miR-361 prevents the formation of hypertrophic scars by inhibiting TGF-β1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article miR-361 prevents the formation of hypertrophic scars by inhibiting TGF-β1 Ziyang Han, Feng Lin, Weiping Wu, Zeming Bai, Na Zuo, Hongyi Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4011946/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Excessive wound repair following dermal injuries, such as burns or trauma, may lead to pathological scar formation. Transforming growth factor-β1 (TGF-β1) is a potent growth factor involved in wound healing. It is considered to be a key regulator of hypertrophic scars (HS) and various fibrotic diseases. MicroRNAs (miRNAs/miRs) widely participate in the pathophysiological processes of various diseases by playing a role in post-transcriptional gene regulation. At present, at least to the best of our knowledge, there are no study assessing the role of miR-361 in HS. The present study thus investigated the role of this miRNA in HS and found that miR-361 expression was downregulated in HS. miR-361 suppressed the proliferation of HS fibroblasts by inhibiting TGF-β1 expression. Moreover, miR-361 inhibited the formation of scars on rabbit ears by inhibiting the expression of TGF-β1. Thus, miR-361 may play a protective role in HS by suppressing TGF-β1. microRNA hypertrophic scar TGF-β1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction The incidence of hypertrophic scars (HS) following dermal injuries, such as deep second-degree burns and trauma, or due to infected wounds, invasive surgery and donor sites with Split Thickness Skin Graft is as high as 40-70% [1] ), which has become a major cause of disfigurement, loss of function and psychological distress for patients. In total, The etiology of HS is majorly due to the uncontrolled myofibroblast activation and pathologically excessive deposition of ECM, Among several factors leading to this pathological process, transforming growth factor-β1 (TGF-β1) is one of the most crucial and potent factors ( [2] ).TGF-β1 promotes fibroblast division and proliferation, leading to extracellular matrix (ECM)deposition and even excessive deposition during the development of HS [3] . The main function of microRNAs (miRNAs/miRs) in skin fibrosis is to regulate the expression of genes related to the pathogenesis of fibrosis [4] ). As previously demonstrated, the downregulation of miR-29 expression in HS can affect TGF-β1 and Collagen 1, thus playing a role in promoting HS ). miR-564 has also been shown to promote the formation of HS by upregulating the expression of TGF-β1 [6] ). miR-361 has been shown to play a crucial role in a variety of fibrotic diseases. miR-361 is abnormally expressed in bleomycin-induced pulmonary fibrosis and participates in the regulation of pulmonary fibrosis [7] ). The overexpression of miR-361 has been found to exert protective effects against interstitial fibrosis in the kidneys of mice [8] ). As also previously demonstrated in HBV-related hepatic fibrosis, miR-361 suppresses NF-κB p65 expression and subsequently inhibits the biological processes of hepatic stellate cells [9] ). However, to date, at least to the best of our knowledge, there is no study available on miR-361 in HS. The present study thus aimed to explore the differentially expressed miRNAs in HS, and to elucidate the mechanisms through which miR-361 affects the formation of HS. Materials and methods Patients and tissue samples . The present study was approved by the Medical Ethics Committee of the Northern Theater General Hospital (Shenyang China). HS (deep red, thickened, itchy and painful HS at 3–6 months following burn injuries or wound healing) tissues were obtained at the surgery from patients with HS, and the surrounding normal skin tissues were selected as the normal controls (12 cases; average age, 32.39 ± 18.42 years; 4 females and 8 males). All the scar tissues were located on either the arms or legs. None of the patients had received any hormone, drug, radiotherapy or other treatments prior to surgery. All participants had no systemic diseases, were able to function independently and were thus able to cooperate to complete the study. Every participant signed a written informed consent form. The epidermis and subcutaneous tissue were removed under the sterile surgical platform, and the samples were divided into three sections: The first section was placed in RNAstore solution (Beyotime Institute of Biotechnology) to extract total RNA. The second section was place in protein lysis buffer (Beyotime Institute of Biotechnology) to extract total protein, and the third section was used to extract fibroblasts. miRNA array analysis . miRNA arrays 3.0 (Affymetrix; Thermo Fisher Scientific, Inc.) was used to analyze the extracted RNAs. A total of 84 miRNAs were examined with the Affymetrix array. Through website( https://starbase.sysu.edu.cn/ )Predict the proteins that miRNA may bind to. Fibroblast isolation The excised scar tissue was cultured on an ultra-clean bench within 1 h of removal. The tissue was washed repeatedly with phosphate buffer, cut into very small sections resembling thick mud, and digested with 0.1% type I collagenase at 37˚C for 2 h. DMEM (Dulbecco's modification of Eagle's medium Dulbecco) with 10% fetal bovine serum medium was used for culture. RNA extraction . Total RNA Extraction Kit (Tiangen biochemical technology (Beijing) Co., Ltd) was used to lyse the tissues or cells, followed by the addition of 0.2 ml chloroform(Tiangen biochemical technology (Beijing) Co., Ltd). The solution was then mixed well and allowed to stand at room temperature for 2 min. The mixture was then centrifuged at 10000 x g at 4˚C for 10 min. Subsequently, 200 µl absolute ethanol was added, followed by centrifugation at 10000 x g at 4˚C for 1 min. The solution was air-dried for 2 min and 50 µl DEPC-treated water (Tiangen biochemical technology (Beijing) Co., Ltd) was then added to the RNA. Quantitative polymerase chain reaction (qPCR) . The real-time reaction kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd, qPCR001) was used to reverse transcribe the RNA into cDNA (Promega Corporation). Reaction was conducted for 15 min at 42°C followed by 5 min at 98°C and the reaction volume was 20 µl. The Mx3000P Real-Time PCR system was used to perform qPCR (Applied Biosystems; Thermo Fisher Scientific, Inc.). Conditions were: 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec and the reaction volume was 25 µl. The sequences of the primer used were: TGF-β1 forward, 5’-GGGACTATCCACCTGCAAGA-3’ and reverse, 5’-CCTCCTTGGCGTAGTAGTCG-3’; GAPDH forward, 5’-AGCCACATCGCTCAGACAC-3’ and reverse, 5’-GCCCAATACGACCAAATCC-3’; miR-361 forward, 5’-CGCGCTAGCAGCACGTAAAT-3’ and reverse, 5’-GTGCAGGGTCCGAGGT-3’; and U6 forward, 5’-CGCTTCGGCAGCACATATAC-3’ and reverse, 5’-TTCACGAATTTGCGTGTCA-3’. 2 −ΔΔCq method was used to calculate the relative gene expressions [ 10 ] Transfection . Serum-free medium was added to a transfection tube and DNA or small-strand DNA was then added, followed by shaking and the addition of Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). The mixture was then added to the fibroblasts. The cells were transfected with the following: miR-361 negative control(UUGUACUACACAAAAGUACUG), miR-361(UUAUCAGAAUCUCCAGGGGUAC), miR-361 inhibitor(GUACCCCUGGAGAUUCUGAUAA), 2µl negative control (NC, Shenggong Bioengineering (Shanghai) Co., Ltd), 2µl si-TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd), 2µl vector (Shenggong Bioengineering (Shanghai) Co., Ltd) or 2µl TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd). 100 nM of miR-361 negative control, miR-361 or miR-361 inhibitor (Guangzhou RiboBio Co., Ltd.) was mixed and incubated for 30 min, and then added into microglia with complete medium containing 15% FBS. After 24 h following transfection, cells were harvested for further study. Luciferase assays . The 3’-UTR of TGF-β1 was cloned into a modified pGL3 luciferase vector (Promega Corporation). The products were also inserted into the pGL3 vector with primers to generate point substitutions in miRNA binding sites (pGl3-TGF-β1-UTR-MUT). Following amplification and DNA sequencing verification, the constructed DNA was used for luciferase reporter assays. HS-derived cells were grown and transfected with 1 µg luciferase gene, pGl3-TGF-β1-UTR, pGl3-TGF-β1-UTR-MUT, miR-361 or negative controls (control) for 24 h by Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). After transfection for 24 h, the cells were lysed and the activity of firefly luciferase and Renilla luciferase was measured by using dual-luciferase reporter assay (Promega Corporation). The ratio of the two identified the relative activity of luciferase. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay . A total of After transfection for 0, 12, 24, 36 and 48 h, 5 mg/ml MTT solution (Beijing kangruina Biotechnology Co., Ltd) was added to the cells followed by incubation at 37°C for 4 h. The medium was then replaced with 150 µl DMSO (Beijing kangruina Biotechnology Co., Ltd). Optical densities were read at 490 nm using a microplate reader (Bio-Rad Laboratories Co., Ltd.) ( [ 11 ] ). Western blot analysis . Tissues and cells were lysed using protein lysis buffer (Beijing YITA Biotechnology Co., Ltd) and centrifuged at 10000 x g for 20 min at 4˚Cand the protein concentration was measured using a BCA Protein Assay kit (Thermo Fisher Scientific, Inc.). A total of 30 µg protein was separated using SDS-PAGE gel and then transferred onto a nitrocellulose membrane by electro blotting. After blocking the membrane with 5% sealing solution for 1 h, it was incubated with antibodies to TGF-β1 (1:1,000, cat. no. ab92486, Abcam) and GAPDH (1:1,000, cat. no. 60004, Cell Signaling Technology, Inc.) overnight at 4˚C. The membrane was then incubated with the secondary antibody (goat anti-rabbit IgG HRP; 1:5,000, ab97051, Abcam) at room temperature for 1 h. Protein bands were detected by Pierce ECL western blot substrate (Thermo Fisher Scientific, Inc.) with ECL detection system (Thermo Fisher Scientific, Inc.). Rabbit ear scar model . A total of nine healthy New Zealand white rabbits (weighing 2-2.5 kg, with an average age of 3 months) were selected and divided into three groups as follows: The control (n = 3), the scar (n = 3) and the miR-361 group (n = 3). The HS model using rabbit ears was established as previously described [ 12 , 13 ] ). A clear ear marginal vein was selected and pentobarbital (40 mg/kg) was then slowly injected from the distal end for anesthesia. After the anesthesia took effect, moving up at a radius of 5 mm in the rabbit ear, the surface skin was peeled off using a scalpel. At 3 weeks post-surgery, scars appeared on the rabbit ears. At this time, in the miR-361 group, 10 µl miR-361 agomir was slowly injected into the scar tissue using a micro syringe. After 60 days, the animals were anesthetized using pentobarbital (i.v., 40 mg/kg) and sacrificed by exsanguination (blood volume, ~ 85 ml each). Specimens with a diameter of ~ 1 cm was obtained from the rabbit ears. All experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication no. 80 − 23, revised 1996) and were performed according to the institutional ethical guidelines for animal experiment. Hematoxylin and eosin (H&E) staining . The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and then embedded in paraffin. The sections were then sliced into serial sections at a thickness of 5 µm, and finally processed for H&E staining(Beijing YITA Biotechnology Co., Ltd) as previously described [ 14 ] . Masson’s staining . The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and embedded in paraffin. They were then sliced into serial sections at a thickness of 5 µm, and finally processed for Masson’s staining (Beijing YITA Biotechnology Co., Ltd) as previously described [ 15 ] . Immunohistochemical staining . The dewaxed tissue slides were placed into 3% H 2 O 2 and allowed to stand at room temperature for 5 min. They were then removed and rinsed under distilled water, and then placed in PBS solution for 5 min. The soaking liquid completely submerged the tissue slides. All sections were sealed in goat serum at room temperature for 10 min. The remaining sealing liquid on the slice was gently and carefully shaken off. Primary antibody(TGF-β1,1:1, 00, cat. no. ab92486, Abcam, VEGF,1:1, 00, cat. no. ab46154, Abcam) was then added in a drop-wise manner to all scar tissue sections, and then placed in a wet box containing an appropriate amount of water and incubated in a low-temperature refrigerator overnight, with the refrigerator temperature set to 4˚C. The PBS solution was then completely washed off, and the residual PBS solution was gently removed. This was followed by the addition of secondary antibody (HRP-conjugated anti-rabbit IgG secondary antibody, 1:200, cat. no. 31460; Invitrogen; Thermo Fisher Scientific, Inc.) in a drop-wise manner and the specimens were placed in an incubator at 37˚C for 30 min. Following treatment with PBS solution again, horseradish enzyme-labeled streptomycin (hz-2037R-HRP, Shanghai Huzhen Industrial Co., Ltd, ) was then added to the tissue slides in a drop-wise manner, followed by incubation in a constant temperature box at 37˚C for 30 min. Sections were visualized using DAB and counterstained using hematoxylin (DA1010-3, Beijing solabao Technology Co., Ltd). Positive staining was indicated by brown and yellow. Statistical analysis . All experiments were repeated three times. The data are expressed as the mean ± standard error of the mean. Statistical analysis was performed using GraphPad Prism 7. A Student’s t-test or one-way/two-way ANOVA with Bonferroni corrections were used for specific comparisons. P < 0.05 was considered to indicate a statistically significant difference. Results Expression of miR-361 in HS tissues . By comparing and analyzing the differential miRNAs between the HS and normal tissues, it was found that there were differences in the expression of multiple miRNAs between them. The expression levels of miR-199a-5p, miR-29a, miR-205, miR-196a, miR-200b, miR-143-3p, miR-10a and miR-361 were downregulated, while those of and miR-21, miR-181, miR-382 and miR-4269 were upregulated. Among these miRNAs, the downregulated expression of miR-361 was the most significant (Fig. 1 A). Through the detection of 12 HS tissues and normal tissues, miR-361 expression was significantly downregulated in the HS tissues (Fig. 1 B). miR-361 inhibits the proliferation of HS cells . HS cells with miR-361 overexpression were established (Fig. 2 A). MTT assay revealed that the overexpression of miR-361 significantly inhibited cell proliferation in the HS tissues (Fig. 2 B)., The proliferation of the HS cells was promoted following the inhibition of miR-361 (Fig. 2 C and D). miR-361 inhibits the proliferation of HS cells by targeting TGF-β1 . The present study further aimed to explore the mechanisms through which miR-361 regulates the proliferation of HS cells. Using the biological software Starbase3, it was predicted that miR-361 can target and bind to the 3 'UTR of TGF-β1 (Fig. 3 A). Through the detection of miR-361 and TGF-β1 in 12 HS tissues and 12 normal tissues, it was found that miR-361 was negatively associated with TGF-β1 (Fig. 3 B). The experimental results of luciferase reporter gene assays revealed that miR-361 inhibited the activity of TGF-β1, and this inhibition was attenuated after mutating their binding sites (Fig. 3 C). Subsequently, TGF-β1 was transfected into HS cells with miR-361 overexpression. The inhibitory effects of miR-361 on the proliferation of HS cells were attenuated following the transfection of TGF-β1 (Fig. 3 D). Conversely, in HS cells in which miR-361 expression was inhibited, the downregulation of TGF-β1 expression restored the promotion of cell proliferation induced by miR-361 inhibitor (Fig. 3 E). miR-361 significantly inhibited TGF-β1 (Fig. 3 F-I). Inhibitory effects of miR-361 on scars on rabbit ears . After the rabbit ear scar model was successfully constructed, the staining of scar tissue and rabbit ear tissue with miR-361 was detected using H&E staining. The results revealed that the fibroblasts in the control group were evenly arranged, their shape and size were basically normal, and there were no hyperplastic collagen fibers. In the scar group, there was disordered cell arrangement and excessive collagen proliferation. In the miR-361 group, the degree of cell disorder was attenuated (Fig. 4 A). Masson’s staining indicated that compared with the control group, collagen hyperplasia in the scar group was significant, and collagen hyperplasia in the miR-361 group was attenuated (Fig. 4 B). Immunohistochemical staining revealed that VEGF expression was upregulated and the density of blood vessels was increased in the scar group. The expression of VEGF was downregulated in the miR-361 group compared with the scar group (Fig. 4 C). The results of the immunohistochemical detection of TGF-β1 also demonstrated that the content of TGF-β1 in the scar group was higher than that in the control group. Compared with the scar group, the expression of TGF-β1 in the miR-361 group was downregulated (Fig. 4 D). TGF-β1 expression in the scar group was upregulated, and miR-361 downregulated TGF-β1 expression (Fig. 4 E and F). Discussion Previous studies have demonstrated that miRNAs can be applied for the treatment of fibrotic diseases, and it is possible to develop a new model for fibrotic diseases [ 16 – 18 ] . miR-3613-3p has been shown to inhibit HS formation by targeting arginine and glutamate-rich 1, which may provide potential therapeutic targets for the management of HS [ 16 ] . miR-190a-3p in HS can bind to the CUB and sushi multiple domains 1 and may regulate its expression, thus affecting the occurrence and development of HS [ 19 ] ). miR-145-5p can prevent fiber formation and reduce the formation of HS by reducing the expression of Smad2/3 [ 18 ] . In the present study, in order to screen the abnormally expressed miRNAs in HS tissues, HS tissues and normal skin tissues were selected for miRNA screening. The results revealed that a variety of miRNAs were abnormally expressed in HS tissues. Among these, miR-361 was downregulated most significantly in HS tissues. A total of 12 tissues were used for detection, and the results confirmed the screening results; that is, miR-361 was significantly downregulated in HS tissues. After extracting primary HS cells, HS cells in which miR-361 was overexpressed or inhibited were established. Subsequently, MTT assay revealed that miR-361 overexpression significantly suppressed the proliferation of HS cells. Through biological prediction, it was found that miR-361 has a binding site with the 3'-UTR region of TGF-β1. TGF-β1 can promote the transformation of wound epithelial fibroblasts into myofibroblasts, cell matrix changes, deposition and wound scar formation [ 2 ] ). By analyzing the expression of miR-361 and TGF-β1 in tissues, the present study found that miR-361 was negatively associated with TGF-β1. The targeting effect of miR-361 on TGF-β1 was also demonstrated using a reporter gene assay. In the follow-up experiment, it was found that TGF-β1 restored the proliferation of HS cells which was suppressed by miR-361 overexpression. Thus, these findings suggest that the effects of miR-361 on the proliferation of HS cells may be mediated via the regulation of TGF-β1. In addition, a rabbit ear scar model was constructed and the treatment group was treated with miR-361. The results revealed that miR-361 significantly attenuated the excessive proliferation and disordered arrangement of fibroblasts, reduced the collagen content, and alleviated HS to a certain extent. The appropriate concentration of TGF-β1 can promote wound epithelial healing, and excessive TGF-β1 will lead to local scar hyperplasia [ 20 ] . In the rabbit ear scar model in the present study, it was found that the introduction of miR-361 decreased the expression of TGF-β1 and VEGF, and inhibited the formation of scars on rabbit ears. In conclusion, in the present study, it was found that the expression of miR-361 was downregulated in HS tissues, which may affect the biological process of HS by affecting the expression of TGF-β1. The findings presented herein may provide a potential theoretical basis for the treatment of HS. Declarations Acknowledgements Not applicable. Funding This research was funded by National Natural Science Foundation of China(No. 82002047); Science and Technology program of Liao Ning province.(No.1030057). Availability of data and materials All data generated or analyzed during this study are included in this published article. The datasets generated and/or analyzed during the current study are available on the GEO database (GSE189134). Authors’ Contributions Ziyang Han conceived the study. Feng Lin ,Ziyang Han, Zeming Bai designed the study, Na zuo performed the statistical analysis., Feng Lin, Ziyang Han Weiping Wu performed the experiments. Hongyi Wang and Dapeng Zhou writed the manuscript. All authors have read and approved the final manuscript. Hongyi Wang and Dapeng Zhou confirm the authenticity of all the raw data. Consent for publication Not applicable. Ethics approval and consent to participate All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee as well as the 1964 Helsinki declaration and its later amendments, or comparable ethical standards. All experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication no. 80-23, revised 1996) and were performed according to the institutional ethical guidelines for animal experiment. The present study was approved by the Medical Ethics Committee of the Northern Theater General Hospital (Shenyang, China). Patient consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Qi X, Liu Y, Yang M. Circ_0057452 functions as a ceRNA in hypertrophic scar fibroblast proliferation and VEGF expression by regulating TGF-beta2 expression and adsorbing miR-145-5p. Am J Transl Res.2021; 13: 6200-6210. Zhang S, Pan S. miR-124-3p targeting of TGF-beta1 inhibits the proliferation of hypertrophic scar fibroblasts. Adv Clin Exp Med.2021; 30: 263-271. Shi A, Li J, Qiu X, Sabbah M, Boroumand S, Huang TC, Zhao C, Terzic A, Behfar A, Moran SL. TGF-beta loaded exosome enhances ischemic wound healing in vitro and in vivo. Theranostics.2021; 11: 6616-6631. Wolska-Gawron K, Bartosinska J, Rusek M, Kowal M, Raczkiewicz D, Krasowska D. Circulating miRNA-181b-5p, miRNA-223-3p, miRNA-210-3p, let 7i-5p, miRNA-21-5p and miRNA-29a-3p in patients with localized scleroderma as potential biomarkers. Sci Rep.2020; 10: 20218. Bi S, Cao C, Chai LL, Li SR, Yang DY. Regulatory mechanism of miR-29 over TGF-beta1 and COL1 in scar cells. Eur Rev Med Pharmacol Sci.2017; 21: 2512-2517. Xiao L, Tang T, Huang Y, Guo J. MiR-564 promotes hypertrophic scar formation through TGF-beta1 upregulation. G Ital Dermatol Venereol.2019; 154: 186-191. Xie T, Liang J, Guo R, Liu N, Noble PW, Jiang D. Comprehensive microRNA analysis in bleomycin-induced pulmonary fibrosis identifies multiple sites of molecular regulation. Physiol Genomics.2011; 43: 479-487. Wu GJ, Zhao HB, Zhang XW. Death-associated protein kinase 1 correlates with podocyte apoptosis and renal damage and can be mediated by miR-361. Histol Histopathol.2021: 18358. Yu G, Mu H, Zhou H, Fang F, Cui Y, Wu Q, Xiong Q, Li H. MicroRNA-361 suppresses the biological processes of hepatic stellate cells in HBV-relative hepatic fibrosis by NF-kappaB p65. Cells Dev.2021; 167: 203711. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.2001; 25: 402-408. Yang S, Evens AM, Prachand S, Singh AT, Bhalla S, David K, Gordon LI. Mitochondrial-mediated apoptosis in lymphoma cells by the diterpenoid lactone andrographolide, the active component of Andrographis paniculata. Clinical cancer research : an official journal of the American Association for Cancer Research.2010; 16: 4755-4768. Kurt M, Akoz Saydam F, Bozkurt M, Serin M, Caglar A. The effects of valsartan on scar maturation in an experimental rabbit ear wound model. J Plast Surg Hand Surg.2020; 54: 382-387. Jiang Z, Zhao L, He F, Tan H, Li Y, Tang Y, Duan X, Li Y. Palmatine-loaded electrospun poly(epsilon-caprolactone)/gelatin nanofibrous scaffolds accelerate wound healing and inhibit hypertrophic scar formation in a rabbit ear model. J Biomater Appl.2021; 35: 869-886. Chen X, Yao JM, Fang X, Zhang C, Yang YS, Hu CP, Chen Q, Zhong GW. Hypoxia promotes pulmonary vascular remodeling via HIF-1alpha to regulate mitochondrial dynamics. J Geriatr Cardiol.2019; 16: 855-871. Zhao H, Li C, Li L, Liu J, Gao Y, Mu K, Chen D, Lu A, Ren Y, Li Z. Baicalin alleviates bleomycininduced pulmonary fibrosis and fibroblast proliferation in rats via the PI3K/AKT signaling pathway. Mol Med Rep.2020; 21: 2321-2334. Li L, Han W, Chen Y, Chen Y. MiR-3613-3p inhibits hypertrophic scar formation by down-regulating arginine and glutamate-rich 1. Mol Cell Biochem.2021; 476: 1025-1036. Xiao Y. MiR-486-5p inhibits the hyperproliferation and production of collagen in hypertrophic scar fibroblasts via IGF1/PI3K/AKT pathway. J Dermatolog Treat.2020: 1-10. Shen W, Wang Y, Wang D, Zhou H, Zhang H, Li L. miR-145-5p attenuates hypertrophic scar via reducing Smad2/Smad3 expression. Biochem Biophys Res Commun.2020; 521: 1042-1048. Gu S, Huang X, Xu X, Liu Y, Khoong Y, Zhang Z, Li H, Gao Y, Zan T. Inhibition of CUB and sushi multiple domains 1 (CSMD1) expression by miRNA-190a-3p enhances hypertrophic scar-derived fibroblast migration in vitro. BMC Genomics.2021; 22: 613. Zheng GY, Hao LL, Wang RN, Lian YJ, Tan N. [Experimental study of TGF-beta2 antisense oligonucleotide on inhibiting corneal scar hyperplasia in rabbits]. Zhonghua Yan Ke Za Zhi.2013; 49: 163-169. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4011946","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":276756221,"identity":"26f9ef22-7365-4880-b516-f410349c3a70","order_by":0,"name":"Ziyang Han","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ziyang","middleName":"","lastName":"Han","suffix":""},{"id":276756222,"identity":"907c8925-e9f9-4216-9393-359f75f73c9c","order_by":1,"name":"Feng Lin","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Lin","suffix":""},{"id":276756223,"identity":"1dacccca-d93f-4485-9042-1fc6c4e41bbf","order_by":2,"name":"Weiping Wu","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weiping","middleName":"","lastName":"Wu","suffix":""},{"id":276756224,"identity":"33d9e870-5e0b-4f2a-81c4-851a50a3eaa4","order_by":3,"name":"Zeming Bai","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zeming","middleName":"","lastName":"Bai","suffix":""},{"id":276756225,"identity":"6b2009f7-6c13-4233-96ea-2dc0d38db05f","order_by":4,"name":"Na Zuo","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Zuo","suffix":""},{"id":276756226,"identity":"524decfc-bb6c-4415-beeb-718d1ded4bbd","order_by":5,"name":"Hongyi Wang","email":"","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongyi","middleName":"","lastName":"Wang","suffix":""},{"id":276756227,"identity":"a8c99c7e-48b5-4f08-8010-ba0955826dba","order_by":6,"name":"Dapeng Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYFAC9oMPEgxsePj5G4jWwpNs8KAiTUZyxgHirTGTfHDmsI1BQwKR6nXbGxIkEtvO8xgwHGD88DGHGCvOHDxgkNh2m8ecuYFZcuY2YrTcSEhIAGmxbDjAxsxLlJb7DwwOJLad4zE4kECslhsMhg0JZw6QouVMTjJDQkUyj+SMg81E+uX48eM/fxjY2fPzNx/88JEYLUiAsYE09aNgFIyCUTAKcAMAeJA7U6fNJdEAAAAASUVORK5CYII=","orcid":"","institution":"The General Hospital of Northern Theater Command","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Dapeng","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2024-03-04 14:06:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4011946/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4011946/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52280621,"identity":"4936b66a-f07e-48ea-a291-4ac080c81afa","added_by":"auto","created_at":"2024-03-08 14:36:51","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":232493,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of miR-361 in HS tissues. (A) Microarray analysis to screen differentially expressed miRNAs in HS tissues and normal tissues (B) Expression of miR-361 in 12 samples of HS tissues and normal tissues were detected using reverse transcription-quantitative PCR. Compared to normal, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05. HS, hypertrophic scar.\u003c/p\u003e","description":"","filename":"FIG1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4011946/v1/2abfe2d0959ae3a6da5d5670.jpg"},{"id":52280624,"identity":"b2ae9b4e-f07d-4a73-8fa1-3fbf4028655a","added_by":"auto","created_at":"2024-03-08 14:36:51","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":315171,"visible":true,"origin":"","legend":"\u003cp\u003emiR-361 inhibits the proliferation of HS cells. (A) Expression of miR-361 in cells was determined using reverse transcription-quantitative PCR. Compared to control, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05. (B) HS cells were transfected with control or miR-361, and cell proliferation was detected using an MTT assay. Compared to control,\u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05. (C) Expression of miR-361 in cells were detected respectively by quantitative PCR. Compared to control,\u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05. (D) HS cells were transfected with control or miR-361 inhibitor and cell proliferation was detected using MTT assay. Compared to control,\u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05. HS, hypertrophic scar.\u003c/p\u003e","description":"","filename":"FIG2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4011946/v1/1607249429f547547652ca89.jpg"},{"id":52280623,"identity":"fc12d864-08b7-4e93-83e7-34ee0025a14a","added_by":"auto","created_at":"2024-03-08 14:36:51","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1085340,"visible":true,"origin":"","legend":"\u003cp\u003emiR-361 inhibits the proliferation of HS cells by targeting TGF-β1. (A) The results predicted using Starbase3 software indicated that miR-361 had binding sites with TGF-β1. (B) Linear analysis revealed that there was a negative correlation between miR-361 and TGF-β1 expression; Y=-0.2742x+1.095 R\u003csup\u003e2\u003c/sup\u003e=0.6535. (C) A luciferase reporter gene assay was used to detect the targeting effect of miR-361 on TGF-β1. (D) MTT assay was used to detect cell proliferation. \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05, vs. vector + control; \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.05, vs. TGF-β1 + control. (E) MTT assay was used to detect cell proliferation. \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05, vs NC + control; \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.05, vs. si-TGF-β1 + control. (F) Expression of miR-361 and TGF-β1 in cells was detected using RT-qPCR. \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05, vs. vector + control; \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.05, vs. TGF-β1 + control. (G) Expression of miR-361 and TGF-β1 in cells was detected using RT-qPCR. \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05, vs. NC + control; \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.05, vs. si-TGF-β1 + control. (H and I) Expression of TGF-β1 in cells was detected using western blot analysis. RT-qPCR, reverse transcription-quantitative PCR.\u003c/p\u003e","description":"","filename":"FIG3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4011946/v1/aa183bbff84df3522b6d75d7.jpg"},{"id":52280622,"identity":"3547f9e3-94b3-40b1-9b8e-5d615f8184a7","added_by":"auto","created_at":"2024-03-08 14:36:51","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2710521,"visible":true,"origin":"","legend":"\u003cp\u003eInhibitory effect of miR-361 on rabbit ear scars. (A) Hematoxylin and eosin staining was used to examine tissue morphology; magnification, x200. (B) Tissue morphology was detected using Masson’s staining; magnification, x200. (C) The expression of VEGF was detected using immunohistochemical staining; magnification, x200. (D) The expression of TGF-β1 was detected using immunohistochemical staining; magnification, x200. (E) The expression of TGF-β1 was detected using western blot analysis. (F) The expression of TGF-β1 and miR-361 was detected using western blot analysis. \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.05, vs. control.\u003c/p\u003e","description":"","filename":"FIG4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4011946/v1/dead78b0d4bc1aa0dfa45f93.jpg"},{"id":53551579,"identity":"46c594bb-3eef-489b-8387-5f764b6c5214","added_by":"auto","created_at":"2024-03-27 11:30:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":599819,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4011946/v1/7de1bcad-a078-4015-9795-d12a595dbda6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"miR-361 prevents the formation of hypertrophic scars by inhibiting TGF-β1","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe incidence of hypertrophic scars (HS) following dermal injuries, such as deep second-degree burns and trauma, or due to infected wounds, invasive surgery and donor sites with Split Thickness Skin Graft is as high as 40-70%\u0026nbsp;\u003csup\u003e[1]\u003c/sup\u003e), which has become a major cause of disfigurement, loss of function and psychological distress for patients. In total, The etiology of HS is majorly due to the uncontrolled myofibroblast activation and pathologically excessive deposition of ECM, Among several factors leading to this pathological process, transforming growth factor-\u0026beta;1 (TGF-\u0026beta;1) is one of the most crucial and potent factors (\u003csup\u003e[2]\u003c/sup\u003e).TGF-\u0026beta;1 promotes fibroblast division and proliferation, leading to extracellular matrix (ECM)deposition and even excessive deposition during the development of HS\u003csup\u003e[3]\u003c/sup\u003e. The main function of microRNAs (miRNAs/miRs) in skin fibrosis is to regulate the expression of genes related to the pathogenesis of fibrosis\u0026nbsp;\u003csup\u003e[4]\u003c/sup\u003e). As previously demonstrated, the downregulation of miR-29 expression in HS can affect TGF-\u0026beta;1 and Collagen 1, thus playing a role in promoting HS ). miR-564 has also been shown to promote the formation of HS by upregulating the expression of TGF-\u0026beta;1\u0026nbsp;\u003csup\u003e[6]\u003c/sup\u003e).\u003c/p\u003e\n\u003cp\u003emiR-361 has been shown to play a crucial role in a variety of fibrotic diseases. miR-361 is abnormally expressed in bleomycin-induced pulmonary fibrosis and participates in the regulation of pulmonary fibrosis\u0026nbsp;\u003csup\u003e[7]\u003c/sup\u003e). The overexpression of miR-361 has been found to exert protective effects against interstitial fibrosis in the kidneys of mice\u0026nbsp;\u003csup\u003e[8]\u003c/sup\u003e). As also previously demonstrated in HBV-related hepatic fibrosis, miR-361 suppresses NF-\u0026kappa;B p65 expression and subsequently inhibits the biological processes of hepatic stellate cells\u0026nbsp;\u003csup\u003e[9]\u003c/sup\u003e). However, to date, at least to the best of our knowledge, there is no study available on miR-361 in HS. The present study thus aimed to explore the differentially expressed miRNAs in HS, and to elucidate the mechanisms through which miR-361 affects the formation of HS.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cem\u003ePatients and tissue samples\u003c/em\u003e. The present study was approved by the Medical Ethics Committee of the Northern Theater General Hospital (Shenyang China). HS (deep red, thickened, itchy and painful HS at 3\u0026ndash;6 months following burn injuries or wound healing) tissues were obtained at the surgery from patients with HS, and the surrounding normal skin tissues were selected as the normal controls (12 cases; average age, 32.39\u0026thinsp;\u0026plusmn;\u0026thinsp;18.42 years; 4 females and 8 males). All the scar tissues were located on either the arms or legs. None of the patients had received any hormone, drug, radiotherapy or other treatments prior to surgery. All participants had no systemic diseases, were able to function independently and were thus able to cooperate to complete the study. Every participant signed a written informed consent form.\u003c/p\u003e \u003cp\u003eThe epidermis and subcutaneous tissue were removed under the sterile surgical platform, and the samples were divided into three sections: The first section was placed in RNAstore solution (Beyotime Institute of Biotechnology) to extract total RNA. The second section was place in protein lysis buffer (Beyotime Institute of Biotechnology) to extract total protein, and the third section was used to extract fibroblasts.\u003c/p\u003e \u003cp\u003e \u003cem\u003emiRNA array analysis\u003c/em\u003e. miRNA arrays 3.0 (Affymetrix; Thermo Fisher Scientific, Inc.) was used to analyze the extracted RNAs. A total of 84 miRNAs were examined with the Affymetrix array.\u003c/p\u003e \u003cp\u003eThrough website( \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://starbase.sysu.edu.cn/\u003c/span\u003e\u003cspan address=\"https://starbase.sysu.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e )Predict the proteins that miRNA may bind to.\u003c/p\u003e \u003cp\u003e \u003cem\u003eFibroblast isolation\u003c/em\u003e The excised scar tissue was cultured on an ultra-clean bench within 1 h of removal. The tissue was washed repeatedly with phosphate buffer, cut into very small sections resembling thick mud, and digested with 0.1% type I collagenase at 37˚C for 2 h. DMEM (Dulbecco's modification of Eagle's medium Dulbecco) with 10% fetal bovine serum medium was used for culture.\u003c/p\u003e \u003cp\u003e \u003cem\u003eRNA extraction\u003c/em\u003e. Total RNA Extraction Kit (Tiangen biochemical technology (Beijing) Co., Ltd) was used to lyse the tissues or cells, followed by the addition of 0.2 ml chloroform(Tiangen biochemical technology (Beijing) Co., Ltd). The solution was then mixed well and allowed to stand at room temperature for 2 min. The mixture was then centrifuged at 10000 x g at 4˚C for 10 min. Subsequently, 200 \u0026micro;l absolute ethanol was added, followed by centrifugation at 10000 x g at 4˚C for 1 min. The solution was air-dried for 2 min and 50 \u0026micro;l DEPC-treated water (Tiangen biochemical technology (Beijing) Co., Ltd) was then added to the RNA.\u003c/p\u003e \u003cp\u003e \u003cem\u003eQuantitative polymerase chain reaction (qPCR)\u003c/em\u003e. The real-time reaction kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd, qPCR001) was used to reverse transcribe the RNA into cDNA (Promega Corporation). Reaction was conducted for 15 min at 42\u0026deg;C followed by 5 min at 98\u0026deg;C and the reaction volume was 20 \u0026micro;l. The Mx3000P Real-Time PCR system was used to perform qPCR (Applied Biosystems; Thermo Fisher Scientific, Inc.). Conditions were: 95\u0026deg;C for 30 sec followed by 40 cycles at 95\u0026deg;C for 5 sec and 60\u0026deg;C for 30 sec and the reaction volume was 25 \u0026micro;l. The sequences of the primer used were: TGF-β1 forward, 5\u0026rsquo;-GGGACTATCCACCTGCAAGA-3\u0026rsquo; and reverse, 5\u0026rsquo;-CCTCCTTGGCGTAGTAGTCG-3\u0026rsquo;; GAPDH forward, 5\u0026rsquo;-AGCCACATCGCTCAGACAC-3\u0026rsquo; and reverse, 5\u0026rsquo;-GCCCAATACGACCAAATCC-3\u0026rsquo;; miR-361 forward, 5\u0026rsquo;-CGCGCTAGCAGCACGTAAAT-3\u0026rsquo; and reverse, 5\u0026rsquo;-GTGCAGGGTCCGAGGT-3\u0026rsquo;; and U6 forward, 5\u0026rsquo;-CGCTTCGGCAGCACATATAC-3\u0026rsquo; and reverse, 5\u0026rsquo;-TTCACGAATTTGCGTGTCA-3\u0026rsquo;. 2\u003csup\u003e\u0026minus;ΔΔCq\u003c/sup\u003e method was used to calculate the relative gene expressions\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eTransfection\u003c/em\u003e. Serum-free medium was added to a transfection tube and DNA or small-strand DNA was then added, followed by shaking and the addition of Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). The mixture was then added to the fibroblasts. The cells were transfected with the following: miR-361 negative control(UUGUACUACACAAAAGUACUG), miR-361(UUAUCAGAAUCUCCAGGGGUAC), miR-361 inhibitor(GUACCCCUGGAGAUUCUGAUAA), 2\u0026micro;l negative control (NC, Shenggong Bioengineering (Shanghai) Co., Ltd), 2\u0026micro;l si-TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd), 2\u0026micro;l vector (Shenggong Bioengineering (Shanghai) Co., Ltd) or 2\u0026micro;l TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd). 100 nM of miR-361 negative control, miR-361 or miR-361 inhibitor (Guangzhou RiboBio Co., Ltd.) was mixed and incubated for 30 min, and then added into microglia with complete medium containing 15% FBS. After 24 h following transfection, cells were harvested for further study.\u003c/p\u003e \u003cp\u003e \u003cem\u003eLuciferase assays\u003c/em\u003e. The 3\u0026rsquo;-UTR of TGF-β1 was cloned into a modified pGL3 luciferase vector (Promega Corporation). The products were also inserted into the pGL3 vector with primers to generate point substitutions in miRNA binding sites (pGl3-TGF-β1-UTR-MUT). Following amplification and DNA sequencing verification, the constructed DNA was used for luciferase reporter assays. HS-derived cells were grown and transfected with 1 \u0026micro;g luciferase gene, pGl3-TGF-β1-UTR, pGl3-TGF-β1-UTR-MUT, miR-361 or negative controls (control) for 24 h by Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). After transfection for 24 h, the cells were lysed and the activity of firefly luciferase and Renilla luciferase was measured by using dual-luciferase reporter assay (Promega Corporation). The ratio of the two identified the relative activity of luciferase.\u003c/p\u003e \u003cp\u003e \u003cem\u003e3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay\u003c/em\u003e. A total of After transfection for 0, 12, 24, 36 and 48 h, 5 mg/ml MTT solution (Beijing kangruina Biotechnology Co., Ltd) was added to the cells followed by incubation at 37\u0026deg;C for 4 h. The medium was then replaced with 150 \u0026micro;l DMSO (Beijing kangruina Biotechnology Co., Ltd). Optical densities were read at 490 nm using a microplate reader (Bio-Rad Laboratories Co., Ltd.) (\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eWestern blot analysis\u003c/em\u003e. Tissues and cells were lysed using protein lysis buffer (Beijing YITA Biotechnology Co., Ltd) and centrifuged at 10000 x g for 20 min at 4˚Cand the protein concentration was measured using a BCA Protein Assay kit (Thermo Fisher Scientific, Inc.). A total of 30 \u0026micro;g protein was separated using SDS-PAGE gel and then transferred onto a nitrocellulose membrane by electro blotting. After blocking the membrane with 5% sealing solution for 1 h, it was incubated with antibodies to TGF-β1 (1:1,000, cat. no. ab92486, Abcam) and GAPDH (1:1,000, cat. no. 60004, Cell Signaling Technology, Inc.) overnight at 4˚C. The membrane was then incubated with the secondary antibody (goat anti-rabbit IgG HRP; 1:5,000, ab97051, Abcam) at room temperature for 1 h. Protein bands were detected by Pierce ECL western blot substrate (Thermo Fisher Scientific, Inc.) with ECL detection system (Thermo Fisher Scientific, Inc.).\u003c/p\u003e \u003cp\u003e \u003cem\u003eRabbit ear scar model\u003c/em\u003e. A total of nine healthy New Zealand white rabbits (weighing 2-2.5 kg, with an average age of 3 months) were selected and divided into three groups as follows: The control (n\u0026thinsp;=\u0026thinsp;3), the scar (n\u0026thinsp;=\u0026thinsp;3) and the miR-361 group (n\u0026thinsp;=\u0026thinsp;3). The HS model using rabbit ears was established as previously described \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e). A clear ear marginal vein was selected and pentobarbital (40 mg/kg) was then slowly injected from the distal end for anesthesia. After the anesthesia took effect, moving up at a radius of 5 mm in the rabbit ear, the surface skin was peeled off using a scalpel. At 3 weeks post-surgery, scars appeared on the rabbit ears. At this time, in the miR-361 group, 10 \u0026micro;l miR-361 agomir was slowly injected into the scar tissue using a micro syringe. After 60 days, the animals were anesthetized using pentobarbital (i.v., 40 mg/kg) and sacrificed by exsanguination (blood volume, ~\u0026thinsp;85 ml each). Specimens with a diameter of ~\u0026thinsp;1 cm was obtained from the rabbit ears.\u003c/p\u003e \u003cp\u003eAll experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication no. 80\u0026thinsp;\u0026minus;\u0026thinsp;23, revised 1996) and were performed according to the institutional ethical guidelines for animal experiment.\u003c/p\u003e \u003cp\u003e \u003cem\u003eHematoxylin and eosin (H\u0026amp;E) staining\u003c/em\u003e. The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and then embedded in paraffin. The sections were then sliced into serial sections at a thickness of 5 \u0026micro;m, and finally processed for H\u0026amp;E staining(Beijing YITA Biotechnology Co., Ltd) as previously described\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eMasson\u0026rsquo;s staining\u003c/em\u003e. The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and embedded in paraffin. They were then sliced into serial sections at a thickness of 5 \u0026micro;m, and finally processed for Masson\u0026rsquo;s staining (Beijing YITA Biotechnology Co., Ltd) as previously described\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eImmunohistochemical staining\u003c/em\u003e. The dewaxed tissue slides were placed into 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and allowed to stand at room temperature for 5 min. They were then removed and rinsed under distilled water, and then placed in PBS solution for 5 min. The soaking liquid completely submerged the tissue slides. All sections were sealed in goat serum at room temperature for 10 min. The remaining sealing liquid on the slice was gently and carefully shaken off. Primary antibody(TGF-β1,1:1, 00, cat. no. ab92486, Abcam, VEGF,1:1, 00, cat. no. ab46154, Abcam) was then added in a drop-wise manner to all scar tissue sections, and then placed in a wet box containing an appropriate amount of water and incubated in a low-temperature refrigerator overnight, with the refrigerator temperature set to 4˚C. The PBS solution was then completely washed off, and the residual PBS solution was gently removed. This was followed by the addition of secondary antibody (HRP-conjugated anti-rabbit IgG secondary antibody, 1:200, cat. no. 31460; Invitrogen; Thermo Fisher Scientific, Inc.) in a drop-wise manner and the specimens were placed in an incubator at 37˚C for 30 min. Following treatment with PBS solution again, horseradish enzyme-labeled streptomycin (hz-2037R-HRP, Shanghai Huzhen Industrial Co., Ltd, ) was then added to the tissue slides in a drop-wise manner, followed by incubation in a constant temperature box at 37˚C for 30 min. Sections were visualized using DAB and counterstained using hematoxylin (DA1010-3, Beijing solabao Technology Co., Ltd). Positive staining was indicated by brown and yellow.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStatistical analysis\u003c/em\u003e. All experiments were repeated three times. The data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. Statistical analysis was performed using GraphPad Prism 7. A Student\u0026rsquo;s t-test or one-way/two-way ANOVA with Bonferroni corrections were used for specific comparisons. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cem\u003eExpression of miR-361 in HS tissues\u003c/em\u003e. By comparing and analyzing the differential miRNAs between the HS and normal tissues, it was found that there were differences in the expression of multiple miRNAs between them. The expression levels of miR-199a-5p, miR-29a, miR-205, miR-196a, miR-200b, miR-143-3p, miR-10a and miR-361 were downregulated, while those of and miR-21, miR-181, miR-382 and miR-4269 were upregulated. Among these miRNAs, the downregulated expression of miR-361 was the most significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Through the detection of 12 HS tissues and normal tissues, miR-361 expression was significantly downregulated in the HS tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003emiR-361 inhibits the proliferation of HS cells\u003c/em\u003e. HS cells with miR-361 overexpression were established (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). MTT assay revealed that the overexpression of miR-361 significantly inhibited cell proliferation in the HS tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB)., The proliferation of the HS cells was promoted following the inhibition of miR-361 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003emiR-361 inhibits the proliferation of HS cells by targeting TGF-β1\u003c/em\u003e. The present study further aimed to explore the mechanisms through which miR-361 regulates the proliferation of HS cells. Using the biological software Starbase3, it was predicted that miR-361 can target and bind to the 3 'UTR of TGF-β1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Through the detection of miR-361 and TGF-β1 in 12 HS tissues and 12 normal tissues, it was found that miR-361 was negatively associated with TGF-β1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The experimental results of luciferase reporter gene assays revealed that miR-361 inhibited the activity of TGF-β1, and this inhibition was attenuated after mutating their binding sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Subsequently, TGF-β1 was transfected into HS cells with miR-361 overexpression. The inhibitory effects of miR-361 on the proliferation of HS cells were attenuated following the transfection of TGF-β1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Conversely, in HS cells in which miR-361 expression was inhibited, the downregulation of TGF-β1 expression restored the promotion of cell proliferation induced by miR-361 inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). miR-361 significantly inhibited TGF-β1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF-I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eInhibitory effects of miR-361 on scars on rabbit ears\u003c/em\u003e. After the rabbit ear scar model was successfully constructed, the staining of scar tissue and rabbit ear tissue with miR-361 was detected using H\u0026amp;E staining. The results revealed that the fibroblasts in the control group were evenly arranged, their shape and size were basically normal, and there were no hyperplastic collagen fibers. In the scar group, there was disordered cell arrangement and excessive collagen proliferation. In the miR-361 group, the degree of cell disorder was attenuated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Masson\u0026rsquo;s staining indicated that compared with the control group, collagen hyperplasia in the scar group was significant, and collagen hyperplasia in the miR-361 group was attenuated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Immunohistochemical staining revealed that VEGF expression was upregulated and the density of blood vessels was increased in the scar group. The expression of VEGF was downregulated in the miR-361 group compared with the scar group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The results of the immunohistochemical detection of TGF-β1 also demonstrated that the content of TGF-β1 in the scar group was higher than that in the control group. Compared with the scar group, the expression of TGF-β1 in the miR-361 group was downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). TGF-β1 expression in the scar group was upregulated, and miR-361 downregulated TGF-β1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePrevious studies have demonstrated that miRNAs can be applied for the treatment of fibrotic diseases, and it is possible to develop a new model for fibrotic diseases \u003csup\u003e[\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. miR-3613-3p has been shown to inhibit HS formation by targeting arginine and glutamate-rich 1, which may provide potential therapeutic targets for the management of HS \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. miR-190a-3p in HS can bind to the CUB and sushi multiple domains 1 and may regulate its expression, thus affecting the occurrence and development of HS \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e). miR-145-5p can prevent fiber formation and reduce the formation of HS by reducing the expression of Smad2/3 \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. In the present study, in order to screen the abnormally expressed miRNAs in HS tissues, HS tissues and normal skin tissues were selected for miRNA screening. The results revealed that a variety of miRNAs were abnormally expressed in HS tissues. Among these, miR-361 was downregulated most significantly in HS tissues. A total of 12 tissues were used for detection, and the results confirmed the screening results; that is, miR-361 was significantly downregulated in HS tissues. After extracting primary HS cells, HS cells in which miR-361 was overexpressed or inhibited were established. Subsequently, MTT assay revealed that miR-361 overexpression significantly suppressed the proliferation of HS cells.\u003c/p\u003e \u003cp\u003eThrough biological prediction, it was found that miR-361 has a binding site with the 3'-UTR region of TGF-β1. TGF-β1 can promote the transformation of wound epithelial fibroblasts into myofibroblasts, cell matrix changes, deposition and wound scar formation \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e). By analyzing the expression of miR-361 and TGF-β1 in tissues, the present study found that miR-361 was negatively associated with TGF-β1. The targeting effect of miR-361 on TGF-β1 was also demonstrated using a reporter gene assay. In the follow-up experiment, it was found that TGF-β1 restored the proliferation of HS cells which was suppressed by miR-361 overexpression. Thus, these findings suggest that the effects of miR-361 on the proliferation of HS cells may be mediated via the regulation of TGF-β1.\u003c/p\u003e \u003cp\u003eIn addition, a rabbit ear scar model was constructed and the treatment group was treated with miR-361. The results revealed that miR-361 significantly attenuated the excessive proliferation and disordered arrangement of fibroblasts, reduced the collagen content, and alleviated HS to a certain extent. The appropriate concentration of TGF-β1 can promote wound epithelial healing, and excessive TGF-β1 will lead to local scar hyperplasia\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. In the rabbit ear scar model in the present study, it was found that the introduction of miR-361 decreased the expression of TGF-β1 and VEGF, and inhibited the formation of scars on rabbit ears.\u003c/p\u003e \u003cp\u003eIn conclusion, in the present study, it was found that the expression of miR-361 was downregulated in HS tissues, which may affect the biological process of HS by affecting the expression of TGF-β1. The findings presented herein may provide a potential theoretical basis for the treatment of HS.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by National Natural Science Foundation of China(No.\u003c/p\u003e\n\u003cp\u003e82002047); Science and Technology program of Liao Ning province.(No.1030057).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available on the GEO database (GSE189134).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZiyang Han conceived the study. Feng Lin ,Ziyang Han, Zeming Bai designed the study, Na zuo performed the statistical analysis., Feng Lin, Ziyang Han Weiping Wu performed the experiments. Hongyi Wang and Dapeng Zhou writed the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eHongyi Wang and\u0026nbsp;Dapeng Zhou\u0026nbsp;confirm the authenticity of all the raw data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee as well as the 1964 Helsinki declaration and its later amendments, or comparable ethical standards.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication no. 80-23, revised 1996) and were performed according to the institutional ethical guidelines for animal experiment.\u003c/p\u003e\n\u003cp\u003eThe present study was approved by the Medical Ethics Committee of the Northern Theater General Hospital (Shenyang, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient consent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eQi X, Liu Y, Yang M. Circ_0057452 functions as a ceRNA in hypertrophic scar fibroblast proliferation and VEGF expression by regulating TGF-beta2 expression and adsorbing miR-145-5p. Am J Transl Res.2021; 13: 6200-6210.\u003c/li\u003e\n\u003cli\u003eZhang S, Pan S. miR-124-3p targeting of TGF-beta1 inhibits the proliferation of hypertrophic scar fibroblasts. Adv Clin Exp Med.2021; 30: 263-271.\u003c/li\u003e\n\u003cli\u003eShi A, Li J, Qiu X, Sabbah M, Boroumand S, Huang TC, Zhao C, Terzic A, Behfar A, Moran SL. TGF-beta loaded exosome enhances ischemic wound healing in vitro and in vivo. Theranostics.2021; 11: 6616-6631.\u003c/li\u003e\n\u003cli\u003eWolska-Gawron K, Bartosinska J, Rusek M, Kowal M, Raczkiewicz D, Krasowska D. Circulating miRNA-181b-5p, miRNA-223-3p, miRNA-210-3p, let 7i-5p, miRNA-21-5p and miRNA-29a-3p in patients with localized scleroderma as potential biomarkers. Sci Rep.2020; 10: 20218.\u003c/li\u003e\n\u003cli\u003eBi S, Cao C, Chai LL, Li SR, Yang DY. Regulatory mechanism of miR-29 over TGF-beta1 and COL1 in scar cells. Eur Rev Med Pharmacol Sci.2017; 21: 2512-2517.\u003c/li\u003e\n\u003cli\u003eXiao L, Tang T, Huang Y, Guo J. MiR-564 promotes hypertrophic scar formation through TGF-beta1 upregulation. G Ital Dermatol Venereol.2019; 154: 186-191.\u003c/li\u003e\n\u003cli\u003eXie T, Liang J, Guo R, Liu N, Noble PW, Jiang D. Comprehensive microRNA analysis in bleomycin-induced pulmonary fibrosis identifies multiple sites of molecular regulation. Physiol Genomics.2011; 43: 479-487.\u003c/li\u003e\n\u003cli\u003eWu GJ, Zhao HB, Zhang XW. Death-associated protein kinase 1 correlates with podocyte apoptosis and renal damage and can be mediated by miR-361. Histol Histopathol.2021: 18358.\u003c/li\u003e\n\u003cli\u003eYu G, Mu H, Zhou H, Fang F, Cui Y, Wu Q, Xiong Q, Li H. MicroRNA-361 suppresses the biological processes of hepatic stellate cells in HBV-relative hepatic fibrosis by NF-kappaB p65. Cells Dev.2021; 167: 203711.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.2001; 25: 402-408.\u003c/li\u003e\n\u003cli\u003eYang S, Evens AM, Prachand S, Singh AT, Bhalla S, David K, Gordon LI. Mitochondrial-mediated apoptosis in lymphoma cells by the diterpenoid lactone andrographolide, the active component of Andrographis paniculata. Clinical cancer research : an official journal of the American Association for Cancer Research.2010; 16: 4755-4768.\u003c/li\u003e\n\u003cli\u003eKurt M, Akoz Saydam F, Bozkurt M, Serin M, Caglar A. The effects of valsartan on scar maturation in an experimental rabbit ear wound model. J Plast Surg Hand Surg.2020; 54: 382-387.\u003c/li\u003e\n\u003cli\u003eJiang Z, Zhao L, He F, Tan H, Li Y, Tang Y, Duan X, Li Y. Palmatine-loaded electrospun poly(epsilon-caprolactone)/gelatin nanofibrous scaffolds accelerate wound healing and inhibit hypertrophic scar formation in a rabbit ear model. J Biomater Appl.2021; 35: 869-886.\u003c/li\u003e\n\u003cli\u003eChen X, Yao JM, Fang X, Zhang C, Yang YS, Hu CP, Chen Q, Zhong GW. Hypoxia promotes pulmonary vascular remodeling via HIF-1alpha to regulate mitochondrial dynamics. J Geriatr Cardiol.2019; 16: 855-871.\u003c/li\u003e\n\u003cli\u003eZhao H, Li C, Li L, Liu J, Gao Y, Mu K, Chen D, Lu A, Ren Y, Li Z. Baicalin alleviates bleomycininduced pulmonary fibrosis and fibroblast proliferation in rats via the PI3K/AKT signaling pathway. Mol Med Rep.2020; 21: 2321-2334.\u003c/li\u003e\n\u003cli\u003eLi L, Han W, Chen Y, Chen Y. MiR-3613-3p inhibits hypertrophic scar formation by down-regulating arginine and glutamate-rich 1. Mol Cell Biochem.2021; 476: 1025-1036.\u003c/li\u003e\n\u003cli\u003eXiao Y. MiR-486-5p inhibits the hyperproliferation and production of collagen in hypertrophic scar fibroblasts via IGF1/PI3K/AKT pathway. J Dermatolog Treat.2020: 1-10.\u003c/li\u003e\n\u003cli\u003eShen W, Wang Y, Wang D, Zhou H, Zhang H, Li L. miR-145-5p attenuates hypertrophic scar via reducing Smad2/Smad3 expression. Biochem Biophys Res Commun.2020; 521: 1042-1048.\u003c/li\u003e\n\u003cli\u003eGu S, Huang X, Xu X, Liu Y, Khoong Y, Zhang Z, Li H, Gao Y, Zan T. Inhibition of CUB and sushi multiple domains 1 (CSMD1) expression by miRNA-190a-3p enhances hypertrophic scar-derived fibroblast migration in vitro. BMC Genomics.2021; 22: 613.\u003c/li\u003e\n\u003cli\u003eZheng GY, Hao LL, Wang RN, Lian YJ, Tan N. [Experimental study of TGF-beta2 antisense oligonucleotide on inhibiting corneal scar hyperplasia in rabbits]. Zhonghua Yan Ke Za Zhi.2013; 49: 163-169.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"microRNA, hypertrophic scar, TGF-β1","lastPublishedDoi":"10.21203/rs.3.rs-4011946/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4011946/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eExcessive wound repair following dermal injuries, such as burns or trauma, may lead to pathological scar formation. Transforming growth factor-β1 (TGF-β1) is a potent growth factor involved in wound healing. It is considered to be a key regulator of hypertrophic scars (HS) and various fibrotic diseases. MicroRNAs (miRNAs/miRs) widely participate in the pathophysiological processes of various diseases by playing a role in post-transcriptional gene regulation. At present, at least to the best of our knowledge, there are no study assessing the role of miR-361 in HS. The present study thus investigated the role of this miRNA in HS and found that miR-361 expression was downregulated in HS. miR-361 suppressed the proliferation of HS fibroblasts by inhibiting TGF-β1 expression. Moreover, miR-361 inhibited the formation of scars on rabbit ears by inhibiting the expression of TGF-β1. Thus, miR-361 may play a protective role in HS by suppressing TGF-β1.\u003c/p\u003e","manuscriptTitle":"miR-361 prevents the formation of hypertrophic scars by inhibiting TGF-β1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-08 14:36:47","doi":"10.21203/rs.3.rs-4011946/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f45126e0-cb09-4d69-9b74-0bd78e69c8ea","owner":[],"postedDate":"March 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-29T11:06:59+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-08 14:36:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4011946","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4011946","identity":"rs-4011946","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.