benefits in Alzheimer's models(Busche et al., 2015 ). Unsurprisingly, contemporary investigations remain heavily neuro-centric, emphasizing phenomena like hippocampal neurogenesis(Prevot et al., 2025 ), premenstrual dysphoric disorder(Stiernman et al., 2025 ) and sleep regulation(Unger & Kohlmeier, 2026 ). As a result, the structural diversity and physiological relevance of GABAAR subunits in peripheral, non-neuronal compartments represent a striking knowledge gap. Deciphering this extraneural GABAergic network is essential to unlocking novel, unexpected therapeutic applications in critical care. In this report, we uncover the functional presence of the GABA A α 1 subunit within pulmonary microvascular endothelial cells (PMVECs). Strikingly, targeted endothelial ablation of this receptor profoundly amplifies both endotoxin-driven cytokine cascades and microvascular leakage. These insights establish GABA A α1 as an unconventional, barrier-preserving therapeutic candidate for sepsis-driven ALI. 2 METHODS 2.1 Ethical approval Ethical clearance for all in vivo protocols was granted by the Institutional Animal Care and Use Committee at Shanghai Jiao Tong University Affiliated Sixth People’s Hospital (Approval ID: 2025-0573). Furthermore, animal handling strictly adhered to the ARRIVE reporting standards and Grundy’s (2015) ethical framework. 2.2 Animals We utilized male C57BL/6J mice (6 weeks old; 25–30 g) sourced from the Shanghai Experimental Animal Center. The housing conditions were standardized at 23 ± 1°C and 50% humidity, following a 12-hour circadian rhythm. Animals were provided with ad libitum food and water and were allowed to adapt to the facility for one week before the experiments commenced. The experimental protocol received approval from the Institutional Animal Care and Use Committee at the Sixth Affiliated Hospital of Shanghai Jiao Tong University. All procedures were conducted in strict compliance with the NIH Guide for the Care and Use of Laboratory Animals. Following a seven-day acclimatization period, the mice were randomly allocated into two experimental groups (n = 4 per group): sham-operated controls and cecal ligation and puncture (CLP) treatment group. Surgical anesthesia was induced by intraperitoneal administration of 4% pentobarbital sodium at a dosage of 40 mg/kg body weight(Shi et al. , 2023). After confirming the absence of the plantar reflex, the abdominal region was shaved and disinfected prior to performing a midline laparotomy. The cecum was carefully exteriorized, ligated distal to the ileocecal valve, and punctured twice using a 25-gauge needle. Following return of the cecum to the abdominal cavity, the surgical incision was closed in layers. Control animals underwent identical surgical procedures excluding the ligation and puncture steps. At 12 hours post-surgery, mice were deeply anesthetized via intraperitoneal injection of pentobarbital sodium (50 mg/kg) (Chen et al. , 2021). Once the loss of pedal reflex was confirmed, thoracotomy was performed followed by cardiac exsanguination to ensure death. 2.3 Histological analysis For histological evaluation, left lung lobes were fixed by tracheal perfusion with ice-cold 4% PFA immediately after euthanasia. The tissues were then post-fixed overnight at 4°C. Subsequent processing included dehydration, paraffin embedding, and sectioning at 4-5 μm. Once stained with H&E per standard protocols, the sections were examined under a light microscope for pathological assessment. 2.4 Cell culture and treatment Human Umbilical Vein Endothelial Cell (HUVEC) line was obtained from the Cell Bank of the Chinese Academy of Sciences. The cells were routinely cultured in high-glucose DMEM (SH30022, HyClone, USA) medium supplemented with 10% fetal bovine serum (FBS) (FBP-S005#, HyCyte, Suzhou, China), 1% Endothelial Cell Growth Supplement (ECGS), 100U/mL penicillin, and 100 μg/mL streptomycin (Biosharp, Beijing, China). Cells were maintainedin a humidified incubator at 37 °C with 5% CO₂. Cells were treated with LPS (10 μg/mL) for 12 h. 2.5 Lentiviral Transduction Lentiviral vectors expressing shRNA targeting GABA A α1 (LV-shGABA A α1) and negative control vectors (LV-NC) were synthesized by GeneChem (Shanghai, China). The shRNA sequence for GABA A α1 was 5’-CCTCCGGTTAAATAACCTAAT-3’, and the control sequence was 5’-TTCTCCGAACGTGTCACGT-3’. For transduction, HUVECs were seeded into 6-well plates and reached 80% confluence before being infected at a multiplicity of infection (MOI) of 10 in the presence of 5 μg/mL Polybrene. The culture medium was refreshed after 24 h, and cells were incubated for an additional 48 h. Transduction efficiency was initially assessed by GFP fluorescence imaging. Subsequently, the knockdown efficiency of GABA A α1 was validated using qRT-PCR. 2.6 Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Total RNA was isolated from treated cells or mouse lung tissues using TRIzol reagent. RNA quality was verified by assessing concentration, purity (A260/A280 ratio) with a NanoDrop™ spectrophotometer, and integrity. Subsequently, 1 μg of total RNA was reverse-transcribed into first-strand cDNA using the 4× EZscript Reverse Transcription Mix II kit. qRT-PCR was performed in a 10 μL reaction volume containing cDNA, gene-specific primers (Table 1), and 2×SYBR Green qPCR Master Mix on a LightCycler® 480 II system. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 sec and 60 °C for 30 sec. Gene expression was normalized to β-actin, and relative quantification was calculated using the 2^(-ΔΔCt) method. Table 1 qPCR primers Gene Genebank Forward and reverse primer sequences (5’ to 3’) GABBR1 NM_001470 F: TACAATGTGGCAGTCCTGTG G: ACTATGGCAAGAGAGGCAAAG GABBR2 NM_005458 F: GCTGACTTACATGCTCCACAT G: CAGGAATGGGTGTTATTGTGT GABRA1 NM_000806.5 F: GCCAGAAACTCCCTCCCTAAGGT G: GCTGAGAACACAAAGGCATAGCAC GABRA2 NM_000807 F: ATGACAACTCTAAGCATCAGTG G: AACAGCAATAAACCAGTCCA GABRA3 NM_000808 F: CGACTGAGACCAAGACCTACA G: GCCCAATAGACCAGATTGAAT GABRA4 NM_000809.4 F: GAGGTTTTATCTCCCTTGCCTAT G: CACCACTTCCCACACTGTAGTT GABRA5 NM_000810.4 F: GCCATACTTCCAGCGAAAT G: TTCCTGAAAGATAGTGCTCACAT GABRB1 NM_000812 F: ATGTCGTCTATTGGCTTTACT G: TGGATGGCTGAATCTCTTA GABRB2 NM_000813.3 F: GACTGATGTGAATGCCATAG G: TAATAAAGCCAATAGACGATGTT GABRB3 NM_000814.6 F: TTCAAAACCCACCATCAGATAAA G: CCAGAGAGCAGCGATTAGGA GABRE NM_004961 F: TCTTCCCGTGATGTTGTCTAT G: GAGAGGCTTCTGGCAGTTT GABRG1 NM_173536 F: GAAGGAAGGATACACATACGCA G: AGCCAACCCAATAAACCAAG GABRG2 NM_198904.4 F: AGATGAAGAGTACGGCTATGAGT G: CAAGCTCCTGTTCGACAAT GABRG3 NM_033223.5 F: GTAACCCATTCTGCATTGAC G: TTTGTGTTCTAGCCCTTTAGATA GABRP NM_014211.3 F: TTTTTGAGTGTGCCAGGGTAAAG G: CTGACAGGAAAGGTAAAGCCGT GABRQ NM_018558.4 F: GACCACCATCGACTCACAT G: AGAACAAGCACACGAGGATATAG GABRR1 NM_002042.5 F: ATACGACACTGTAGCGACTGATG G: GGGTCTAACGGGTGGAACTAA GABRR2 NM_002043 F: GCGTCACACTTCACATCTCT G: CTAGGCAATCTGAGGGTCTAA TNF-α NM_000594.4 F: CCTCTCTCTAATCAGCCCTCTG G: GAGGACCTGGGAGTAGATGAG β-actin NM_001101 F: AAGGTGACAGCAGTCGGTT G: TGTGTGGACTTGGGAGAGG 2.7 Immunofluorescence staining Paraffin-embedded lung sections were deparaffinized, rehydrated, and blocked with 5% BSA containing 0.5% Triton X-100. HUVECs, seeded on coverslips and subjected to LPS stimulation where indicated, were fixed with 4% PFA, permeabilized with 0.5% Triton X-100, and blocked with 5% BSA.Samples were incubated overnight at 4 °C with the following primary antibodies: CD31 (P72490#, MCE), ICAM-1 (10831#, proteintech), VCAM-1 (11444#, proteintech), VE-Cadherin (98251#, proteintech), and GBARA1 (12410#, proteintech). After washing, samples were incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG (ab150077#, Abcam) and/or Alexa Fluor 594-conjugated goat anti-mouse IgG (ab150116#, Abcam) for 1-2 h at room temperature. Nuclei were counterstained with DAPI (C1006#, Beyotime). Images were captured using Leica or Zeiss microscopy systems and analyzed with ImageJ software. 2.8. Measurement of transendothelial electrical resistance Transendothelial Electrical Resistance (TEER) measurements were performed using an Electric Cell-substrate Impedance Sensing (ECIS) system (Applied BioPhysics, Troy, NY, USA). HUVECs were grown to form confluent monolayers on ECIS array slides pre-coated with 0.1% gelatin. Subsequently, the cells were transfected with shGABA A α1 for 48 hours as described above, followed by treatment with 10 μg/ml LPS. TEER values were obtained every 3 min for 8 h after LPS treatment as an automatically recorded resistance (TEER = R TEER × Marea (cm 2 ), R TEER represents the monolayer cell resistance). The relative TEER values were calculated by dividing actual TEER values at each time point by the initial TEER values. 2.9 Statistical analysis Statistical analyses were carried out using GraphPad Prism 9 to evaluate the data, which are reported as mean ± SD. Group comparisons involved the unpaired Student's t-test for two groups or one-way ANOVA with Tukey's post-hoc test for multiple groups, respectively. Statistical significance was set at P < 0.05. 3 RESULTS 3.1 The expression of GABA receptor genes in ECs upon LPS stimulation To determine the expression of GABA receptor genes in ECs, HUVECs were incubated with LPS (10 μg/ml) for 12 hours. Gabbr1 , Gabbr2 , Gabra1 , Gabra2 , Gabra3 , Gabra4 , Gabra5 , Gabrb1 , Gabrb2 , Gabrb3 , Gabre , Gabrg1 , Gabrg2 , Gabrg3 , Gabrp , Gabrq , Gabrr1 and Gabrr2 mRNA were analyzed by RT-qPCR. The results revealed that, among the 18 GABAAR genes examined, the expression levels of two GABA receptor genes (GABRA1 and GABRP) and one GABAb receptor gene (GABBR1) were decreased in ECs upon LPS stimulation compared to the control group. In contrast, the expression of GABRA3 and GABRA5 was significantly upregulated following LPS challenge. Notably, the expression level of GABRA1 was the most markedly downregulated after LPS treatment (Figure 1a and b). 3.2 The expression of GABA A α1 decreased in the PMVECs of septic mice Histological examination via H&E staining revealed substantial lung injury in the CLP-induced sepsis model, characterized by alveolar hemorrhage, enlargement of airspaces, and infiltration of inflammatory cells. The pathological alterations were markedly more severe than those observed in the sham-operated control group (Figure 2a), confirming the successful establishment of the septic animal model. To investigate the expression pattern of GABA A α1 in pulmonary microvascular endothelial cells (PMVECs), we performed immunofluorescence staining on lung sections using a GABA A α1-specific antibody. As illustrated in Figure 2b, GABA A α1 was found to be co-localized with CD31, an endothelial cell marker. Notably, a significant reduction in GABA A α1 expression was detected within PMVECs of septic mice. Collectively, these findings imply a potential role for GABA A α1 downregulation in PMVECs during the pathogenesis of sepsis-induced ALI. 3.3 GABA A α1 negatively regulates ECs inflammation and barrier integrity To investigate the impact of GABA A α1 loss-of-function on inflammatory cytokine expression in LPS-treated HUVECs, we employed lentivirus-mediated RNA interference for targeted gene knockdown in vitro (Figure 3a). The efficiency of GABA A α1 depletion was confirmed in HUVECs using quantitative real-time PCR (Figure 3b). Analysis revealed that silencing GABA A α1 markedly upregulated the expression of TNF-α , ICAM-1 , and VCAM-1 under LPS stimulation (Figure 3c-e). Furthermore, to assess the consequences of GABA A α1 knockdown on endothelial barrier function, we monitored transendothelial electrical resistance (TEER) using an electric cell-substrate impedance sensing system following LPS exposure. Notably, while LPS alone reduced TEER values in HUVECs, the additional loss of GABA A α1 significantly exacerbated this barrier impairment (Figure 3f). 4. DISCUSSION Sepsis-induced acute lung injury is fundamentally driven by the catastrophic failure of the pulmonary microvascular barrier(Saguil & Fargo, 2020). Within this pathological framework, our current investigation uncovers an unexpected molecular event: the profound depletion of the γ-aminobutyric acid type A receptor α 1 subunit (GABRA1) in the pulmonary endothelium of septic mice. This in vivo suppression temporally aligns with the onset of lethal pulmonary edema and the loss of tissue homeostasis. Classically, GABAergic signaling is synonymous with central nervous system inhibition, where it dictates neuronal excitability and developmental trajectories(Mohler, 2006; Pontes et al. , 2013). However, emerging paradigms suggest a broader, extraneural footprint for these ionotropic channels. For instance, specific subunits like Gabrb3 have been mapped to periventricular endothelial networks, where their genetic ablation not only perturbs neurobehavioral outcomes but also dysregulates fundamental endothelial processes such as proliferation and angiogenic sprouting(Babij et al. , 2023; Li et al. , 2018; Won et al. , 2013).Building upon this concept of "endothelial GABAergic signaling," we hypothesized that GABRA1 might act as an intrinsic regulator of vascular stability during severe systemic infection. To mechanistically validate this, we employed lentiviral-mediated depletion of GABRA1 in human endothelial cells. Strikingly, the loss of this receptor dramatically sensitized the endothelium to endotoxemic injury. Upon LPS challenge, GABRA1-deficient cells exhibited an exaggerated inflammatory phenotype, characterized by the hyper-expression of leukocyte adhesion molecules (ICAM-1 and VCAM-1). Furthermore, this molecular hyperactivation translated into severe structural vulnerability, demonstrated by a precipitous decline in TEER. Taken together, these data delineate a previously unrecognized paradigm wherein the loss of endothelial GABRA1 actively drives the immunopathology of sepsis. Rather than being a mere bystander, GABRA1 appears to function as a critical molecular brake, restraining cytokine storms and reinforcing the alveolar-capillary barrier. Consequently, rescuing or augmenting this localized endothelial GABAergic tone may offer a highly innovative therapeutic avenue for mitigating sepsis-associated vascular collapse. 4.1 Study limitations Our current findings, while methodologically grounded, carry inherent constraints. The statistical power underpinning our in vivo conclusions would be substantially strengthened by recruiting larger murine cohorts, a step critical to guaranteeing both reproducibility and translational confidence. Furthermore, our genetic manipulation of GABRA1 was restricted to cultured systems; the absence of endothelial-targeted conditional knockout transgenic lines limits our ability to definitively confirm these phenotypes within a complex physiological environment. Additionally, the precise molecular crosstalk driving pathogen-induced endothelial hyperactivation remains incompletely resolved. Future investigations must dissect these mechanisms while explicitly accounting for the profound phenotypic heterogeneity of vascular beds across different organs. Ultimately, pinpointing exactly how this receptor orchestrates microvascular barrier competence will require high-resolution mapping of its downstream signaling cascades. 4.2 Conclusions In conclusion, this study demonstrates that GABA A α1 is expressed in PMVECs and is reduced during sepsis. Its knockdown in endothelial cells exacerbated the inflammatory response to LPS, suggesting that enhancing GABA A α1 signaling could be a promising strategy for treating infection-induced inflammatory lung injury. Abbreviations ALI, acute lung injury; LPS, lipopolysaccharide; ECs, endothelial cells; GABA A α1, γ-aminobutyric acid type A receptor α1; VCAM-1, vascular cell adhesion molecule-1; ICAM-1, intercellular cell adhesion molecule-1; BALF, bronchoalveolar lavage fluid; TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6. Declarations AUTHOR CONTRIBUTIONS The research framework and central hypothesis were jointly formulated by Xiaotao Xu and Aizhong Wang. Shuting Zhou and Xudong He performed the experiments. Shuting Zhou and Xinzhe Ni analysed the data. The initial manuscript was prepared by Shuting Zhou. Xiaotao Xu critically reviewed the manuscript. Every named contributor has thoroughly examined and endorsed the finalized document, assuming collective responsibility for the study's veracity and scientific rigor. We formally commit to transparently addressing any future inquiries concerning the validity or ethical execution of this research. Furthermore, the designated author list strictly reflects individuals meeting established attribution criteria, ensuring no eligible researchers have been omitted. FUNDING INFORMATION This work was supported by Natural Science Foundation of Shanghai (Grant No.25ZR1401287). CONFLICT OF INTEREST None declared DATA AVAILABILITY STATEMENT The data that support the findings of the present study are available from the corresponding author upon reasonable request. Clinical trial number: not applicable. References Babij R, Ferrer C, Donatelle A, Wacks S, Buch AM, Niemeyer JE, Ma H, Duan ZRS, Fetcho RN, Che A, Otsuka T, Schwartz TH, Huang BS, Liston C. & De Marco Garcia, N. V. (2023). Gabrb3 is required for the functional integration of pyramidal neuron subtypes in the somatosensory cortex. Neuron , 111 (2), 256–274 e210. Busche MA, Kekus M, Adelsberger H, Noda T, Forstl H, Nelken I, Konnerth A. Rescue of long-range circuit dysfunction in Alzheimer's disease models. Nat Neurosci. 2015;18(11):1623–30. Chen J, Xue X, Cai J, Jia L, Sun B, Zhao W. (2021). Protective effect of taurine on sepsis–induced lung injury via inhibiting the p38/MAPK signaling pathway. Mol Med Rep, 24 (3). Farrant M, Nusser Z. Variations on an inhibitory theme: phasic and tonic activation of GABA(A) receptors. Nat Rev Neurosci. 2005;6(3):215–29. Guazzi M, Phillips SA, Arena R, Lavie CJ. Endothelial dysfunction and lung capillary injury in cardiovascular diseases. Prog Cardiovasc Dis. 2015;57(5):454–62. Joffre J, Hellman J, Ince C, Ait-Oufella H. Endothelial Responses in Sepsis. Am J Respir Crit Care Med. 2020;202(3):361–70. Li S, Kumar TP, Joshee S, Kirschstein T, Subburaju S, Khalili JS, Kloepper J, Du C, Elkhal A, Szabo G, Jain RK, Kohling R, Vasudevan A. Endothelial cell-derived GABA signaling modulates neuronal migration and postnatal behavior. Cell Res. 2018;28(2):221–48. Macdonald RL, Kang JQ, Gallagher MJ. Mutations in GABAA receptor subunits associated with genetic epilepsies. J Physiol. 2010;588(Pt 11):1861–9. Mohler H. GABA(A) receptor diversity and pharmacology. Cell Tissue Res. 2006;326(2):505–16. Ohkawa Y, Iwata K, Inui N. Screening for skin-tumor promoters. Biomed Pharmacother. 1988;42(7):447–50. Pontes A, Zhang Y, Hu W. (2013). Novel functions of GABA signaling in adult neurogenesis. Front Biol (Beijing), 8 (5). Prevot TD, Marcotte M, David DJ, Mendez-David I, Mian MY, Cook JM, Guilloux JP, Sibille E. Chronic alpha5-GABA-A Receptor Potentiation Promotes Mouse Adult Hippocampal Neurogenesis. Hippocampus. 2025;35(4):e70019. Saguil A, Fargo MV. Acute Respiratory Distress Syndrome: Diagnosis and Management. Am Fam Physician. 2020;101(12):730–8. Shi J, Song S, Wu K, Liang G, Wang A, Xu X. Role of brain-derived neurotrophic factor in endotoxaemia-induced acute lung injury. Exp Physiol. 2023;108(12):1456–65. Shi YW, Zhang Q, Cai K, Poliquin S, Shen W, Winters N, Yi YH, Wang J, Hu N, Macdonald RL, Liao WP, Kang JQ. Synaptic clustering differences due to different GABRB3 mutations cause variable epilepsy syndromes. Brain. 2019;142(10):3028–44. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016;315(8):801–10. Stiernman L, Comasco E, Johansson M, Bixo M. Transcription of GABA(A) receptor subunits in circulating monocytes and association to emotional brain function in premenstrual dysphoric disorder. Transl Psychiatry. 2025;15(1):255. Unger C, Kohlmeier KA. Pharmacological management of insomnia with a focus on GABA(A) receptor positive allosteric modulators and orexin receptor antagonists. Sleep Med. 2026;139:108743. Ward PA. New approaches to the study of sepsis. EMBO Mol Med. 2012;4(12):1234–43. Ware LB, Matthay MA. The acute respiratory distress syndrome. N Engl J Med. 2000;342(18):1334–49. Won C, Lin Z, Kumar TP, Li S, Ding L, Elkhal A, Szabo G, Vasudevan A. Autonomous vascular networks synchronize GABA neuron migration in the embryonic forebrain. Nat Commun. 2013;4:2149. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 28 Apr, 2026 Read the published version in BMC Pulmonary Medicine → Version 1 posted Editorial decision: Revision requested 25 Mar, 2026 Reviews received at journal 19 Mar, 2026 Reviewers agreed at journal 19 Mar, 2026 Reviewers agreed at journal 18 Mar, 2026 Reviews received at journal 16 Mar, 2026 Reviewers agreed at journal 16 Mar, 2026 Reviewers agreed at journal 15 Mar, 2026 Reviewers invited by journal 15 Mar, 2026 Editor assigned by journal 15 Mar, 2026 Editor invited by journal 10 Mar, 2026 Submission checks completed at journal 10 Mar, 2026 First submitted to journal 10 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9007304","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":607095293,"identity":"885c9604-c4d6-4d47-8117-1dff75a1e576","order_by":0,"name":"Shuting Zhou","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Shuting","middleName":"","lastName":"Zhou","suffix":""},{"id":607095296,"identity":"4204609c-2235-457d-bb0b-bf69337416ca","order_by":1,"name":"Xudong He","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Xudong","middleName":"","lastName":"He","suffix":""},{"id":607095297,"identity":"4d4d8ab0-2299-4abb-9dd5-f1610e67fe07","order_by":2,"name":"Xinzhe Ni","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Xinzhe","middleName":"","lastName":"Ni","suffix":""},{"id":607095299,"identity":"27efd81b-3f0c-43c5-b572-591669c99a32","order_by":3,"name":"Aizhong Wang","email":"","orcid":"","institution":"Shanghai Sixth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Aizhong","middleName":"","lastName":"Wang","suffix":""},{"id":607095300,"identity":"567819e8-88f1-4933-bfea-ced7780032d0","order_by":4,"name":"Xiaotao Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFElEQVRIie2QsWrDMBRFZQTx8kxWmZT6F6ylpRDqX7ER5BNCh2IcDM9jVwfSfkOnQLcYQbOIzB4bvLbgzFkqO94auxkL1VmeBPfo8kSIwfAHGVMrq/WE0/WB0HbCgOJmKXaZJqwIhd8UX22xO2rFwi49pJAywspBeTXOnor68BLbAQutjy8k3m2PYeVRxpc4A6YkdZdrSYGFlD8j4W/JeYWyKGEHnAIpBZk4602jjCYOktDfnFdGjRIhA68U9Ois4kaxj0MKQIFti18K/XhC2xY6pDB7kfJ8NwOu5M1d/q53UfvUXe0Yf+1RAmnvK5jL4Hq7qMr6MRZ2Jor6cz71+lp+IPQvJk39hXnN/eVRg8Fg+C98A/gSVK+bEkt1AAAAAElFTkSuQmCC","orcid":"","institution":"Shanghai Sixth People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xiaotao","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2026-03-02 08:08:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9007304/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9007304/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12890-026-04311-1","type":"published","date":"2026-04-28T15:57:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":104840026,"identity":"673c01b2-2e20-4b65-ba7c-e3d7b8ee2115","added_by":"auto","created_at":"2026-03-17 19:06:04","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":322168,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of GABA receptor genes in ECs upon LPS stimulation. HUVECs was treated by LPS for 12 hours. (a) The expression of GABA receptor-related genes in ECs was analyzed by RT-qPCR. The mRNA levels of Gabbr1, Gabbr2, Gabra1, Gabra2, Gabra3, Gabra4, Gabra5, Gabrb1, Gabrb2, Gabrb3, Gabre, Gabrg1, Gabrg2, Gabrg3, Gabrp, Gabrq, Gabrr1, and Gabrr2 are presented as a heatmap. (b) represents the significant difference analysis for (a). In the graph, individual data points are represented by circles (Control group, n=4) and squares (LPS group, n=4), while the bar graphs depict the mean ± SD for each group. Comparisons between these two groups were performed using a Two-way ANOVA. The analysis revealed significant differences in the expression of the following genes: Gabra1 (P \u0026lt; 0.0001), Gabra3 (P = 0.0004), Gabra5 (P = 0.0029), Gabrp (P = 0.0029), and Gabrr1 (P = 0.0150). Significance levels are denoted as *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9007304/v1/13ee9d93953f354d061755f8.jpg"},{"id":104840028,"identity":"7057dca0-c4be-4587-a841-7ec037b49f0e","added_by":"auto","created_at":"2026-03-17 19:06:04","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":101812,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of GABA\u003csub\u003eA\u003c/sub\u003e α1 decreased in PMVECs of septic mice. (a) Lung injury was assessed by H\u0026amp;E staining (n=4; scale bar: 100 µm). (b) Representative immunofluorescence images showing co-localization of GABA\u003csub\u003eA\u003c/sub\u003e α1 (green) and the endothelial marker CD31 (red) in lung tissue sections. Nuclei were counterstained with DAPI (blue) (Scale bar: 100 µm).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9007304/v1/1eb8fa2a943404014587df7b.jpg"},{"id":104840027,"identity":"62a2e876-2f14-4585-bfc8-6eed4d1b8c3c","added_by":"auto","created_at":"2026-03-17 19:06:04","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":62937,"visible":true,"origin":"","legend":"\u003cp\u003eGABA\u003csub\u003eA\u003c/sub\u003e α1 negatively regulates ECs inflammation and barrier integrity. (a) Transfection efficiency in ECs 48 hours post-transfection with shNC (negative control) and shGABA\u003csub\u003eA\u003c/sub\u003e α1, as observed under a fluorescence microscope (scale bar: 200 μm). (b) qRT-PCR analysis to determine the optimal sequence for GABA\u003csub\u003eA\u003c/sub\u003e α1 gene knockdown (n=4, P \u0026lt; 0.0001). Individual data points are represented by circles (shNC group, n=4), squares (knockdown group Homo798, n=4), triangles (knockdown group Homo1158, n=4), and diamonds (knockdown group Homo1752, n=4). Bar graphs represent the mean ± SD for each group. (c) mRNA expression levels of TNF-α among groups following stable lentiviral transduction (n=4, P \u0026lt; 0.0001). Individual data points are represented by circles (shNC group, n=4), squares (knockdown group, n=4), triangles (LPS-induced model group, n=4), and diamonds (knockdown + LPS-induced model group, n=4). Bar graphs represent the mean ± SD for each group. (d and e) Immunofluorescence staining of ICAM-1 (green), VCAM-1 (green), and DAPI (blue) in endothelial cells (scale bar: 100 μm). (f) Real-time changes in TEER values following LPS treatment up to 8 hours (n=4, P \u0026lt; 0.0001). Bar graphs represent the mean ± SD for each group. For comparisons across multiple groups, one-way ANOVA with repeated measures was employed, followed by Tukey's post-hoc test for multiple comparisons. Significance levels are denoted as *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9007304/v1/e0b4f2cb10242f26a49f96a8.jpg"},{"id":108444536,"identity":"a22385a5-933d-4092-8b1c-6ffec5703ab3","added_by":"auto","created_at":"2026-05-04 17:34:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":745788,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9007304/v1/96ef3036-d6c8-4e3a-b959-9df78bc7c733.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Activation of endothelial GABA A α1 receptor protects against barrier dysfunction in acute lung injury","fulltext":[{"header":"Highlights","content":"\u003cp\u003e\u003cstrong\u003eWhat is the central question of this study?\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo primary objectives guide this research on sepsis-induced ALI: first, to characterize the expression profile of GABAA receptor subunits (with a focus on α1) in endothelial cells; and second, to delineate the functional role of the α1 subunit in preserving endothelial barrier integrity and controlling the inflammatory response.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWhat is the main finding and its importance?\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe observed a significant downregulation of GABA\u003csub\u003eA\u003c/sub\u003e α1 in PMVECs during sepsis. Consequently, knocking down this subunit in endothelial cells worsened LPS-induced injury, manifesting as impaired barrier function (lower TEER) and enhanced inflammation (elevated ICAM-1/VCAM-1). These data collectively identify endothelial GABA\u003csub\u003eA\u003c/sub\u003e α1 as a novel protector in septic ALI and a promising target for therapeutic intervention.\u003c/p\u003e"},{"header":"1 INTRODUCTION","content":"\u003cp\u003eThe profound mortality associated with septic acute lung injury (ALI) is fundamentally driven by the structural collapse of the pulmonary microvascular endothelium(Singer et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This loss of barrier integrity triggers massive plasma extravasation, inundating alveolar compartments with proteinaceous exudate and severely impairing respiratory function(Ware \u0026amp; Matthay, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Consequently, targeting and restoring endothelial stability represents a critical imperative for future sepsis interventions.\u003c/p\u003e \u003cp\u003eBeyond the classical myeloid-driven cytokine storm, sepsis profoundly dysregulates the vascular endothelium(Ward, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Rather than functioning as mere passive conduits, endothelial cells (ECs) act as innate immune sentinels at the blood-tissue interface(Joffre et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). During early infection, this endothelial activation is an adaptive mechanism- shifting toward a pro-coagulant and adhesive phenotype to orchestrate leukocyte trafficking for pathogen clearance. However, in severe sepsis, this response rapidly becomes maladaptive. Rampant, unchecked endothelial hyperactivation inevitably compromises structural integrity, thereby amplifying collateral tissue injury and local inflammation(Guazzi et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Consequently, preserving endothelial homeostasis has emerged as a paramount therapeutic strategy for septic ALI.\u003c/p\u003e \u003cp\u003eHistorically, γ-aminobutyric acid type A receptors (GABAARs) have been almost exclusively characterized as the primary inhibitory gatekeepers of the central nervous system (CNS) (Farrant \u0026amp; Nusser, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Defective GABAAR signaling is fundamentally linked to epileptic pathogenesis(Macdonald et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Ohkawa et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Shi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). While its functional restoration offers cognitive benefits in Alzheimer's models(Busche et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Unsurprisingly, contemporary investigations remain heavily neuro-centric, emphasizing phenomena like hippocampal neurogenesis(Prevot et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), premenstrual dysphoric disorder(Stiernman et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) and sleep regulation(Unger \u0026amp; Kohlmeier, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2026\u003c/span\u003e). As a result, the structural diversity and physiological relevance of GABAAR subunits in peripheral, non-neuronal compartments represent a striking knowledge gap. Deciphering this extraneural GABAergic network is essential to unlocking novel, unexpected therapeutic applications in critical care.\u003c/p\u003e \u003cp\u003eIn this report, we uncover the functional presence of the GABA\u003csub\u003eA\u003c/sub\u003e α 1 subunit within pulmonary microvascular endothelial cells (PMVECs). Strikingly, targeted endothelial ablation of this receptor profoundly amplifies both endotoxin-driven cytokine cascades and microvascular leakage. These insights establish GABA\u003csub\u003eA\u003c/sub\u003e α1 as an unconventional, barrier-preserving therapeutic candidate for sepsis-driven ALI.\u003c/p\u003e"},{"header":"2 METHODS","content":"\u003cp\u003e\u003cstrong\u003e2.1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical clearance for all in vivo protocols was granted by the Institutional Animal Care and Use Committee at Shanghai Jiao Tong University Affiliated Sixth People’s Hospital (Approval ID: 2025-0573). Furthermore, animal handling strictly adhered to the ARRIVE reporting standards and Grundy’s (2015) ethical framework.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe utilized male C57BL/6J mice (6 weeks old; 25–30 g) sourced from the Shanghai Experimental Animal Center. The housing conditions were standardized at 23 ± 1°C and 50% humidity, following a 12-hour circadian rhythm. Animals were provided with ad libitum food and water and were allowed to adapt to the facility for one week before the experiments commenced. The experimental protocol received approval from the Institutional Animal Care and Use Committee at the Sixth Affiliated Hospital of Shanghai Jiao Tong University. All procedures were conducted in strict compliance with the NIH Guide for the Care and Use of Laboratory Animals. Following a seven-day acclimatization period, the mice were randomly allocated into two experimental groups (n = 4 per group): sham-operated controls and cecal ligation and puncture (CLP) treatment group. Surgical anesthesia was induced by intraperitoneal administration of 4% pentobarbital sodium at a dosage of 40 mg/kg body weight(Shi\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2023). After confirming the absence of the plantar reflex, the abdominal region was shaved and disinfected prior to performing a midline laparotomy. The cecum was carefully exteriorized, ligated distal to the ileocecal valve, and punctured twice using a 25-gauge needle. Following return of the cecum to the abdominal cavity, the surgical incision was closed in layers. Control animals underwent identical surgical procedures excluding the ligation and puncture steps. At 12 hours post-surgery, mice were deeply anesthetized via intraperitoneal injection of pentobarbital sodium (50 mg/kg) (Chen\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2021). Once the loss of pedal reflex was confirmed, thoracotomy was performed followed by cardiac exsanguination to ensure death.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Histological analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor histological evaluation, left lung lobes were fixed by tracheal perfusion with ice-cold 4% PFA immediately after euthanasia. The tissues were then post-fixed overnight at 4°C. Subsequent processing included dehydration, paraffin embedding, and sectioning at 4-5 μm. Once stained with H\u0026amp;E per standard protocols, the sections were examined under a light microscope for pathological assessment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Cell culture and treatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman Umbilical Vein Endothelial Cell (HUVEC) line was obtained from the Cell Bank of the Chinese Academy of Sciences. The cells were routinely cultured in high-glucose DMEM (SH30022, HyClone, USA) medium supplemented with 10% fetal bovine serum (FBS) (FBP-S005#, HyCyte, Suzhou, China), 1% Endothelial Cell Growth Supplement (ECGS), 100U/mL penicillin, and 100 μg/mL streptomycin (Biosharp, Beijing, China). Cells were maintainedin a humidified incubator at 37 °C with 5% CO₂. Cells were treated with LPS (10 μg/mL) for 12 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Lentiviral Transduction\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLentiviral vectors expressing shRNA targeting GABA\u003csub\u003eA\u003c/sub\u003e α1 (LV-shGABA\u003csub\u003eA\u003c/sub\u003e α1) and negative control vectors (LV-NC) were synthesized by GeneChem (Shanghai, China). The shRNA sequence for GABA\u003csub\u003eA\u003c/sub\u003e α1 was 5’-CCTCCGGTTAAATAACCTAAT-3’, and the control sequence was 5’-TTCTCCGAACGTGTCACGT-3’. For transduction, HUVECs were seeded into 6-well plates and reached 80% confluence before being infected at a multiplicity of infection (MOI) of 10 in the presence of 5 μg/mL Polybrene. The culture medium was refreshed after 24 h, and cells were incubated for an additional 48 h. Transduction efficiency was initially assessed by GFP fluorescence imaging. Subsequently, the knockdown efficiency of GABA\u003csub\u003eA\u003c/sub\u003e α1 was validated using qRT-PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from treated cells or mouse lung tissues using TRIzol reagent. RNA quality was verified by assessing concentration, purity (A260/A280 ratio) with a NanoDrop™ spectrophotometer, and integrity. Subsequently, 1 μg of total RNA was reverse-transcribed into first-strand cDNA using the 4× EZscript Reverse Transcription Mix II kit. qRT-PCR was performed in a 10 μL reaction volume containing cDNA, gene-specific primers (Table 1), and 2×SYBR Green qPCR Master Mix on a LightCycler® 480 II system. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 sec and 60 °C for 30 sec. Gene expression was normalized to β-actin, and relative quantification was calculated using the 2^(-ΔΔCt) method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e qPCR primers\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGenebank\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward and reverse primer sequences (5’ to 3’)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABBR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001470\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TACAATGTGGCAGTCCTGTG\u003c/p\u003e\n \u003cp\u003eG: ACTATGGCAAGAGAGGCAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABBR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_005458\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GCTGACTTACATGCTCCACAT\u003c/p\u003e\n \u003cp\u003eG: CAGGAATGGGTGTTATTGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000806.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GCCAGAAACTCCCTCCCTAAGGT\u003c/p\u003e\n \u003cp\u003eG: GCTGAGAACACAAAGGCATAGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000807\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: ATGACAACTCTAAGCATCAGTG\u003c/p\u003e\n \u003cp\u003eG: AACAGCAATAAACCAGTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000808\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: CGACTGAGACCAAGACCTACA\u003c/p\u003e\n \u003cp\u003eG: GCCCAATAGACCAGATTGAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000809.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GAGGTTTTATCTCCCTTGCCTAT\u003c/p\u003e\n \u003cp\u003eG: CACCACTTCCCACACTGTAGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000810.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GCCATACTTCCAGCGAAAT\u003c/p\u003e\n \u003cp\u003eG: TTCCTGAAAGATAGTGCTCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000812\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: ATGTCGTCTATTGGCTTTACT\u003c/p\u003e\n \u003cp\u003eG: TGGATGGCTGAATCTCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRB2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000813.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GACTGATGTGAATGCCATAG\u003c/p\u003e\n \u003cp\u003eG: TAATAAAGCCAATAGACGATGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRB3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000814.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TTCAAAACCCACCATCAGATAAA\u003c/p\u003e\n \u003cp\u003eG: CCAGAGAGCAGCGATTAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_004961\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TCTTCCCGTGATGTTGTCTAT\u003c/p\u003e\n \u003cp\u003eG: GAGAGGCTTCTGGCAGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRG1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_173536\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GAAGGAAGGATACACATACGCA\u003c/p\u003e\n \u003cp\u003eG: AGCCAACCCAATAAACCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRG2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_198904.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: AGATGAAGAGTACGGCTATGAGT\u003c/p\u003e\n \u003cp\u003eG: CAAGCTCCTGTTCGACAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRG3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_033223.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GTAACCCATTCTGCATTGAC\u003c/p\u003e\n \u003cp\u003eG: TTTGTGTTCTAGCCCTTTAGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_014211.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TTTTTGAGTGTGCCAGGGTAAAG\u003c/p\u003e\n \u003cp\u003eG: CTGACAGGAAAGGTAAAGCCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_018558.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GACCACCATCGACTCACAT\u003c/p\u003e\n \u003cp\u003eG: AGAACAAGCACACGAGGATATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_002042.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: ATACGACACTGTAGCGACTGATG\u003c/p\u003e\n \u003cp\u003eG: GGGTCTAACGGGTGGAACTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGABRR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_002043\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GCGTCACACTTCACATCTCT\u003c/p\u003e\n \u003cp\u003eG: CTAGGCAATCTGAGGGTCTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTNF-α\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000594.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: CCTCTCTCTAATCAGCCCTCTG\u003c/p\u003e\n \u003cp\u003eG: GAGGACCTGGGAGTAGATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eβ-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: AAGGTGACAGCAGTCGGTT\u003c/p\u003e\n \u003cp\u003eG: TGTGTGGACTTGGGAGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Immunofluorescence staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eParaffin-embedded lung sections were deparaffinized, rehydrated, and blocked with 5% BSA containing 0.5% Triton X-100. HUVECs, seeded on coverslips and subjected to LPS stimulation where indicated, were fixed with 4% PFA, permeabilized with 0.5% Triton X-100, and blocked with 5% BSA.Samples were incubated overnight at 4 °C with the following primary antibodies: CD31 (P72490#, MCE), ICAM-1 (10831#, proteintech), VCAM-1 (11444#, proteintech), VE-Cadherin (98251#, proteintech), and GBARA1 (12410#, proteintech). After washing, samples were incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG (ab150077#, Abcam) and/or Alexa Fluor 594-conjugated goat anti-mouse IgG (ab150116#, Abcam) for 1-2 h at room temperature. Nuclei were counterstained with DAPI (C1006#, Beyotime). Images were captured using Leica or Zeiss microscopy systems and analyzed with ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Measurement of transendothelial electrical resistance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransendothelial Electrical Resistance (TEER) measurements were performed using an Electric Cell-substrate Impedance Sensing (ECIS) system (Applied BioPhysics, Troy, NY, USA). HUVECs were grown to form confluent monolayers on ECIS array slides pre-coated with 0.1% gelatin. Subsequently, the cells were transfected with shGABA\u003csub\u003eA\u003c/sub\u003e α1 for 48 hours as described above, followed by treatment with 10 μg/ml LPS. TEER values were obtained every 3 min for 8 h after LPS treatment as an automatically recorded resistance (TEER = R\u003csub\u003eTEER\u0026nbsp;\u003c/sub\u003e× Marea (cm\u003csup\u003e2\u003c/sup\u003e), R\u003csub\u003eTEER\u003c/sub\u003e represents the monolayer cell resistance). The relative TEER values were calculated by dividing actual TEER values at each time point by the initial TEER values.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were carried out using GraphPad Prism 9 to evaluate the data, which are reported as mean ± SD. Group comparisons involved the unpaired Student's t-test for two groups or one-way ANOVA with Tukey's post-hoc test for multiple groups, respectively. Statistical significance was set at P \u0026lt; 0.05.\u003c/p\u003e"},{"header":"3 RESULTS","content":"\u003cp\u003e\u003cstrong\u003e3.1 The expression of GABA receptor genes in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eECs\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;upon LPS stimulation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the expression of GABA receptor genes in\u0026nbsp;ECs, HUVECs were incubated with LPS (10 μg/ml) for 12 hours.\u0026nbsp;\u003cem\u003eGabbr1\u003c/em\u003e, \u003cem\u003eGabbr2\u003c/em\u003e, \u003cem\u003eGabra1\u003c/em\u003e, \u003cem\u003eGabra2\u003c/em\u003e, \u003cem\u003eGabra3\u003c/em\u003e, \u003cem\u003eGabra4\u003c/em\u003e, \u003cem\u003eGabra5\u003c/em\u003e, \u003cem\u003eGabrb1\u003c/em\u003e, \u003cem\u003eGabrb2\u003c/em\u003e, \u003cem\u003eGabrb3\u003c/em\u003e, \u003cem\u003eGabre\u003c/em\u003e, \u003cem\u003eGabrg1\u003c/em\u003e, \u003cem\u003eGabrg2\u003c/em\u003e, \u003cem\u003eGabrg3\u003c/em\u003e, \u003cem\u003eGabrp\u003c/em\u003e, \u003cem\u003eGabrq\u003c/em\u003e, \u003cem\u003eGabrr1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eGabrr2\u0026nbsp;\u003c/em\u003emRNA were analyzed by RT-qPCR. The results revealed that, among the 18 GABAAR genes examined, the expression levels of two GABA receptor genes (GABRA1 and GABRP) and one GABAb receptor gene (GABBR1) were decreased in\u0026nbsp;ECs\u0026nbsp;upon LPS stimulation compared to the control group. In contrast, the expression of GABRA3 and GABRA5 was significantly upregulated following LPS challenge. Notably, the expression level of GABRA1 was the most markedly downregulated after LPS treatment (Figure 1a and b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 The expression of GABA\u003csub\u003eA\u003c/sub\u003e α1 decreased in the PMVECs of septic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistological examination via H\u0026amp;E staining revealed substantial lung injury in the CLP-induced sepsis model, characterized by alveolar hemorrhage, enlargement of airspaces, and infiltration of inflammatory cells. The pathological alterations were markedly more severe than those observed in the sham-operated control group (Figure 2a), confirming the successful establishment of the septic animal model. To investigate the expression pattern of GABA\u003csub\u003eA\u003c/sub\u003e α1 in pulmonary microvascular endothelial cells (PMVECs), we performed immunofluorescence staining on lung sections using a GABA\u003csub\u003eA\u003c/sub\u003e α1-specific antibody. As illustrated in Figure 2b, GABA\u003csub\u003eA\u003c/sub\u003e α1 was found to be co-localized with CD31, an endothelial cell marker. Notably, a significant reduction in GABA\u003csub\u003eA\u003c/sub\u003e α1 expression was detected within PMVECs of septic mice. Collectively, these findings imply a potential role for GABA\u003csub\u003eA\u003c/sub\u003e α1 downregulation in PMVECs during the pathogenesis of sepsis-induced ALI.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 GABA\u003csub\u003eA\u003c/sub\u003e α1 negatively regulates\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eECs\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;inflammation and barrier integrity\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the impact of GABA\u003csub\u003eA\u003c/sub\u003e α1 loss-of-function on inflammatory cytokine expression in LPS-treated HUVECs, we employed lentivirus-mediated RNA interference for targeted gene knockdown in vitro (Figure 3a). The efficiency of GABA\u003csub\u003eA\u003c/sub\u003e α1 depletion was confirmed in HUVECs using quantitative real-time PCR (Figure 3b). Analysis revealed that silencing GABA\u003csub\u003eA\u003c/sub\u003e α1 markedly upregulated the expression of \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eICAM-1\u003c/em\u003e, and \u003cem\u003eVCAM-1\u003c/em\u003e under LPS stimulation (Figure 3c-e). Furthermore, to assess the consequences of GABA\u003csub\u003eA\u003c/sub\u003e α1 knockdown on endothelial barrier function, we monitored transendothelial electrical resistance (TEER) using an electric cell-substrate impedance sensing system following LPS exposure. Notably, while LPS alone reduced TEER values in HUVECs, the additional loss of GABA\u003csub\u003eA\u003c/sub\u003e α1 significantly exacerbated this barrier impairment (Figure 3f).\u003c/p\u003e"},{"header":"4. DISCUSSION","content":"\u003cp\u003eSepsis-induced acute lung injury is fundamentally driven by the catastrophic failure of the pulmonary microvascular barrier(Saguil \u0026amp; Fargo, 2020). Within this pathological framework, our current investigation uncovers an unexpected molecular event: the profound depletion of the γ-aminobutyric acid type A receptor α 1 subunit (GABRA1) in the pulmonary endothelium of septic mice. This in vivo suppression temporally aligns with the onset of lethal pulmonary edema and the loss of tissue homeostasis.\u003c/p\u003e\n\u003cp\u003eClassically, GABAergic signaling is synonymous with central nervous system inhibition, where it dictates neuronal excitability and developmental trajectories(Mohler, 2006; Pontes\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2013). However, emerging paradigms suggest a broader, extraneural footprint for these ionotropic channels. For instance, specific subunits like Gabrb3 have been mapped to periventricular endothelial networks, where their genetic ablation not only perturbs neurobehavioral outcomes but also dysregulates fundamental endothelial processes such as proliferation and angiogenic sprouting(Babij\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2023; Li\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2018; Won\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2013).Building upon this concept of \"endothelial GABAergic signaling,\" we hypothesized that GABRA1 might act as an intrinsic regulator of vascular stability during severe systemic infection.\u003c/p\u003e\n\u003cp\u003eTo mechanistically validate this, we employed lentiviral-mediated depletion of GABRA1 in human endothelial cells. Strikingly, the loss of this receptor dramatically sensitized the endothelium to endotoxemic injury. Upon LPS challenge, GABRA1-deficient cells exhibited an exaggerated inflammatory phenotype, characterized by the hyper-expression of leukocyte adhesion molecules (ICAM-1 and VCAM-1). Furthermore, this molecular hyperactivation translated into severe structural vulnerability, demonstrated by a precipitous decline in TEER.\u003c/p\u003e\n\u003cp\u003eTaken together, these data delineate a previously unrecognized paradigm wherein the loss of endothelial GABRA1 actively drives the immunopathology of sepsis. Rather than being a mere bystander, GABRA1 appears to function as a critical molecular brake, restraining cytokine storms and reinforcing the alveolar-capillary barrier. Consequently, rescuing or augmenting this localized endothelial GABAergic tone may offer a highly innovative therapeutic avenue for mitigating sepsis-associated vascular collapse.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.1 Study limitations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur current findings, while methodologically grounded, carry inherent constraints. The statistical power underpinning our in vivo conclusions would be substantially strengthened by recruiting larger murine cohorts, a step critical to guaranteeing both reproducibility and translational confidence. Furthermore, our genetic manipulation of GABRA1 was restricted to cultured systems; the absence of endothelial-targeted conditional knockout transgenic lines limits our ability to definitively confirm these phenotypes within a complex physiological environment. Additionally, the precise molecular crosstalk driving pathogen-induced endothelial hyperactivation remains incompletely resolved. Future investigations must dissect these mechanisms while explicitly accounting for the profound phenotypic heterogeneity of vascular beds across different organs. Ultimately, pinpointing exactly how this receptor orchestrates microvascular barrier competence will require high-resolution mapping of its downstream signaling cascades.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.2 Conclusions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn conclusion, this study demonstrates that GABA\u003csub\u003eA\u003c/sub\u003e α1 is expressed in PMVECs and is reduced during sepsis. Its knockdown in endothelial cells exacerbated the inflammatory response to LPS, suggesting that enhancing GABA\u003csub\u003eA\u003c/sub\u003e α1 signaling could be a promising strategy for treating infection-induced inflammatory lung injury.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eALI, acute lung injury; LPS,\u0026nbsp;lipopolysaccharide; ECs, endothelial cells;\u0026nbsp;GABA\u003csub\u003eA\u003c/sub\u003e \u0026alpha;1, \u0026gamma;-aminobutyric acid type A receptor \u0026alpha;1; VCAM-1, vascular cell adhesion molecule-1; ICAM-1, intercellular cell adhesion molecule-1; BALF, bronchoalveolar lavage fluid; TNF-\u0026alpha;, tumor necrosis factor-\u0026alpha;; IL-1\u0026beta;, interleukin-1\u0026beta;; IL-6, interleukin-6.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research framework and central hypothesis were jointly formulated by Xiaotao Xu and Aizhong Wang. Shuting Zhou and Xudong He performed the experiments. Shuting Zhou and Xinzhe Ni analysed the data. The initial manuscript was prepared by Shuting Zhou. Xiaotao Xu critically reviewed the manuscript. Every named contributor has thoroughly examined and endorsed the finalized document, assuming collective responsibility for the study's veracity and scientific rigor. We formally commit to transparently addressing any future inquiries concerning the validity or ethical execution of this research. Furthermore, the designated author list strictly reflects individuals meeting established attribution criteria, ensuring no eligible researchers have been omitted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING INFORMATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Natural Science Foundation of Shanghai (Grant No.25ZR1401287).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone declared\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of the present study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number:\u003c/strong\u003e not applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBabij R, Ferrer C, Donatelle A, Wacks S, Buch AM, Niemeyer JE, Ma H, Duan ZRS, Fetcho RN, Che A, Otsuka T, Schwartz TH, Huang BS, Liston C. \u0026amp; De Marco Garcia, N. V. (2023). Gabrb3 is required for the functional integration of pyramidal neuron subtypes in the somatosensory cortex. \u003cem\u003eNeuron\u003c/em\u003e, \u003cem\u003e111\u003c/em\u003e(2), 256\u0026ndash;274 e210.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBusche MA, Kekus M, Adelsberger H, Noda T, Forstl H, Nelken I, Konnerth A. Rescue of long-range circuit dysfunction in Alzheimer's disease models. Nat Neurosci. 2015;18(11):1623\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Xue X, Cai J, Jia L, Sun B, Zhao W. (2021). Protective effect of taurine on sepsis\u0026ndash;induced lung injury via inhibiting the p38/MAPK signaling pathway. Mol Med Rep, \u003cem\u003e24\u003c/em\u003e(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarrant M, Nusser Z. Variations on an inhibitory theme: phasic and tonic activation of GABA(A) receptors. Nat Rev Neurosci. 2005;6(3):215\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuazzi M, Phillips SA, Arena R, Lavie CJ. Endothelial dysfunction and lung capillary injury in cardiovascular diseases. Prog Cardiovasc Dis. 2015;57(5):454\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoffre J, Hellman J, Ince C, Ait-Oufella H. Endothelial Responses in Sepsis. Am J Respir Crit Care Med. 2020;202(3):361\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Kumar TP, Joshee S, Kirschstein T, Subburaju S, Khalili JS, Kloepper J, Du C, Elkhal A, Szabo G, Jain RK, Kohling R, Vasudevan A. Endothelial cell-derived GABA signaling modulates neuronal migration and postnatal behavior. Cell Res. 2018;28(2):221\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacdonald RL, Kang JQ, Gallagher MJ. Mutations in GABAA receptor subunits associated with genetic epilepsies. J Physiol. 2010;588(Pt 11):1861\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohler H. GABA(A) receptor diversity and pharmacology. Cell Tissue Res. 2006;326(2):505\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhkawa Y, Iwata K, Inui N. Screening for skin-tumor promoters. Biomed Pharmacother. 1988;42(7):447\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePontes A, Zhang Y, Hu W. (2013). Novel functions of GABA signaling in adult neurogenesis. Front Biol (Beijing), \u003cem\u003e8\u003c/em\u003e(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrevot TD, Marcotte M, David DJ, Mendez-David I, Mian MY, Cook JM, Guilloux JP, Sibille E. Chronic alpha5-GABA-A Receptor Potentiation Promotes Mouse Adult Hippocampal Neurogenesis. Hippocampus. 2025;35(4):e70019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaguil A, Fargo MV. Acute Respiratory Distress Syndrome: Diagnosis and Management. Am Fam Physician. 2020;101(12):730\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi J, Song S, Wu K, Liang G, Wang A, Xu X. Role of brain-derived neurotrophic factor in endotoxaemia-induced acute lung injury. Exp Physiol. 2023;108(12):1456\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi YW, Zhang Q, Cai K, Poliquin S, Shen W, Winters N, Yi YH, Wang J, Hu N, Macdonald RL, Liao WP, Kang JQ. Synaptic clustering differences due to different GABRB3 mutations cause variable epilepsy syndromes. Brain. 2019;142(10):3028\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinger M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016;315(8):801\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStiernman L, Comasco E, Johansson M, Bixo M. Transcription of GABA(A) receptor subunits in circulating monocytes and association to emotional brain function in premenstrual dysphoric disorder. Transl Psychiatry. 2025;15(1):255.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUnger C, Kohlmeier KA. Pharmacological management of insomnia with a focus on GABA(A) receptor positive allosteric modulators and orexin receptor antagonists. Sleep Med. 2026;139:108743.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWard PA. New approaches to the study of sepsis. EMBO Mol Med. 2012;4(12):1234\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWare LB, Matthay MA. The acute respiratory distress syndrome. N Engl J Med. 2000;342(18):1334\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWon C, Lin Z, Kumar TP, Li S, Ding L, Elkhal A, Szabo G, Vasudevan A. Autonomous vascular networks synchronize GABA neuron migration in the embryonic forebrain. Nat Commun. 2013;4:2149.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-pulmonary-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pulm","sideBox":"Learn more about [BMC Pulmonary Medicine](http://bmcpulmmed.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pulm/default.aspx","title":"BMC Pulmonary Medicine","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"GABAA α1 receptor, Endothelial cells, Acute lung injury","lastPublishedDoi":"10.21203/rs.3.rs-9007304/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9007304/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eVascular hyperpermeability drives the pathogenesis of acute lung injury (ALI) during sepsis. Although γ-aminobutyric acid type A receptors (GABAARs) are classically recognized as central nervous system ion channels, we identified an unexpected, essential requirement for the GABA\u003csub\u003eA\u003c/sub\u003e α 1 subunit (GABRA1) in preserving pulmonary endothelial integrity. Analysis of pulmonary microvascular endothelial cells (PMVECs) isolated from mice with polymicrobial sepsis (CLP) revealed a profound depletion of GABRA1. This suppression was faithfully mirrored in cultured endothelial cells following endotoxin (LPS) challenge. Crucially, targeted silencing of GABRA1 in HUVECs severely aggravated LPS-triggered barrier dysfunction, characterized by a precipitous drop in transendothelial electrical resistance and exaggerated upregulation of adhesion molecules (ICAM-1, VCAM-1). These results re-define GABRA1 as a vital structural gatekeeper in the pulmonary vasculature, offering a non-canonical therapeutic avenue for managing septic endothelial leakage.\u003c/p\u003e","manuscriptTitle":"Activation of endothelial GABA A α1 receptor protects against barrier dysfunction in acute lung injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-17 19:05:57","doi":"10.21203/rs.3.rs-9007304/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-25T08:24:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-19T14:53:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"99706547144492448686739951382581230540","date":"2026-03-19T14:41:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"243652136443386755236055279929156322053","date":"2026-03-18T11:58:12+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-16T05:53:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"334266253106392329113526138987753116974","date":"2026-03-16T05:38:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"55120314950541123560770859685343874748","date":"2026-03-16T02:04:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-15T20:56:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-15T20:53:53+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-10T17:57:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-10T14:30:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Pulmonary Medicine","date":"2026-03-10T10:45:55+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-pulmonary-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pulm","sideBox":"Learn more about [BMC Pulmonary Medicine](http://bmcpulmmed.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pulm/default.aspx","title":"BMC Pulmonary Medicine","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e03b0746-546f-418b-b574-df470da624a4","owner":[],"postedDate":"March 17th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T17:34:17+00:00","versionOfRecord":{"articleIdentity":"rs-9007304","link":"https://doi.org/10.1186/s12890-026-04311-1","journal":{"identity":"bmc-pulmonary-medicine","isVorOnly":false,"title":"BMC Pulmonary Medicine"},"publishedOn":"2026-04-28 15:57:24","publishedOnDateReadable":"April 28th, 2026"},"versionCreatedAt":"2026-03-17 19:05:57","video":"","vorDoi":"10.1186/s12890-026-04311-1","vorDoiUrl":"https://doi.org/10.1186/s12890-026-04311-1","workflowStages":[]},"version":"v1","identity":"rs-9007304","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9007304","identity":"rs-9007304","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}