Abstract
Bisphenol-A (BPA) is a nonsteroidal estrogen that is ubiquitous in the environment. The homeobox gene Hoxa10 controls uterine organogenesis, and its expression is affected by in utero BPA exposure. We hypothesized that an epigenetic mechanism underlies BPA-mediated alterations in Hoxa10 expression. We analyzed the expression pattern and methylation profile of Hoxa10 after in utero BPA exposure. Pregnant CD-1 mice were treated with BPA (5 mg/kg IP) or vehicle control on d 9–16 of pregnancy. Hoxa10 mRNA and protein expression were increased by 25% in the reproductive tract of mice exposed in utero. Bisulfite sequencing revealed that cytosine-guanine dinucleotide methylation was decreased from 67 to 14% in the promoter and from 71 to 3% in the intron of Hoxa10 after in utero BPA exposure. Decreased DNA methylation led to an increase in binding of ER-α to the Hoxa10 ERE both in vitro as and in vivo as determined by EMSA and chromatin immunoprecipitation, respectively. Diminished methylation of the ERE-containing promoter sequence resulted in an increase in ERE-driven gene expression in reporter assays. We identify altered methylation as a novel mechanism of BPA-induced altered developmental programming. Permanent epigenetic alteration of ERE sensitivity to estrogen may be a general mechanism through which endocrine disruptors exert their action.—Bromer, J. G., Zhou, Y., Taylor, M. B., Doherty, L., Taylor, H. S.. Bisphenol-A exposure in utero leads to epigenetic alterations in the developmental programming of uterine estrogen response.
Keywords
BPA, DNA methylation, HOXA10/Hoxa10, epigenetics, developmental programming
The term “endocrine disrupting chemical” (EDC) has been coined to describe numerous compounds found in the environment with the ability to mimic the actions of endogenous hormones in vivo and in vitro(1). Humans are widely exposed to these EDCs, which have been implicated in the disruption of normal developmental processes (2). More specifically, exposure to estrogenic EDCs during critical stages of differentiation can interfere with the hormonal signaling necessary for normal development and can also result in persistently altered gene expression.
One example of an estrogenic EDC is bisphenol-A (BPA). BPA is a high-production-volume monomeric compound that has been used in the manufacture of polycarbonate plastics and subsequently incorporated in baby bottles, water bottles, and laboratory flasks. It is also used in manufacturing epoxy resins used to coat food cans and in resin-based dental composites and sealants. More important, humans are widely exposed to BPA, as evidenced by the detection of BPA in 95% of human urine samples (3). This exposure occurs as BPA leaches from polycarbonate flasks during autoclaving (4), older bottles due to decay of the plastic from repeated heating or sterilization (5), lacquer coatings in food cans during autoclaving of their contents (4), and dental sealants and composites during the first hour after application (6).
BPA is also known to be a weakly estrogenic compound, with the ability to bind to both estrogen receptor (ER) α and β. This binding results in uterotrophic activity ∼10−4 to that of estradiol (7). As was recently reviewed by Dolinoy et al.(8), this estrogenic activity of BPA has been shown to have marked effects on development in rodent models. These effects include advanced puberty, altered mammary development, increased body weight, higher incidence of breast and prostate cancer, and altered reproductive function (8,9,10,11) Furthermore, BPA enters the placenta and accumulates in fetuses after maternal exposure (12).
In humans, HOXA10 is expressed in uterine epithelial and stromal cells, and its expression is regulated by sex steroids, including estrogens. Disturbances in the normal endocrine regulation of HOX genes are a purported mechanism of estrogenic endocrine disruption. We have previously demonstrated that exposure to BPA alters Hox gene expression in the female reproductive tract in a dose-dependent fashion (13). Although it is tempting to speculate that BPA-mediated alterations in Hoxa10 gene expression are simply a result of the known weak estrogen-agonist activity of BPA, in utero exposure results in lasting changes in gene expression, which persist well after the exposure (13). Classical endocrine regulation of gene expression cannot account for these epigenetic effects.
Recently aberrant DNA methylation of cytosine-guanine dinucleotide (CpG) islands has emerged as an important epigenetic mechanism resulting in long-term changes in gene expression (14,15,16,17,18,19). Methylation generally results in decreased expression of the methylated gene. In mammals, DNA methylation is mediated by 3 DNA methyltransferases: DNMT1, DNMT3a, and DNMT3b (20).
Alterations in HOXA10 methylation have been recently associated with several human cancers (14, 16, 18, 21, 22). Wu et al.(20, 23, 24) have also reported that aberrant methylation of HOXA10 may be the cause of its lower expression in the endometrium of women with endometriosis. We recently reported similar findings in a murine model of endometriosis (25). However, altered methylation during development with subsequent modification in adult gene expression has only been recently reported (26), and the mechanism responsible for these changes is still not fully characterized.
BPA has been previously shown to act through an epigenetic mechanism. A recent study by Dolinoy et al.(8) examined yellow agouti (Avy) mouse offspring after in utero BPA exposure and found that BPA exposure resulted in an altered phenotype, shifting the coat color of these mice toward yellow. They then associated this shift in coat color with significantly decreased DNA methylation in 9 examined CpG sites. Specifically, they noted decreased CpG methylation in regions upstream of the agouti gene, as well as in the CDK5 activator-binding protein. Thus, it is clear that BPA is capable producing epigenetic modification by hypomethylation of DNA.
In the present study, we hypothesized that the permanent epigenetic effects seen with in utero exposure to BPA are mediated through aberrant methylation of the Hoxa10 gene. To evaluate this mechanism, we utilized a mouse model of EDC exposure to analyze the DNA methylation status of the Hoxa10 gene as well as the expression of the DNMTs after BPA exposure in utero. We determined that in utero exposure led to decreased methylation of the Hoxa10 gene including its estrogen response element (ERE). We demonstrate that this decreased methylation led to increased ER binding to the ERE both in vitro and in vivo and rendered the ERE more estrogen responsive.
Materials and methods
Animals
CD-1 mice were obtained from Charles River Laboratories (Wilmington, MA, USAS). The mice were housed in standard polypropylene cages in a temperature-controlled room (22°C) with a 14:10-h light-dark cycle. Food (Purina Chow; Purina Mills, Richmond, IN, USA) and water were provided ad libitum. Eight-week-old CD-1 female mice were bred to male mice of the same strain. Detection of a vaginal plug was considered d 0 of pregnancy. Pregnant mice were then housed individually and treated with intraperitoneal injection of BPA (Sigma Chemicals, St. Louis, MO, USA) in sesame oil at a dose of 5 mg/kg of maternal body weight on d 9–16 of gestation. Controls received sesame oil alone. All experiments were conducted in accordance with the Yale University Animal Care Committee Guidelines.
Female offspring were euthanized by cervical dislocation at 2 or 6 wk after birth. Uteri were removed, and one horn was fixed in 4% formalin and embedded in paraffin for histological and immunohistochemical analysis. Genomic DNA and RNA were isolated from the contralateral horns using the DNeasy and RNeasy Mini Kits, respectively (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol.
Bisulfite modification
One microgram of genomic DNA was treated with sodium bisulfite using the CpGenome™ DNA Modification Kit (Upstate, Charlottesville, VA, USA). This process converts unmethylated cytosine residues to uracil, whereas methylated cytosines remain unchanged. Bisulfite modified samples were aliquoted and stored at −80°C. Then 200 ng of sodium bisulfite-treated DNA was analyzed using primer sets directed to CpG islands contained in the 5′ promoter and intron regions of the bisulfite-modified Hoxa10 gene sequence (Fig. 1). These regions contain multiple CpG islands, and alterations in methylation in these regions have been shown to have HOXA10 regulatory capabilities (20, 24). DNA from CpG methylated mouse genomic DNA (New England BioLabs, Ipswitch, MA, USA) was used as a positive control for methylated alleles. Unmethylated mouse genomic DNA (New England BioLabs) was used as a negative control for methylated genes.
PCR, DNA cloning, and sequencing
Quantification of methylation at the 5′ promoter and intron-1 regions in the mouse was investigated via bisulfite conversion, PCR amplification, and sequencing of multiple individual clones. The Hoxa10-promotor region comprised bases −295 to −30, and the intronic region comprised bp +1243 to +1398. Next, 200 ng of bisulfite-treated DNA was utilized in a 50-μl reaction containing 1.5 μl of 20 μM forward and reverse primers, 1.25 mM deoxynucleotide triphosphates, 25 mM Mg2+, and 0.5 μl of HotStarTaq DNA polymerase (Qiagen). All primers were synthesized by the Department of Pathology, Yale University School of Medicine. The following primer sets were utilized: promotor forward primer (5′→3′) TATTTTGAGGTAGTTTTTATAGTTT, reverse primer (5′ →3′) CAAATAACCCTTTCTAACTAACATTTC; intron forward primer (5′→3′) TAAAAGGAGGGAGGGTATAATT, reverse primer (5′→3′) ATTCTAAAACCAAATTTTCACTTATC.
Amplification conditions were as follows: 15 min starting at 95°C, 35 cycles at 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s followed by a final extension at 72°C for 10 min.
The level of methylation was determined by sequencing individual clones from 7 animals in each treatment group. The PCR products of bisulfate-treated DNA were gel-purified, and then cloned into PCR4-TOPO sequencing vector (Invitrogen). Fifteen to 20 clones from each animal were cloned and sequenced using the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using the M13 primer. DNA sequencing was performed by our Keck DNA facility using dye-terminator Applied Biosystems 3730 capillary instruments. The sequencing reactions utilize fluorescently labeled dideoxynucleotides (BigDye Terminators; Applied Biosystems) and TaqFS DNA polymerase in thermal cycling protocol recommended by the manufacturer. The average read length is 550–750 bases with >99% accuracy.
The methylation of each CpG site was recorded from each individual clone for each CpG site and averaged to obtain the methylation percentage in each animal. The average of these values at each CpG site is presented. Also presented is the average percentage methylation for the promoter and intronic CpG islands.
Imunohistochemistry
Immunohistochemical analysis of Hoxa10 expression was performed as described previously (27, 28). Briefly, slides were deparaffinized and dehydrated through a serious of xylene and ethanol washes, followed by permeabilization in 95% cold ethanol. After a 5-min rinse in distilled water, slides were steamed in 0.01 M sodium citrate buffer for 20 min and cooled for 20 min. Slides were rinsed for 5 min in PBS with 0.1% Tween 20 (PBST), and sections were circumscribed with a hydrophobic pen. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 5 min followed by a 5-min PBST wash. Nonspecific binding was blocked with 1.5% normal horse serum in PBST for 1 h at room temperature. The primary Hoxa10 antibody (sc-17159) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). We have previously demonstrated the specificity of this antibody. Slides were incubated with the primary antibody overnight at 4°C. Normal goat IgG (Santa Cruz Biotechnology) was used as a negative control. Horse α-goat biotinylated secondary antibody was purchased from Vector Laboratories (Burlingame, CA, USA) and applied for 1 h at 4°C. Slides were washed in 1× PBST, incubated in ABC Elite (Vector) for 15 min at room temperature, washed in 1× PBST, and incubated for 5 min in diaminobenzidine (Vector). A 20-s exposure to hematoxylin was used as a counterstain. All slides were processed simultaneously. Slides were rehydrated through 3-min ethanol and xylene washes and mounted with Permount.
Quantitative real-time RT-PCR
Quantitative real-time RT-PCR was performed using the LightCycler SYBR Green RT-PCR kit from Roche (Stockholm, Sweden). One microgram of total RNA was reverse transcribed in 20 μl of reaction mixture containing l0 mm each of deoxy (d) ATP, dCTP, dGTP, and dTTP; 20 pmol oligo(dT); 40 U/μl ribonuclease inhibitor, l0 U/μl avian myeloblastosis virus-reverse transcriptase, and 10× AMV reverse-transcriptase buffer for 30 min at 61°C. PCR for HOXA10 was performed for 45 cycles of 95°C for 2 s, 65°C for 5 s, and 72°C for 18 s. PCR for DNMT1, DNMT3a, DNMT3b, and for control β-actin was performed for 45 cycles of 95°C for 2 s, 60°C for 5 s, and 72°C for 18 s.
Quantitation of samples were determined with the Roche Light-Cycler and adjusted to the quantitative expression of β-actin from these same samples during the exponential phase of amplification. Melting curve analysis was conducted to determine the specificity of the amplified products and to ensure the absence of primer-dimer formation. All products obtained yielded the predicted melting temperature.
Methylation of genomic DNA
CpG islands in genomic DNA were methylated using SssI methylase (New England Biolabs) according to the manufacturer’s protocol. We incubated 1 μg of genomic DNA for 60 min at 37°C in a 20-μl reaction containing 4 U of SssI methylase and buffer solution. The promoter and ERE were inserted into Pgl3-promoter between NheI and SmaI. The 2 restriction sequences can be methylated by SssI-methylase and thus rendered resistant to digestion. The completeness of methylation was initially assesed by measuring the extent of protection from digestion by the restriction enzymes NheI and SmaI. For genomic DNA, the methylation of ER-a binding sites GGGCGGG was examined using the restriction enzyme AciI, also blocked by methylation. The extent of methylation (>90%) was validated using bisulfite modification, PCR amplification and sequencing as described above.
Electrophoretic mobility shift assay (EMSA)
Complementary single-stranded oligodeoxyribonucleotides designed to incorporate an ERE in the HOXA10 promoter and its flanking sequence (nt −345 to −314) were synthesized (27, 28). The oligonucleotide probes had the following sequences: 5′-TCCGGGTAGGGGCGGGGCGAGCCCAATGGCCAGGCC-3′, 5′-TGGCCATTGGGCTCGCCCCGCCCCTACCCGGACGTG-3′. The oligonucleotides were annealed, and the resultant probes were end labeled using the Biotin 3′End DNA labeling Kit (Thermo Fisher Scientific, Rockford IL, USA). Nuclei were isolated, and nuclear extracts wereprepared from either Ishikawa or MCF-7 cells using the Nuclear Extract Kit (Activemotif, Carlsbad, CA, USA). Binding reactions were performed using the LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, Rockford, IL, USA). The reactions were performed on ice for 20 min with 0.5–1.0 μg of nuclear extract and 20 fmol of labeled DNA in a final volume of 20 μl, containing 2 μl of 10× binding buffer, and 1 μl of Poly (dI.dC). For supershift assays, 1 μg of human ER-α antibody (Santa Cruz Biotechnology) was added to the reaction mixture described above, followed by incubation on ice for 15 min prior to the addition of the labeled oligonucleotide probe. All samples were fractionated for 3 h at 200 V in a 4% nondenaturing polyacrylamide gel containing 1× Tris borate-EDTA at 4°C. The gel was dried under a vacuum at 80°C for 45 min, exposed overnight on X-OMAT film (Kodak, Rochester, NY, USA), and then developed.
Chromatin immunoprecipitation (ChIP) assay
Uterine samples were collected from mice treated with BPA or vehicle (control) as described above. A ChIP assay was performed following the manufacturer’s guidelines (Sigma-Aldrich, St. Louis, MO, USA). Fresh tissue was cross-linked with 1% formaldehyde at room temperature for 20 min. We coated 4 μg of polyclonal anti-mouse ER-α antibody (Santa Cruz Biotechnology,), mouse IgG (negative control), or anti-RNA polymerase II (positive control) onto assay wells overnight at 4°C. After washing equal amounts of control or BPA-treated tissue, extracts were added to assay wells and incubated at room temperature for 1.5 h. Five percent of tissue extracts was saved for use as input control. PCR amplification of the Hoxa10 promoter region was performed on purified DNA samples using forward primer 5′-CCTACGAAACCAAACTGGGA and reverse 5′-CATGCTGAATACGATTAGCAATCC. The PCR was performed for 30 cycles at 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min. PCR products were separated on a 3% agarose gel and stained with ethidium bromide. These primers yielded a 103-bp product containing the ERE in the Hoxa10 promoter.
Luciferase reporter assay
MCF-7 cells were cultured in phenol-red-free DMEM, supplemented with 10% charcoal-stripped calf serum, grown to 60–70% confluence in 6-well plates, and then transfected using lipofectamine 2000 (Life Technologies, Gaithersburg, MD, USA) with 2 μg of pGL3-promoter alone, methylated pGL3-promoter, pGL3-ERE/SP1, or methylated pGL3-ERE/SP1. All cells were contransfected with 80 ng pRL-TK to control for transfection efficiency. Transfectants were incubated for 5 h at 37°C in 5% CO2, washed with 1× PBS, and grown to confluence for an additional 48 h. Cells were then treated with either 10−6 M estradiol or vehicle alone for 24 h. The cells were washed with cold PBS and lysed with 1× reporter lysis buffer (Promega, Madison, WI, USA), and the lysate was collected. The cells were rinsed with cold PBS and lysed. The luciferase activity was determined in the supernatant by using the luciferase assay kit (Promega) and a luminometer. The ß-galactosidase activity was determined by using the B-Galactosidase Kit (Tropix, Bedford, MA, USA) and a luminometer. Renilla was used to normalize luciferase values.
Statistical analysis
Statistical analysis was performed with the 2-sided Fisher’s exact test for the comparison of DNA methylation frequencies of the Hoxa10 gene between BPA-treated mice and control mice. Student’s t test was used to compare the mean number of methylated sites for each region. Values of P < 0.05 were considered statistically significant. Analyses were performed using SigmaStat v12 (Systat Software, Chicago, IL, USA).
Results
BPA exposure in utero increases adult Hoxa10 gene expression
To establish that in utero BPA exposure produced alterations in Hoxa10 expression, pregnant mice were treated with BPA or vehicle control, and the female pups were examined. An increase in uterine Hoxa10 expression was identified by quantitative real time RT-PCR. Hoxa10 mRNA expression was increased by ∼25% after BPA exposure compared to controls (P=0.02) (Fig. 2).
Immunohistochemistry was also performed on sections of the uteri from female offspring at 2 wk of age. Vehicle treated controls revealed expression of Hoxa10 protein consistent with previous reports (13, 29). The offspring of BPA-treated mice demonstrated a relative increase of Hoxa10 protein expression throughout the uterus (Fig. 3).
Methylation of the Hoxa10 gene in mice after in utero BPA exposure
We investigated whether the observed increase in Hoxa10 expression after BPA-treatment was correlated with alterations in DNA methylation using bisulfite conversion, PCR amplicon cloning, and sequencing. Portions of the Hoxa10 gene rich in CpG islands were identified in the promoter region, and primer sets were designed to amplify these regions. Fifteen mice from ≥3 separate litters were examined. We found that only 38% (3/7) of BPA-treated mice showed evidence of any methylation in the promoter fragment, compared with 100% (7/7) of control mice (P=0.001). The intron also was found to have a similar degree of demethylation, with 100% of controls showing methylation and only 57% (4/7) of the BPA-treated mice demonstrating methylation.
The quantitative difference in methylation levels of Hoxa10 expressed as the mean percentage of methylation at each CpG island was also examined, demonstrating the extent of methylation on average for both the promoter and intronic regions (Fig. 4A). All sites showed decreased methylation, and many were completely demethylated. Also presented is the mean methylation in the promoter and intronic regions examined. In the promotor, BPA treatment was associated with significantly decreased mean number of methylated sites compared to controls (67 vs. 14%, respectively; P=0.007). Similarly, the level of methylation was significantly reduced in the intron as well (71 and 3%, respectively; P=0.001). Methylation was not altered in the uteri of adult mice treated with the same dose of BPA (data not shown).
Alteration in the expression of DNA methyltransferases after in utero BPA exposure
We investigated whether the observed changes in DNA methylation were accompanied by persistent changes in expression of the known DNMTs. mRNA levels of DNMT1, DNMT3a, and DNMT3b from the uteri of 2-wk-old offspring exposed to BPA in utero are demonstrated in Fig. 5. The relative fold changes in mRNA expression of DNMT1, DNMT3a, and DNMT3b were not significantly altered after BPA exposure (DNMT1: 1.17 fold, P=0.459; DNMT3a: 1.13 fold, P=0.751; DNMT3b :1.34 fold, P=0.165). Thus, the decreased methylation in the Hoxa10 gene was not due to persistent repression of DNA methytransferases.
DNA methylation decreases ER-α binding to the Hoxa10 promoter
To assess whether DNA methylation altered the ability of ER-α to bind to the Hoxa10 promoter, DNA oligonucleotides containing the Hoxa10 ERE sequence were used for EMSA. Nuclear extract from ER-expressing cell lines shifted the Hoxa10 ERE-containing probe (Fig. 6). Addition of anti-ER-α antibody to the binding reaction resulted in a loss of the shifted complex, confirming the identity of the protein bound to the ERE as ER-α. To determine the effect of DNA methylation on ER binding, the probe was treated with SssI methylase and compared using EMSA to the unmethylated probe. The lack of methylation mimicked the effect of BPA exposure as demonstrated above. EMSA demonstrated that although both ER-αs bound the ERE-containing oligonucleotides (Fig. 6, lane UN), this binding was significantly decreased in the presence of DNA methylation (Fig. 6, lane M).
Similarly, to determine if the loss of methylation in the Hoxa10 ERE after BPA exposure effects binding in vivo, we preformed ChIP. Uterine tissue from offspring exposed in utero and vehicle-exposed controls were precipitated using an anti-ER-α antibody. As demonstrated in Fig. 7, significantly more ERE is occupied by ER in the mice exposed to BPA than in controls.
Effect of methylation on the ERE-driven gene expression
We next determined whether the diminished ERE binding in the presence of DNA methylation led to diminished response to estradiol in vitro, using MCF-7 cells. MCF-7 cells are a well-differentiated ER-expressing breast carcinoma cell line in which estrogen responsiveness has been extremely well characterized. Cells were transfected with methylated or unmethylated ERE-containing the HOXA10 promoter sequence in pGL3-promotor, and responsiveness to estradiol was assessed using a luciferase reporter assay. Luciferase activity was significantly increased after the addition of estradiol in the cells transfected with unmethylated sequences. No change in reporter activity was seen after the treatment with estradiol in cells transfected with the fully methylated ERE (Fig. 8). Thus, methylation modulates estrogen responsiveness of the ERE.
Discussion
BPA exposure has recently been linked to a variety of adverse outcomes, including a higher incidence of breast and prostate cancer and altered reproductive function (10). Hoxa10 is an essential developmental mediator in the patterning of the embryonic uterus (30), but it also continues to be expressed dynamically in the adult endometrium, where it has been shown to be necessary for implantation and regulated by sex steroids (31, 32). The alteration of Hoxa10 expression by BPA could provide an explanation of how BPA exerts its estrogenic endocrine-disrupting effects on the reproductive system.
In the present study, we investigated the change in DNA methylation of Hoxa10 after in utero BPA exposure. We have shown that exposure leads to aberrant methylation in the promotor and intron of Hoxa10 and have further shown that this altered methylation persists after birth. At the same time, we found no significant changes in DNA methylation of Hoxa10 in adults that were acutely treated with intraperitoneal BPA. This result suggests that epigenetic modification, that is, changes in DNA methylation, may occur only during a critical developmental window.
Interestingly, we did not see persistently decreased levels of mRNA expression of known DNA methyltransferases, the enzymes responsible for DNA methylation. It is likely that BPA decreased the expression or activity of these enzymes during embryonic development, and then expression normalized prior to our assay. It is also important to note that levels of DNMT expression are not specific markers for methylation in any one gene, including Hoxa10, and cannot be interpreted as reflective of specificity of methylation. The mechanism driving altered methylaton may involve a direct effect of BPA on DNMTs, however, we cannot exclude that BPA exposure leads to changes in pregnancy-related homeostatic mechanisms or maternal food intake that have a more direct effect on DNA methlytransferases. Future studies will attempt to further characterize DNMT expression during critical stages of development in utero.
DNA methylation has been shown to regulate a variety of aspects of cellular physiology, including growth and differentiation, through alterations in gene expression (33, 34). Alterations in DNA methylation are associated with a variety of processes, including control of gene expression, change in chromatin structure, histone modification, gene imprinting, and transcriptional silencing of genes (35,36,37). These methylation-induced epigenetic changes also play an important role in development (38). The effect of DNA methylation, demonstrated here using reporter assays, may be further altered beyond what is indicated when these secondary effects of DNA methylation are considered.
Our findings suggest that hypomethylation of the Hoxa10 gene is a mechanism responsible for BPA-related altered developmental programming of the Hoxa10 gene. These findings are consistent with another recent study by our laboratory (26), in which differences in levels of DNA methylation in both the promoter and the intron of Hoxa10 were observed after in utero exposure to diethylstilbestrol (DES), another estrogenic EDC. However, after DES exposure, methylation is increased rather than decreased as seen after BPA exposure. This difference may explain the distinct set of developmental consequences seen after exposure to these 2 compounds, despite both being estrogenic. The effect of xenoestrogens on DNA methylation and embryonic development may be independent of their function as estrogens. Although the estrogenic function of these compounds has been described in adults, adult exposure did not lead to epigenetic alterations. Epigenetic alterations caused by xenoestrogens are likely a distinct function of these compounds during embryogenesis. In fact, the epigenetic alterations in DNA methylation seen with BPA, DES, and perhaps other xenoestrogens may act in a manner unrelated to their estrogenicity, leading to complex changes in gene expression and function. These changes may not be readily predictable based on our current understanding of estrogen action.
It is likely that hypomethylation regulates gene expression through alterations in transcription factor binding. We have recently characterized both an ERE and a specificity protein 1 sequence that modulate estrogen responsiveness of Hoxa10(28). Here we have shown that inducing DNA methylation in the Hoxa10 ERE significantly impairs transcription factor binding as well as estrogen-driven gene expression. As this region contains CpG sites that may become demethylated after BPA exposure, demethylation, in turn, may lead to enhanced binding of the transcription factors that drive Hoxa10 expression. BPA exposure during development may subsequently lead to hyper-responsiveness to estrogens as an adult.
Alteration of responsiveness to estrogens may be a general mechanism through which endocrine disruptors exert their action. Greathouse et al.(39) recently described the developmental programming of 6 genes with putative EREs in rats exposed in utero to DES. We suggest that this programming might be explained by alterations in DNA methylation leading to changes in transcription factor binding. We propose a model whereby exposure to potent estrogens such as DES leads to hypermethylation and decreased estrogen responsiveness, whereas exposure to weak estrogens leads to hypomethylation and increased estrogen responsiveness. Other types of developmental programming in response to environmental cues increase risk of disease later in life. For instance, infants born with low birth weight, as a marker of an unfavorable intrauterine nutritional environment, are programmed differently; they have an increased risk of obesity and an increased risk of metabolic syndrome, coronary heart disease, and hypertension in adulthood. Similarly the estrogen environment in utero programs estrogen responses in adulthood. This has implications for reproduction and perhaps many other of the pleiotrophic actions of estrogens in adults.
In summary, we have shown that abnormal DNA methylation of regulatory elements in the Hoxa10 gene after in utero BPA exposure leads to altered developmental programming of Hoxa10 expression after birth. Altered methylation affects ER binding to the Hoxa10 ERE and increases estrogen responsiveness of this gene. Permanent epigenetic alteration of ERE sensitivity to estrogen may be a general mechanism through which endocrine disruptors exert their action.
Acknowledgments
The authors thank Hongling Du for technical advice and assistance. This research was supported by U.S. National Institutes of Health grants ES10610 and HD052668.
References
- Morrison A. G., Callanan J. J., Evans N. P., Aldridge T. C., Sweeney T. Effects of endocrine disrupting compounds on the pathology and oestrogen receptor alpha and beta distribution in the uterus and cervix of ewe lambs. Domest Anim Endocrinol. 2003;25:329–343. doi: 10.1016/j.domaniend.2003.06.004. [DOI] [PubMed] [Google Scholar]
- Colborn T., vom Saal F. S., Soto A. M. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect. 1993;101:378–384. doi: 10.1289/ehp.93101378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calafat A. M., Kuklenyik Z., Reidy J. A., Caudill S. P., Ekong J., Needham L. L. Urinary concentrations of bisphenol A and 4-nonylphenol in a human reference population. Environ Health Perspect. 2005;113:391–395. doi: 10.1289/ehp.7534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brotons J. A., Olea-Serrano M. F., Villalobos M., Pedraza V., Olea N. Xenoestrogens released from lacquer coatings in food cans. Environ Health Perspect. 1995;103:608–612. doi: 10.1289/ehp.95103608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mountfort K. A., Kelly J., Jickells S. M., Castle L. Investigations into the potential degradation of polycarbonate baby bottles during sterilization with consequent release of bisphenol A. Food Addit Contam. 1997;14:737–740. doi: 10.1080/02652039709374584. [DOI] [PubMed] [Google Scholar]
- Olea N., Pulgar R., Perez P., Olea-Serrano F., Rivas A., Novillo-Fertrell A., Pedraza V., Soto A. M., Sonnenschein C. Estrogenicity of resin-based composites and sealants used in dentistry. Environ Health Perspect. 1996;104:298–305. doi: 10.1289/ehp.96104298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sheehan D. M. Activity of environmentally relevant low doses of endocrine disruptors and the bisphenol A controversy: initial results confirmed. Proc Soc Exp Biol Med (N Y) 2000;224:57–60. doi: 10.1046/j.1525-1373.2000.22401.x. [DOI] [PubMed] [Google Scholar]
- Dolinoy D. C., Huang D., Jirtle R. L. Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Proc Natl Acad Sci U S A. 2007;104:13056–13061. doi: 10.1073/pnas.0703739104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Howdeshell K. L., Hotchkiss A. K., Thayer K. A., Vandenbergh J. G., vom Saal F. S. Exposure to bisphenol A advances puberty. Nature. 1999;401:763–764. doi: 10.1038/44517. [DOI] [PubMed] [Google Scholar]
- Maffini M. V., Rubin B. S., Sonnenschein C., Soto A. M. Endocrine disruptors and reproductive health: the case of bisphenol-A. Mol Cell Endocrinol. 2006;254–255:179–186. doi: 10.1016/j.mce.2006.04.033. [DOI] [PubMed] [Google Scholar]
- Markey C. M., Luque E. H., Munoz De Toro M., Sonnenschein C., Soto A. M. In utero exposure to bisphenol A alters the development and tissue organization of the mouse mammary gland. Biol Reprod. 2001;65:1215–1223. doi: 10.1093/biolreprod/65.4.1215. [DOI] [PubMed] [Google Scholar]
- Takahashi O., Oishi S. Disposition of orally administered 2,2-Bis(4-hydroxyphenyl)propane (bisphenol A) in pregnant rats and the placental transfer to fetuses. Environ Health Perspect. 2000;108:931–935. doi: 10.1289/ehp.00108931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith C. C., Taylor H. S. Xenoestrogen exposure imprints expression of genes (Hoxa10) required for normal uterine development. FASEB J. 2007;21:239–246. doi: 10.1096/fj.06-6635com. [DOI] [PubMed] [Google Scholar]
- Ballestar E., Paz M. F., Valle L., Wei S., Fraga M. F., Espada J., Cigudosa J. C., Huang T. H., Esteller M. Methyl-CpG binding proteins identify novel sites of epigenetic inactivation in human cancer. EMBO J. 2003;22:6335–6345. doi: 10.1093/emboj/cdg604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu M. C., Selam F. B., Taylor H. S. HOXA10 regulates p53 expression and matrigel invasion in human breast cancer cells. Cancer Biol Ther. 2004;3:568–572. doi: 10.4161/cbt.3.6.848. [DOI] [PubMed] [Google Scholar]
- Lee T. S., Kim J. W., Kang G. H., Park N. H., Song Y. S., Kang S. B., Lee H. P. DNA hypomethylation of CAGE promotors in squamous cell carcinoma of uterine cervix. Ann N Y Acad Sci. 2006;1091:218–224. doi: 10.1196/annals.1378.068. [DOI] [PubMed] [Google Scholar]
- Rauch T., Wang Z., Zhang X., Zhong X., Wu X., Lau S. K., Kernstine K. H., Riggs A. D., Pfeifer G. P. Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay. Proc Natl Acad Sci U S A. 2007;104:5527–5532. doi: 10.1073/pnas.0701059104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakuma M., Akahira J., Ito K., Niikura H., Moriya T., Okamura K., Sasano H., Yaegashi N. Promoter methylation status of the Cyclin D2 gene is associated with poor prognosis in human epithelial ovarian cancer. Cancer Sci. 2007;98:380–386. doi: 10.1111/j.1349-7006.2007.00394.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Whitcomb B. P., Mutch D. G., Herzog T. J., Rader J. S., Gibb R. K., Goodfellow P. J. Frequent HOXA11 and THBS2 promoter methylation, and a methylator phenotype in endometrial adenocarcinoma. Clin Cancer Res. 2003;9:2277–2287. [PubMed] [Google Scholar]
- Wu Y., Strawn E., Basir Z., Halverson G., Guo S. W. Aberrant expression of deoxyribonucleic acid methyltransferases DNMT1, DNMT3A, and DNMT3B in women with endometriosis. Fertil Steril. 2007;87:24–32. doi: 10.1016/j.fertnstert.2006.05.077. [DOI] [PubMed] [Google Scholar]
- Enokida H., Shiina H., Urakami S., Igawa M., Ogishima T., Li L. C., Kawahara M., Nakagawa M., Kane C. J., Carroll P. R., Dahiya R. Multigene methylation analysis for detection and staging of prostate cancer. Clin Cancer Res. 2005;11:6582–6588. doi: 10.1158/1078-0432.CCR-05-0658. [DOI] [PubMed] [Google Scholar]
- Yoshida H., Broaddus R., Cheng W., Xie S., Naora H. Deregulation of the HOXA10 homeobox gene in endometrial carcinoma: role in epithelial-mesenchymal transition. Cancer Res. 2006;66:889–897. doi: 10.1158/0008-5472.CAN-05-2828. [DOI] [PubMed] [Google Scholar]
- Taylor H. S., Arici A., Olive D., Igarashi P. HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J Clin Investig. 1998;101:1379–1384. doi: 10.1172/JCI1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu Y., Halverson G., Basir Z., Strawn E., Yan P., Guo S. W. Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol. 2005;193:371–380. doi: 10.1016/j.ajog.2005.01.034. [DOI] [PubMed] [Google Scholar]
- Lee B., Du H., Taylor H. S. Experimental murine endometriosis induces DNA methylation and altered gene expression in eutopic endometrium. Biol Reprod. 2009;80:79–85. doi: 10.1095/biolreprod.108.070391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bromer J. G., Wu J., Zhou Y., Taylor H. S. Hypermethylation of HOXA10 by in utero diethylstilbestrol exposure: an epigenetic mechanism for altered developmental programming. Endocrinology. 2009;150:3376–3382. doi: 10.1210/en.2009-0071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Akbas G. E., Song J., Taylor H. S. A HOXA10 estrogen response element (ERE) is differentially regulated by 17 beta-estradiol and diethylstilbestrol (DES) J Mol Biol. 2004;340:1013–1023. doi: 10.1016/j.jmb.2004.05.052. [DOI] [PubMed] [Google Scholar]
- Martin R., Taylor M. B., Krikun G., Lockwood C., Akbas G. E., Taylor H. S. Differential cell-specific modulation of HOXA10 by estrogen and specificity protein 1 response elements. J Clin Endocrinol Metab. 2007;92:1920–1926. doi: 10.1210/jc.2006-1694. [DOI] [PubMed] [Google Scholar]
- Block K., Kardana A., Igarashi P., Taylor H. S. In utero diethylstilbestrol (DES) exposure alters Hox gene expression in the developing mullerian system. FASEB J. 2000;14:1101–1108. doi: 10.1096/fasebj.14.9.1101. [DOI] [PubMed] [Google Scholar]
- Du H., Taylor H. S. Molecular regulation of mullerian development by Hox genes. Ann N Y Acad Sci. 2004;1034:152–165. doi: 10.1196/annals.1335.018. [DOI] [PubMed] [Google Scholar]
- Daftary G. S., Taylor H. S. Implantation in the human: the role of HOX genes. Semin Reprod Med. 2000;18:311–320. doi: 10.1055/s-2000-12568. [DOI] [PubMed] [Google Scholar]
- Eun Kwon H., Taylor H. S. The role of HOX genes in human implantation. Ann N Y Acad Sci. 2004;1034:1–18. doi: 10.1196/annals.1335.001. [DOI] [PubMed] [Google Scholar]
- Cedar H. DNA methylation and gene activity. Cell. 1988;53:3–4. doi: 10.1016/0092-8674(88)90479-5. [DOI] [PubMed] [Google Scholar]
- Newell-Price J., Clark A. J., King P. DNA methylation and silencing of gene expression. Trends Endocrinol Metab. 2000;11:142–148. doi: 10.1016/s1043-2760(00)00248-4. [DOI] [PubMed] [Google Scholar]
- Issa J. P. Epigenetic variation and human disease. J Nutr. 2002;132:2388S–2392S. doi: 10.1093/jn/132.8.2388S. [DOI] [PubMed] [Google Scholar]
- Laird P. W. The power and the promise of DNA methylation markers. Nat Rev Cancer. 2003;3:253–266. doi: 10.1038/nrc1045. [DOI] [PubMed] [Google Scholar]
- Robertson K. D., Wolffe A. P. DNA methylation in health and disease. Nat Rev Genet. 2000;1:11–19. doi: 10.1038/35049533. [DOI] [PubMed] [Google Scholar]
- Li E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet. 2002;3:662–673. doi: 10.1038/nrg887. [DOI] [PubMed] [Google Scholar]
- Greathouse K. L., Cook J. D., Lin K., Davis B. J., Berry T. D., Bredfeldt T. G., Walker C. L. Identification of uterine leiomyoma genes developmentally reprogrammed by neonatal exposure to diethylstilbestrol. Reprod Sci. 2008;15:765–778. doi: 10.1177/1933719108322440. [DOI] [PubMed] [Google Scholar]
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.