Neurotropic and non-neurotropic equid alphaherpesvirus 1 (EHV1) mobilize most histones within viral replication compartments

28 Equid alphaherpesvirus 1 (EHV1) is a DNA virus that causes severe disease 29 outcomes in equids. Some EHV1 strains are neurotropic and cause disease in the central 30 nervous system, whereas others are non-neurotropic and can cause negative reproductive 31 outcomes. The molecular mechanisms that govern pathotype of individual EHV1 strains 32 are not understood. However, EHV1 replication in the presence of epigenetic inhibitors 33 suggests that neurotropic and non-neurotropic EHV1 are di\erentially susceptible to 34 epigenetic silencing. Aside from this evidence, little is known about EHV1 chromatin or its 35 regulation. Here, we used fluorescence recovery after photobleaching to characterize 36 EHV1 lytic chromatin dynamics. Infection with neurotropic or non-neurotropic EHV1 37 mobilized all histones. Canonical (H2A, H2B, H3.1, H4) or variant (H2A.B, H2A.Z, H2A.X, 38 macroH2A, H3.3) core and linker H1.2 histones were equally mobilized by either strain. 39 Thus, there were no vast di\erences in histone mobility during neurotropic or non-40 neurotropic EHV1 infection. All histones except for H2A.B were more mobile within EHV1 41 replication compartments (RCs) than the surrounding infected-cell chromatin. The 42 di\erential mobility of histones within domains enriched for viral or cellular chromatin is 43 consistent with distinct mechanisms to assemble and regulate the chromatin associated 44 with viral or host DNA. Histones were further mobilized within RCs in cells in which 45 infection had further progressed. Such mobilization indicates that increased levels of EHV1 46 transcription, DNA replication, or protein expression directly or indirectly mobilize 47 histones. The high histone mobility within EHV1 RCs is consistent with assembly of EHV1 48 genomes in very dynamic and unstable nucleosomes. These data support a model in which 49 EHV1 limits genome silencing by preventing stable chromatin assembly, or destabilizing 50 the chromatin assembled, with viral genomes during lytic infection. We propose that 51 manipulation of histone dynamics represents a novel mechanism of epigenetic regulation 52 adopted by alphaherpesviruses to maintain genome accessibility and prevent gene 53 silencing. 54 55 56 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 3 Author summary 57 DNA viruses are subjected to epigenetic regulation that silences or promotes gene 58 expression. Multiple epigenetic mechanisms contribute to stabilize chromatin to silence 59 gene expression or destabilize it to promote gene expression. Knowledge of the 60 mechanisms whereby viruses prevent or overcome genome silencing and promote 61 expression of their genes is important to understand how viruses, including 62 alphaherpesviruses, take over the host cell to establish productive infection. Here we show 63 that EHV1 broadly mobilizes histones within nuclear domains enriched in viral chromatin. 64 Histone mobilization destabilizes chromatin and is consistent with the assembly of EHV1 65 genomes in dynamic, unstable nucleosomes. The manipulation of histone mobility is a 66 phenomenon first described for the alphaherpesvirus herpes simplex virus 1 (HSV1). The 67 conserved approach to dysregulate chromatin dynamics and mobilize histones represents 68 a unique means whereby herpesviruses destabilize chromatin. Understanding the 69 mechanisms that mobilize histones during infection will increase our general 70 understanding of epigenetic regulation, which is important in the pathogenesis of 71 infectious diseases and also of developmental or genetic ones. Moreover, knowledge of the 72 processes whereby herpesviruses destabilize chromatin will support the development of 73 novel therapeutics to maintain viral genomes in stable, silenced chromatin to prevent 74 productive infection and development of associated diseases. 75 76

77 EHV1 is prevalent and highly infectious (1, 2). It initially infects and establishes 78 primary lytic replication within epithelial cells lining the upper respiratory tract. Infection of 79 monocytes, including CD172a+, recruited to EHV1-infected epithelial cells enables EHV1 to 80 disseminate throughout the body in a cell-associated viremia (3, 4). Subsequent cell-to-81 cell contacts between infected monocytes and endothelial cells lining blood vessels 82 transfers EHV1 to the endothelial cells where it establishes secondary lytic replication (5). 83 This replication causes severe disease outcomes reflective of the a\ected organ(s). 84 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 4 Infection of cells lining vasculature within the central nervous system (CNS), for example, 85 causes neurological symptoms including equine herpes myeloencephalopathy (EHM) (6). 86 Whereas infection of cells lining vasculature within the uterus is associated with negative 87 reproductive outcomes, including abortion and neonatal foal death (6). The molecular 88 mechanisms underlying EHV1 pathotype are not yet well understood. One correlate is a 89 single nucleotide polymorphism in the gene encoding the DNA polymerase (ORF 30) (7). 90 Neurotropic strains typically encode a D at amino acid (a.a.) residue 752, whereas non-91 neurotropic strains typically encode an N (8, 9). However, this polymorphism is not strictly 92 associated with, nor is it predictive, of neurotropism (10-12). Neurotropic EHV1 infection is 93 characterized by more pronounced and extended cell-associated viremia subsequent to 94 increased replication within epithelial cells, greater infection of, and faster replication 95 kinetics within, immune cells, and increased transfer to endothelial cells (3, 13-15). The 96 di\erences between neurotropic and non-neurotropic EHV1 replication may, at least in 97 part, relate to chromatin regulation of viral gene expression. Within CD172a+ cells, 98 neurotropic EHV1 strains are less sensitive to chromatin-mediated gene silencing than are 99 non-neurotropic ones (13, 14). However neurotropic strains are sensitive to chromatin-100 mediated gene silencing within epithelial cells (16). To understand how chromatin 101 regulation of EHV1 gene expression contributes to replication kinetics, and potentially 102 strain pathotype, more knowledge of EHV1 chromatin is required. 103 Chromatin physically and functionally regulates DNA access for gene expression. 104 The basic unit of chromatin is the nucleosome, a core histone octamer composed of two 105 molecules each of histones H2A, H2B, H3, and H4 wrapped in approximately 147bp of DNA 106 (17). Linker H1 histones bind to the DNA at nucleosome entry-exit sites to stabilize and 107 compact chromatin. Histone-histone and histone-DNA interactions within and between 108 nucleosomes regulate chromatin stability and compaction to control DNA access. 109 Stabilization of such interactions promotes chromatin compaction to decrease DNA 110 accessibility, whereas their destabilization promotes decompaction to increase DNA 111 accessibility. Multiple factors contribute to regulate nucleosome stability, including the 112 association of chromatin-binding or -regulatory proteins, posttranslational modifications 113 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 5 (PTMs) of the histones assembled in nucleosomes, and the assembly of histone variants 114 within nucleosomes. Histones are broadly categorized as canonical or variant based on 115 their cell-cycle-related expression and primary mechanism of chromatin assembly (18-20). 116 Variant histones have unique a.a. sequences that structurally impact nucleosome stability 117 and functionally provide alternate residues for PTMs or interactions with other chromatin-118 regulatory or -binding proteins (21, 22). Histones H2A and H3 have distinct variants 119 whereas H2B and H4 have no somatic variants in equids. 120 Histone H2A has the most numerous and diverse somatic variants. H2A.X most 121 resembles canonical H2A, with 82% sequence identity. Even so, H2A.X-containing 122 nucleosomes are less stable than H2A-containing ones due to increased DNA unwrapping 123 at nucleosome entry-exit sites (23). H2A.X is well characterized for its role in the DNA 124 damage response (DDR), where its phosphorylated form (g-H2A.X) further destabilizes 125 nucleosomes and decreases H1 association to facilitate DNA access for repair (23). H2A.Z 126 shares only 60% sequence identity with canonical H2A and structurally di\ers in several 127 key regions that decrease nucleosome stability and increase DNA unwrapping at 128 nucleosome entry-exit sites (24). Consequently, H2A.Z-containing nucleosomes are also 129 more unstable and accessible than H2A-containing ones (24, 25). H2A.Z regulates 130 chromatin for multiple cellular processes, including transcription, heterochromatin 131 formation and maintenance, DNA repair, and DNA replication(26). MacroH2A is a more 132 distinct variant that is only 64% similar to H2A in its amino (N)-terminus and has an 133 additional unique linker region connecting a macrodomain to its carboxyl (C)-terminus. 134 MacroH2A mediates stronger intranucleosomal interactions to increases nucleosome 135 stability, compaction, and inaccessibility (27-29). Consequently, macroH2A nucleosomes 136 repress transcription and stabilize heterochromatin (30-32). H2A.B (H2A.Bbd) is the most 137 divergent variant and shares only 48% sequence identity with canonical H2A. The H2A C-138 terminus and docking domain are truncated in H2A.B and it has a unique N-terminal 139 arginine-rich region (33, 34). H2A.B nucleosomes wrap only 118bp of DNA, have weaker 140 intranucleosomal interactions, and undergo transient DNA unwrapping at nucleosome 141 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 6 entry-exit sites (34-36). H2A.B nucleosomes are therefore highly unstable and accessible, 142 and are enriched in regions of high transcriptional activity and DNA synthesis (37-40). 143 H3 has two somatic variants, H3.3 and centromere-specific CENPA (centromeric 144 protein A; CenH3). H3.3 is more than 96% identical to canonical H3.1 and H3.2, di\ering by 145 only 5 or 4 a.a., respectively. H3.3 nucleosomes have similar stability as those assembled 146 with canonical H3, however, H3.3 synergizes with co-assembled H2A variants, such as 147 H2A.Z, to further regulate nucleosome stability and DNA association (25). H3.3 148 accumulates in transcriptionally active regions and telomeric heterochromatin (41-43). The 149 more diverse CENPA is assembled in centromeric nucleosomes and shares only 45% 150 sequence identity with canonical H3 (44). CENPA nucleosomes loosely wrap only 121bp of 151 DNA, have transient DNA unwrapping at nucleosome entry-exit sites, and form an 152 untwisted chromatin structure to increase CENPA-nucleosome accessibility and instability 153 (45-47). 154 Histones continually exchange within chromatin to facilitate structural and 155 functional regulation of chromatin at any given locus. Intrinsic histone exchange generally 156 relates to their stability of association within chromatin. For example, H1 chromatin 157 exchange is the fastest, while H2A-H2B dimers peripheral in the nucleosome undergo 158 faster exchange than the H3-H4 dimers central in the nucleosome (48-58). For any given 159 histone type, variants have inherently distinct exchange rates consistent with their e\ects 160 on nucleosome stability such that destabilizing histones typically exchange faster than 161 stabilizing ones (24). Nonetheless, even stabilizing histones assembled in condensed 162 chromatin undergo exchange. Histone exchange is also regulated by external factors, 163 including PTMs of the histones assembled in nucleosomes, the association of chromatin-164 interacting or -regulatory proteins, and processes that require DNA access (59). 165 Nucleosomes are partially or fully disassembled to enable DNA access and are then 166 reassembled. Processes such as transcription that require access to the DNA therefore 167 enhance histone exchange. Highly transcriptionally active chromatin regions have very fast 168 rates of histone exchange to accommodate the DNA accessibility necessary for high levels 169 of transcription. Accordingly, the most transcriptionally active chromatin, including 170 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 7 nucleolar chromatin, is assembled in highly dynamic and unstable nucleosomes. Such 171 dynamic chromatin is challenging to study due to inherent nucleosome instability and 172 associated DNA hyperaccessibility. Consequently, the most dynamic and accessible 173 chromatin appears as “nucleosome free” when evaluated by most common chromatin 174 interrogation methods. 175 Histone exchange (chromatin dynamics) informs on viral chromatin. For example, 176 the alphaherpesvirus HSV1 broadly dysregulates histone exchange. With exception of 177 H2A.B, all evaluated linker and core histones are mobilized (have increased exchange) 178 during lytic HSV1 infection (48-51, 60). Mobilization of histones from the cellular chromatin 179 provides a source for the histones that assemble in HSV1 chromatin and also relates to 180 composition of the viral chromatin (50, 51). Histones are most mobile within HSV1 181 replication compartments (RCs), which are nuclear domains enriched in viral chromatin 182 (60). The high mobility of histones within HSV1 RCs is consistent with the assembly of viral 183 genomes in highly dynamic, unstable, and accessible chromatin. Thus, measured histone 184 mobility relates to the remarkable hyperaccessibility of the unique chromatin assembled 185 with lytic HSV1 genomes (51, 61-64). 186 To initiate our investigation of EHV1 chromatin, we used fluorescence recovery after 187 photobleaching (FRAP) as it is the only technique to directly measure histone mobility. 188 Infection with neurotropic or non-neurotropic (abortogenic) EHV1 equally mobilized all 189 evaluated canonical (H2A, H2B, H3.1, and H4) and variant (H2A.Z, H2A.X, H2A.B, 190 macroH2A, and H3.3) core histones and linker histone H1.2. We show that all histones 191 except for H2A.B were most mobile within nuclear domains enriched for EHV1 chromatin, 192 the RCs. Mobilization of histones within RCs altered their chromatin residency to increase 193 the net level of histones unbound from chromatin at any given time. Moreover, mobilization 194 increased histone low-a\inity chromatin exchange. The degree of histone mobilization 195 within RCs apparently related to infection progression as histones were more mobile within 196 medium- to large-sized ones than within small ones. Furthermore, within medium- to large-197 sized RCs histones were more mobile than within the nucleoli of mock-infected cells. 198 These data indicate that lytic EHV1 chromatin is more dynamic or unstable than nucleolar 199 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 8 chromatin, which is considered most unstable. Although histones were primarily mobilized 200 within domains enriched for viral chromatin, H2A, H3.3, and H4 were also mobilized, albeit 201 to a lesser degree, within the cellular chromatin surrounding EHV1 RCs. Conversely, linker 202 histone H1.2 was less mobile within the infected-cell chromatin. Histone mobilization is a 203 novel consequence of alphaherpesvirus infection that represents a unique and conserved 204 chromatin regulatory mechanism to destabilize viral chromatin. 205 206

207 EHV1 mobilizes core histones H2B and H4 . 208 We first evaluated mobility of core histones H2B and H4 as they have no somatic 209 variants in equids that could be di\erentially mobilized by infection. Furthermore, H2B 210 represents the more mobile H2A-H2B heterodimers flanking the nucleosome, while H4 211 represents the more stable H3-H4 heterodimers central to the nucleosome (17, 57). 212 Transiently expressed GFP-H2B or -H4 had distinct granular localization with areas 213 relatively enriched or depleted for GFP , consistent with GFP-histone assembly in chromatin 214 (Fig 1, Mock). Most cells had nucleoli depleted for GFP-H2B or -H4, consistent with 215 nucleolar chromatin instability (33, 65, 66). In cells infected with either abortogenic or 216 neurotropic EHV1, viral RCs were evident as nuclear domains generally depleted for GFP-217 H2B or -H4, similar to the reported depletion of histones within HSV1 RCs (Fig 1, EHV1) (49, 218 60). As expected for field isolated strains, infection progression, as evaluated by RC 219 number and size, was variable. Most infected cells had GFP-H2B or -H4 depleted regions 220 clearly identifiable as RCs by size or shape (Fig 1, EHV1 “Large RC”; S1 Table). However, 221 some infected cells had smaller GFP-H2B or -H4 depleted regions that more resembled the 222 depleted regions within mock-infected cells (Fig 1, EHV1 “Small RC”). Regardless of the 223 number or size of EHV1 RCs, nucleoli remained as discrete GFP-H2B or -H4 depleted 224 domains. 225 We evaluated histone dynamics at 5 hours after infection when most cells had 226 identifiable RCs of various sizes (S1 Table). Thus, we evaluated histone mobility in a 227 heterogeneous population of infected cells with variable levels of viral transcription, IE 228 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 9 (immediate early), E (early), or L (late) protein expression, and DNA replication. As a 229 surrogate measure for EHV1 chromatin dynamics, we measured histone mobility within 230 RCs, as these nuclear domains are enriched for viral chromatin (Fig 2A). We also measured 231 histone mobility within regions of infected-cell chromatin to test the e\ect, if any, of 232 infection on cellular chromatin dynamics (Fig 2A). EHV1 RCs are highly transcriptionally 233 active domains, therefore, as a comparator for histone dynamics within a transcriptionally 234 active nuclear domain we measured histone mobility within mock-infected nucleoli (Fig 235 2A). Equal volume areas were selected for photobleaching within mock-infected nucleoli 236 and the surrounding cell chromatin of the same mock-infected cell, or within an EHV1 RC 237 and the surrounding infected-cell chromatin of the same EHV1-infected cell (Fig 2A). 238 Fluorescence recovery within the photobleached regions, which represents GFP-histone 239 mobility, was then measured over time. Most core histones are typically stably assembled 240 in chromatin and their exchange occurs in the magnitude of hours (49-51, 57, 58, 60, 67, 241 68). This histone population is unlikely to undergo chromatin exchange in a timescale 242 relevant for assembly in lytic EHV1 chromatin. However, smaller populations of core 243 histones are, at any given time, not assembled in chromatin and available within the freely 244 di\using histone pool, or more transiently associated with chromatin and undergoing fast 245 chromatin exchange (Fig 2B). We therefore measured histone mobility with a focus on 246 these dynamic histone populations most likely available to assemble in lytic EHV1 247 chromatin (Fig 2B). 248 GFP-H4 fluorescence recovered faster within mock-infected nucleoli than within the 249 surrounding cellular chromatin (Fig 3). Thus, as expected, GFP-H4 was more mobile within 250 nucleoli where the highly transcribed and unstable nucleolar chromatin is. Infection with 251 abortogenic or neurotropic EHV1 mobilized GFP-H4 such that fluorescence recovered 252 faster in infected- than in mock-infected cell chromatin (Fig 3). Moreover, GFP-H4 253 fluorescence recovered even faster within the EHV1 RCs than within the surrounding 254 infected-cell chromatin (Fig 3). These data show that EHV1 infection globally mobilized H4 255 and mobilized it to a greater degree in nuclear domains enriched for viral chromatin. H4 256 was more mobile within RCs than within mock-infected nucleoli, suggesting that H4 257 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 10 interactions in EHV1 chromatin are more dynamic or unstable than its interactions in 258 nucleolar chromatin. 259 GFP-H2B or -H4 were similarly mobilized during infection with abortogenic or 260 neurotropic EHV1 (Fig 3; data not shown). Given the heterogeneity of infection progression 261 with field isolated strains, we considered that the levels of EHV1 transcription, protein 262 expression, DNA replication, or cellular responses to them, may a\ect H2B or H4 mobility. 263 We therefore pooled the infected cell FRAP data for each histone and then segregated it by 264 the presence or absence of identifiable RCs rather than by infecting strain. Cells with GFP-265 H2B or -H4-depleted regions identifiable as RCs by shape or size were grouped as “large” 266 RC, whereas cells with depleted regions that more resembled mock-infected cells were 267 grouped as “small” RC (for examples see Fig 1). Seventy-six or 70% of GFP-H2B expressing 268 cells or 77 or 67% of GFP-H4 expressing ones infected with abortogenic or neurotropic 269 EHV1, respectively, had identifiable “large” RCs (S1 Table). 270 Fluorescence recovery of GFP-H2B or -H4 was still enhanced within “small” RCs, 271 although fluorescence recovered slower within these domains than within mock infected 272 nucleoli (Fig 4A). Fluorescence recovery in the surrounding infected-cell chromatin was 273 also slower, and similar to that within the mock-infected cell chromatin (Fig 4A). GFP-H2B 274 or -H4 fluorescence recovery was most enhanced within the “large” RCs, where it 275 recovered much faster than within mock-infected nucleoli (Fig 4B). Mobilization of H2B or 276 H4 in cells with “large” RCs also mobilized these histones within the surrounding infected-277 cell chromatin such that fluorescence recovered faster than it did within the mock-infected 278 cell chromatin (Fig 4B). 279 These data show that EHV1 mobilized H2B and H4. These histones were more 280 mobile within RCs, illustrating that H2B and H4 were most dynamic within nuclear domains 281 enriched for viral chromatin. H2B and H4 were mobilized to a greater degree in RCs of cells 282 in which infection was further progressed. Therefore, increased levels of EHV1 283 transcription, IE, E, or L protein expression, or DNA replication may directly or indirectly 284 enhance H2B and H4 mobility. Within “large” RCs, H2B and H4 were more mobile than 285 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 11 within mock-infected nucleoli, suggesting that EHV1 chromatin may be more dynamic or 286 unstable than nucleolar chromatin. 287 288 The most dynamic H2B and H4 populations are mobilized by EHV1. 289 To investigate the H2B and H4 histone populations mobilized during EHV1 infection, 290 we examined GFP-H2B and -H4 fluorescence recovery kinetics. As a surrogate measure for 291 the histones not assembled in chromatin and freely di\using in the nucleoplasm (the “free” 292 pool), we used the first value after photobleaching (Fig 2B). Only freely di\using histones 293 can move into photobleached regions within this time frame. In mock-infected cells, 294 nucleolar H2B or H4 free pools were 160 ± 4% or 172 ± 5%, respectively, of the free pools 295 within the surrounding cellular chromatin, consistent with the dynamic instability of 296 nucleolar chromatin (P<0.01; Fig 5A, Table 1). Within infected cells, H2B or H4 free pools 297 tended to increase within domains enriched for infected-cell chromatin, to 111 ± 3% or 114 298 ± 3%, respectively, of their levels within the mock-infected cell chromatin (P=ns or <0.01, 299 respectively; Fig 5A, Table 1). However, H2B or H4 free pools increased to a greater degree 300 in domains enriched for viral chromatin. In “small” RCs, free H2B or H4 levels increased to 301 133 ± 6% or 144 ± 8%, respectively, relative to mock-infected cell chromatin (P<0.01; Fig 302 5A, Table 1). Free H2B or H4 pools increased even further within “large” RCs, to 217 ± 6% or 303 234 ± 6%, respectively (P<0.01; Figure 5A, Table 1). The levels of free H2B or H4 within 304 “large” RCs were significantly greater than within mock-infected nucleoli, further 305 supporting that H2B and H4 are most dynamic within “large” EHV1 RCs (P<0.01; Fig 5A, 306 Table 1). 307 It was possible that a subpopulation of infected cells increased their H2B or H4 free 308 pools by an extreme degree while others had little to no change. We therefore evaluated the 309 level of free H2B or H4 per individual cell. The frequency distribution of free H2B or H4 310 within the cell chromatin of each individual EHV1- or mock-infected cell were unimodal 311 and largely overlapped, consistent with the similar average levels of H2B or H4 in their free 312 pools (Fig 5A, B). The frequency distribution of free H2B or H4 within “small” or “large” RCs 313 per individual cell were also unimodal, indicating that H2B and H4 free pools increased 314 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 12 within RCs throughout the infected cell population (Fig 5B). Consistent with the average 315 increases in H2B or H4 free pools within “small” or “large” RCs, their frequency 316 distributions shifted to the right relative to that of mock-infected cell chromatin (Fig 5B). 317 Most of the “small” RCs evaluated had free H2B or H4 levels greater than one standard 318 deviation (SD) above their average levels within mock-infected cell chromatin (67 or 77% of 319 cells, respectively; Fig 5B, Table 1). The free pools of H2B or H4 increased by an extreme 320 degree (>1SD above the mock-infected cell chromatin average) in all evaluated “large” RCs 321 (Fig 5B, Table 1). Furthermore, 70% or 68% of cells had H2B or H4 free pools within “large” 322 RCs greater than 1SD above their average levels within mock-infected nucleoli. 323 To ensure that H2B or H4 free pools were not increased due to GFP-H2B or -H4 324 expression levels, the level of free histone per individual cell was plotted relative to its total 325 nuclear fluorescence intensity prior to photobleaching (Fig 5C). Free H2B or H4 levels in 326 any evaluated nuclear domain of either mock- or EHV1-infected cells did not correlate with 327 total nuclear fluorescence. Thus, H2B or H4 free pools within nuclear domains enriched for 328 viral, nucleolar, or cellular chromatin were independent of the overall GFP-histone 329 expression levels. 330 EHV1 mobilization of H2B or H4 caused a net increase in their free pools within RCs 331 and the H4 free pool within the infected-cell chromatin. To identify whether infection also 332 a\ected H2B or H4 low-a\inity chromatin turnover (fast chromatin exchange) we next 333 evaluated their initial normalized fluorescence recovery rates (Fig 2B). H2B or H4 fast 334 chromatin exchange tended to increase within “small” RCs (to 153 ± 37% or 154 ± 18%, 335 respectively), although these rates were not significantly di\erent from those within mock-336 infected cell chromatin (Fig 5D, Table 2). Nonetheless, 30 or 55% of cells had an extreme 337 increase in H2B or H4 fast chromatin exchange within “small” RCs (>1SD higher than the 338 mock-infected cell chromatin average), which is larger than expected in a normal 339 population were they not mobilized (Fig 5E, Table 2). The fast chromatin exchange of H2B or 340 H4 further increased within “large” RCs (to 281 ± 35% or 304 ± 20%, respectively; P1SD above the mock-343 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 13 infected cell chromatin average) in 56 or 84% of cells, respectively (Fig 5E, Table 2). H4 344 mobilization within EHV1-infected cells also a\ected its fast chromatin exchange within 345 the surrounding infected-cell chromatin, where it increased to 187 ± 11% (P<0.01; Fig 5D, 346 E, Table 2). 347 To investigate whether EHV1 also mobilized those histones more stably assembled 348 in chromatin, we next evaluated slow normalized fluorescence recovery (Fig 2B). This 349 analysis revealed that the high-a\inity (stable) chromatin interactions of H2B and H4 were 350 largely una\ected during infection. The H2B or H4 slow chromatin exchange rates tended 351 to increase within RCs (to 144 ± 16% or 127 ± 12%, respectively), however, these rates were 352 not significantly di\erent from those within mock-infected cell chromatin (Fig 5F , G, Table 353 3). Thus, EHV1 infection primarily mobilized H2B and H4 by increasing their low-a\inity 354 chromatin turnover and free pools. These most mobile histone populations would be 355 available to assemble in, and exchange with, EHV1 chromatin on a timescale relevant to 356 lytic infection. 357 Together these data show that H2B and H4 were mobilized to the greatest degree 358 within nuclear domains enriched for EHV1 chromatin. Mobilization altered H2B and H4 359 chromatin residency to cause a net increase in their free pools and increased their rates of 360 low-a\inity chromatin exchange. H2B and H4 were mobilized to a greater degree within the 361 RCs of cells in which infection had further progressed, suggesting that higher levels of 362 EHV1 DNA replication, transcription, protein expression, or cellular responses to them 363 further mobilize H2B or H4. Infection also mobilized H4, but not H2B, within the infected-364 cell chromatin by increasing its free pool and low-a\inity turnover. EHV1 did not 365 significantly mobilize populations of H2B or H4 more stably bound in chromatin and 366 undergoing slow chromatin exchange. Thus, EHV1 further mobilized the dynamic histone 367 populations most likely available to assemble in lytic viral chromatin. 368 369 EHV1 mobilizes canonical H3.1 and variant H3.3 histones. 370 We next measured canonical H3.1 and variant H3.3 mobility to test whether EHV1 371 di\erentially mobilizes particular histone types (as does HSV1) (50, 60, 61). GFP-H3.1 or -372 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 14 H3.3 had discrete granular localization consistent with chromatin regions relatively 373 enriched or depleted for either histone and they were relatively depleted from nucleoli 374 (Figure 6). Due to less pronounced H3.1 depletion from nucleoli and other nuclear 375 domains, it generally appeared more di\use than H3.3 (Fig 6). In most infected cells, H3.1 376 or H3.3 were largely depleted from EHV1 RCs. However, some cells had less pronounced 377 depletion of GFP-H3.1 or -H3.3 from “large” RCs relative to the surrounding infected-cell 378 chromatin. Moreover, a minor subpopulation of cells had di\use GFP-H3.1 or -H3.3, with 379 relative depletion of either histone only apparent from nucleoli (Fig 6 EHV1 “Di\use”; S1 380 Table). 381 EHV1 infection mobilized H3.1 and H3.3 within RCs, where the viral chromatin is 382 enriched (S2 Fig). Free H3.1 or H3.3 pools increased to 175 ± 7% or 237 ± 7%, respectively, 383 within “large” RCs (P1SD above the mock-385 infected cell chromatin average) in 81 or 99% of cells, respectively (Fig 7A, B, Table 1). 386 Moreover, H3.1 or H3.3 free pools within “large” RCs were significantly greater than those 387 within mock-infected nucleoli (144 ± 5% or 176 ± 6%, respectively; P<0.01), and 34 or 52% 388 of cells had free pools more than 1SD above the average levels within mock-infected 389 nucleoli (Fig 7A, B, Table 1). Such high levels of free H3.1 or H3.3 within “large” RCs were 390 not consequent to GFP-histone expression levels (Fig 7C). 391 Although H3.1 and H3.3 were mobilized within “large” RCs, neither histone was 392 substantially mobilized within “small” ones. H3.1 or H3.3 free pools only tended to 393 increase within “small” RCs (to 117 ± 4% or 119 ± 7%, respectively; P=ns; Fig 7A, B). 394 Infection also did not substantially mobilize H3.1 or H3.3 within the infected-cell 395 chromatin. Only the H3.3 free pool increased, to 129 ± 5%, within the cell chromatin 396 surrounding “large” RCs (P<0.05; Fig 7A, B, Table 1). 397 It was not possible to discern nuclear domains likely to be enriched for viral- or cell-398 chromatin within cells with di\use H3.1 or H3.3. Therefore, H3.1 or H3.3 mobility within 399 these cells represents their net mobility due to cell- and EHV1- chromatin dynamics. H3.1 400 or H3.3 were nonetheless mobilized within these cells. Mobilization increased H3.1 or H3.3 401 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 15 free pools to 256 ± 12% or 270 ± 9%, respectively, which were significantly larger than their 402 free pools within “large” RCs (P<0.01; Fig 7A, B, Table 1). This extreme increase to H3.1 or 403 H3.3 free pools occurred throughout this cell population and did not correlate with overall 404 GFP-histone expression levels (Fig 7B, C). Thus, H3.1 and H3.3 were most mobilized within 405 infected cells with di\use H3. 406 Mobilization of H3.1 and H3.3 within “large” RCs and cells with di\use H3 altered 407 their chromatin residency to cause a net increase in their free pools. In cells with di\use 408 H3.1 or H3.3 this was accompanied by increased fast chromatin exchange (373 ± 36% or 409 502 ± 40%, respectively, P<0.01; Fig 7D, E, Table 2). In contrast, only H3.3 fast chromatin 410 exchange increased (to 260 ± 40%; P<0.05), while that of H3.1 was not significantly altered 411 (155 ± 18%), within “large” RCs (Fig 7D, E, Table 2). However, analysis of the H3.3 fast 412 chromatin exchange rate per individual cell revealed that H3.3 fast chromatin exchange 413 only increased in “large” RCs within a minor subpopulation of cells (23% of cells had a rate 414 >1SD above the mock-infected cell chromatin average; Fig 7E, Table 2). Thus, most cells 415 did not have increased H3.3 fast chromatin exchange within “large” RCs. These data show 416 that H3.1 and H3.3 are di\erentially mobilized in “large” RCs or cells with di\use H3 and 417 suggest that di\erent mechanisms contribute to increase H3.1 or H3.3 free pools within 418 either. 419 In summary, EHV1 did not particularly mobilize H3.1 or H3.3 within “small” RCs or 420 domains enriched for infected-cell chromatin. Only H3.3 was partially mobilized within the 421 cell chromatin surrounding “large” RCs. EHV1 did, however, mobilize canonical H3.1 and 422 variant H3.3 histones within “large” RCs and cells with di\use H3. This mobilization caused 423 a net increase in H3.1 and H3.3 free pools. However, mobilization di\erentially a\ected 424 H3.1 and H3.3 fast chromatin exchange. Whereas the fast chromatin exchange of H3.1 and 425 H3.3 increased within cells with di\use H3, only H3.3 fast chromatin exchange increased 426 within “large” RCs and only in a minor subpopulation of cells. Thus, the free pools of H3.1 427 and H3.3 predominantly increased within “large” RCs without substantial alteration to their 428 fast chromatin exchange. 429 430 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 16 H3.3 is mobilized to a greater degree than H3.1 in EHV1 “large” RCs. 431 H3.1 and H3.3 were mobilized within “large” RCs and in cells with di\use H3. In 432 these cells, H3.3 appeared mobilized to a greater degree than H3.1, at least relative to their 433 respective mobilities within mock-infected cell chromatin (Fig 7A, D). H3.3 may thus be 434 more susceptible to histone mobilizing factors or, alternatively, H3.1 may have higher 435 intrinsic mobility and therefore lower potential magnitude for mobilization. To investigate 436 these possibilities, we evaluated mobilization of H3.3 relative to H3.1 (S2 Fig, S2 Table). 437 Surprisingly, H3.3 was less mobile than H3.1 in mock-infected cell chromatin. H3.3 had a 438 relatively smaller free pool and slower fast chromatin exchange than H3.1 (85 ± 5% or 60 ± 439 10%, respectively, P<0.05; S2 Fig; S2 Table). Within nucleoli, however, H3.1 and H3.3 free 440 pools were similar, despite significantly slower H3.3 fast chromatin exchange (56 ± 7% that 441 of H3.1, P<0.01; S2 Fig, S2 Table). These data indicate that EDerm cells have a dynamic 442 population of H3.1 that is intrinsically more mobile than H3.3. 443 Infection mobilized H3.1 and H3.3 such that H3.3 free pools increased significantly 444 relative to those of H3.1 within “large” RCs or cells with di\use H3 (113 ± 3%, P<0.01 or 112 445 ± 3%, P<0.05, respectively; S2 Fig, S2 Table). H3.3 average fast chromatin exchange also 446 increased by a greater magnitude than H3.1 in “large” RCs (260 ± 40% vs 155 ± 18%) and 447 cells with di\use H3 (502 ± 40% vs 373 ± 26%; Fig 7D, E). However, this resulted in relatively 448 similar H3.3 and H3.1 fast chromatin exchange rates (S2 Fig, S2 Table). 449 Together these data show that a population of H3.1 is inherently more mobile than 450 H3.3 within EDerm cell chromatin, with a larger unbound population and faster low-a\inity 451 chromatin exchange. In “large” RCs H3.3 was mobilized by a greater magnitude, and in 452 di\use cells H3.3 fast chromatin exchange increased by a greater magnitude. This 453 mobilization resulted in relatively larger free pools of H3.3 than H3.1, despite relatively 454 similar fast chromatin exchange. H3.3 may thus be more susceptible to histone mobilizing 455 factors within “large” RCs or cells with di\use H3. Furthermore, the relatively larger H3.3 456 free pool suggests that mobilizing factors may preferentially evict H3.3 from, or prevent it 457 from binding in, EHV1 chromatin. 458 459 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 17 EHV1 mobilizes canonical H2A and variant H2A.Z, H2A.X, and macroH2A. 460 Canonical H3.1 and variant H3.3 were di\erentially mobilized during EHV1 461 infection. To further interrogate whether EHV1 preferentially mobilizes particular histone 462 types we next evaluated mobility of canonical H2A and variant H2A.Z, H2A.X, and 463 macroH2A during EHV1 infection (the uniquely mobile H2A.B variant is presented and 464 discussed below). GFP-H2A, -H2A.Z, -H2A.X, and -macroH2A had discrete granular 465 nuclear localization consistent with their assembly in chromatin (Fig 8). Regions of varying 466 fluorescence intensity marked chromatin regions relatively enriched or depleted for each 467 histone (Fig 8). The evaluated H2A variants and canonical H2A were typically largely 468 depleted from nucleoli, although H2A and H2A.Z often had larger nucleolar pools (less 469 depletion) than H2A.X or macroH2A (Fig 8). Consistent with other evaluated core histones, 470 H2A, H2A.Z, H2A.X and macroH2A were also largely depleted from EHV1 RCs (Fig 8). 471 Histone H2A variants are the most numerous and functionally diverse to regulate 472 nucleosome stability and DNA accessibility. FRAP analysis revealed that, as expected, 473 canonical and variant GFP-H2A fusion proteins had distinct mobilities within the cell 474 chromatin that corresponded to their e\ects on nucleosome stability (S3 Fig)(24, 58). GFP-475 H2A.Z was the most mobile variant with a significantly larger free pool and increased fast 476 chromatin exchange relative to canonical H2A (116 ± 3% and 144 ± 12%, respectively, 477 P<0.01; S3 Fig, S2 Table). Conversely, GFP-macroH2A was the least mobile variant. Its free 478 pool or fast chromatin exchange, however, were not significantly di\erent from those of 479 canonical H2A (91 ± 3% or 95 ± 10%, respectively; S3 Fig, S2 Table). H2A, H2A.Z, H2A.X, 480 and macroH2A were all more mobile within nucleoli and, surprisingly, were similarly 481 mobile within this domain (Fig 9, S3 Fig, S2 Table). Only the macroH2A fast chromatin 482 exchange rate was relatively slower than that of H2A within nucleoli (76 ± 7%, P<0.05; S3 483 Fig, S2 Table). 484 Infection mobilized H2A, H2A.Z, H2A.X, and macroH2A within EHV1 RCs (Fig 9, S3 485 Fig). In “small” RCs, H2A, H2A.Z, H2A.X, or macroH2A free pools increased to 127 ± 6%, 486 147 ± 8%, 169 ± 9%, or 147 ± 8%, respectively (P<0.01, except H2A P<0.05; Fig 9A, Table 1). 487 This equated to an extreme increase in free pool levels within the “small” RCs of more than 488 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 18 50% of cells. H2A, H2A.Z, H2A.X, and macroH2A were further mobilized within “large” RCs, 489 where their free pools increased to 238 ± 5%, 215 ± 5%, 229 ± 6%, or 233 ± 6%, respectively 490 (P<0.01; Fig9 A, Table 1). This corresponded to an extreme increase in free pools within 491 “large” RCs throughout the entire infected cell population (Fig 9A, B, Table 1). Moreover, 492 greater than 70% of cells had canonical or variant H2A free pools within “large” RCs greater 493 than 1SD above their average levels within mock-infected nucleoli. Consistently, H2A, 494 H2A.Z, H2A.X, and macroH2A free pools within “large” RCs were significantly greater than 495 those within mock-infected nucleoli. These data indicate that H2A, H2A.Z, H2A.X, and 496 macroH2A association in EHV1 chromatin is more dynamic or unstable than their 497 association in nucleolar chromatin, further in support of the dynamic instability of EHV1 498 lytic chromatin. 499 EHV1 mobilization of H2A, H2A.Z, H2A.X, and macroH2A within “small” or “large” 500 RCs resulted in a net increase in their free pools within RCs throughout the infected cell 501 population. In “small” RCs, canonical or variant H2A free pools increased without 502 substantially a\ecting their fast chromatin exchange (Fig 9C, D, Table 2). Only H2A.X fast 503 chromatin exchange increased within “small” RCs in a minor subpopulation of cells, shown 504 by the bimodal frequency distribution of the H2A.X initial fluorescence recovery rate per 505 individual cell (Fig 9D, Table 2). Mobilization of canonical or variant H2A within “large” RCs, 506 however, did increase their fast chromatin exchange. H2A, H2A.Z, H2A.X, or macroH2A fast 507 chromatin exchange increased to 357 ± 27%, 263 ± 25%, 212 ± 14%, or 210 ± 26%, 508 respectively, within “large” RCs (P<0.01; Fig 9C, D, Table 2). Thus, mobilization of H2A, 509 H2A.Z, H2A.X, and macroH2A within “large” RCs resulted from changes in their chromatin 510 residency and low-a\inity chromatin exchange, whereas mobilization in “small” RCs 511 primarily a\ected their chromatin residency. 512 While variant and canonical H2A were mobilized within domains enriched for EHV1 513 chromatin, they were not significantly mobilized within domains of infected-cell chromatin. 514 Free H2A, H2A.Z, H2A.X, or macroH2A pools were similar in EHV1- and mock-infected cell 515 chromatin (Fig 9A, B, Table 1). Moreover, with exception of canonical H2A, their fast 516 chromatin exchange rates were also largely unaltered. H2A fast chromatin exchange 517 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 19 increased to 202 ± 12% in the cell chromatin surrounding “large” RCs (P<0.01; Fig 9C, D, 518 Table 2). 519 In summary, EHV1 mobilized H2A, H2A.Z, H2A.X, and macroH2A. These histones 520 were primarily mobilized within nuclear domains enriched for EHV1 chromatin (RCs). 521 Mobilization increased their free pools within “small” and “large” RCs but only increased 522 their fast chromatin exchange within “large” ones. These results are consistent with 523 di\erent mechanisms to increase free pools within “small” or “large” RCs. In contrast, only 524 canonical H2A was mobilized within infected-cell chromatin, and only within cells 525 containing “large” RCs. In this case, mobilization increased its fast chromatin exchange 526 without altering its free pool. 527 528 Variant and canonical H2A histones are diHerentially mobilized by EHV1. 529 H2A, H2A.Z, H2A.X, and macroH2A were mobilized within EHV1 RCs relative to their 530 intrinsic mobility within mock-infected cell chromatin. As it was possible that particular 531 H2A types were di\erentially mobilized by infection, we examined variant H2A mobility 532 relative to that of canonical H2A. In EHV1 “small” RCs, the inherent relationships between 533 variant and canonical H2A mobilities were not well conserved. H2A.X was mobilized to the 534 greatest degree such that its mobility within “small” RCs resembled more that of H2A.Z 535 than H2A (Fig 9, S3 Fig, S2 Table). The H2A.X free pool increased to 133 ± 7% (P<0.01) and 536 its fast chromatin exchange rate tended to increase (to 136 ± 29%; P=ns) relative to H2A (S3 537 Fig, S2 Table). H2A.Z was also further mobilized relative to H2A within “small” RCs. H2A.Z 538 fast chromatin exchange increased from 131 ± 9% that of H2A within the mock-infected 539 cell chromatin to 172 ± 26% that of H2A within “small” RCs (S3 Fig, S2 Table). Despite 540 increased fast chromatin exchange, H2A.Z free pools remained relatively similar to those of 541 H2A within “small” RCs or mock-infected cell chromatin (131 ± 8% or 127 ± 3% that of H2A, 542 respectively; S3 Fig, S2 Table). Together, these data suggest that H2A.X and H2A.Z may be 543 preferentially mobilized within “small” RCs or more susceptible to histone mobilizing 544 factors in abundance at earlier stages of infection. 545 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 20 Further mobilization in “large” RCs resulted in relatively similar free pools of H2A, 546 H2A.X, and H2A.Z (S3 Fig, S2 Table). However, H2A fast chromatin exchange increased by a 547 greater magnitude than that of H2A.Z or H2A.X. Thus, H2A.Z fast chromatin exchange was 548 similar to (117 ± 9%; P=ns), while that of H2A.X was significantly slower than (66 ± 6%; 549 P<0.01), that of H2A within “large” RCs (S3 Fig, S2 Table). Although macroH2A was also 550 further mobilized within “large” RCs, it remained the least mobile variant within them. It’s 551 free pool or fast chromatin exchange rate were 89 ± 2% or 64 ± 8% those of H2A, 552 respectively (P<0.01; S3 Fig, S2 Table). These data suggest that canonical H2A may be 553 more susceptible to histone mobilizing factors in abundance within “large” RCs. 554 In contrast to mobilization of canonical and variant H2A within RCs, infection had 555 little e\ect on the intrinsic relationships between variant and canonical H2A mobilities 556 within the surrounding infected-cell chromatin. However, as in “large” RCs, H2A.X and 557 macroH2A fast chromatin exchange further decreased relative to H2A (102 ± 7% to 84 ± 5% 558 or 95 ± 10% to 69 ± 5%, P<0.05 or <0.01, respectively), consistent with H2A mobilization 559 within the cell chromatin surrounding “large” RCs (S3 Fig, S2 Table). Regardless, the H2A, 560 H2A.Z, H2A.X, and macroH2A free pools were proportionately maintained within infected-561 cell chromatin. 562 In summary, infection di\erentially mobilized canonical H2A and variant H2A.Z, 563 H2A.X, and macroH2A within domains enriched for EHV1 chromatin. H2A.X and H2A.Z 564 were initially mobilized by a larger degree relative to H2A within “small” RCs, suggesting 565 that they may be preferentially mobilized or more susceptible to mobilization factors in 566 abundance at earlier stages of infection. Mobilization of H2A.X and H2A.Z in “small” RCs, 567 however, were distinct in that the H2A.X free pool was most enhanced whereas H2A.Z fast 568 chromatin exchange was most enhanced. The di\erential mobilization of H2A.X and H2A.Z 569 within “small” RCs indicates that they are mobilized by distinct mechanisms or have 570 di\erential associations within EHV1 chromatin. At later stages of infection, the further 571 mobilization of H2A, H2A.X, and H2A.Z resulted in relatively similar free pools within 572 “large” RCs. However, despite similar free pools, H2A.X fast chromatin exchange was 573 relatively slower than that of H2A or H2A.Z. Moreover, despite further mobilization of 574 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 21 macroH2A within “large” RCs its free pool and fast chromatin exchange remained relatively 575 smaller and slower than those of H2A. The di\erential relative mobilities of H2A, H2A.Z, 576 H2A.X, and macroH2A within “large” RCs suggests that they have distinct EHV1 chromatin 577 interactions. 578 579 Variant H2A.B is uniquely mobilized during EHV1 infection. 580 H2A.B is the most unique and dynamic H2A variant. It had distinct nuclear 581 localization patterns that ranged from largely homogenous throughout the nucleus to 582 pronounced enrichment within nucleoli (Fig 10). The variable localization of equine H2A.B 583 resembled the cell cycle-related localization of human H2A.B and likewise may relate to 584 cell cycle stage (69). FRAP analysis revealed that H2A.B localization patterns corresponded 585 with distinct mobilities within non-nucleolar chromatin. We arbitrarily numbered the 586 mobility groups from the slowest (1), which corresponded to relatively homogenously 587 distributed H2A.B, to the fastest (4), which corresponded to pronounced nucleolar 588 enrichment (Fig 10). Most cells were within mobility groups 3 (38%) and 2 (31%), with 589 smaller populations within the most extreme mobility groups 1 (13%) and 4 (18%) (Fig 10, 590 S3 Table). The slowest mobility group 1 had the smallest H2A.B free pool and slowest fast 591 chromatin exchange, whereas the fastest mobility group 4 had the largest and fastest, 592 respectively (Fig 11, Tables 1 and 2). The variable mobility of H2A.B within non-nucleolar 593 chromatin did not relate to GFP-H2A.B expression levels measured as the total normalized 594 nuclear fluorescence before photobleaching (S4 Fig). 595 H2A.B mobility within nucleoli was similar in all evaluated mock-infected cells (Fig 596 10B). This suggests that factors to regulate H2A.B chromatin exchange primarily do so 597 within non-nucleolar chromatin and have little impact on H2A.B exchange within nucleolar 598 chromatin. The similar mobility of H2A.B within nucleoli, regardless of its mobility within 599 the cell chromatin, further supports the independence of mobility and GFP-H2A.B 600 expression levels. Furthermore, these data show that H2A.B chromatin exchange within 601 nucleoli is independent of nucleoli number or relative H2A.B enrichment within them. The 602 H2A.B free pool within nucleoli was similar to that within the surrounding cell chromatin for 603 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 22 mobility groups 1 and 2 (67 ± 2%, vs 67 ± 6% and 83 ± 3%, respectively, of the H2A.B free 604 pool within mobility group 3; Fig 11, Table 1). H2A.B fast chromatin exchange within 605 nucleoli, however, resembled more that of mobility group 3, which had a significantly larger 606 H2A.B free pool (Fig 11, Tables 1 and 2). Thus, given the similar fast chromatin exchange of 607 H2A.B within nucleoli and the non-nucleolar chromatin within mobility group 3, these data 608 suggest that H2A.B chromatin residency within nucleoli is greater to account for its 609 relatively smaller free pool. 610 H2A.B is the most dynamic H2A variant and its chromatin exchange kinetics 611 resemble more linker, rather than other core histones (54, 55, 57). Consistently, within non-612 nucleolar cell chromatin all H2A.B mobility groups had larger free pools (with exception of 613 mobility group 1) and increased fast chromatin exchange relative to canonical H2A (S3 Fig, 614 S2 Table). Within nucleoli, however, the H2A.B free pool was significantly smaller (74 ± 2%) 615 and its fast chromatin exchange significantly faster (567 ± 30%) relative to canonical H2A 616 (P<0.01, S3 Fig, S2 Table). Thus, H2A.B chromatin turnover is exceptionally rapid relative to 617 that of H2A within nucleoli, yet H2A.B is also more likely than H2A to be assembled in 618 nucleolar chromatin at any given time. 619 EHV1 infection surprisingly did not alter H2A.B nuclear localization. H2A.B still had 620 varying localization patterns that ranged from largely homogenous throughout the nucleus 621 to pronounced nucleolar enrichment (Fig 10). Significant H2A.B depletion from, or 622 enrichment in, EHV1 RCs was not observed. Nuclear domains likely to be enriched in viral- 623 or cell-chromatin were therefore indistinguishable and measured H2A.B mobility 624 represents its net mobility due exchange with cell- and EHV1-chromatin. H2A.B also 625 consistently segregated into distinct mobility groups within infected cells (Fig 10B, S5 Fig). 626 The slowest H2A.B mobility groups within infected cells were similar to the slowest mobility 627 groups within mock-infected cell chromatin (1-3; Fig 10B, S5 Fig). Only the fastest mobility 628 group within EHV1-infected cells, designated as 4+, was mobilized relative to mock-629 infected cells. This most mobile H2A.B group was evident regardless of whether cells were 630 infected with abortogenic or neurotropic EHV1, although the relative populations of cells 631 within this, or the slower mobility groups 1-3, varied (S5 Fig, S3 Table). Most cells infected 632 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 23 with abortogenic EHV1 segregated into mobility group 4+, with no cells within the slowest 633 mobility group 1 (S5 Fig, S3 Table). Most cells infected with neurotropic EHV1, meanwhile, 634 segregated into mobility groups 2 and 3. These data suggest that H2A.B mobilization may 635 relate to infection progression as the abortive EHV1 strain tended to have slightly faster 636 replication kinetics than the neurotropic one in EDerm cells. Alternatively, other factors, 637 such as specific virus-host protein-protein interactions, may contribute to regulate H2A.B 638 chromatin exchange within EHV1-infected cells. 639 H2A.B mobility group 4+ was the most mobile. Fluorescence within these cells 640 recovered faster than within any other mobility group of mock-or EHV1-infected cells or 641 within mock-infected nucleoli (Fig 10B). H2A.B mobility group 4+ had the largest free pool 642 (149 ± 3%) and the greatest fast chromatin exchange (86 ± 3%) within EHV1-infected cells 643 (expressed relative to H2A.B mobility group 3 in mock-infected cell chromatin; Fig 11, 644 Tables 1 and 2). The H2A.B free pool within mobility group 4+ was significantly increased 645 relative to that within mock-infected mobility group 4 (149 ± 3% vs 113 ± 4%), although its 646 fast chromatin exchange rate was significantly slower (86 ± 3% vs 161 ± 15%, P<0.01; Fig 647 11, Tables 1 and 2). Thus H2A.B mobilization within this subpopulation of infected cells (4+) 648 increased its net level in the free pool despite relatively slower fast chromatin exchange. 649 These data suggest that within this population of infected cells H2A.B is less likely to re-650 bind chromatin once unbound but has slower turnover when bound. 651 The inability to distinguish EHV1 RCs in H2A.B expressing cells precluded 652 comparative analysis of H2A.B and H2A mobilization within domains enriched for viral or 653 infected-cell chromatin. As a surrogate analysis, H2A.B mobility was expressed relative to 654 H2A mobility within infected-cell chromatin or “large” RCs. The intrinsic property of H2A.B 655 as the most dynamic H2A variant was maintained relative to H2A within infected-cell 656 chromatin (S3 Fig, S2 Table). All H2A.B mobility groups had larger free pools (with exception 657 of mobility group 1) and enhanced fast chromatin exchange relative to H2A within the 658 infected-cell chromatin (S3 Fig, S2 Table). With respect to H2A mobility within “large” RCs, 659 however, only H2A.B mobility group 4+ had a larger free pool (108 ± 2%, P<0.05) and 660 enhanced fast chromatin exchange (257 ± 8%, P<0.01) relative to H2A (S3 Fig, S2 Table). 661 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 24 Mobility groups 1 to 3 had significantly smaller free pools and, with exception of mobility 662 group 1, significantly increased fast chromatin exchange relative to H2A within “large” RCs 663 (S3 Fig, S2 Table). The relative mobilities of H2A.B mobility groups 1 to 3 and H2A within 664 “large” RCs were similar to the relative mobilities of H2A.B and H2A within mock-infected 665 nucleolar chromatin. 666 These data highlight the unique chromatin exchange of H2A.B. EHV1 did not notably 667 alter H2A.B nuclear localization and only mobilized H2A.B within a subpopulation of 668 infected cells (4+). Within this subpopulation, H2A.B free pools increased despite a relative 669 decrease in fast chromatin exchange. Thus, in these cells H2A.B is less likely to bind in 670 chromatin but undergoes slower low-a\inity turnover when bound. 671 672 Linker histone H1.2 is most mobile within EHV1 RCs . 673 Linker histones are the most dynamic histone and undergo rapid chromatin 674 exchange (48, 53-56). We evaluated H1.2 mobility during EHV1 infection as a 675 representative linker histone given that it is abundantly expressed throughout the cell cycle, 676 assembles in euchromatin, and is the H1 variant most mobilized by HSV1 (48, 56, 70). GFP-677 H1.2 had discrete granular distribution with relative nucleolar depletion. However, 678 depletion from nucleoli tended to be less pronounced than that of most core histones (Fig 679 12A). FRAP analysis revealed that, as expected, H1.2 was more mobile than core histones 680 and also more mobile within nucleoli than within the surrounding cell chromatin (Fig 12B). 681 Infection altered H1.2 localization such that it was relatively depleted from viral RCs 682 and accumulated in discrete puncta within domains enriched for infected-cell chromatin 683 (Fig 12A). The redistribution of H1.2 within infected cells was reflected in its mobility. H1.2 684 was mobilized within EHV1 RCs (Fig 12B). This mobilization apparently related to infection 685 progression as H1.2 was further mobilized in “large” relative to “small” RCs (Fig 12B). 686 Conversely, H1.2 mobility decreased in the infected-cell chromatin such that fluorescence 687 recovered even slower within it than within mock-infected cell chromatin (Fig 12B). The 688 apparent stabilization of H1.2 binding within infected-cell chromatin is consistent with its 689 accumulation (or immobilization) in discrete puncta. 690 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 25 As an overall measure of H1.2 mobility we calculated its T50, the time to recover 50% 691 of the normalized fluorescence intensity within photobleached regions (Fig 12C). T50 and 692 mobility inversely relate so that a smaller T50 reflects increased mobility, while a larger T50 693 reflects reduced mobility. The T50 is most influenced by low-a\inity chromatin binding and 694 consequently primarily reflects mobility of the most dynamic histone populations. H1.2 695 mobilization in “small” or “large” RCs decreased its T50 to 52 ± 6% or 26 ±3 %, respectively, 696 of that in mock-infected cell chromatin (P<0.01; Fig 13A, B). H1.2 was mobilized within RCs 697 throughout the infected cell population with an extreme degree of mobilization in 61% or 698 93% of cells within “small” or “large” RCs, respectively (Fig 13B). H1.2 mobilization within 699 RCs caused a net increase in its free pools, to 137 ± 6% or 191 ± 6%, and increased its fast 700 chromatin exchange, to 142 ± 9% or 138 ± 11%, within “small” or “large” RCs, respectively 701 (P<0.01; Fig 13C-F , Tables 1 and 2). Interestingly, H1.2 fast chromatin exchange in “small” 702 or “large” RCs were similar despite a significantly larger H1.2 free pool within the “large” 703 ones (Fig 13C, E). Thus, as infection progresses H1.2 may be less likely to assemble in, or 704 be displaced from, EHV1 chromatin to account for its increased free pool within “large” 705 RCs. 706 In contrast to mobilization within RCs, H1.2 mobility was decreased within domains 707 enriched for infected-cell chromatin (Fig 12B). Reduced mobility of H1.2 tended to increase 708 its T50 to 124 ± 9 %, although significance was not achieved (Fig 13A, B). Regardless, 31% of 709 cells had a T50 greater than 1SD above the average T50 in mock-infected cell chromatin, 710 which is almost double the population expected were H1.2 not immobilized within it (Fig 711 13B). Although the overall mobility of H1.2 decreased, its free pool and fast chromatin 712 exchange were similar within EHV- or mock-infected cell chromatin (97 ± 3% or 106 ± 4%, 713 respectively; Fig 13 C-F , Tables 1 and 2). These data suggest that decreased H1.2 mobility 714 within infected-cell chromatin reflects stabilization of H1.2 high-a\inity, rather than low-715 a\inity, chromatin interactions. 716 Together, these data show that EHV1 mobilized H1.2 within nuclear domains 717 enriched for viral chromatin (RCs). Mobilization was apparently independent of infection 718 progression, although as infection progressed H1.2 was less likely to be bound in 719 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 26 chromatin within RCs. Thus, H1.2 may be less likely assembled in, or displaced from, EHV1 720 chromatin during robust viral transcription and DNA replication, and when all kinetic 721 protein classes are expressed. Infection decreased H1.2 mobility within the infected-cell 722 chromatin. This de-mobilization did not a\ect H1.2 chromatin residency or low-a\inity 723 chromatin interactions, suggesting that EHV1 may further stabilize higher-a\inity H1.2 724 binding within infected-cell chromatin. 725 726

727 Herein we show that EHV1 mobilized canonical and variant core histones and linker 728 histone H1.2. Histones were most mobile within RCs, which are enriched for viral 729 chromatin. The distinctive mobilities of histones within RCs or the surrounding cellular 730 chromatin indicate that histone associations with viral chromatin are di\erent from their 731 associations with cellular chromatin and suggest that viral and cellular chromatin have 732 unique properties. Moreover, the dissimilar mobility of histones within EHV1 RCs and the 733 surrounding cellular chromatin supports the idea that histone assembly and turnover are 734 di\erentially regulated in either chromatin. The particular factors that regulate such 735 processes within the viral chromatin are therefore likely enriched in RCs. 736 The di\erential mobilization of histones within EHV1 RCs suggests that their 737 mobilization is unlikely a general response to indiscriminately disrupt chromatin. Histone 738 mobility was primarily enhanced through changes in chromatin residency or low-a\inity 739 turnover. Mobility of most histones within EHV1 RCs reflected a trend in which chromatin 740 residency was most a\ected at earlier stages of infection, whereas both chromatin 741 residency and low-a\inity turnover were a\ected at later stages (Figs 5 and 9). Exceptions 742 to this trend were mobilization of H3.1, H3.3, and H1.2 (Figs 7 and 13). These data are 743 consistent with specific mechanisms that regulate chromatin assembly and turnover of 744 individual histones. The magnitude of mobilization for individual histones were also 745 variable. Some, such as H2A.X, H2A.Z, and H1.2, were preferentially mobilized at earlier 746 stages of infection, whereas others, such as H2A, H3.1, and H3.3, were preferentially 747 mobilized at later stages. Thus, the chromatin-binding and -turnover properties of 748 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 27 individual histone types were di\erentially altered relative to each other and their relative 749 mobilities varied over the course of infection. Any given histone may be mobilized to 750 promote its assembly in viral chromatin. Conversely, mobilization may reflect eviction 751 from, or inhibition of assembly in, EHV1 chromatin. The varied mobilities of individual 752 histones over the course of infection is consistent with changes to their associations with 753 viral chromatin and suggest that viral chromatin composition may also be variable. 754 Our data did not reveal significant di\erences in histone mobility during infection 755 with neurotropic or non-neurotropic EHV1. Nonetheless, several trends indicate at least 756 some di\erences in the histone mobilization mechanisms or histone-chromatin 757 interactions of either strain. For example, during neurotropic EHV1 infection H2A.Z and 758 H3.1 fast chromatin exchange tended to be slower in “small” RCs and faster in “large” RCs 759 than during non-neurotropic EHV1 infection. Neurotropic EHV1 also tended to enhance 760 H3.3 and H4 fast chromatin exchange in the cell chromatin surrounding “large” RCs. 761 Despite such trends, free histone pools were consistently similarly altered during infection 762 with either neurotropic or non-neurotropic EHV1. The more prominent or variable alteration 763 of fast chromatin exchange of particular histones during neurotropic EHV1 infection may 764 reflect more specific nuances of viral chromatin regulation that are not readily apparent by 765 FRAP analysis. Knowledge of histone mobilization mechanisms will support more in-depth 766 characterizations of EHV1 chromatin and its regulation to provide insight into whether 767 chromatin regulation varies between, or contributes to, strain pathotype. Regardless of 768 whether neurotropic or non-neurotropic chromatin regulation is similar or distinct, 769 understanding how viral chromatin is regulated will support the design of novel antiviral 770 therapies to silence EHV1 genomes and prevent productive infection. 771 Histones were typically mobilized to a greater degree when infection had further 772 progressed (based on identifiable RC size or number). However, given the similar 773 appearance of “small” RCs and histone depleted regions within mock-infected cells, it is 774 possible that that histone mobility within “small” RCs is greater than measured due to 775 inadvertent selection of non-RC nuclear regions. If this were the case, analyses of histone 776 mobility within any given “small” RC per individual cell would be expected to produce a 777 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 28 bimodal frequency distribution, with subpopulations that have histone mobilities 778 resembling those within mock-infected cell chromatin or “large” RCs. Only two analyses 779 revealed bimodal distributions for histone mobility within “small” RCs, the fast chromatin 780 exchange of H2B and H2A.X (Figs 5E and 9D). All other analyses of mobility within a “small” 781 RC per individual cell revealed unimodal distributions intermediate to histone mobilities 782 within mock-infected cell chromatin or “large” RCs. These data are consistent with a mixed 783 population of infected cells that have mobilized a particular histone to varying extents 784 within any given “small” RC. This mobilization supports a model in which the magnitude of 785 mobilization relates to EHV1 replication properties that become more prominent as 786 infection progresses. Thus, levels of EHV1 transcription or DNA replication, expression or 787 accumulation of specific viral proteins, or cellular responses to them may further enhance 788 histone mobility. This proposed model is consistent with our understanding of HSV1 789 mobilization of histones, for which this phenomenon of histone mobilization during viral 790 infection was first described (48). All HSV1 transcription activators VP16, ICP0, and ICP4 791 mobilize histones, although ICP4 mobilizes them to the greatest extent and is su\icient to 792 do so (48-50, 60). The EHV1 ICP4 homologue, IE1, has some conservation with ICP4 a.a. 793 sequence, particularly within the DNA binding domain, and with some transcription 794 regulatory mechanisms (71-75). However, whether the function of ICP4 to mobilize 795 histones is conserved in IE1 is not yet known. Work is underway to characterize histone 796 mobilization mechanisms and test how they relate to EHV1 infection progression. 797 Histones were predominantly depleted from RCs. This depletion is consistent with 798 mobilization of histones specifically within RCs as, at any given time, histones were more 799 likely imaged within cellular chromatin domains where they are less mobile and 800 accordingly spend more time. However, histones were not universally depleted from RCs. 801 Minor subpopulations of cells had RCs relatively less depleted for H3.1, H3.3, or 802 macroH2A (Figs 6 and 8). Furthermore, di\use H2A.B or di\use H3.1 or H3.3 within a minor 803 subpopulation of cells revealed that in some cases histones may be equally enriched, and 804 spend equal time, within domains containing cellular or viral chromatin (Figs 6 and 10). The 805 high degree of H3.1 or H3.3 mobilization in cells with di\use H3 was unlikely due to general 806 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 29 H3 eviction from all chromatins as nucleoli remained depleted for either histone (Fig 6). 807 Thus, mechanisms to mobilize H3 to such an extreme degree within the viral or infected-808 cell chromatin did not notably alter its association or turnover within nucleolar chromatin. 809 Likewise, nucleoli remained enriched for H2A.B within cells of mobility groups 2, 3, and 4+ 810 (Fig 10). H2A.B association and turnover within nucleolar chromatin is thus also distinct 811 from that within viral or infected-cell chromatin. While H2A.B is considered the most 812 dynamic core histone, the extreme mobility of H3.1 and H3.3 within cells with di\use H3 813 was to a similar degree as H2A.B mobilization within mobility group 4+ (Tables 1 and 2). 814 These data show that, at least under certain circumstances, other core histones can be 815 equally as mobile as H2A.B. 816 Histones were more dynamic within medium- to large-sized EHV1 RCs than within 817 nucleoli. The higher mobility of histones within RCs indicates that EHV1 chromatin is more 818 unstable or dynamic than nucleolar chromatin. This observation is also consistent with our 819 understanding of the unique HSV1 lytic chromatin. HSV1 nucleosomes are highly unstable. 820 Accordingly, they have very low immunoprecipitation e\iciency and viral genomes are 821 hyperaccessible to nucleases (51, 62-64, 76-81). As reported herein for EHV1, canonical 822 (H2A, H2B, H3.1, H4) and variant (H2A.X, macroH2A, H3.3) core histones are also more 823 dynamic within HSV1 RCs than within mock-infected nucleoli (Conn & Schang, 824 unpublished). Although the extreme mobility of histones within HSV1 RCs is most 825 consistent with the assembly of viral genomes in highly dynamic and unstable 826 nucleosomes, whether histone mobility contributes to the remarkable hyperaccessibility of 827 HSV1 chromatin is yet to be tested. HSV1 chromatin composition may contribute more to 828 its unique hyperaccessibility than dynamic histone exchange. Consistently, H2A.B 829 chromatin enrichment is associated with the DNA hyperaccessibility that is characteristic 830 of HSV1 or nucleolar chromatin. Although histone mobilization is consistent with 831 nucleosome instability, whether EHV1 chromatin is also hyperaccessible or enriched in 832 H2A.B is not yet known. H2A.B enrichment within HSV1 chromatin is accompanied by its 833 relative de-mobilization and accumulation in RCs (51). Similarly, H3.1 is relatively de-834 mobilized and can accumulate in RCs concomitant with its assembly in HSV1 chromatin 835 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 30 (50, 82). We did not observe notable enrichment of any histone within EHV1 RCs. Nor was 836 any histone relatively de-mobilized, or not mobilized, within RCs during EHV1 infection. 837 Thus, histone mobility on its own did not highlight preferential assembly of any histone 838 within EHV1 chromatin. This distinction suggests that EHV1 and HSV1 lytic chromatins 839 have distinct properties or some degree of unique regulation. Work is underway to evaluate 840 EHV1 chromatin composition and biophysical properties to further test the relationships 841 between viral nucleosome instability, DNA hyperaccessibility, and histone mobility. 842 The dysregulation of histone chromatin exchange, with enhanced mobility in viral 843 RCs, is a feature conserved between EHV1 and HSV1 (48-51, 60). However, di\erences in 844 histone mobilization during infection with either virus are apparent. Most striking is the 845 distinct mobilization of H2A.B. In HSV1-infected cells, H2A.B accumulates within viral RCs 846 and is relatively de-mobilized concomitant with enrichment in transcriptionally active 847 HSV1 chromatin (51). Conversely, H2A.B was neither depleted nor enriched within EHV1 848 RCs and its mobility was enhanced within a subpopulation of cells (Figs 10 and 11). Human 849 and equine H2A.B are the most dissimilar histones evaluated herein, sharing only 70% a.a. 850 identity (S1 Fig). Thus, structural di\erences, di\erent PTMs, or di\erent protein-protein 851 interactions may account for distinct mobilizations of H2A.B during EHV1 or HSV1 852 infections. The apparent maintenance of nucleoli during EHV1 infection is potentially 853 another contributing factor to di\erential H2A.B mobilization. Herein we show that nucleoli 854 are largely morphologically similar within EHV1- or mock-infected cells (Figs 1, 2, 6, 8, 10, 855 12). In contrast, HSV1 morphologically and compositionally disrupts nucleoli (83-88). 856 Consequently, many abundant nucleolar resident proteins, including nucleophosmin 857 (NPM1, B23), fibrillarin, nucleolin, and upstream binding factor (UBF), redistribute 858 throughout HSV1-infected nuclei and some accumulate within RCs (83-87, 89-93). 859 Nucleolar protein redistribution kinetics, re-localization patterns, and the roles of specific 860 HSV1 proteins (or not) in their redistribution highlight that multiple mechanisms contribute 861 to disrupt nucleoli during HSV1 infection. At least one HSV1 protein, UL24, has conserved 862 sequence identity with its EHV1 homologue, ORF37, in key regions necessary to disrupt 863 nucleoli (83, 92, 94). Whether this function is conserved in ORF37 and whether individual 864 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 31 nucleolar components, aside from H2A.B (Fig 10) or EAP (EBV-encoded small nuclear RNA-865 associated protein) (95), redistribute throughout the EHV1-infected nucleus are not yet 866 tested. HSV1-mediated nucleoli disruption could displace H2A.B from nucleolar chromatin 867 to promote its assembly in viral chromatin. Conversely, maintenance of nucleoli during 868 EHV1-infection may maintain H2A.B association with nucleolar chromatin so that it is less 869 available for assembly, or less likely to stably assemble, within EHV1 chromatin. 870 The apparent maintenance of nucleoli during EHV1 infection may relate to yet 871 another di\erence between EHV1 and HSV1 mobilization of histones. EHV1 did not 872 substantially mobilize histones in the infected-cell chromatin. Only H2A, H3.3, and H4 873 were partially mobilized within the cellular chromatin surrounding EHV1 RCs (Figs 5, 7, 9). 874 The mobility of H2A, H3.3, and H4 within infected-cell chromatin reflected unique changes 875 to individual chromatin interactions, their chromatin residency (H4 and H3.3, Figs 5A and 876 7A ) or low-a\inity chromatin exchange (H4 and H2A, Figs 5D and 9C ). The di\erential 877 mobilization of H2A, H3.3, and H4 within EHV1-infected cell chromatin more likely reflects 878 distinct mechanisms to regulate chromatin exchange of individual histone types rather 879 than a consequence of general nucleosome disruption. In contrast, HSV1 more broadly 880 disrupts the cellular chromatin surrounding RCs. A similar analysis in HSV1-infected cells 881 revealed that all evaluated canonical (H2A, H2B, H3.1, H4) and variant (H2A.X, macroH2A, 882 H3.3) core histones were mobilized to increase their free pools within the infected cell 883 chromatin (Conn & Schang, unpublished). It is interesting to note that histones are broadly 884 mobilized within the cellular chromatin during HSV1 infection despite its progressive 885 compaction and marginalization as infection progresses (96). Two nucleolar resident 886 proteins that redistribute throughout HSV1-infected nuclei, nucleolin and NPM1, are 887 histone chaperones that disrupt nucleosomes to exchange H2A-H2B (nucleolin) or H3-H4 888 (NPM1) dimers (83, 84, 87, 92, 93, 97-100). Additionally, nucleolin and NPM1 promote 889 nucleosome remodeling and interact with H1 to further decondense chromatin and 890 facilitate histone mobilization (97-99, 101, 102). Thus, increased abundance of nucleolin 891 and NPM1 throughout the HSV1-infected cell chromatin may account for, or contribute to, 892 general mobilization of core histones within it. Conversely, morphological maintenance of 893 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 32 nucleoli within EHV1-infected cells suggests that nucleolar resident proteins may not be 894 dispersed, or as drastically dispersed, as they are during HSV1 infection. It remains to be 895 tested whether individual nucleolar proteins, particularly those with histone chaperone 896 activities, relocalize during EHV1 infection and, if so, how they may contribute to histone 897 mobilization. 898 Herein, we provide a comprehensive analysis of histone mobility in equine cells that 899 is the first to comparatively evaluate mobility within nucleolar and non-nucleolar 900 chromatin. Importantly, as previous investigations of histone mobility used primate- or 901 murine-derived cells, our report of histone mobility within equine-derived cells provides a 902 unique perspective and opportunity to identify processes that may be distinct or 903 di\erentially regulated in a more evolutionarily distant mammalian species. The mobility of 904 most core histones evaluated herein were as expected based on their known e\ects on 905 nucleosome stability and, when available, reported mobilities. Histone mobility was also 906 most consistent with our understanding of the relationships between chromatin stability 907 and histone exchange in that histones were more mobile within nucleolar than non-908 nucleolar chromatin. It is interesting to note that H2A variants, aside from H2A.B, were 909 quite similarly mobile within nucleolar chromatin despite distinct mobilities within non-910 nucleolar chromatin (S3 Fig, S2 Table). This observation further highlights the unique 911 regulation and properties of nucleolar chromatin. Despite the expected mobilities of most 912 core histones, two examples of remarkable histone dynamics were apparent, the multiple 913 mobilities of H2A.B and the highly dynamic H3.1 population. To our knowledge, this is the 914 first study to comparatively evaluate H2A.B mobility within nucleolar and non-nucleolar 915 chromatin and the first to report distinct H2A.B mobilities within either chromatin, as well 916 as variable H2A.B mobilities within non-nucleolar chromatin (Fig 10, S5 Fig). The distinct 917 mobilities of H2A.B reported herein may not have been noted in other studies due to 918 measuring H2A.B mobility across larger nuclear regions containing variable proportions of 919 nucleolar or non-nucleolar chromatin (36, 51, 69). H2A.B mobility within nucleoli was 920 remarkably consistent across all cells evaluated, indicating that H2A.B exchange in 921 nucleolar chromatin is tightly regulated (Fig 10, S5 Fig). Its distinct and consistent mobility 922 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 33 within nucleoli also suggests that factors to mediate or regulate H2A.B turnover within 923 nucleolar chromatin primarily do so within this domain. Conversely, the multiple and 924 variable mobilities of H2A.B within non-nucleolar chromatin are consistent with multiple 925 mechanisms to regulate its assembly or turnover within this chromatin and suggest that 926 H2A.B is subjected to di\erential regulation within it. The basic arginine repeat region of 927 human H2A.B, which is thought to have regulatory functions, is truncated from 6 to 4 928 residues within equine H2A.B (S1 Fig). Moreover, equine H2A.B has a serine residue within 929 this region that may be subject to PTM. The sequence di\erences within the N-terminus of 930 equine H2A.B may contribute to alternate regulation of its chromatin assembly or turnover 931 within non-nucleolar chromatin. 932 The observation that a population of H3.1 is more dynamic than H3.3 within the 933 cellular chromatin was also unexpected (S2 Fig, S2 Table). This is the first study to 934 comparatively evaluate H3.3 and H3.1 chromatin dynamics using FRAP , which is a 935 sensitive technique to directly evaluate dynamic histone populations. Another study that 936 used FRAP to measure GFP-H3.3 or -H3.1 mobility within Vero (African green monkey) cells 937 shows the same dynamic H3.1 population, although H3.3 and H3.1 mobilities were not 938 directly compared(50). The reported normalized initial fluorescence intensity after 939 photobleaching is approximately 25% or less than 20% for GFP-H3.1 or GFP-H3.3, 940 respectively, within Vero cells, which is comparable to the 25% or 21% reported herein 941 (Table 1) (50). Other methods to indirectly measure H3.1 or H3.3 mobility typically use 942 labelled histones to measure their enrichment in or depletion from specific chromatin 943 regions over time. Such studies do not encounter the most dynamic histone populations as 944 highly dynamic histones are less e\iciently fixed and are lost during nuclei preparations. 945 Thus, studies that indirectly measure H3.1 or H3.3 mobility likely have not encountered this 946 most dynamic H3.1 population consequent to methodologies used. 947 In summary, we show that neurotropic and non-neurotropic EHV1 mobilize 948 histones. Linker histone H1.2 and all canonical and variant core histones, with exception of 949 H2A.B, are mobilized within nuclear domains enriched for EHV1 chromatin. Histones are 950 further mobilized as infection progresses, consistent with increased levels of EHV1 951 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 34 transcription, DNA replication, or protein expression directly or indirectly enhancing 952 histone mobility. The high degree of histone mobilization within EHV1 chromatin domains 953 is consistent with the assembly of viral genomes in dynamic and unstable nucleosomes. 954 Although histones are mobilized within domains enriched in viral chromatin, they are not 955 within domains enriched in cellular chromatin. Histones may therefore be preferentially 956 mobilized within viral chromatin to regulate its stability. The manipulation of histone 957 dynamics is a novel epigenetic mechanism conserved among EHV1 and HSV1 that directly 958 regulates viral chromatin stability and genome accessibility. 959 960

961 Cells and virus 962 EDerm cells (NBL-6; ATCC) were maintained in Dulbecco’s modified minimum 963 Eagle’s medium (DMEM, Gibco 11885-084) supplemented with 10% fetal bovine serum 964 (FBS, Corning 35-077-CV) at 37°C in 5% CO2. Equid alphaherpesvirus 1 (EHV1) strains R08-965 8428 and D08-8315 were generous gifts from Dr. Vikram Misra (University of 966 Saskatchewan). Strain D08-8315 has ORF 30 G2254 (D752) associated with neurological 967 EHV1 pathotype. This strain was isolated from a 17-year-old female quarter horse with 968 neurological deficits (Prairie Diagnostic Services (PDS) Saskatoon). Strain R08-8428 has 969 ORF 30 A2254 (N752) associated with non-neurotropic EHV1 pathotype. No information 970 regarding this strain isolation is available (PDS Saskatoon). 971 972 Viral stock preparation and titration 973 Viral stocks were prepared and titrated in EDerm cells. Briefly, cells were seeded 974 such that they were approximately 40% confluent at the time of infection. Cells were 975 typically infected with 0.01 to 0.05 plaque forming units (PFU) per cell diluted in a minimal 976 volume of 4°C DMEM. Following inoculum addition, cells were incubated at 37°C in 5% 977 CO2 for 1h with rocking and rotating every 5-10min. The inoculum was then removed and 978 cells were washed twice with 4°C phosphate bu\ered saline (PBS; 150mM NaCl, 1mM 979 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 35 KH2PO4, 3mM Na2HPO4, pH 7.4) prior to the addition of fresh 37°C DMEM supplemented 980 with 10% FBS. Cells incubated at 33°C in 5% CO2 until greater than 95% cytopathic e\ect 981 (CPE) was observed. Infected cells were then harvested and pelleted by centrifugation at 982 3,214xg for 20min at 4°C. Extracellular virions were isolated from the resulting supernatant 983 by centrifugation at 10,000xg for 2h at 4°C. Intracellular virions were released from the cell 984 pellet by the disruption of cell membranes through three rapid freeze-thaw cycles in a dry 985 ice-EtOH bath and 37°C water bath, respectively. Cellular debris was then pelleted by 986 centrifugation at 5,500xg for 30min at 4°C. Intra- and extracellular virions were combined 987 for the EHV1 stocks. 988 For stock titration, EDerm cells were seeded in 12-well tissue culture plates such 989 that they would be 50-60% confluent at the time of infection. The EHV1 stock was serially 990 diluted 10-fold in 4°C DMEM and cell monolayers overlayed with a minimum volume of the 991 serial dilutions (typically 10-3 to 10-6). Cells incubated at 37°C in 5% CO2 for 1h with rocking 992 and rotating every 5-10min. The dilutions were then removed, cells were washed twice with 993 4°C PBS and then overlayed with 37°C 0.5% (w/v) methylcellulose in DMEM supplemented 994 with 5% FBS. Infected cells incubated at 37°C in 5% CO2 until well-defined plaques were 995 visible in the cell monolayer (typically 3-5 days). Cells were then fixed and stained by 996 addition of 1% (w/v) crystal violet in 17% (v/v) MeOH and incubated at room temperature 997 for a minimum of 24h. Titrations were washed by gentle agitation in a bucket of ambient 998 water and air dried at room temperature prior to counting plaques. 999 1000 Plasmids 1001 Constructs encoding green fluorescent protein (GFP) fused to the amino (N)-1002 terminus of histones H2A.X, H2B, H3.3, H3.1, and H4, and GFP fused to the carboxyl (C)-1003 terminus of H2A.Z were generous gifts from Dr. Luis Schang (Cornell University) (49-51, 60). 1004 The amino acid sequences of human and equine histones H2A.Z.1 (NP_002097, 1005 XP_023493427), H2B (NP_003514, XP_001497452), H3.3 (NP_001365974, NP_001356113), 1006 H3.1 (NP_001368928, NP_001356115), and H4 (NP_001029249, XP_001496752) are 1007 identical. The DNA sequence encoding H2A.Z.1 (H2A.Zv) was PCR amplified from 1008 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 36 pH2A.Z.1-GFP using primers H2A.Z F and H2A.Z R (Table 4) with flanking BglII and HindIII 1009 restriction sites, respectively. Amplified DNA was ligated in-frame with GFP in pEGFP-C1 (a 1010 generous gift from Dr. Luis Schang, Cornell University) to create pEGFP-H2A.Z. Human 1011 (NP_002096) and equine (XP_023500737) histone H2A.X di\er at amino acid 131. H2A.X 1012 human 131S was changed to equine 131A by site-directed mutagenesis of pEGFP-H2A.X 1013 using primers H2A.X S131A F and H2A.X S131A R (Table 4). 1014 Human and equine histone H2A are identical (NP_003501, XP_001505083). The 1015 sequence encoding H2A was PCR amplified from U2OS (human osteosarcoma; ATCC HTB-1016 96) genomic DNA using the primers H2A F and H2A R (Table 4). Amplified DNA was ligated 1017 in-frame with GFP in pEGFP-C1 using BglII and SalI restriction sites to create pEGFP-H2A. 1018 DNA sequences encoding equine macroH2A (XP_023473434.1) and equine H2A.B 1019 (XP_023489462.1) were ordered as gBlocks from Integrated DNA Technologies (IDT; Table 1020 5). Flanking BglII and KpnI (macroH2A) or BglII and HindIII (H2A.B) restriction sites were 1021 used for in-frame ligation with GFP in pEGFP-C1 to create pEGFP-macroH2A or pEGFP-1022 H2A.B, respectively. The DNA sequence encoding equine linker histone H1.2 1023 (XM_005603676) was PCR amplified from EDerm genomic DNA using the primers H1.2 F 1024 and H1.2 R (Table 4). Amplified DNA was ligated in-frame with GFP in pEGFP-C1 using BglII 1025 and HindIII restriction sites to create pEGFP-H1.2. All plasmid sequences were confirmed 1026 by Sanger sequencing (Sanger Sequencing Platform, CRCHU de Québec-Université Laval, 1027 CHUL). 1028 Amino acid sequence comparison of equine and human histones H2A.B, H2A.X, 1029 macroH2A, and H1.2 are depicted in S1 Fig. 1030 1031 Transfection 1032 EDerm cells (2.0- 2.6x105) were seeded in 6-well tissue culture plates at least 12h 1033 prior to transfection. Plasmid DNA was transfected using Lipofectamine 3000 Transfection 1034 Reagent (Invitrogen, L3000001). Briefly, for each well to be transfected 4-6µg of plasmid 1035 DNA were combined with 4-6µl of P3000 reagent in 100µl of 4°C DMEM in a microfuge tube. 1036 In a separate microfuge tube, 1µl of Lipofectamine 3000 was added to 100µl of 4°C DMEM. 1037 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 37 Following a 5min incubation at room temperature, the plasmid DNA-P3000 mix was added 1038 to the Lipofectamine mix. The combined transfection mix incubated at room temperature 1039 for an additional 30min before the volume was brought to 800µl with room temperature 1040 DMEM. Cell medium was removed and the cells overlayed with the transfection mix. Cells 1041 incubated at 37°C in 5% CO2 for 5-6h, then the transfection mix was removed and replaced 1042 with fresh 37°C DMEM supplemented with 10% FBS. Transfected cells incubated in 5% CO2 1043 at 37°C at least 36h prior to seeding for infection and FRAP analysis. Transiently expressed 1044 exogenous histones with N-terminal GFP fusions are nuclear, assemble in chromatin, and 1045 have lower expression levels than endogenous histones (48-51, 60). 1046 1047 EHV1 infection 1048 Transfected EDerm cells were seeded (4x105) on 18x18mm coverslips in 6-well 1049 plates for fluorescence recovery after photobleaching (FRAP) analysis. Seeded cells 1050 incubated at 37°C in 5% CO2 at least 7h prior to infection. Inoculum was prepared by 1051 diluting purified EHV1 stocks in 4°C DMEM. For mock infections, 4°C DMEM was used. 1052 Cells were overlaid with 400µl of inoculum containing 10 PFU/cell of EHV1 strain R08- 8428 1053 (abortogenic) or strain D08-8315 (neurotropic) and incubated at 37°C in 5% CO2 for 1h with 1054 rocking and rotating every 5-10min. The inoculum was then removed, cells were washed 1055 twice with 4°C PBS and overlayed with fresh 37°C DMEM supplemented with 10% FBS. 1056 Infected cells incubated at 37°C in 5% CO2 until they were subjected to FRAP analysis. 1057 1058 FRAP 1059 Histone mobility was evaluated between 5 and 6hpi as described previously (48-50, 1060 60). Briefly, a coverslip was mounted on a slide and put on a 37°C stage on a Zeiss LSM 700 1061 inverted confocal microscope(48). Cells were viewed using a Plan-Apochromat 40x/ 1.4 oil 1062 DIC objective lens. FRAP was performed using an Argon laser (488nm) with maximum 1063 pinhole size. Whole cell imaging was performed at 2-3% laser intensity while 1064 photobleaching was achieved with 30-35 iterations at 100% laser intensity. Two circular 1065 regions of equal volume, one within the nucleoli or EHV1 replication compartment of 1066 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 38 mock- or EHV1-infected cells, respectively, and one within the surrounding cellular 1067 chromatin of each were photobleached (as depicted in Fig2A). Thirty to forty-five 1068 di\erential interference contrast (DIC) and fluorescent images were collected at 0.9s 1069 intervals from before photobleaching and after photobleaching. At each interval the 1070 fluorescence of the entire cell nucleus was measured. The fluorescence of the 1071 photobleached regions at each time were normalized to the total nuclear fluorescence at 1072 that same time. The normalized fluorescence of each photobleached region at any time is 1073 presented as a ratio to the normalized fluorescence of the same region before 1074 photobleaching. The fluorescence of the photobleached regions recover as bleached GFP-1075 histones from within them undergo chromatin exchange with the non-bleached fluorescent 1076 GFP-histones from outside them. FRAP was measured for 30-45s as we were interested in 1077 evaluating the most dynamic histone populations. Moreover, any potential contribution of 1078 newly synthesized and nuclear imported GFP-histones to the fluorescence recovery is 1079 negated by such a short time. A single slide was used for FRAP analysis for less than 1h. 1080 Typically 8-10 cells per condition (mock-, R08-8428- or D08-8315-infection) from at least 4 1081 independent experiments were evaluated. 1082 The normalized fluorescence intensity of the photobleached nuclear regions at the 1083 first time after photobleaching was used as a surrogate measure for the level of histones 1084 available in the free pool (not bound in chromatin and di\using in the nucleoplasm). The 1085 slope between the normalized fluorescence at the first and second times after 1086 photobleaching, representing the initial rate of fluorescence recovery, was used as a 1087 surrogate measure for the fast chromatin exchange rate (those histones weakly bound in 1088 chromatin and undergoing low-a\inity chromatin exchange). The slope of normalized 1089 fluorescence recovery from 15-30 s after photobleaching was used as a surrogate measure 1090 for the slow chromatin exchange rate (those histones stably bound in chromatin and 1091 undergoing high-a\inity chromatin exchange). For linker histone H1.2, mobilization was 1092 also evaluated by the time to recover 50% of the normalized fluorescence in the 1093 photobleached regions (T50). A higher degree of mobilization results in a shorter T50 as 1094 mobilization and T50 inversely relate. 1095 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 39 For each individual experiment the level of free histone, calculated fast or slow 1096 chromatin exchange rates, or T50 (for H1.2) for each mock-, R08-8428-, or D08-8315-1097 infected cell were normalized to their average values for the mock-infected cell chromatin 1098 from the same experiment to account for any potential di\erences in photobleaching 1099 e\iciency on any given day. 1100 1101 Image preparation 1102 Fluorescent images were analyzed using Zeiss Zen black. DIC and fluorescent 1103 image brightness and contrast were altered for figure preparation using FIJI(103). 1104 1105 Statistical analysis 1106 Statistical significance was tested using single-factor ANOVA. For comparisons 1107 where ANOVA identified di\erences, samples were evaluated pairwise post hoc using 1108 Tukey Kramer analysis to identify those samples that di\ered. Student’s two-tailed T-test 1109 was used for pairwise comparison of canonical and variant histone mobilities. 1110 1111

1112 We acknowledge University of Saskatchewan Health Sciences 6th floor Virology 1113 Cluster for use of lab space and cell culture facilities, and the University of Saskatchewan 1114 Cancer Cluster for use of the Zeiss LSM 700 microscope. 1115 1116 Figure captions 1117 Fig 1. GFP-H2B or -H4 fusion proteins are depleted from EHV1 replication 1118 compartments. Digital fluorescent (left panels) and di\erential interference contrast 1119 (DIC; right panels) micrographs show the nucleus of EDerm cells expressing GFP-H2B or -1120 H4. Cells were transfected with plasmids expressing GFP-H2B or -H4. At least 40h after 1121 transfection, cells were mock-infected or infected with 10 plaque forming units (PFU) per 1122 cell with an abortogenic or neurotropic field isolated EHV1 strain. Live cells were imaged 1123 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 40 between 5 and 6 hours post infection (hpi). Note the presence of small pools of GFP-H2B or 1124 -H4 within EHV1 replication compartments (RCs), similar to the reported localization of 1125 GFP-H2B or -H4 within HSV1 RCs(49). Note that nucleoli similarly have small pools of GFP-1126 H2B or -H4 within them. 1127 1128 Fig 2. Representative FRAP of GFP-core histone fusion proteins. EDerm cells 1129 were transfected with plasmids expressing GFP fused to H4. Transfected cells were mock-1130 infected or infected with 10 PFU/cell of EHV1 at least 40h after transfection. GFP-H4 FRAP 1131 was evaluated between 5 and 6hpi. (A) Digital DIC (left panel) and fluorescent (right panels) 1132 micrographs of the nucleus of cells expressing GFP-H4 before and at 1 or 30s after 1133 photobleaching. Selected equal volume regions within the cell chromatin (solid circle) and 1134 the nucleolus or EHV1 replication compartment (RC) (dashed circle) were photobleached 1135 and fluorescence recovery within the photobleached regions was measured over time. In 1136 infected cells, the region selected within the cell chromatin is enriched for cellular 1137 chromatin relative to EHV1 chromatin, whereas the region selected within the RC is 1138 enriched for EHV1 chromatin relative to cellular chromatin. Fluorescence within the 1139 photobleached regions recovers as the bleached GFP-histones within them exchange with 1140 the non-bleached fluorescent GFP-histones outside them. (B) Line graph of a 1141 representative GFP-H4 FRAP in the cell chromatin (an area such as that denoted by the 1142 solid circle in panel A, mock). The fluorescence intensity of the photobleached region at a 1143 given time is normalized to the fluorescence intensity of the entire nucleus at that same 1144 time, expressed relative to the normalized fluorescence intensity of the same 1145 photobleached region prior to photobleaching, and is plotted against time after 1146 photobleaching. FRAP is therefore independent of the GFP-histone expression levels within 1147 any given cell. The first data point after photobleaching is set at 0s due to di\erences in the 1148 time required to photobleach two regions per nucleus within each individual cell (as 1149 depicted in panel A). The first data point after photobleaching is a surrogate measure for 1150 the levels of free GFP-histone as only freely di\using histones can move into the 1151 photobleached region in this timeframe. Subsequent fluorescent recovery is biphasic. An 1152 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 41 initial faster phase represents those histones that are weakly bound (low-a\inity 1153 interactions) in chromatin and therefore undergoing fast chromatin exchange. As a 1154 surrogate measure for this histone population, we calculated the initial rate of normalized 1155 fluorescence recovery (the slope between the normalized fluorescence at the first and 1156 second data points after photobleaching; shown in the inset). The second slower phase of 1157 fluorescence recovery represents those histones that are more stably bound (high-a\inity 1158 interactions) in chromatin and undergoing slow chromatin exchange. As a surrogate 1159 measure for this histone population, we calculated the slow rate of fluorescence recovery 1160 (the slope between the normalized fluorescence at the 15 and 30s data points after 1161 photobleaching). Those histones available in the free pool or undergoing fast chromatin 1162 exchange (weakly bound in chromatin) represent the histone populations that are most 1163 likely available for assembly in EHV1 chromatin in a timescale relevant to lytic infection. 1164 1165 Fig 3. GFP-H4 fluorescence recovers faster in EHV1 -infected than in mock-1166 infected cells. EDerm cells were transfected with plasmids encoding GFP-H4. At least 1167 40h after transfection, cells were mock infected (squares) or infected (circles) with 10 1168 PFU/cell of abortogenic or neurotropic EHV1, as indicated. The mobility of GFP-H4 was 1169 evaluated between 5 and 6hpi by FRAP . Line graphs present the normalized fluorescence 1170 intensities of the photobleached nuclear regions expressed as a ratio to their normalized 1171 fluorescence intensities prior to photobleaching plotted against time after photobleaching. 1172 FRAP of GFP-H4 in mock-infected cell- or nucleolar- chromatin are plotted in both graphs 1173 for comparison. Error bars, standard errors of the means (SEM); n³39 cells per treatment 1174 from 4 independent experiments. 1175 1176 Fig 4. H2B or H4 are most mobile within EHV1 RCs. EDerm cells were 1177 transfected with plasmids encoding GFP-H2B or -H4. Transfected cells were mock-infected 1178 or infected with 10 PFU/cell of abortogenic or neurotropic EHV1 at least 40h after 1179 transfection. Nuclear mobility of GFP-H2B or -H4 was evaluated by FRAP between 5 and 1180 6hpi. FRAP data for EHV1 infected cells were pooled for each histone and segregated by the 1181 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 42 absence (A; Small RC) or presence (B; Large RC) of clearly identifiable RCs. Line graphs 1182 present GFP-H2B or -H4 FRAP in the RCs or infected- cell chromatin of EHV1-infected cells, 1183 or the nucleolar- or cell-chromatin of mock-infected cells. GFP-H4 FRAP data presented in 1184 Figure 3 is re-analyzed and re-plotted. FRAP of GFP-H2B or -H4 in the nucleolar- or cell-1185 chromatin of mock-infected cells are plotted in both graphs for comparison. Error bars, 1186 SEM; n³38 cells per treatment from 4 independent experiments. 1187 1188 Fig 5. EHV1 mobilizes unbound and weakly bound H2B or H4 within RCs. 1189 EDerm cells were transfected with plasmids encoding GFP-H2B or -H4. At least 40h post 1190 transfection, cells were mock-infected or infected with 10 PFU/cell of abortogenic or 1191 neurotropic EHV1. Nuclear mobilities of GFP-H2B or -H4 were evaluated by FRAP between 1192 5 and 6hpi. FRAP data for EHV1 infected cells were pooled for each histone and segregated 1193 by the absence (Small) or presence (Large) of clearly identifiable RCs. (A) Bar graphs 1194 present the average normalized levels of GFP-H2B or -H4 in the free pools expressed as a 1195 ratio to the average normalized level in mock-infected cell chromatin (set at 1). (B) 1196 Frequency distribution plots show the percentage of free GFP-H2B or -H4 per individual 1197 cell. Solid vertical black line indicates one standard deviation (SD) above the average level 1198 of free GFP-H2B or -H4 in mock-infected cell chromatin; dashed vertical black line 1199 indicates 1 SD above the average level of free GFP-H2B or -H4 in mock-infected nucleolar 1200 chromatin. The levels of free GFP-H2B or -H4 per individual cell in the mock-infected cell- 1201 or nucleolar- chromatin are plotted in both graphs for comparison. (C) Dot plots present 1202 the level of GFP-H2B or -H4 in the free pools of individual cells plotted against their 1203 normalized total nuclear fluorescence intensity prior to photobleaching. (D) Bar graphs 1204 present the average initial normalized fluorescence recovery rate for GFP-H2B or -H4 1205 expressed as a ratio to the average initial normalized fluorescence recovery rate in mock-1206 infected cell chromatin (set at 1). (E) Frequency distribution plots present the initial 1207 normalized fluorescence recovery rate of GFP-H2B or -H4 per individual cell. Solid or 1208 dashed vertical black lines, 1 SD above the average initial normalized fluorescence 1209 recovery rate for GFP-H2B or -H4 in mock-infected cell- or nucleolar-chromatin, 1210 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 43 respectively. The initial normalized fluorescence recovery rate for GFP-H2B or -H4 per 1211 individual cell in the mock-infected cell- or nucleolar-chromatin are plotted in both graphs 1212 for comparison. (F) Bar graphs represent the average slow normalized fluorescence 1213 recovery rate for GFP-H2B or -H4 expressed as a ratio to the average slow normalized 1214 fluorescence recovery rate in mock-infected cell chromatin (set at 1). (G) Frequency 1215 distribution plots show the slow normalized fluorescence recovery rate for GFP-H2B or -H4 1216 per individual cell. Solid or dashed vertical black lines, 1 SD above the average slow 1217 normalized fluorescence recovery rate for GFP-H2B or -H4 in mock-infected cell- or 1218 nucleolar-chromatin, respectively. The slow normalized fluorescence recovery rate for 1219 GFP-H2B or -H4 in mock-infected cell- or nucleolar-chromatin are re-plotted in both graphs 1220 for comparison. Error bars, SEM. n³38 cells per treatment from 4 independent 1221 experiments. Di\erent letters denote P<0.01; matching symbols denote P<0.05. Statistical 1222 significance evaluated by ANOVA with post-hoc Tukey Kramer pair-wise analysis. 1223 1224 Fig 6. GFP-H3.1 or -H3.3 are variably depleted from EHV1 RCs. Digital 1225 fluorescent (left panels) and DIC (right panels) micrographs show the nucleus of EDerm 1226 cells expressing GFP-H3.1 or -H3.3. Cells were transfected with plasmids encoding GFP 1227 fused to H3.1 or H3.3 and, at least 40h after transfection, were mock-infected or infected 1228 with 10 PFU/cell of abortogenic or neurotropic EHV1. Live cells were imaged between 5 and 1229 6hpi. 1230 1231 Fig 7. H3.1 and H3.3 are most dynamic within “large” EHV1 RCs and cells 1232 with diHuse H3. EDerm cells were transfected with plasmids encoding GFP fused to 1233 H3.1 or H3.3. At least 40h post transfection, cells were mock-infected or infected with 10 1234 PFU/cell of abortogenic or neurotropic EHV1. Nuclear mobilities of GFP-H3.1 or -H3.3 were 1235 evaluated by FRAP between 5 and 6hpi. FRAP data for EHV1 infected cells were pooled for 1236 each histone and segregated by the absence (Small) or presence (Large) of clearly 1237 identifiable RCs. (A) Bar graphs present the average normalized levels of free GFP-H3.1 or -1238 H3.3 expressed relative to the average normalized levels in mock-infected cell chromatin 1239 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 44 (set at 1). (B) Frequency distribution plots show the percentage of free GFP-H3.1 or -H3.3 1240 per individual cell. Vertical solid or dashed black lines, 1 SD above the average level of free 1241 GFP-H3.1 or -H3.3 in mock-infected cell- or nucleolar-chromatin, respectively. The level of 1242 free GFP-H3.1 or -H3.3 per individual cell in the mock-infected cell- or nucleolar- 1243 chromatin are plotted in both graphs for comparison. (C) Dot plots present the level of GFP-1244 H3.1 or -H3.3 in the free pool per individual cell plotted against its normalized total nuclear 1245 fluorescence intensity prior to photobleaching. (D) Bar graphs represent the average initial 1246 normalized fluorescence recovery rate for GFP-H3.1 or -H3.3 expressed relative to the 1247 average initial normalized fluorescence recovery rate in mock-infected cell chromatin (set 1248 at 1). (E) Frequency distribution plots present the initial normalized fluorescence recovery 1249 rate for GFP-H3.1 or -H3.3 per individual cell. Solid or dashed vertical black lines, 1 SD 1250 above the average initial normalized fluorescence recovery rate for GFP-H3.1 or -H3.3 in 1251 mock-infected cell- or nucleolar-chromatin, respectively. The initial normalized 1252 fluorescence recovery rate for GFP-H3.1 or -H3.3 per individual cell in the mock-infected 1253 cell- or nucleolar-chromatin are plotted in both grapns for comparison. Error bars, SEM. 1254 H3.1 n³46 cells per treatment from 5 independent experiments; H3.3 n³60 cells per 1255 treatment from 6 independent experiments. Di\erent letters denote P<0.01; matching 1256 symbols denote P<0.05. Statistical significance evaluated by ANOVA with post-hoc Tukey 1257 Kramer pair-wise analysis. 1258 1259 Fig 8. Canonical H2A and variant H2A.Z, H2A.X, and macroH2A are largely 1260 depleted from EHV1 RCs. Digital fluorescent (left panels) and DIC (right panels) 1261 micrographs show the nucleus of EDerm cells expressing GFP fused to H2A, H2A.Z, H2A.X, 1262 or macroH2A. At least 40h after transfection with plasmids encoding the GFP-histone 1263 fusion proteins, cells were mock-infected or infected with 10 PFU/cell of abortogenic or 1264 neurotropic EHV1. Live cells were imaged between 5 and 6hpi. 1265 1266 Fig 9. Canonical H2A and variant H2A.Z, H2A.X, and macroH2A are most 1267 mobile within “large” EHV1 RCs. EDerm cells were transfected with plasmids 1268 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 45 expressing GFP-H2A, -H2A.Z, -H2A.X, or -macroH2A at least 40h prior to mock-infection or 1269 infection with 10 PFU/cell of abortogenic or neurotropic EHV1. Nuclear mobilities of GFP-1270 H2A, -H2A.Z, -H2A.X or -macroH2A were evaluated by FRAP between 5 and 6hpi. FRAP 1271 data for EHV1 infected cells were pooled for each histone and segregated by the absence 1272 (Small) or presence (Large) of clearly identifiable RCs. (A) Bar graphs represent the average 1273 normalized levels of free GFP-H2A, -H2A.Z, -H2A.X or -macroH2A expressed relative to 1274 their average normalized levels in mock-infected cell chromatin (set at 1). (B) Frequency 1275 distribution plots show the percentage of free GFP-H2A, -H2A.Z, -H2A.X or -macroH2A per 1276 individual cell. Solid or dashed vertical black lines, 1 SD above the average level of free 1277 GFP-H2A, -H2A.Z, -H2A.X or -macroH2A in mock-infected cell- or nucleolar-chromatin, 1278 respectively. The level of free GFP-H2A, -H2A.Z, -H2A.X or -macroH2A per individual cell in 1279 the mock-infected cell- or nucleolar- chromatin are plotted in both graphs for comparison. 1280 (C) Bar graphs present the average initial normalized fluorescence recovery rate for GFP-1281 H2A, -H2A.Z, -H2A.X or -macroH2A expressed relative to their average initial normalized 1282 fluorescence recovery rate in mock-infected cell chromatin (set at 1). (D) Frequency 1283 distribution plots present the initial normalized fluorescence recovery rate for GFP-H2A, -1284 H2A.Z, -H2A.X or -macroH2A per individual cell. Solid or dashed vertical black lines, 1 SD 1285 above their average initial normalized fluorescence recovery rate in mock-infected cell- or 1286 nucleolar-chromatin, respectively. The initial normalized fluorescence recovery rate for 1287 GFP-H2A, -H2A.Z, -H2A.X or -macroH2A per individual cell in the mock-infected cell- or 1288 nucleolar-chromatin are plotted in both graphs for comparison. Error bars, SEM. H2A n³47 1289 cells per treatment from 5 independent experiments, H2A.Z, H2A.X, macroH2A n³40 cells 1290 per treatment from 4 independent experiments. Di\erent letters denote P<0.01; matching 1291 symbols denote P<0.05. Statistical significance evaluated by ANOVA with post-hoc Tukey 1292 Kramer pair-wise analysis. 1293 1294 Fig 10. Variant H2A.B is neither depleted nor enriched in EHV1 RCs. EDerm 1295 cells were transfected with plasmids encoding GFP fused to H2A.B. At least 40h after 1296 transfection, cells were mock-infected or infected with 10 PFU/cell of abortogenic or 1297 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 46 neurotropic EHV1. Live cells were imaged and GFP-H2A.B mobility evaluated by FRAP 1298 between 5 and 6hpi. FRAP data from EHV1-infected cells or the cell chromatin of mock-1299 infected cells were combined and segregated into mobility groups. (A) Digital fluorescent 1300 (left panels) and DIC (right panels) micrographs show the nucleus of cells expressing GFP-1301 H2A.B. (B) Line graph presents FRAP of GFP-H2A.B in mock- or EHV1-infected EDerm cells. 1302 Error bars, SEM; n³38 cells per treatment from 4 independent experiments. 1303 1304 Fig 11. H2A.B is most mobile in a subpopulation of EHV1 infected cells . 1305 EDerm cells were transfected with plasmids encoding GFP-H2A.B at least 40h prior to 1306 mock-infection or infection with 10 PFU/cell of abortogenic or neurotropic EHV1. Nuclear 1307 mobility of GFP-H2A.B was evaluated by FRAP between 5 and 6hpi. FRAP data for EHV1-1308 infected cells or for mock-infected cell chromatin were pooled and segregated by mobility 1309 group. (A) Bar graph presents the average normalized level of free GFP- H2A.B per mobility 1310 group expressed relative to the average normalized level in the mock-infected cell 1311 chromatin for mobility group 3 (set at 1). (B) Frequency distribution plots show the 1312 percentage of free GFP-H2A.B per individual cell segregated by mobility group. Dashed 1313 vertical black lines, 1 SD above or below the average level of free H2A.B in the mock-1314 infected cell chromatin for mobility group 3. (C) Bar graph presents the average initial 1315 normalized fluorescence recovery rate per GFP-H2A.B mobility group expressed relative to 1316 the average initial normalized fluorescence recovery rate in the mock-infected cell 1317 chromatin of mobility group 3 (set at 1). (D) Frequency distribution plots present the initial 1318 normalized fluorescence recovery rate for GFP-H2A.B per individual cell segregated by 1319 mobility group. Solid or dashed vertical black lines, 1 SD above or below the average initial 1320 normalized fluorescence recovery rate in the mock-infected cell chromatin of mobility 1321 group 3. Error bars, SEM. n³38 cells per treatment from 4 independent experiments. 1322 Di\erent letters denote P<0.01; matching symbols denote P<0.05. Statistical significance 1323 evaluated by ANOVA with post-hoc Tukey Kramer pair-wise analysis. 1324 1325 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 47 Fig 12. EHV1 mobilizes linker histone H1.2. EDerm cells were transfected with 1326 plasmids encoding GFP fused to H1.2 at least 40h before mock-infection or infection with 1327 10 PFU/cell of abortogenic or neurotropic EHV1. Live cells were imaged and GFP-H1.2 1328 mobility evaluated by FRAP between 5 and 6hpi. FRAP data from EHV1 infected cells were 1329 combined and segregated by the presence (RC large) or absence (RC small) of clearly 1330 identifiable RCs. (A) Digital fluorescent (left panels) and DIC (right panels) micrographs 1331 show the nucleus of cells expressing GFP-H1.2. (B) Line graph presents FRAP of GFP-H1.2 1332 in mock- or EHV1-infected cells. (C) Line graph of a representative GFP-H1.2 FRAP in mock-1333 infected cell chromatin (an area such as that denoted by the solid circle in Figure 2A, 1334 mock). The surrogate measures for the levels of H1.2 not bound in chromatin (available in 1335 the “free” pools) or weakly bound in chromatin (undergoing fast chromatin exchange) are 1336 calculated as for the core histones (described in Figure 2). The T50, a summary measure 1337 that primarily reflects low-a\inity chromatin interactions, is calculated as the time after 1338 photobleaching to recover 50% normalized fluorescence in the photobleached region. 1339 Error bars, SEM; n³38 cells per treatment from 4 independent experiments. 1340 1341 Fig 13. H1.2 is most dynamic in EHV1 RCs. EDerm cells were transfected with 1342 plasmids encoding GFP-H1.2 at least 40h prior to mock-infection or infection with 10 1343 PFU/cell of abortogenic or neurotropic EHV1. Nuclear mobility of GFP-H1.2 was evaluated 1344 by FRAP between 5 and 6hpi. FRAP data for EHV1 infected cells were pooled and 1345 segregated by the absence (Small) or presence (Large) of clearly identifiable RCs. (A) Bar 1346 graph presents the average T50 for GFP-H1.2 expressed relative to the average T50 in mock-1347 infected cell chromatin (set at 1). (B) Frequency distribution plots present the T50 for GFP-1348 H1.2 per individual cell. Solid or dashed vertical black lines, 1 SD below (RC) or above 1349 (Infected Cell Chromatin) the average T50 for GFP-H1.2 in mock-infected cell- or nucleolar-1350 chromatin, respectively. The T50 for GFP-H1.2 per individual cell in the mock-infected cell- 1351 or nucleolar-chromatin are plotted in both graphs for comparison. (C) Bar graph presents 1352 the average normalized level of free GFP-H1.2 expressed relative to the average normalized 1353 level in mock-infected cell chromatin (set at 1). (D) Frequency distribution plots show the 1354 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 48 percentage of free GFP- H1.2 per individual cell. Solid or dashed vertical black lines, 1 SD 1355 above the average level of free GFP-H1.2 in mock-infected cell- or nucleolar-chromatin, 1356 respectively. The level of free GFP-H1.2 per individual cell in the mock-infected cell- or 1357 nucleolar- chromatin are plotted in both graphs for comparison. (E) Bar graph presents the 1358 average initial normalized fluorescence recovery rate for GFP-H1.2 expressed relative to the 1359 average initial normalized fluorescence recovery rate in mock-infected cell chromatin (set 1360 at 1). (F) Frequency distribution plots present the initial normalized fluorescence recovery 1361 rate of GFP-H1.2 per individual cell. Solid or dashed vertical black lines, 1 SD above the 1362 average initial normalized fluorescence recovery rate of GFP-H1.2 in mock-infected cell- or 1363 nucleolar-chromatin, respectively. The initial normalized fluorescence recovery rate for 1364 GFP-H1.2 per individual cell in the mock-infected cell- or nucleolar-chromatin are plotted 1365 in both panels for comparison. Error bars, SEM. n³38 cells per treatment from 4 1366 independent experiments. Di\erent letters denote P<0.01; matching symbols denote 1367 P<0.05. Statistical significance evaluated by ANOVA with post-hoc Tukey Kramer pair-wise 1368 analysis. 1369 1370 1371 1372 1373 1374 1375 1376 1377 Table 1. Free histone levels. 1378 1379 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 49 1380 Chromatin 19.8 ± 0.7 100 ± 3 - 23 Nucleolus 31.7 ± 0.8 160 ± 4 ** 94 Small RC 27.0 ± 1.1 133 ± 6 ** 67 Large RC 42.8 ± 1.3 217 ± 6 ** 100 Cell Chromatin 22.0 ± 0.6 111 ± 3 ns 36 Chromatin 19.6 ± 0.7 100 ± 3 - 15 Nucleolus 33.8 ± 1.0 172 ± 5 ** 97 Small RC 27.3 ± 1.2 144 ± 8 ** 77 Large RC 46.3 ± 1.3 234 ± 6 ** 100 Cell Chromatin 22.2 ± 0.7 114 ± 3 ** 32 Chromatin 25.1 ± 1.2 100 ± 4 - 20 Nucleolus 35.9 ± 1.5 144 ± 5 ** 59 Small RC 31.2 ± 1.4 117 ± 4 ns 33 Large RC 43.2 ± 1.5 175 ± 7 ** 81 Cell Chromatin 25.4 ± 1.0 101 ± 4 ns 19 Diffuse 52.3 ± 2.2 256 ± 12 ** 100 Chromatin 21.4 ± 1.1 100 ± 5 - 17 Nucleolus 37.0 ± 1.3 176 ± 6 ** 71 Small RC 24.6 ± 1.1 119 ± 7 ns 19 Large RC 48.6 ± 1.3 237 ± 7 ** 99 Small Cell Chromatin 18.7 ± 1.2 91 ± 7 ns 8b Large Cell Chromatin 26.6 ± 1.0 129 ± 5 * 22 Diffuse 58.4 ± 1.4 270 ± 9 ** 98 Chromatin 20.2 ± 0.7 100 ± 3 - 20 Nucleolus 31.1 ± 1.0 155 ± 5 ** 83 Small RC 25.8 ± 1.3 127 ± 6 * 55 Large RC 47.7 ± 1.1 238 ± 5 ** 100 Cell Chromatin 21.6 ± 0.6 107 ± 3 ns 29 Chromatin 23.3 ± 0.6 100 ± 3 - 10 Nucleolus 33.4 ± 1.0 143 ± 4 ** 90 Small RC 33.8 ± 2.0 147 ± 8 ** 83 Large RC 50.3 ± 1.1 215 ± 5 ** 100 Cell Chromatin 24.2 ± 0.7 104 ± 3 ns 30 Chromatin 20.6 ± 0.7 100 ± 3 - 20 Nucleolus 33.1 ± 1.2 160 ± 5 ** 90 Small RC 34.4 ± 1.8 169 ± 9 ** 93 Large RC 47.2 ± 1.2 229 ± 6 ** 100 Cell Chromatin 21.5 ± 0.6 104 ± 3 ns 24 Chromatin 18.3 ± 0.7 100 ± 3 - 13 Nucleolus 29.4 ± 0.9 161 ± 5 ** 93 Small RC 26.0 ± 1.1 147 ± 8 ** 74 Large RC 42.6 ± 1.1 233 ± 6 ** 100 Cell Chromatin 20.1 ± 0.6 111 ± 4 ns 30 Nucleolus 23.0 ± 0.7 67 ± 2 ** 92b Chromatin 1 23.3 ± 2.1 67 ± 6 * 100b Chromatin 2 28.6 ± 0.9 83 ± 3 ns 50b Chromatin 3 34.5 ± 1.3 100 ± 4 - 7 Chromatin 4 39.1 ± 1.5 113 ± 4 ns 57 Chromatin 1 25.1 ± 1.7 73 ± 5 ** 80b Chromatin 2 32.2 ± 1.0 93 ± 3 ns 37b Chromatin 3 32.1 ± 0.8 93 ± 2 ns 25b Chromatin 4+ 51.5 ± 1.1 149 ± 3 ** 94 Chromatin 23.2 ± 0.6 100 ± 2 - 21 Nucleolus 27.4 ± 0.7 119 ± 3 * 44 Small RC 31.5 ± 1.6 137 ± 6 ** 68 Large RC 44.0 ± 1.3 191 ± 6 ** 100 Cell Chromatin 22.2 ± 0.6 97 ± 3 ns 18 a percentage of cells with a free pool > 1SD above the average in mock-infected cell chromatin b percentage of cells with a free pool > 1SD below the average in mock-infected cell chromatin P values represent post-hoc pairwise comparison with mock chromatin following Anova analysis; ** P <0.01; * P <0.05 * H2A.B normalized to mock mobility group 3 Absolute (Normalized Fluorescence Intensity, %) Relative (% mock cell chromatin) Level of Free Histone (avg ± SEM) Cells with extreme increasea (%) H2B Mock EHV P H4 Mock EHV H3.1 Mock EHV H3.3 Mock EHV H2A Mock EHV H2A.Z Mock EHV H2A.X Mock EHV H1.2 Mock EHV Macro H2A Mock EHV H2A.B* Mock EHV .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 50 Table 2. Initial normalized rates of fluorescence recovery.1381 1382 Chromatin 27.5 ± 2.5 100 ± 7 - 11 Nucleolus 42.3 ± 4.0 156 ± 12 ns 29 Small RC 41.3 ± 6.4 153 ± 37 ns 30 Large RC 61.9 ± 61.9 281 ± 35 ** 56 Cell Chromatin 36.7 ± 2.9 160 ± 16 ns 28 Chromatin 27.5 ± 1.7 100 ± 6 - 16 Nucleolus 27.9 ± 2.2 101 ± 8 ns 19 Small RC 40.8 ± 4.5 154 ± 18 ns 55 Large RC 84.5 ± 6.0 304 ± 20 ** 84 Cell Chromatin 51.4 ± 3.3 187 ± 11 ** 65 Chromatin 73.9 ± 8.9 100 ± 10 - 13 Nucleolus 84.0 ± 10.5 110 ± 10 ns 15 Small RC 75.7 ± 12.3 85 ± 15 ns 7 Large RC 90.0 ± 8.2 155 ± 18 ns 25 Cell Chromatin 61.8 ± 6.2 94 ± 10 ns 12 Diffuse 215.3 ± 19.1 373 ± 36 ** 82 Chromatin 44.3 ± 7.1 100 ± 11 - 10 Nucleolus 46.6 ± 5.5 118 ± 14 ns 14 Small RC 39.7 ± 6.4 162 ± 39 ns 13 Large RC 75.7 ± 7.7 260 ± 40 * 23 Cell Chromatin 49.8 ± 4.6 157 ± 18 ns 11 Diffuse 194.7 ± 11.5 502 ± 40 ** 89 Chromatin 24.3 ± 2.0 100 ± 5 - 11 Nucleolus 37.3 ± 2.9 162 ± 10 ns 36 Small RC 31.1 ± 4.6 110 ± 20 ns 32 Large RC 72.9 ± 5.6 357 ± 27 ** 82 Small Cell Chromatin 27.6 ± 2.4 99 ± 17 ns 25 Large Cell Chromatin 40.8 ± 2.2 202 ± 12 * 44 Chromatin 35.0 ± 2.9 100 ± 8 - 18 Nucleolus 37.7 ± 2.8 111 ± 9 ns 13 Small RC 53.5 ± 8.2 154 ± 28 ns 45 Large RC 85.0 ± 6.8 263 ± 25 ** 70 Cell Chromatin 49.6 ± 3.4 152 ± 13 ns 32 Chromatin 24.9 ± 1.8 100 ± 6 - 15 Nucleolus 34.5 ± 2.8 137 ± 10 ns 43 Small RC 42.1 ± 8.9 189 ± 49 ns 36 Large RC 48.4 ± 4.1 212 ± 14 ** 58 Cell Chromatin 31.8 ± 1.8 136 ± 9 ns 25 Chromatin 23.1 ± 2.4 100 ± 9 - 10 Nucleolus 28.2 ± 2.6 123 ± 11 ns 16 Small RC 26.8 ± 2.5 119 ± 13 ns 8 Large RC 46.9 ± 5.7 210 ± 26 ** 48 Cell Chromatin 26.3 ± 1.8 116 ± 9 ns 20 Nucleolus 211.0 ± 10.9 97 ± 5 ns 15 Chromatin 1 90.3 ± 13.0 42 ± 6 ** 100b Chromatin 2 176.9 ± 20.0 81 ± 9 ns 33b Chromatin 3 217.3 ± 20.2 100 ± 9 - 13 Chromatin 4 350.6 ± 31.8 161 ± 15 ** 71 Chromatin 1 85.0 ± 7.1 39 ± 3 ** 100b Chromatin 2 130.1 ± 6.0 60 ± 3 ** 65b Chromatin 3 132.3 ± 6.1 61 ± 3 ** 66b Chromatin 4+ 187.5 ± 6.1 86 ± 3 ns 8b Chromatin 42.0 ± 1.6 100 ± 4 - 18 Nucleolus 41.4 ± 2.4 99 ± 6 ns 13 Small RC 59.6 ± 3.7 142 ± 9 ** 60 Large RC 57.5 ± 4.5 138 ± 11 ** 57 Cell Chromatin 44.0 ± 1.7 106 ± 4 ns 25 a percentage of cells with an initial fluorescence recovery rate > 1SD above the average in mock-infected cell chromatin b percentage of cells with an initial fluorescence recovery rate >1SD below the average in mock-infected cell chromatin P values represent post-hoc pairwise comparison with mock chromatin following Anova analysis; ** P <0.01; * P <0.05 * H2A.B normalized to mock mobility group 3 Absolute (Normalized Fluorescence Intensity/ms) Relative (% mock cell chromatin) P Cells with extreme increasea (%) H2B Mock EHV Initial Fluorescence Recovery Rates (avg ± SEM) H4 Mock EHV H3.1 Mock EHV H3.3 Mock EHV H2A Mock EHV H2A.Z Mock EHV H2A.X Mock EHV H1.2 Mock EHV Macro H2A Mock EHV H2A.B* Mock EHV .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 51 Table 3. Normalized rates of slow fluorescence recovery. 1383 1384 Table 4. PCR primer sequences. 1385 Chromatin 0.60 ± 0.06 100 ± 10 - 16 Nucleolus 0.70 ± 0.09 115 ± 15 ns 15 RC 0.88 ± 0.10 144 ± 16 ns 28 Cell Chromatin 0.69 ± 0.05 114 ± 9 ns 24 Chromatin 0.97 ± 0.10 100 ± 10 - 17 Nucleolus 1.09 ± 0.15 116 ± 14 ns 20 RC 1.11 ± 0.09 127 ± 12 ns 27 Cell Chromatin 0.95 ± 0.08 108 ± 10 ns 20 Chromatin 1.52 ± 0.31 100 ± 16 - 13 Nucleolus 2.06 ± 0.43 130 ± 24 ns 14 RC 1.31 ± 0.17 120 ± 23 ns 4 Cell Chromatin 0.88 ± 0.10 77 ± 11 ns 0b Diffuse 1.96 ± 0.28 155 ± 46 ns 14 Chromatin 1.14 ± 0.13 100 ± 10 - 21 Nucleolus 1.83 ± 0.20 167 ± 18 ns 39 RC 1.66 ± 0.22 168 ± 25 ns 30 Cell Chromatin 1.13 ± 0.12 108 ± 12 ns 11 Diffuse 1.26 ± 0.17 105 ± 14 ns 13 Chromatin 0.71 ± 0.07 100 ± 9 - 16 Nucleolus 0.82 ± 0.09 119 ± 13 ns 20 RC 1.08 ± 0.09 152 ± 12 * 33 Cell Chromatin 0.90 ± 0.08 126 ± 10 ns 30 Chromatin 0.83 ± 0.07 100 ± 8 - 14 Nucleolus 0.99 ± 0.11 119 ± 13 ns 32 RC 1.67 ± 0.17 146 ± 14 ** 60 Cell Chromatin 1.17 ± 0.08 139 ± 10 ns 38 Chromatin 0.71 ± 0.10 100 ± 12 - 10 Nucleolus 0.96 ± 0.11 136 ± 14 ns 30 RC 1.15 ± 0.12 191 ± 27 ns 35 Cell Chromatin 0.93 ± 0.11 154 ± 24 ns 15 Chromatin 0.78 ± 0.11 100 ± 14 - 10 Nucleolus 1.14 ± 0.15 147 ± 20 ns 33 RC 1.20 ± 0.12 150 ± 14 ns 25 Cell Chromatin 0.77 ± 0.06 100 ± 8 ns 11 a percentage of cells with a slow fluorescence recovery rate > 1SD above the average in mock-infected cell chromatin b percentage of cells with a slow fluorescence recovery rate >1SD below the average in mock-infected cell chromatin P values represent post-hoc pairwise comparison with mock chromatin following Anova analysis; ** P <0.01; * P <0.05 H2A Mock EHV H2A.Z Absolute (Normalized Fluorescence Intensity/ ms) Relative (% mock chromatin) Mock EHV Cells with Extreme increasea (%) H3.3 Mock EHV H4 Mock EHV H2B Mock EHV H3.1 Mock EHV Slow Fluorescence Recovery Rates (avg ± SEM) P H2A.X Mock EHV Macro H2A Mock EHV .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 52 1386 Restriction enzyme recognition sequences are bolded. 1387 Table 5. Synthetic DNA sequences. 1388 1389 Restriction enzyme recognition sequences are bolded. 1390 1391 1392 Primer Sequence (5` to 3`) H2A.Z F AAAAAGATCT ATGGCTGGCGGTAAGGCTGGA H2A.Z R AAAAAAGCTT TTAGGTGGCGACCGGTGGATC H2A.X S131A F TGGGGCCGAAGGCGCCCGCGGGCGGCAAGA H2A.X S131A R CCTTCTTGCCGCCCGCGGGCGCCTTCGG H2A F TTTTAGATCT ACCATGTCTGGACGTGGCAAGCA H2A R TTTTGTCGAC AGCCCTTACTTGCCCTTAGCTT H1 F TTTTAGATCT GAACCTTTGGTGTTCAGCATG H1 R TTTTAAGCTT AAGCAGACGTTCGACCTACTT gBlock Sequence (5` to 3`) MacroH2A TTTTTTAGATCT ATGAGTAGCCGTGGTGGAAAGAAAAAGAGTACGAAAACCTCACGCTCTGCCAAGG CCGGAGTCATCTTCCCCGTCGGTCGCATGCTGCGTTATATCAAAAAGGGTCACCCTAAGTACAGAA TTGGGGTCGGTGCTCCCGTTTATATGGCTGCCGTGCTGGAATATCTGACAGCGGAGATTCTGGAGC TGGCCGGGAACGCCGCACGTGATAACAAGAAAGGAAGGGTTACCCCCAGGCACATCCTCCTGG CCGTCGCCAACGACGAGGAACTGAATCAGCTCCTGAAGGGCGTGACGATCGCCAGCGGGGGT GTGCTTCCTAACATTCACCCTGAGTTGCTGGCTAAGAAACGTGGCAGCAAAGGCAAGTTGGAGGC CATTATCATGCCTCCCCCGGCTAAGAAAGCTAAGTCTCCGTCTCAGAAAAAGCCCGTGTCTAAGAA AGCCGGAGGCAAAAAGGGAGCCCGCAAGTCCAAAAAGCAGGGCGAGGTTTCTAAGGCAGCTTCC GCTGACTCTACTACCGAGGGCACCCCCGCCGATGGCTTCACCGTACTCAGCACCAAATCTTTGTT TCTTGGCCAGAAGTTGAATCTGATCCACAGCGAGATCAGTAACCTGGCTGGCTTCGAAGTGGAGGC GATCATTAATCCCACCAACGCCGACATCGACCTGAAAGATGACTTGGGCAACACTCTGGAGAAAAA GGGTGGGAAGGAGTTCGTGGAGGCTGTGCTCGAGTTGCGCAAAAAGAACGGCCCTCTCGAGGTC GCTGGCGCTGCCCTGTCTGCCGGCCACGGCTTGCCTGCTAAGTTTGTAATCCACTGCAACTCTC CAGTGTGGGGCGTGGACAAGTGCGAGGAACTGTTGGAGAAAACTGTCAAGAACTGCCTCGCACTG GCCGATGACAAAAAGCTCAAGAGTATCGCCTTTCCCAGTATCGGTAGCGGCCGCAACGGGTTTCC AAAACAGACAGCCGCGCAGCTGATCCTGAAAGCCATCTCTAGCTACTTCGTGTCCACTATGTCATC CTCTATCAAGACCGTTTATTTCGTACTGTTCGATTCTGAATCTATCGGTATTTATGTGCAGGAGATGGC GAAGCTTGATGCAAACTAGGGTACC TTTTTT H2A.B TTTTTTAGATCT ATGCCAGGCAATCGGTCCCGCCGTCGCCGTGGTAGCTCCCATGGCCAGGGTC GGCCTCGCTCACGTACAGCGCGCGCTCAACTTCTGTTCTCCGTCTCTTGGGTGGAGCACTTGCT CAGGGAAGGCCACTATGCACGCAGGTTGTCTCCGTCTGCACCTGTCTTTCTGGCCGCTGTCATTC AATACCTGACCGCCAAGGTGCTGGAACTGGCAGGCAATGAAGCATGCAAGTCCGGCCGCCGGA GGATCACTCCAGAATTGGTGGATATGGCTGTGCACAATAACGCTCTCCTGTCTGGGTTCTTTGGCG CGACAACCATCAGCCAGGTGGCCCCTGGTAGAGAGTAGAAGCTT TTTTTT .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 53

1393 1. Lunn DP, Davis-Poynter N, Flaminio MJ et al. Equine herpesvirus-1 consensus 1394 statement. J Vet Intern Med. 2009;23:450-461. 1395 2. Dunowska M. A review of equid herpesvirus 1 for the veterinary practitioner. Part B: 1396 pathogenesis and epidemiology. N Z Vet J. 2014;62:179-188. 1397 3. Vandekerckhove AP, Glorieux S, Gryspeerdt AC et al. Replication kinetics of 1398 neurovirulent versus non-neurovirulent equine herpesvirus type 1 strains in equine 1399 nasal mucosal explants. J Gen Virol. 2010;91:2019-2028. 1400 4. Baghi HB, Nauwynck HJ. Impact of equine herpesvirus type 1 (EHV-1) infection on the 1401 migration of monocytic cells through equine nasal mucosa. Comp Immunol Microbiol 1402 Infect Dis. 2014;37:321-329. 1403 5. Laval K, Favoreel HW, Poelaert KCK, Van Cleemput J, Nauwynck HJ. Equine 1404 Herpesvirus Type 1 Enhances Viral Replication in CD172a+ Monocytic Cells upon 1405 Adhesion to Endothelial Cells. J Virol. 2015;89:10912-10923. 1406 6. Laval K, Poelaert KCK, Van Cleemput J et al. The Pathogenesis and Immune Evasive 1407 Mechanisms of Equine Herpesvirus Type 1. Front Microbiol. 2021;12:662686. 1408 7. Nugent J, Birch-Machin I, Smith KC et al. Analysis of equid herpesvirus 1 strain 1409 variation reveals a point mutation of the DNA polymerase strongly associated with 1410 neuropathogenic versus nonneuropathogenic disease outbreaks. J Virol. 1411 2006;80:4047-4060. 1412 8. Goodman LB, Loregian A, Perkins GA et al. A point mutation in a herpesvirus 1413 polymerase determines neuropathogenicity. PLoS Pathog. 2007;3:e160. 1414 9. Van de Walle GR, Goupil R, Wishon C, Damiani A, Perkins GA, Osterrieder N. A single-1415 nucleotide polymorphism in a herpesvirus DNA polymerase is su\icient to cause 1416 lethal neurological disease. J Infect Dis. 2009;200:20-25. 1417 10. Sutton G, Thieulent C, Fortier C et al. Identification of a New Equid Herpesvirus 1 DNA 1418 Polymerase (ORF30) Genotype with the Isolation of a C2254/H752 Strain in French 1419 Horses Showing no Major Impact on the Strain Behaviour. Viruses. 2020;12:1160. 1420 11. Bryant NA, Wilkie GS, Russell CA et al. Genetic diversity of equine herpesvirus 1 1421 isolated from neurological, abortigenic and respiratory disease outbreaks. 1422 Transbound Emerg Dis. 2018;65:817-832. 1423 12. Lunn DP, Burgess BA, Dorman DC et al. Updated ACVIM consensus statement on 1424 equine herpesvirus-1. J Vet Intern Med. 2024;38:1290-1299. 1425 13. Laval K, Favoreel HW, Nauwynck HJ. Equine herpesvirus type 1 replication is delayed 1426 in CD172a+ monocytic cells and controlled by histone deacetylases. J Gen Virol. 1427 2015;96:118-130. 1428 14. Laval K, Van Cleemput J, Poelaert KC, Brown IK, Nauwynck HJ. Replication of 1429 neurovirulent equine herpesvirus type 1 (EHV-1) in CD172a+ monocytic cells. Comp 1430 Immunol Microbiol Infect Dis. 2017;50:58-62. 1431 15. Mohamed E, Zarak I, Vereecke N, Theuns S, Laval K, Nauwynck H. Genomic analysis 1432 and replication kinetics of the closely related EHV-1 neuropathogenic 21P40 and 1433 abortigenic 97P70 strains. Vet Res. 2025;56:12. 1434 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 54 16. Tallmadge RL, Žygelytė E, Van de Walle GR, Kristie TM, Felippe MJB. E\ect of a 1435 Histone Demethylase Inhibitor on Equine Herpesvirus-1 Activity In Vitro. Front Vet Sci. 1436 2018;5:34. 1437 17. Luger K, Mäder AW, Richmond RK, Sargent DF, Richmond TJ. Crystal structure of the 1438 nucleosome core particle at 2.8 A resolution. Nature. 1997;389:251-260. 1439 18. Armstrong C, Spencer SL. Replication-dependent histone biosynthesis is coupled to 1440 cell-cycle commitment. Proc Natl Acad Sci U S A. 2021;118:e2100178118. 1441 19. Tagami H, Ray-Gallet D, Almouzni G, Nakatani Y. Histone H3.1 and H3.3 complexes 1442 mediate nucleosome assembly pathways dependent or independent of DNA 1443 synthesis. Cell. 2004;116:51-61. 1444 20. Talbert PB, Heniko\ S. Histone variants on the move: substrates for chromatin 1445 dynamics. Nat Rev Mol Cell Biol. 2017;18:115-126. 1446 21. Mandemaker IK, Fessler E, Corujo D et al. The histone chaperone ANP32B regulates 1447 chromatin incorporation of the atypical human histone variant macroH2A. Cell Rep. 1448 2023;42:113300. 1449 22. Corujo D, Buschbeck M. Post-Translational Modifications of H2A Histone Variants 1450 and Their Role in Cancer. Cancers (Basel). 2018;10:59. 1451 23. Li A, Yu Y, Lee S-C, Ishibashi T, Lees-Miller SP, Ausió J. Phosphorylation of histone 1452 H2A.X by DNA-dependent protein kinase is not a\ected by core histone acetylation, 1453 but it alters nucleosome stability and histone H1 binding. J Biol Chem. 1454 2010;285:17778-17788. 1455 24. Horikoshi N, Arimura Y, Taguchi H, Kurumizaka H. Crystal structures of heterotypic 1456 nucleosomes containing histones H2A.Z and H2A. Open Biol. 2016;6 1457 25. Jung H, Sokolova V, Lee G, Stevens VR, Tan D. Structural and Biochemical 1458 Characterization of the Nucleosome Containing Variants H3.3 and H2A.Z. 1459 Epigenomes. 2024;8:21. 1460 26. Diegmüller F, Leers J, Hake SB. The “Ins and Outs and What-Abouts” of H2A.Z: A 1461 tribute to C. David Allis. J Biol Chem. 2025;301:108154. 1462 27. Angelov D, Molla A, Perche P-Y et al. The histone variant macroH2A interferes with 1463 transcription factor binding and SWI/SNF nucleosome remodeling. Mol Cell. 1464 2003;11:1033-1041. 1465 28. Chakravarthy S, Patel A, Bowman GD. The basic linker of macroH2A stabilizes DNA at 1466 the entry/exit site of the nucleosome. Nucleic Acids Res. 2012;40:8285-8295. 1467 29. Sun Z, Bernstein E. Histone variant macroH2A: from chromatin deposition to 1468 molecular function. Essays Biochem. 2019;63:59-74. 1469 30. Kozlowski M, Corujo D, Hothorn M et al. MacroH2A histone variants limit chromatin 1470 plasticity through two distinct mechanisms. EMBO Rep. 2018;19:e44445. 1471 31. Douet J, Corujo D, Malinverni R et al. MacroH2A histone variants maintain nuclear 1472 organization and heterochromatin architecture. J Cell Sci. 2017;130:1570-1582. 1473 32. Doyen C-M, An W, Angelov D et al. Mechanism of polymerase II transcription 1474 repression by the histone variant macroH2A. Mol Cell Biol. 2006;26:1156-1164. 1475 33. Jiang X, Soboleva TA, Tremethick DJ. Short Histone H2A Variants: Small in Stature but 1476 not in Function. Cells. 2020;9 1477 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 55 34. Peng J, Yuan C, Hua X, Zhang Z. Molecular mechanism of histone variant H2A.B on 1478 stability and assembly of nucleosome and chromatin structures. Epigenetics 1479 Chromatin. 2020;13:28. 1480 35. Bao Y, Konesky K, Park Y-J et al. Nucleosomes containing the histone variant H2A.Bbd 1481 organize only 118 base pairs of DNA. EMBO J. 2004;23:3314-3324. 1482 36. Gautier T, Abbott DW, Molla A, Verdel A, Ausio J, Dimitrov S. Histone variant H2ABbd 1483 confers lower stability to the nucleosome. EMBO Rep. 2004;5:715-720. 1484 37. Tolstorukov MY, Goldman JA, Gilbert C, Ogryzko V, Kingston RE, Park PJ. Histone 1485 variant H2A.Bbd is associated with active transcription and mRNA processing in 1486 human cells. Mol Cell. 2012;47:596-607. 1487 38. Soboleva TA, Nekrasov M, Pahwa A, Williams R, Huttley GA, Tremethick DJ. A unique 1488 H2A histone variant occupies the transcriptional start site of active genes. Nat Struct 1489 Mol Biol. 2011;19:25-30. 1490 39. Sansoni V, Casas-Delucchi CS, Rajan M et al. The histone variant H2A.Bbd is 1491 enriched at sites of DNA synthesis. Nucleic Acids Res. 2014;42:6405-6420. 1492 40. Hirano R, Arimura Y, Kujirai T et al. Histone variant H2A.B-H2B dimers are 1493 spontaneously exchanged with canonical H2A-H2B in the nucleosome. Commun 1494 Biol. 2021;4:191. 1495 41. Goldberg AD, Banaszynski LA, Noh K-M et al. Distinct factors control histone variant 1496 H3.3 localization at specific genomic regions. Cell. 2010;140:678-691. 1497 42. Lewis PW, Elsaesser SJ, Noh K-M, Stadler SC, Allis CD. Daxx is an H3.3-specific 1498 histone chaperone and cooperates with ATRX in replication-independent chromatin 1499 assembly at telomeres. Proc Natl Acad Sci U S A. 2010;107:14075-14080. 1500 43. Hoelper D, Huang H, Jain AY, Patel DJ, Lewis PW. Structural and mechanistic insights 1501 into ATRX-dependent and -independent functions of the histone chaperone DAXX. 1502 Nat Commun. 2017;8:1193. 1503 44. Palmer DK, O’Day K, Trong HL, Charbonneau H, Margolis RL. Purification of the 1504 centromere-specific protein CENP-A and demonstration that it is a distinctive 1505 histone. Proc Natl Acad Sci U S A. 1991;88:3734-3738. 1506 45. Tachiwana H, Kagawa W, Shiga T et al. Crystal structure of the human centromeric 1507 nucleosome containing CENP-A. Nature. 2011;476:232-235. 1508 46. Takizawa Y, Ho C-H, Tachiwana H et al. Cryo-EM Structures of Centromeric Tri-1509 nucleosomes Containing a Central CENP-A Nucleosome. Structure. 2020;28:44-1510 53.e4. 1511 47. Ali-Ahmad A, Bilokapić S, Schäfer IB, Halić M, Sekulić N. CENP-C unwraps the human 1512 CENP-A nucleosome through the H2A C-terminal tail. EMBO Rep. 2019;20:e48913. 1513 48. Conn KL, Hendzel MJ, Schang LM. Linker histones are mobilized during infection with 1514 herpes simplex virus type 1. J Virol. 2008;82:8629-8646. 1515 49. Conn KL, Hendzel MJ, Schang LM. Core histones H2B and H4 are mobilized during 1516 infection with herpes simplex virus 1. J Virol. 2011;85:13234-13252. 1517 50. Conn KL, Hendzel MJ, Schang LM. The di\erential mobilization of histones H3.1 and 1518 H3.3 by herpes simplex virus 1 relates histone dynamics to the assembly of viral 1519 chromatin. PLoS Pathog. 2013;9:e1003695. 1520 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 56 51. Flores Cortes E, Saddoris SM, Owens AK, Gibeault R, Depledge DP, Schang LM. 1521 Histone H2A variant H2A.B is enriched in transcriptionally active and replicating HSV-1522 1 lytic chromatin. J Virol. 2024;98:e0201523. 1523 52. Gibeault RL. The Herpes Simplex Virus 1 Transcription Activator ICP4 Modulates 1524 Histone Dynamics. Thesis submitted in partial fulfillment of the requirments for the 1525 degree of Doctor of Philosophy. 2017 1526 53. Hendzel MJ, Lever MA, Crawford E, Th’ng JPH. The C-terminal domain is the primary 1527 determinant of histone H1 binding to chromatin in vivo. J Biol Chem. 2004;279:20028-1528 20034. 1529 54. Lever MA, Th’ng JP, Sun X, Hendzel MJ. Rapid exchange of histone H1.1 on chromatin 1530 in living human cells. Nature. 2000;408:873-876. 1531 55. Misteli T, Gunjan A, Hock R, Bustin M, Brown DT. Dynamic binding of histone H1 to 1532 chromatin in living cells. Nature. 2000;408:877-881. 1533 56. Th’ng JPH, Sung R, Ye M, Hendzel MJ. H1 family histones in the nucleus. Control of 1534 binding and localization by the C-terminal domain. J Biol Chem. 2005;280:27809-1535 27814. 1536 57. Kimura H, Cook PR. Kinetics of core histones in living human cells: little exchange of 1537 H3 and H4 and some rapid exchange of H2B. J Cell Biol. 2001;153:1341-1353. 1538 58. Siino JS, Nazarov IB, Svetlova MP et al. Photobleaching of GFP-labeled H2AX in 1539 chromatin: H2AX has low di\usional mobility in the nucleus. Biochem Biophys Res 1540 Commun. 2002;297:1318-1323. 1541 59. Li W, Nagaraja S, Delcuve GP, Hendzel MJ, Davie JR. E\ects of histone acetylation, 1542 ubiquitination and variants on nucleosome stability. Biochem J. 1993;296:737-744. 1543 60. Gibeault RL, Conn KL, Bildersheim MD, Schang LM. An Essential Viral Transcription 1544 Activator Modulates Chromatin Dynamics. PLoS Pathog. 2016;12:e1005842. 1545 61. editors. Transcriptional Competence and the Unusually Highly Dynamic HSV-1 1546 Chromatin. 2021; 2021. 1547 62. Hu M, Depledge DP, Flores Cortes E, Breuer J, Schang LM. Chromatin dynamics and 1548 the transcriptional competence of HSV-1 genomes during lytic infections. PLoS 1549 Pathog. 2019;15:e1008076. 1550 63. Lacasse JJ, Schang LM. During lytic infections, herpes simplex virus type 1 DNA is in 1551 complexes with the properties of unstable nucleosomes. J Virol. 2010;84:1920-1933. 1552 64. Lacasse JJ, Schang LM. Herpes simplex virus 1 DNA is in unstable nucleosomes 1553 throughout the lytic infection cycle, and the instability of the nucleosomes is 1554 independent of DNA replication. J Virol. 2012;86:11287-11300. 1555 65. Long M, Sun X, Shi W et al. A novel histone H4 variant H4G regulates rDNA 1556 transcription in breast cancer. Nucleic Acids Res. 2019;47:8399-8409. 1557 66. Pang MYH, Sun X, Ausió J, Ishibashi T. Histone H4 variant, H4G, drives ribosomal RNA 1558 transcription and breast cancer cell proliferation by loosening nucleolar chromatin 1559 structure. J Cell Physiol. 2020;235:9601-9608. 1560 67. Higashi T, Matsunaga S, Isobe K et al. Histone H2A mobility is regulated by its tails 1561 and acetylation of core histone tails. Biochem Biophys Res Commun. 2007;357:627-1562 632. 1563 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 57 68. Horikoshi N, Sato K, Shimada K et al. Structural polymorphism in the L1 loop regions 1564 of human H2A.Z.1 and H2A.Z.2. Acta Crystallogr D Biol Crystallogr. 2013;69:2431-1565 2439. 1566 69. Arimura Y, Kimura H, Oda T et al. Structural basis of a nucleosome containing histone 1567 H2A.B/H2A.Bbd that transiently associates with reorganized chromatin. Sci Rep. 1568 2013;3:3510. 1569 70. Pehrson JR, Cole RD. Histone H1 subfractions and H10 turnover at di\erent rates in 1570 nondividing cells. Biochemistry. 1982;21:456-460. 1571 71. Albrecht RA, Jang HK, Kim SK, O’Callaghan DJ. Direct interaction of TFIIB and the IE 1572 protein of equine herpesvirus 1 is required for maximal trans-activation function. 1573 Virology. 2003;316:302-312. 1574 72. Jang HK, Albrecht RA, Buczynski KA, Kim SK, Derbigny WA, O’Callaghan DJ. Mapping 1575 the sequences that mediate interaction of the equine herpesvirus 1 immediate-early 1576 protein and human TFIIB. J Virol. 2001;75:10219-10230. 1577 73. Kim SK, Smith RH, O’Callaghan DJ. Characterization of DNA binding properties of the 1578 immediate-early gene product of equine herpesvirus type 1. Virology. 1995;213:46-1579 56. 1580 74. Kim SK, Shakya AK, O’Callaghan DJ. Full trans-activation mediated by the immediate-1581 early protein of equine herpesvirus 1 requires a consensus TATA box, but not its 1582 cognate binding sequence. Virus Res. 2016;211:222-232. 1583 75. Smith RH, Zhao Y, O’Callaghan DJ. The equine herpesvirus type 1 immediate-early 1584 gene product contains an acidic transcriptional activation domain. Virology. 1585 1994;202:760-770. 1586 76. Cli\e AR, Knipe DM. Herpes simplex virus ICP0 promotes both histone removal and 1587 acetylation on viral DNA during lytic infection. J Virol. 2008;82:12030-12038. 1588 77. Conn KL, Schang LM. Chromatin dynamics during lytic infection with herpes simplex 1589 virus 1. Viruses. 2013;5:1758-1786. 1590 78. Kent JR, Zeng PY, Atanasiu D, Gardner J, Fraser NW, Berger SL. During lytic infection 1591 herpes simplex virus type 1 is associated with histones bearing modifications that 1592 correlate with active transcription. J Virol. 2004;78:10178-10186. 1593 79. Kristie TM. Dynamic modulation of HSV chromatin drives initiation of infection and 1594 provides targets for epigenetic therapies. Virology. 2015;479-480:555-561. 1595 80. Kutluay SB, Triezenberg SJ. Regulation of histone deposition on the herpes simplex 1596 virus type 1 genome during lytic infection. J Virol. 2009;83:5835-5845. 1597 81. Leinbach SS, Summers WC. The structure of herpes simplex virus type 1 DNA as 1598 probed by micrococcal nuclease digestion. J Gen Virol. 1980;51:45-59. 1599 82. Placek BJ, Huang J, Kent JR et al. The histone variant H3.3 regulates gene expression 1600 during lytic infection with herpes simplex virus type 1. J Virol. 2009;83:1416-1421. 1601 83. Bertrand L, Pearson A. The conserved N-terminal domain of herpes simplex virus 1 1602 UL24 protein is su\icient to induce the spatial redistribution of nucleolin. J Gen Virol. 1603 2008;89:1142-1151. 1604 84. Lymberopoulos MH, Pearson A. Involvement of UL24 in herpes-simplex-virus-1-1605 induced dispersal of nucleolin. Virology. 2007;363:397-409. 1606 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 58 85. Ouellet Lavallée G, Pearson A. Upstream binding factor inhibits herpes simplex virus 1607 replication. Virology. 2015;483:108-116. 1608 86. López MR, Schlegel EFM, Wintersteller S, Blaho JA. The major tegument structural 1609 protein VP22 targets areas of dispersed nucleolin and marginalized chromatin during 1610 productive herpes simplex virus 1 infection. Virus Res. 2008;136:175-188. 1611 87. Callé A, Ugrinova I, Epstein AL, Bouvet P, Diaz J-J, Greco A. Nucleolin is required for 1612 an e\icient herpes simplex virus type 1 infection. J Virol. 2008;82:4762-4773. 1613 88. Sirtori C, Bosisio-Bestetti M. Nucleolar changes in KB tumor cells infected with 1614 herpes simplex virus. Cancer Res. 1967;27:367-376. 1615 89. Leopardi R, Roizman B. Functional interaction and colocalization of the herpes 1616 simplex virus 1 major regulatory protein ICP4 with EAP, a nucleolar-ribosomal 1617 protein. Proc Natl Acad Sci U S A. 1996;93:4572-4576. 1618 90. Lymberopoulos MH, Pearson A. Relocalization of upstream binding factor to viral 1619 replication compartments is UL24 independent and follows the onset of herpes 1620 simplex virus 1 DNA synthesis. J Virol. 2010;84:4810-4815. 1621 91. Stow ND, Evans VC, Matthews DA. Upstream-binding factor is sequestered into 1622 herpes simplex virus type 1 replication compartments. J Gen Virol. 2009;90:69-73. 1623 92. Bertrand L, Leiva-Torres GA, Hyjazie H, Pearson A. Conserved residues in the UL24 1624 protein of herpes simplex virus 1 are important for dispersal of the nucleolar protein 1625 nucleolin. J Virol. 2010;84:109-118. 1626 93. Lymberopoulos MH, Bourget A, Ben Abdeljelil N, Pearson A. Involvement of the UL24 1627 protein in herpes simplex virus 1-induced dispersal of B23 and in nuclear egress. 1628 Virology. 2011;412:341-348. 1629 94. Knizewski L, Kinch L, Grishin NV, Rychlewski L, Ginalski K. Human herpesvirus 1 UL24 1630 gene encodes a potential PD-(D/E)XK endonuclease. J Virol. 2006;80:2575-2577. 1631 95. Kim SK, Buczynski KA, Caughman GB, O’Callaghan DJ. The equine herpesvirus 1 1632 immediate-early protein interacts with EAP, a nucleolar-ribosomal protein. Virology. 1633 2001;279:173-184. 1634 96. Monier K, Armas JC, Etteldorf S, Ghazal P, Sullivan KF. Annexation of the 1635 interchromosomal space during viral infection. Nat Cell Biol. 2000;2:661-665. 1636 97. Angelov D, Bondarenko VA, Almagro S et al. Nucleolin is a histone chaperone with 1637 FACT-like activity and assists remodeling of nucleosomes. EMBO J. 2006;25:1669-1638 1679. 1639 98. Okuwaki M, Matsumoto K, Tsujimoto M, Nagata K. Function of nucleophosmin/B23, a 1640 nucleolar acidic protein, as a histone chaperone. FEBS Lett. 2001;506:272-276. 1641 99. Sen Gupta A, Joshi G, Pawar S, Sengupta K. Nucleolin modulates 1642 compartmentalization and dynamics of histone 2B-ECFP in the nucleolus. Nucleus. 1643 2018;9:350-367. 1644 100. Goldstein M, Derheimer FA, Tait-Mulder J, Kastan MB. Nucleolin mediates 1645 nucleosome disruption critical for DNA double-strand break repair. Proc Natl Acad 1646 Sci U S A. 2013;110:16874-16879. 1647 101. Erard MS, Belenguer P, Caizergues-Ferrer M, Pantaloni A, Amalric F. A major 1648 nucleolar protein, nucleolin, induces chromatin decondensation by binding to 1649 histone H1. Eur J Biochem. 1988;175:525-530. 1650 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 59 102. Gadad SS, Senapati P, Syed SH et al. The multifunctional protein nucleophosmin 1651 (NPM1) is a human linker histone H1 chaperone. Biochemistry. 2011;50:2780-2789. 1652 103. Schindelin J, Arganda-Carreras I, Frise E et al. Fiji: an open-source platform for 1653 biological-image analysis. Nat Methods. 2012;9:676-682. 1654 104. Draizen EJ, Shaytan AK, Mariño-Ramírez L, Talbert PB, Landsman D, Panchenko AR. 1655 HistoneDB 2.0: a histone database with variants--an integrated resource to explore 1656 histones and their variants. Database (Oxford). 2016;2016:baw014. 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint Fig 1 Mock Abortogenic Neurotropic Small RCLarge RC EHV1 GFP-H2B Small RCLarge RC GFP-H4 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint Fig 2 0.0 0.2 0.4 0.6 0.8 1.0 -2 6 14 22 30 Relative Fluorescence Intensity Time 0.1 0.3 0 Relative free histone Initial fluorescence re cove ry rate Faster chromatin exchange Slower chromatin exchange Slow fluorescence re cove ry rate B 0.2 Mock Photobleach EHV1 Pre-photobleach Time, s 1 30 DIC GFP-H4A .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint -2 8 18 28 0.0 0.2 0.4 0.6 0.8 1.0 -2 8 18 28 Abortogenic Neurotropic Time, s Fig 3 Fluorescence Intensity, relative levels EHV1: / RC / Infe cte d cell chro ma tin Mock: Nucleol ar chromatin Cell chromatin .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint EHV1: RC Infected cell chromatin Mock: Nucleol ar chromatin Cell chromatin 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 Fig 4 A Fluorescence Intensity, relative levels B Time, s H4H2B Large RCs Small RCs 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 0. 9 1. 3 1. 7 2. 1 2. 5 0 25 50 75 10 0 0 25 50 75 10 0 Fig 5 Free histone, relative levels 66 Free histone per individual cell, % 18 30 42 54 // 666 18 30 42 54 // a b c e H4 0. 9 1. 3 1. 7 2. 1 2. 5 A Cells, % B RC Infected Cell Chromatin H2B a b b,d c a,d † ‡ † Small Mo ck Nucleol i Large d 0 25 50 75 10 0 0 25 50 75 10 0 7 21 35 49 // // 63 77 7 21 35 49 63 77 ‡ Large+ Small 0. 8 1. 2 1. 6 2. 0 0. 9 1. 5 2. 1 2. 7 3. 3 0. 9 1. 5 2. 1 2. 7 3. 3 0 25 50 75 10 0 0 25 50 75 10 0 222 6 10 14 18 // 222 6 10 14 18 // 0 25 50 75 10 0 0 25 50 75 10 0 2.5 7.5 12 .5 // // 17 .5 22 .5 27 .5 2.5 7.5 12 .5 17 .5 22 .5 27 .5 Initial fluorescence recovery rate, relative levels Cells, % Initial fluorescence recovery rate per individual cell, [normalized fluorescence intensity/s]*100 E Mock RC Cell Chromatin EHV1 RC Infected Cell Chromatin F Slow fluorescence recovery rate, relative levels H2B a a, b c b H4 a a,b a,b a † a a a a a 0 25 50 75 10 0 0 25 50 75 10 0 3. 5 10 . 5 17 . 5 24 . 5 // // 0 25 50 75 10 0 0 25 50 75 10 0 Slow fluorescence recovery rate, [normalized fluorescence intensity/ms]*10 424 12 20 28 36 // 424 12 20 28 36 // G 0. 8 1. 2 1. 6 2. 0 Mock RC Cell Chromatin EHV1 a a a a H2B H4 Cells, % 31 . 5 38 . 5 3. 5 10 . 5 17 . 5 24 . 5 31 . 5 38 . 5 6Mock RC Cell Chromatin EHV1 C Free histone, % per cell Relative nuclear fluorescence intensity 40 60 80 H2B H4 D b † 0. 511. 5 0 20 r2 = 0.002 EHV1: Large RC Small RC Cell Chromatin Mo ck: Nucleol i Cell Chromatin 0. 511. 5 EHV1: Large Small Large + Small Mo ck: Nucleol i Cell Chromatin r2 = 0.009 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint Fig 6 Mock Abortogenic Neurotropic Small RCLarge RC EHV1 GFP-H3.1 Diffuse Small RCLarge RC GFP-H3.3 Diffuse .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 0. 511. 50. 511. 5 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0 20 40 60 80 0 25 50 75 10 0 0 25 50 75 10 0 777 21 35 49 63 // 777 21 35 49 63 // 7 21 // //0 25 50 75 10 0 0. 8 1. 4 2. 0 2. 6 0. 8 1. 4 2. 0 2. 6 Fig 7 A Free H3, relative levels Cells, % Free H3 per individual cell, % B Mock RC Cell Chromatin EHV1 RC Infected Cell Chromatin H3.1 H3.3 80 a a,b a b c d Diffuse 7735 49 63 a,b a ba,b † † c d e Small Mo ck Nucleol i Large Large+ Small Diffuse 0. 6 1. 4 2. 2 3. 0 3. 8 4. 6 5. 4 0. 6 1. 4 2. 2 3. 0 3. 8 4. 6 5. 4 Mock RC Cell Chromatin EHV1 Diffuse 424 12 20 28 36 // 424 12 20 28 36 // 4. 5 13 . 5 22 . 5 31 . 5 40 . 5 // // 49 . 54. 5 13 . 5 22 . 5 31 . 5 40 . 5 D Initial fluorescence recovery rate, relative levels Cells, % Initial fluorescence recovery rate per individual cell, [normalized fluorescence intensity/s]*100 E RC Infected Cell Chromatin H3.1 a b c H3.3 a b a a aa a,b a,b 49 . 5 a C Free histone, % per cell Relative nuclear fluorescence intensity H3.1 H3.3 r2 < 0.001 EHV1: Diffuse Large RC Small RC Cell Chrom atin Mo ck: Nucleol i Cell Chrom atin r2 = 0.002 EHV1: Diffuse Large Small Large + Small Mo ck: Nucleol i Cell Chromatin 7 21 35 49 63 77 0 25 50 75 10 0 0 25 50 75 10 0 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint Fig 8 Mock Abortogenic Neurotropic Small RCLarge RC EHV1 GFP-H2A Small RCLarge RC GFP-H2A.Z Small RCLarge RC GFP-H2A.X Small RCLarge RC GFP- macroH2A .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 EHV1: Large Small Large + Small Mo ck: Nucleol i Cell Chromatin 0. 9 1. 3 1. 7 2. 1 2. 5 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0. 9 1. 3 1. 7 2. 1 2. 5 0. 9 1. 3 1. 7 2. 1 2. 5 0. 9 1. 3 1. 7 2. 1 2. 5 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 0 25 50 75 10 0 7 21 35 49 // // a b c a 63 7 21 35 49 63 77 // // a b c a b Free H2A per individual cell, % 6 18 30 42 // // a b c a Mock RC Cell chromat in EHV1 54 66 6 18 30 42 54 66 b Fig 9 6 18 30 42 // // a b c a RC Infected Cell Chromatin † ‡ ‡ † 54 66 6 18 30 42 54 66 a b b Small Mo ck Nucleol i Large H2A H2A.Z H2A.X 7 21 35 49 63 77 7 21 35 49 63 77 macro H2A A Free H2A, relative levels Cells, % B 0. 8 1. 8 2. 8 3. 8 0. 8 1. 8 2. 8 3. 8 0. 8 1. 8 2. 8 3. 8 0 25 50 75 10 0 0 25 50 75 10 0 1. 5 4. 5 7. 5 // // 10 . 5 13 . 5 1. 5 4. 5 7. 5 10 . 5 13 . 5 15 . 5 1. 5 4. 5 7. 5 // // 10 . 5 13 . 5 15 . 5 1. 5 4. 5 7. 5 10 . 5 13 . 5 15 . 5 2. 5 7. 5 12 . 5 // // 17 . 5 22 . 5 2. 5 7. 5 12 . 5 17 . 5 22 . 5 27 . 5 2. 5 7. 5 12 . 5 // // 17 . 5 22 . 5 2. 5 7. 5 12 . 5 17 . 5 22 . 5 27 . 5 0. 8 1. 8 2. 8 3. 8 a a b a a a b a a Mock RC Cell chromat in EHV1 b a a b a† a a,b H2A H2A.Z H2A.X macro H2A C Cells, % D a † 27 . 5 27 . 5 15 . 5 a a a a, b Initial fluorescence recovery rate, relative levels Initial fluorescence recovery rate per individual cell, [normalized fluorescence intensity/s]*100 Large+ Small 77 0 25 50 75 10 0 .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint Fig 10 B 4/ 4+ 3 2 1 Time, s 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 38 48 1 2 3 4 4+ Fluorescence Intensity, Relative Levels C Mobility Group: Consensus Equine Human Consensus Equine Human Docking DomainHistone FoldRRRA EHV1 Abortogenic Neurotropic EHV1: RC/ Infected cell chromatin Mock: Nucleolar chr om at in Cell chromatin Mock .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 0. 0 0. 4 0. 8 1. 2 1. 6 2. 0 1 2 3 4 nucleol us1 2 3 4+ 0. 4 0. 8 1. 2 1. 6 2. 0 1 2 3 4 nucleol us1 2 3 4+ 0 25 50 75 10 0 0 25 50 75 10 0 Fig 11 0 25 50 75 10 0 0 25 50 75 10 0A Free H2A.B, relative levels 71 . 5 Cells, % Free H2A.B per cell, % 16 .5 27 .5 38 .5 49 . 5 60 .5 B a,b c e Mock EHV1 † ‡ † ‡ ¶ ¶ 4/ 4+ 3 2 1 Nucleol us aa,b,c b,c a,d b,c,d 4/ 4+ 3 2 1 Mo ck Nucl eoli // // 71 .516 . 5 27 .5 38 .5 49 .5 60 . 5 C 49 . 5 Cells, % 4. 5 13 . 5 22 . 5 31 . 5 40 . 5 D a,b e † † c a,c,d c b b,d b,d // // 49 . 54. 5 13 . 5 22 . 5 31 . 5 40 . 5 ¶ b,c,d Initial fluorescence recovery rate, relative levels Initial fluorescence recovery rate per individual cell, [normalized fluorescence intensity/s]*100 c Mock EHV1/ Infected cell chromatin .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 38 48 EHV1: Large RC Small RC Infected cell chromatin Mock: Nucleol ar chromatin Cell chromatin Fig 12 Fluorescence Intensity, Relative Levels Time, s B Mock Abortogenic Neurotropic Small RCLarge RC EHV-1A 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 -2 8 18 28 38 48 0. 2 0. 4 0 Fluorescence Intensity, Relative Levels Time, s Relative ”free” histone Initial fluorescence re cove ry rate Slower exchangeC 0.15 T50 Faster exchange .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint RC Infected Cell ChromatinSmall Mo ck Nucleol i Large Fig 13 0 25 50 75 10 0 0 25 50 75 10 0 0. 9 1. 2 1. 5 1. 8 C Cells, % D c // // Free H1.2 per cell, relative levels 6515 25 35 45 55 6515 25 35 45 55 a,b d a,d † † b Free H1.2 per cell, % 0 25 50 75 10 0 0 25 50 75 10 0 0. 2 0. 6 1. 0 1. 4 0 25 50 75 10 0 0 25 50 75 10 0 0. 9 1. 1 1. 3 1. 5 Initial fluorescence recovery rate, relative levels a b a a Initial fluorescence recovery rate, [normalized fluorescence intensity/s]*100 222 6 10 14 18 // 222 6 10 14 18 // E Cells, % F b Mock RC Cell chromat in EHV1 T50, relative levels a,b a,c c,d T50, s 777 21 35 49 63 // 777 21 35 49 63 // A Cells, % B b d A Large+ Small EHV1: Large Small Large + Small Mo ck: Nucleol i Cell Chromat in .CC-BY-NC 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted August 1, 2025. ; https://doi.org/10.1101/2025.08.01.668067doi: bioRxiv preprint