Full text
77,231 characters
· extracted from
preprint-html
· click to expand
MpNPR modulates lineage-specific oil body development and defence against gastropod herbivory in Marchantia polymorpha | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results MpNPR modulates lineage-specific oil body development and defence against gastropod herbivory in Marchantia polymorpha View ORCID Profile Loreto Espinosa-Cores , View ORCID Profile Santiago Michavila , View ORCID Profile Marina Gonzalez-Zuloaga , View ORCID Profile Roberto Solano , View ORCID Profile Selena Gimenez-Ibanez doi: https://doi.org/10.1101/2025.11.17.688000 Loreto Espinosa-Cores 1 Plant Molecular Genetics Department, Centro Nacional de Biotecnología-CSIC (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Loreto Espinosa-Cores Santiago Michavila 1 Plant Molecular Genetics Department, Centro Nacional de Biotecnología-CSIC (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Santiago Michavila Marina Gonzalez-Zuloaga 1 Plant Molecular Genetics Department, Centro Nacional de Biotecnología-CSIC (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Marina Gonzalez-Zuloaga Roberto Solano 1 Plant Molecular Genetics Department, Centro Nacional de Biotecnología-CSIC (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Roberto Solano Selena Gimenez-Ibanez 1 Plant Molecular Genetics Department, Centro Nacional de Biotecnología-CSIC (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Selena Gimenez-Ibanez For correspondence: selena.gimenez{at}cnb.csic.es Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT The transition to land exposed early plants to novel biotic constraints, creating strong selection pressures that drove the evolution of the plant immune system. Extant land plants comprise two major groups, tracheophytes and bryophytes, which include liverworts, hornworts and mosses. These two groups diverged early after land colonization, and thus, immune mechanisms have also been subjected to independent evolution. Here, we investigated the function of the unique NPR in the liverwort Marchantia polymorpha and report that it exhibits a specialised immune function relative to its orthologs in tracheophytes. We show that MpNPR modulates the formation of oil bodies, a synapomorphy of liverworts, which function as storage organelles for secondary metabolites and defence against arthropods. We found that MpNPR interacts with MpERF13, a transcription factor controlling oil body differentiation, and that plants with altered levels of MpNPR are misregulated in the expression of MpERF13-dependent genes. Furthermore, we uncover that MpNPR and MpERF13 are required for the defence against snail herbivory. Finally, we show that the ability of MpNPR to induce oil body formation and resistance to gastropods is fully dependent on MpERF13. Taken together, our results demonstrate that NPR mediates a novel regulatory pathway in lineage-specific oil body formation and immunity against gastropod herbivory through the MpERF13 TF in Marchantia, while also pinpoint a novel specialised evolutionary trajectory of NPR in liverworts. INTRODUCTION The colonisation of the terrestrial environment by plants was a key step in evolution that paved the way for all terrestrial life. On land, early plants were rapidly exposed to a multitude of novel biotic stresses, constituting strong selection pressures that acted as a driving force for the evolution of new sophisticated defence mechanisms to quickly adapt or perish 1 , 2 . This included the emergence of effective immune responses against a large diversity of microbes with contrasting infective strategies and lifestyles such as bacteria, fungi, oomycetes and herbivores, among many others. Extant land plants comprise two major groups, tracheophytes (vascular plants) and bryophytes (non-vascular plants). Tracheophytes contain four plant lineages (lycophytes, ferns, gymnosperms and angiosperms), while bryophytes include the three lineages liverworts, hornworts and mosses 3 – 5 . These two groups diverged from each other early after land colonization, and thus, immune mechanisms against invaders have also been subjected to independent evolution over the past 400 million years 5 . This might have led to a large diversity of immune mechanisms, which encompasses well-conserved across land plants’ defence systems, such as cell surface immune receptors and metabolic routes, and also, lineage-specific innovations for immunity 2 . Lineage-specific plant immunity might be the result of singular co-evolution with pathogen pressures, and represent diversified reservoirs of immune mechanisms that are exclusive to certain plants. Most liverworts contain oil bodies within their cells, which represents a typical synapomorphy of this lineage, and a likely liverwort-specific innovation for immunity against herbivores 6 – 9 . Oil bodies are intracellular specialized organelles that synthesize and store a large diversity of bioactive cytotoxic metabolites, such as terpenoids or bisbibenzyls, as major chemical constituents 6 , 8 , 10 – 13 . Their specific characteristics, such as size, shape, and colour, vary between plant species 8 . Some liverworts, like in the Radula genus contain oil bodies in almost every cell, while in others, such as Marchantia polymorpha ( Marchantia ), oil bodies are large and differentiate only in specialized cells referred to as idioblasts in a relative constant proportion 14 . Recent studies in Marchantia have provided significant insights into the mechanisms governing oil body cell differentiation and formation, highlighting key transcription factors (TFs), such as MpERF13, MpC1HDZ, MpTGA, and MpMYB02 in this process 6 , 7 , 15 , 16 . Among all, MpERF13 and MpC1HDZ are master TFs required for oil body cell differentiation and formation that act likely by regulating the expression of MpSYB12B, an SNARE protein that coordinates the redirection of the secretory pathway towards the formation of the oil body 6 , 7 . In contrast, MpMYB02 likely acts later in the development of the oil body cell and is also involved in the biosynthesis of secondary metabolites such as marchantins that are stored at the organelle 10 , 15 , 17 . Moreover, retention of additionally synthetised sesquiterpenes within the oil body further require the Mp ABCG1 transporter 12 . Notably, recent targeted functional analyses in Marchantia have shown that mutants for the Mp ERF13 and Mp C1HDZ TFs, which are depleted of oil body cells, are also more susceptible to the attack of the terrestrial isopod Armadillidium vulgare 6 , 7 . Conversely, gain-of-function mutants of Mp ERF13 or genome-edited mutant lines of MpTGA, which show a significant increase in oil body numbers, are more resistant to feeding by this arthropod 7 , 16 . These results have stablished the first evidences for the direct role of oil bodies in controlling herbivory by arthropods in Marchantia . However, oil bodies are likely to be not only effective in protecting against the attack of arthropods as early experiments performed more than a century ago already associated the presence of these organelles to the feeding behaviour of land snails 18 . While all this recent work has paved the way for starting to understand the regulatory circuits controlling oil body cell differentiation and function, which host regulators control TF-driven oil body formation and liverwort-specific immunity in Marchantia remains enigmatic. In angiosperms, NPR ( non-expressors of PR ) genes such as NPR1, NPR3 , and NPR4 have been extensively studied for their essential roles as hormonal salicylic acid (SA) sensors and executors of SA-dependent plant defences against biotrophic and hemibiotrophic pathogens, although with different binding affinities for the hormone and immune outcomes 19 – 23 . While NPR1 is a positive regulator of SA signalling and related defence responses, NPR3/NPR4 act as repressors 21 . These NPRs features represent a commonality for multiple plants from angiosperms 24 . Marchantia has a unique MpNPR ortholog, which is a substantial difference compared to the Arabidopsis genome 25 . Its recent characterization has revealed that Mp NPR can complement the At npr1 mutant, but not At npr3npr4, when ectopically expressed in Arabidopsis 25 , 26 . This goes in line with that previously observed for a PpNPR from the moss Physcomitrium patens 27 . Paradoxically, mutations in Mp NPR gene do not result in At npr1 -like phenotypes in Marchantia . In fact, Mp npr mutants show enhanced resistance to the hemibiotrophic bacterium Pseudomonas syringae , hypersensitivity to SA exogenous treatments and notably, unaltered SA-induced transcriptional reprograming compared to wild-type Marchantia plants 25 . These unexpected results indicate that Mp NPR may not be the master regulator of SA-induced responses in this liverwort. In support of this, hornworts lack NPR genes but still produce SA for still unknown purposes 28 – 30 . Additionally, recent analysis in Mp npr mutants have identified roles for MpNPR in the regulation of abiotic stresses, including thermomorphogenesis and far-red light responses, and also developmental processes such as sexual reproduction 16 , 25 . This has led to the hypothesis that, despite some NPR biochemical properties might be partially conserved between bryophytes and tracheophytes, MpNPR might have been initially acquired by liverworts to different purposes than vascular plants 2 , 25 . Taken together, the recent data suggests that NPR-associated pathways might have evolved distinctly in divergent land plant lineages, while also opens the intriguing question of whether NPR, which is considered a master regulator on plant defences in most plants, also contribute to immunity in bryophytes to any extent. Here, we investigated the role of MpNPR and report that it exhibits a specialised immune function unique to liverworts. Our results show that MpNPR controls lineage-specific oil body formation and defence against snail herbivory through the master MpERF13 TF in Marchantia, further indicanting that the defensive role of oil bodies is not restricted to arthropods and that might be general against herbivore attack. Globally, our suggests that NPRs from liverworts were co-opted towards the control of the oil body to fend off against the selective pressures that likely early herbivores impose on ancestral liverworts. RESULTS MpNPR is a positive regulator of oil body formation To gain insight into the NPR function in Marchantia , we generated Mp npr mutants by conventional CRISPR/Cas9 technology in the WT Tak-1 background 31 . We obtained two different alleles, Mp npr-3 ge and Mp npr-4 ge , which contained a 22 bp deletion and a 37 bp insertion in the first exon of Mp NPR , respectively (Figure S1A). Both alleles resulted in a premature stop codon and, therefore, non-functional MpNPR peptides lacking all fundamental domains for an NPR protein (Figure S1A). Our Mp npr-3 ge and Mp npr-4 ge alleles did not show obvious developmental defects (Figure S1B), as alleles described previously 16 , 25 . To understand the biological role of MpNPR, we performed a detailed phenotypic characterization of the mutant alleles. It has been previously described that the thallus of M. polymorpha grown on axenic conditions contain a relative low number of oil bodies, while specific environmental conditions such as starvation and non-axenic cultivation increase the accumulation of these organelles 6 , 10 . Thus, we analysed the formation of oil bodies in gemmae from Tak-1 and Mp npr mutants grown on axenic and non-axenic conditions using vermiculite as substrate. As observed before for oil body cells in the thallus of M. polymorpha 6 , 10 , gemmae from non-axenically grown Tak-1 plants showed significantly higher amounts of oil bodies, and specially, decreased dispersion in the number of these organelles among gemmae, compared to plants grown on axenic conditions (Figure S2). Under non-axenic conditions, gemmae from both Mp npr mutant alleles showed a significant reduction in the number of oil bodies compared to Tak-1 plants ( Figure 1A and 1B ). In contrast, under axenic conditions, gemmae from Mp npr mutants grown in vitro did not display significant differences compared to Tak-1 (Figure S3), as it has been previously described 16 . This indicates that MpNPR is not essential for basal levels of oil bodies, but contributes to the formation of these organelles during environmental-induced modulation of oil body development. Download figure Open in new tab Figure 1. MpNPR is a positive regulator of oil body formation. (A) Phenotype of BODIPY-stained 0-d-old gemmae from WT Tak-1 and Mp npr mutant plants under fluorescence microscopy. Oil bodies are indicated by arrows. (B) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1 and Mp npr mutant plants. Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (C) Phenotype of BODIPY-stained 0-d-old gemmae from WT Tak-1 and Mp NPR overexpressing plants under fluorescence microscopy. Oil bodies are indicated by arrows. (D) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1 and Mp NPR overexpressing plants. Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). To further study the function of MpNPR during the development of oil bodies, we next evaluated the impact of increasing endogenous MpNPR levels in Marchantia. To do this, we generated transgenic Marchantia plants overexpressing Mp NPR-citrine under the control of the Mp EF1⍺ promoter in the Tak-1 background. Western blotting assays confirmed protein accumulation of MpNPR-citrine (Figure S4A). Compared to Tak-1, ectopic Mp NPR expression reduced thallus growth while maintaining the typical dichotomous branching from apical meristems of this liverwort (Figure S4B). However, the most outstanding phenotype of Marchantia plants overexpressing Mp NPR (Mp NPR-3 ox and Mp NPR-4 ox ) was a striking overaccumulation in the number of oil bodies in gemmae ( Figure 1C and 1D ). Whereas WT Tak-1 gemmae formed around 40 oil bodies predominantly accumulating near the gemmae margin, gemmae overexpressing Mp NPR contained an average above 200 oil body cells, distributed throughout all the gemmae tissue ( Figure 1C and 1D ). These data indicate that Mp NPR is a positive regulator of oil body formation in Marchantia . MpNPR interacts with MpERF13 transcription factor Recent studies have provided insights into the molecular mechanisms controlling oil body formation in Marchantia , uncovering key TFs involved in oil body cell differentiation and maturation 8 . These include TFs from several families, such as MpERF13 7 , MpC1HDZ 6 and MpMYB02 15 , as positive regulators of oil body cell differentiation and formation. Conversely, the MpTGA was identified as a negative regulator for the formation of these structures 16 . Among all, the MpERF13 TF from the AP2-ERF family called our attention as a recently described gain-of-function allele of Mp ERF13 (Mp erf13 GOF ) showed a significant increase in oil body numbers reminiscent to what we observed for our overexpressing Mp NPR gemmae 7 . Thus, we directly compared oil body numbers in gemmae from Mp erf13 GOF , and also an already characterized genome-edited mutant line of Mp ERF13 (Mp erf13-1 ge ), with mutant and overexpressing lines of Mp NPR (Mp npr-4 ge and Mp NPR-4 ox ) 7 . As previously described 7 , Mp erf13-1 ge gemmae were completely depleted of oil bodies while Mp erf13 GOF gemmae significantly over accumulated these organelles along all the gemma compared to Tak-1 ( Figure 2A ). Mp npr gemmae showed significantly lower amounts of oil bodies compared to Tak-1, but far from Mp erf13-1 ge ( Figure 2A and 2B ). In contrast, gemmae overexpressing Mp NPR showed increased oil body numbers and a distribution pattern for these specialized structures rather similar to that observed for Mp erf13 GOF ( Figure 2A and 2C ). While these results indicate that MpNPR is not the unique protein modulating oil body formation in Marchantia , the similarities between Mp NPR ox and Mp erf13 GOF raise the possibility that MpNPR could be connected to the MpERF13 TF to modulate oil body cell differentiation in Marchantia . Download figure Open in new tab Figure 2. MpNPR interacts with MpERF13 transcription factor. (A) Phenotype of BODIPY-stained 0-d-old gemmae from WT Tak-1, Mp erf13-1 ge , Mp erf13 GOF , Mp npr-4 ge and Mp NPR-4 ox plants under fluorescence microscopy. Oil bodies are indicated by arrows. (B) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1, Mp erf13-1 ge and Mp npr-4 ge mutant plants. Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (C) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1, Mp erf13 GOF and Mp NPR-4 ox plants. Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (D) Yeast two-hybrid (Y2H) interaction assays between MpNPR and MpERF13. BD, binding domain (pGBKT7 vector); AD, activation domain (pGADT7 vector). Growth on plasmid-selective media SD (-2) (minimal media lacking leucine (L) and tryptophan (T)), and interaction-selective media SD (-4) (lacking leucine (L), tryptophan (T), adenine (A) and histidine (H), in the presence or absence of 10 mM of 3-AT) are shown. (D) MpNPR interacts with MpERF13 TF in pull-down (PD) assays. Immunoblots with anti-GFP antibody of MpNPR-citrine recovered after PD experiments using crude protein extracts from Mp NPR-4 ox ( pro Mp EF1α: Mp NPR-citrine ) or Tak-1 plants, and resin-bound recombinant MBP or MBP-fused MpERF13 protein. Input lines show the level of expression of MpNPR protein in transgenic and control plants. CBB staining shows the amount of recombinant MpERF13-MBP or MBP proteins used in the resin (bottom). In angiosperms, NPR proteins directly interact with several different TFs and TF families to regulate their responses 32 – 37 . In addition, further confocal microscopy on our overexpressing MpNPR-citrine lines showed that this protein is nuclear localized in stable Marchantia transgenic plants (Figure S4C), supporting the previous observed nuclear localization of MpNPR when transiently expressed in heterologous systems 16 , 26 . We reasoned that similarities in the content of oil bodies between Mp NPR ox and Mp erf13 GOF plants imply that MpNPR might target MpERF13 directly. To test this, we examined the ability of MpNPR to interact with the MpERF13 in a yeast two-hybrid assay (Y2H). MpNPR interacted with MpERF13 in these experiments ( Figure 2C ). To further confirm the MpNPR-MpERF13 association, we expressed the MpERF13 fused to MBP in E. coli and purified the protein for pull-down (PD) analysis with cell extracts of transgenic plants overexpressing MpNPR-citrine. The MpNPR–MpERF13 interaction was also confirmed by PD assays ( Figure 2D ). Noteworthy, MpNPR was detected as a double band in these PD experiments, which might correspond to monomeric and homodimer forms of MpNPR-citrine (∼ 95 kDa), as described for the Arabidopsis NPR1 ortholog 20 ( Figure 2D ). Thus, our results indicate that MpERF13 TF is a likely target of MpNPR in Marchantia . MpNPR regulates the expression of MpERF13-dependent genes Combined RNAseq-based transcriptomic profiling of Mp erf13-1 ge and Mp erf13 GOF mutant plants have uncovered core genes controlled by MpERF13 in oil body cell differentiation 7 . These include Mp MYB02, Mp SYP12B, MpABCG1, and Mp ERF13 itself, whose expression is also under the tight control of the TF it encodes 7 . We hypothesized that if MpERF13 TF is a bona fide target of MpNPR, plants with altered levels of MpNPR, such as Mp npr mutants and overexpressing MpNPR lines, must show altered patterns of expression for MpERF13-dependent genes. To test this, we performed firstly quantitative RT-PCR analysis for Mp MYB02, Mp SYP12B, MpABCG1, and also Mp ERF13 , on Mp npr and Mp erf13-1 ge mutants grown on non-axenic conditions. Expression of all those genes was almost undetectable in the Mp erf13-1 ge mutant as previously described 7 , while both Mp npr alleles showed significant lower expression compared with Tak-1, indicating that MpERF13-dependent gene expression is partially compromised in plants lacking Mp NPR ( Figure 3A ). We further compared the expression of those genes in Mp NPR ox and Mp erf13 GOF plants. Contrary to previous results, all those genes were highly expressed in plants overexpressing Mp NPR compared to Tak-1, although to a lesser extent than Mp erf13 GOF , which showed remarkably high levels of expression for all genes ( Figure 3B ). Altogether, our results indicate that MpNPR acts as a positive regulator of MpERF13-dependent transcriptional activity, including MpERF13 itself. Download figure Open in new tab Figure 3. MpNPR regulates the expression of MpERF13-dependent genes. (A) qPCR analysis of three selected MpERF13-dependent marker genes (Mp MYB02 , Mp SYPB12B and Mp ABCG1 ) in WT Tak-1, Mp npr-3 ge , Mp npr-4 ge and Mp erf13-1 ge plants grown in vermiculite for five days (basal conditions). Gene expression was normalized against Mp EF1⍺. The measurements represent the relative expression compared to WT Tak-1. Error bars represent SD (n = 3; biological replicates). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (B) qPCR analysis of three selected MpERF13-dependent marker genes (Mp MYB02 , Mp SYPB12B and Mp ABCG1 ) in WT Tak-1, Mp NPR-3 ox , Mp NPR-4 ox and Mp erf13 GOF plants grown in vermiculite for five days (basal conditions). Gene expression was normalized against Mp EF1⍺. The measurements represent the relative expression compared to WT Tak-1. Error bars represent SD (n = 3; biological replicates). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.05). MpNPR controls oil body formation through MpERF13 transcription factor Our previous data suggest that MpNPR functions as an MpERF13 coregulator during oil body cell differentiation in Marchantia . Thus, we next examined whether ectopic expression of MpNPR leads to activation of Mp ERF13, Mp MYB02, Mp SYP12B, and MpABCG1 genes in an MpERF13-dependent manner. To do this, we firstly generated transgenic Marchantia plants overexpressing Mp NPR-citrine under the control of the Mp EF1⍺ promoter in the Mp erf13-1 ge mutant background. Western blotting assays confirmed protein accumulation of MpNPR-citrine, and two independent lines showing similar protein accumulation to the previously generated Mp NPR-3 ox and Mp NPR-4 ox plants were selected (Figure S5). These lines were designated as Mp NPR-5 ox Mp erf13-1 ge and Mp NPR-8 ox Mp erf13-1 ge , respectively. Then, we performed by quantitative RT-PCR analysis for the activation of those genes in Mp erf13-1 ge and Mp NPR-4 ox as controls, and both Mp NPR ox Mp erf13-1 ge alleles grown in non-axenic conditions. As seen before, all those genes were highly expressed in Mp NPR-4 ox , but their expression was significantly lower or not detectable in the Mp erf13-1 ge mutant compared with Tak-1 plants ( Figure 4A ). In all cases, expression levels of those genes on both Mp NPR ox Mp erf13-1 ge alleles were similar to the Mp erf13-1 ge mutant ( Figure 4A ). This indicates that MpNPR induces the activation of oil body-related genes in an MpERF13-dependent manner. Download figure Open in new tab Figure 4. MpNPR controls oil body formation through MpERF13 transcription factor (A) qPCR analysis of selected MpERF13-dependent marker genes (Mp MYB02 , Mp SYPB12B, Mp ABCG1 and Mp ERF13 ) in WT Tak-1, Mp erf13-1 ge , Mp NPR-4 ox , Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge plants grown in vermiculite for five days (basal conditions). Gene expression was normalized against Mp EF1⍺. The measurements represent the relative expression compared to WT Tak-1. Error bars represent SD (n = 3; biological replicates). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.05). (B) Phenotype of 12 days-old WT Tak-1, Mp erf13-1 ge , Mp NPR-4 ox and overexpression of Mp NPR in the Mp erf13-1 ge mutant background (Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge lines). Growth inhibition induced by overexpression of Mp NPR in Tak-1 is not reverted in plants lacking Mp erf13 . (C) Relative growth (% area) of plants from (A) compared to Tak-1. Data shown as mean ± SD (n=14). Different letters represent statistical significances (one-way ANOVA, Tukey’s HSD, p < 0.01). (D) Phenotype of BODIPY-stained 0-d-old gemmae from WT Tak-1 Mp erf13-1 ge , Mp NPR-4 ox and overexpression of Mp NPR in the Mp erf13-1 ge mutant background (Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge lines) under fluorescence microscopy. Oil bodies are indicated by arrows. (E) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1 gemmae from WT Tak-1 Mp erf13-1 ge , Mp NPR-4 ox and overexpression of Mp NPR in the Mp erf13-1 ge mutant background (Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge lines). Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (E) qPCR analysis of selected MpERF13-dependent marker genes (Mp MYB02 , Mp SYPB12B, Mp ABCG1 and Mp ERF13 ) in WT Tak-1, Mp erf13-1 ge , Mp NPR-4 ox , Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge plants grown in vermiculite for five days (basal conditions). Gene expression was normalized against Mp EF1⍺. The measurements represent the relative expression compared to WT Tak-1. Error bars represent SD (n = 3; biological replicates). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.05). Finally, we next examined whether MpNPR-induced oil body formation also requires the MpERF13 TF. Notably, similar to the overexpression of Mp NPR in the Tak-1 background (Mp NPR-4 ox ), both Mp NPR-5 ox Mp erf13-1 ge and Mp NPR-8 ox Mp erf13-1 ge plants also showed a marked inhibition of growth compared to the Mp erf13-1 ge background ( Figure 4B and 4C ). This indicates that ectopic expression of MpNPR in Marchantia leads to thallus growth inhibition in a manner that is independent of MpERF13 ( Figure 4B and 4C ). In contrast, gemmae from both Mp NPR ox Mp erf13-1 ge alleles did not resemble plants overexpressing Mp NPR in the Tak-1 background, as they were completely depleted of oil bodies to a similar extent as Mp erf13-1 ge gemmae ( Figure 4D and 4E ), supporting that this is a specific phenotype related to the function of MpERF13. These results evidence that the ability of MpNPR to induce the formation of oil body cells is fully dependent on the MpERF13 TF in Marchantia , while also demonstrate that NPR mediates a novel regulatory pathway in oil body formation through the MpERF13 TF in Marchantia . MpNPR and MpERF13 control defence against snail herbivory Recent evidence has shown the protective role of oil bodies against arthropod herbivory in Marchantia, as mutant plants defective in oil body cell formation, such as Mp erf13, are more susceptible to the terrestrial isopod Armadillidium vulgare than WT plants 6 , 7 . Noteworthy, early experiments associated the presence of oil bodies by using fresh and alcohol-washed liverworts to the feeding behaviour of snails 18 and recently, Marchantia ’s defence mechanisms were shown to be active against gastropod herbivory 38 . Thus, we decided to evaluate the protective role of oil bodies and the function of MpERF13 and MpNPR towards the attack of snails. To do this, we firstly performed concomitant two-choice experiments using Tak-1 and Mp erf13-1 ge plants on one side, and Tak-1 and Mp npr-4 ge mutants on the other side, challenged with juveniles of the land snail Helix aspersa . Then, we monitored the total thalli area consumed by the snails for 24 h. Compared to Tak-1, thalli of Mp erf13-1 ge were severely consumed while Mp npr-4 e mutants were significantly reduced, although to a lesser extent than Mp erf13-1 ge ( Figure 5A and 5B ). These results correlate with the level of previously observed defects in oil body content on both Mp erf13 and Mp npr mutant gemmae ( Figure 2A and 2B ). We next performed concomitant two-choice experiments comparing Tak-1 with Mp erf13 GOF or Mp NPR-4 ox , as gemmae from those plants showed in our experiments a similar enhanced pattern for oil body distribution and numbers. Thallus areas of Tak-1 plants were significantly reduced compared with Mp erf13 GOF or Mp NPR-4 ox thalli, which in both cases, remained almost intact, and to a similar extent after 24 h of herbivory ( Figure 5C and 5D ). This indicates that ectopic expression of NPR or MpERF13 in Marchantia leads to gastropod resistance. Finally, we evaluated whether enhanced resistance to the attack of land snails observed in Mp NPR ox plants is dependent on MpERF13. To test this, we performed four simultaneously two-choice experiments comparing Tak-1 with Mp NPR-4 ox or Mp erf13-1 ge as controls, or both Mp NPR ox Mp erf13-1 ge generated independent alleles. As shown in Figures 5E and 5F , MpNPR-triggered enhanced resistance against snail herbivory was fully abolished when this gene was introduced into the Mp erf13-1 ge mutant background ( Figure 5E and 5F ). Indeed, Mp NPR ox Mp erf13-1 ge alleles and the Mp erf13-1 ge mutant showed a similar enhanced susceptibility to the attack of snails ( Figure 5E and 5F ). These data demonstrate that the ability of MpNPR to induce resistance to gastropods is fully dependent on MpERF13, while also expands the protective role of oil bodies in liverworts towards the defence against the attack of gastropods. Taken together, our results indicate that MpNPR controls lineage-specific oil body formation and defence against gastropod herbivory through the MpERF13 TF in Marchantia . Download figure Open in new tab Figure 5. MpNPR and MpERF13 control defence against snail herbivory (A) 12-day-old thalli of WT Tak-1, Mp erf13-1 ge and Mp npr-4 ge plants before and after co-cultivation with snails ( Helix aspersa ) for 24 hours. Herbivory experiments were designed as a two-choice experiment, comparing WT Tak-1 with Mp erf13-1 ge or Mp npr-4 ge . Both two-choice experiments were performed at the same time and thus, they are directly comparable. (B) Quantification of snail feeding assay with 12-d-old WT Tak-1, Mp erf13-1 ge and Mp npr-4 ge plants from (A). Plants were co-cultivated for 24 h with snails ( Helix aspersa ) and thallus area change ratio (%) was determined by area quantification after and before the feeding assay. Dot lines separate two-choice experiments performed at the same time. Bars indicate means ± SD (n = 54). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (C) 12-day-old thalli of WT Tak-1, Mp erf13 GOF and Mp NPR-4 OX plants before and after co-cultivation with snails ( Helix aspersa ) for 24 hours. Herbivory experiments were designed as a two-choice experiment, comparing WT Tak-1 with Mp erf13 GOF or Mp NPR-4 OX . Both two-choice experiments were performed at the same time and thus, they are directly comparable. (D) Quantification of snail feeding assay with 12-d-old WT Tak-1, Mp erf13 GOF and Mp NPR-4 OX plants from (C). Plants were co-cultivated for 24 h with snails ( Helix aspersa ) and thallus area change ratio (%) was determined by area quantification after and before the feeding assay. Dot lines separate two-choice experiments performed at the same time. Bars indicate means ± SD (n = 54). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). (E) 12-day-old thalli of WT Tak-1, Mp erf13-1 ge , Mp NPR-4 OX , Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge plants before and after co-cultivation with snails ( Helix aspersa ) for 24 hours. Herbivory experiments were performed comparing WT Tak-1 with Mp erf13-1 ge , Mp NPR-4 OX , Mp NPR-5 OX Mp erf13-1 ge or Mp NPR-8 OX Mp erf13-1 ge plants, as four two-choice experiments performed at the same time and thus, they are comparable. (F) Quantification of snail feeding assay with 12-d-old WT Tak-1, Mp erf13-1 ge , Mp NPR-4 OX , Mp NPR-5 OX Mp erf13-1 ge and Mp NPR-8 OX Mp erf13-1 ge plants from (E). Plants were co-cultivated for 24 h with snails ( Helix aspersa ) and thallus area change ratio (%) was determined by area quantification after and before the feeding assay. Dot lines separate two-choice experiments performed at the same time. Bars indicate means ± SD (n = 54). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). DISCUSSION Since its discovery more than 20 years ago, NPR proteins have been the focus of countless studies in a multitude of vascular plants and agricultural crops 24 . In Arabidopsis , NPR genes play essential roles as hormonal SA sensors and executors of SA-dependent plant defences against pathogens with prominent biotrophic or hemibiotrophic lifestyles such as P. syringae . But surprisingly, the recent characterization of the unique MpNPR has not supported a similar function in Marchantia as in angiosperms 25 . As a paradox, while Mp NPR can complement the At npr1 mutant for all tested responses so far when ectopically expressed in Arabidopsis, mutations in Mp NPR do not result in At npr1 -like phenotypes in Marchantia, indicating that Mp NPR may not be the master regulator of SA-induced responses in this liverwort 25 , 26 . Indeed, hornworts accumulate SA but lack NPR genes 28 – 30 , which opens the intriguing possibility that additional SA sensors might exist in bryophytes, as it also happens in angiosperms 39 . Nevertheless, all these compelling data suggest that NPR-associated pathways might have evolved distinctly in divergent land plant lineages 2 , 25 . Here, we discover that MpNPR controls the formation of oil bodies, a synapomorphy of liverworts that function as active sites for the biosynthesis and storage of diverse bioactive specialized metabolites with cytotoxic activity 8 . We found that genome-edited mutants of Mp NPR show a reduced number of oil bodies, while its overexpression in Marchantia induces a remarkable overaccumulation of these organelles in gemmae. And several lines of evidence support that MpNPR acts through the master MpERF13 TF for controlling the signalling pathway leading to oil body cell differentiation in this liverwort. Firstly, MpNPR interacts with MpERF13. Secondly, Mp npr mutants and transgenic lines overexpressing MpNPR display alterations in the expression pattern of genes that are under the control of the MpERF13 TF. These include Mp SYBP12B , Mp MYB02, and Mp ABCG1 , all of which are responsible for critical and different steps in the formation and functionality of this organelle 7 , 12 , 15 , 17 , 40 . Notably, Mp ERF13 expression is also affected in plants with altered levels of Mp NPR , which goes in line with previous observations indicating that MpERF13 is also under its own transcriptional control, which further supports the close regulation of MpERF13 by MpNPR 7 . And finally, the effect of MpNPR in regulating oil body formation, is fully dependent on MpERF13. Globally, our results demonstrate that NPR mediates a novel regulatory pathway in lineage-specific oil body formation through the MpERF13 TF in Marchantia . Notably, despite the overexpression of Mp NPR in Marchantia leads to the overaccumulation of oil bodies in gemmae similar to that observed for the gain-of-function Mp erf13 GOF , Mp npr mutants do not resemble to Mp erf13 plants, which are completely depleted of oil bodies. Indeed, Mp npr plants only display subtle defects in oil body cell counts, that are evident when plants are grown under non-axenic conditions, but not on axenic conditions. While this likely explains why a previous work failed to detect defects in oil body numbers on their axenically grown Mp npr plants compared to wild-type Marchantia 16 , it also indicates that MpNPR is mostly relevant during stress-induced modulation of oil body development, likely triggered by non-axenic growth. Nonetheless, our results also indicate that MpNPR is not the unique protein modulating oil body formation in Marchantia. Indeed, our results suggest that other pathway/s might contribute redundantly with MpNPR towards oil body differentiation. In this sense, the OPDA signalling pathway in Marchantia , which is analogous to Jasmonic Acid (JA) in tracheophytes, emerges as a plausible candidate. Indeed, this signalling pathway in Marchantia has been widely related to the resistance against herbivory in this liverwort 38 , 41 , 42 . Moreover, mutation in the unique Mp MYCX/Y TF responsible for all OPDA responses is defective in the accumulation of sesquiterpenes such as thujopsene, β-chamigrene, and cuparene, which are present in oil bodies, in response Spodoptera littoralis feeding 41 . Notably, it was recently reported that the Marchantia OPDA receptor MpCOI1 is required for resistance against snail herbivory 38 . All these data open the possibility that OPDA though its receptor MpCOI1 and its co-receptor MpJAZ 42 , 43 , might hint additional TF targets such as MpERF13, MpC1HDZ or MpMYB02 apart from its canonical Mp MYCX/Y TF to modulate other responses such as oil body cell differentiation in Marchantia. However, as mutants in Mp MYCX/Y TF already contain defects on the levels of secondary metabolites accumulating in oil bodies, the most likely possibility is that OPDA might regulate any of the previously described oil-bodies related TFs at the transcriptional level through Mp MYCX/Y , although this remains to be demonstrated. Alternatively, abscisic acid (ABA) signalling has been shown to induce the biosynthesis of bisbibenzyls, also characteristic metabolites found in oil bodies, upon UV-C light stress 44 . Whether any of these pathways are involved in oil body development as a mechanism to provide inbuilt redundancy with MpNPR is still unknown, and will deserve further investigations. Finally, emerging data indicate that the oil body likely represents a predominant liverwort-specific immune innovation, as plants with reduced number of these organelles, such as mutants for the Mp erf13 and Mp c1hdz TFs, has shown to exhibit increased isopod herbivory to the common pill-bug Armadillidium vulgare , but not defects associated to multiple abiotic stress responses in Marchantia 6 , 7 . Moreover, the metabolic content of oil bodies itself, full of diverse biologically active cytotoxic compounds, also supports a major role of this organelle as a defensive organ against pathogen attack 6 , 8 , 10 – 13 . Interestingly, extracts from plants with reduced contents of specific compounds accumulating in oil bodies have reduced antimicrobial activity against bacteria and fungi in vitro 6 , 45 . However, whether the oil body itself is important for defence against these types of microbes still remains to be demonstrated, as it is unclear how metabolic compounds contained in these intracellular organelles can interact with these microorganisms during plant-microbe interactions in nature. Nonetheless, currently there is convincing evidence for the immune role of oil bodies against arthropod herbivory in Marchantia 6 , 7 . Our work now expands the protective role of oil body organelles towards gastropod herbivory, as loss-of-function Mp npr and Mp erf13 mutants with reduced content of oil bodies are more susceptible to land snails, while Marchantia plants over accumulating these organelles through the ectopic expression of MpNPR or a gain-of-function allele of Mp ERF13 are in both cases highly resistant to the attack of this gastropod. Moreover, we found that the ability of MpNPR to protect Marchantia against snail feeding is directly related to the MpERF13 function, as plants overexpressing Mp NPR in the Mp erf13 mutant background are highly susceptible to snail feeding to a similar extent as Mp erf13 ge mutants. On the one side, our results provide now convincing evidence supporting the hypothesis formulated more than a century ago, that oil bodies from liverworts contain deterrent compounds that are effective against land snails 18 . And on the other side, we uncover the existence of an Mp NPR- Mp ERF13 module controlling oil body differentiation and defences against snail herbivory. Our results are appealing as in angiosperms NPRs have profoundly associated to the resistance against biotrophic or hemibiotrophic pathogens such as P. syringae . However, a similar scenario is currently not supported in Marchantia . Indeed, Mp npr mutants were recently found to be more resistant to hemibiotrophic bacteria and hypersensitive to exogenous SA treatments, suggesting that indeed, MpNPR might function as a rather negative regulator for these responses 25 . While the molecular mechanisms for those outcomes still remain to be uncovered, it is possible that they might reflect additional specialised trajectories for the unique MpNPR in Marchantia to defend against pathogens, as it has been previously proposed 2 , 25 . NPR proteins originated in the most recent common ancestor of land plants, during the early stages of terrestrialization 26 . Taking into account that the estimated origin of gastropods in the Cambrian–Ordovician era coincides with that of the first land plants 38 , and that several fossil evidences suggest early herbivory on ancestral liverworts 46 , 47 , it is tempting to speculate that NPRs from liverworts were co-opted towards the control of oil body, as a unique lineage-specific immune strategy, to fend off against the specific selective pressures that early herbivores impose on ancestral liverworts. Moreover, as oil bodies are a synapomorphy of liverworts, our results pinpoint an unique specialised evolutionary trajectory of NPR in liverworts. RESOURCE AVAILABILITY Lead Contact Requests for new resources generated in this study and further information should be directed toward Selena Gimenez-Ibanez ( selena.gimenez{at}cnb.csic.es ). Materials Availability New plasmids and plant materials generated in this study are available upon request. Please note that the distribution of generated transgenic plants will be governed by material transfer agreements (MTAs) and will be dependent on appropriate import permits acquired by the receiver. Data and Code Availability No datasets has been generated during this study. AUTHOR CONTRIBUTIONS S.G-I. designed the research; S.G-I. conceived the project; L.E-C. and S.M. generated materials; L.E-C., S.M. and M.G-Z. performed experiments; L.E-C. and S.G-I analysed the data; R.S. and S.G-I. discussed the data; L.E-C., R.S. and S.G-I. wrote the manuscript; All authors corrected the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. MATERIAL AND METHODS Plant material Marchantia polymorpha accession Takaragaike-1 (Tak-1; male) was used as wild-type (WT). To generate Mp npr mutants in the Tak-1 background, we used CRISPR-Cas9 nickase-mediated mutagenesis targeting Mp NPR (Mp1g02380). Four different gRNAs were designed to target the gene (listed below). These gRNAs were first cloned into the vectors pMPGE_EN04, pBC-GE12, pBC-GE23, and pBC-GE34. Subsequently, they were transferred into the pMpGE018 binary vector, which carries the CRISPRCas9 nickase, using Gateway LR Clonase (Invitrogen). Tak-1 plants were transformed, and thalli were selected by chlorosulfuron resistance employing the regenerating thalli transformation method 48 . To identify mutant plants, genomic DNA of chlorosulfuron-resistant explants was extracted and sequenced using primers flanking the gRNAs target sites. For the generation of Mp NPR-citrine overexpression in Tak-1 or Mp erf13-1 ge backgrounds, the full-length CDS of Mp NPR (Mp1g02380), designed with Gateway attB sites and lacking the stop codon, was synthesized by Integrated DNA Technolgies (IDT, Coralville, Iowa, USA), cloned into the pDONR207 vector (Invitrogen) and then, transferred into the binary vector pMpGWB108 49 , which express Mp NPR fused to citrine under the control of the Mp EF1α promoter ( pro Mp EF1α: Mp NPR-citrine ). Tak-1 or Mp erf13-1 ge plants were transformed and selected by hygromycin resistance as previously described. Mp erf13-1 ge and Mp erf13 GOF were previously described, and kindly obtained by Prof. T. Ueda (NIBB) (Kanazawa et al., 2020). Gene identification Sequences were obtained from the Plant Genomics Resource Phytozome ( https://phytozome-next.jgi.doe.gov ) and Genome Database for Marchantia ( https://marchantia.info ). Growth conditions Marchantia gemmae were grown on half Gamborg’s B5 medium containing 1% agar, under long day conditions (16 h light; 50–60 µmol m−2 s−1) in vitro at 22 °C, for 5 to 10 days for all experiments to synchronize an homogenous initial growth of all gemmae, commonly on whatman filter papers. Then, plants were transferred to non-axenic conditions, on pots or plates containing vermiculite, and grown in controlled environment chambers at an average temperature of 22°C (range 19°C–23°C) with 45%–65% relative humidity under long-day conditions (16 h light), for the specified days described for each experiment. Confocal Microscopy For subcellular localization of MpNPR, gemmalings of Mp NPR ox ( pro Mp EF1α: Mp TGA-citrine/ Tak-1) lines were imaged using the confocal laser scanning microscopes STELLARIS 5 from Leica with a water-immersion objective (HC PL APO CS2 63x/1.29). Excitation and emission were set at 488 and 520 nm, respectively, for Citrine. Chloroplasts fluorescence was detected between 659 and 735 nm. Confocal images were processed using the ImageJ software 50 . Fluorescence microscopy and oil body quantification For oil body quantification, plants were grown on pots with vermiculite under non-axenic conditions, until plants generated gemma cups. Similar gemma cups were selected in all plants, and gemmae was obtained from a pool of about 5-10 gemma cups. For oil body quantification, 0-day-old gemmae were stained by 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene (BODIPY 493/503, Thermo Fisher) as previously described 7 . Gemmae were imaged using ×5 (numerical aperture 0.12) and ×10 (numerical aperture = 0.25) objectives on a Leica DM R fluorescence microscope equipped with an MPS60 camera (Leica). Images were acquired with a GFP3 excitation filter and processed using the ImageJ software 50 . Snail feeding assays For snail feeding assays, two-choice experiments were designed by growing gemmae from Marchantia WT Tak-1 and the selected line to be analysed on the same whatman filter paper on previously described in vitro conditions for 6 to 8 days. Then, filter papers containing plants were transferred to plates with vermiculite under non-axenic conditions for additional 5 to 7 days. Juvenile common land snails ( Helix aspersa ) were kindly obtained from “Cargols de Cal Jep” ( https://www.caljep.com ). Snails were maintained on plastic garden boxes containing vermiculite moistened with water in controlled environment chambers under long-day conditions (16 h light and 22 °C). Snails were fed with sweet potato and kept in a moist environment by water spraying once a week until use, as previously described 38 . Two-choice experiments were conducted by placing 10 juvenile snails ( Helix aspersa ) into each plate. To quantify the area of plant tissue consumed, photos were taken before and 24 h after feeding. Thallus areas were measured using the ImageJ software 50 , and the thallus area change ratio (%) was determined by area quantification after and before the feeding assay. Quantitative RT-PCR For oil body quantification, plants were grown on pots with vermiculite under non-axenic conditions for 5-7 days. RNA was extracted and quantitative RT-PCR was performed as previously described 51 . Data analysis shown was done using three biological replicates. Error bars represent standard deviation (SD). All samples were normalized against the housekeeping gene Mp EF1α (Mp3g23400). Yeast-two hybrid For yeast two-hybrid assays, the full-length CDS of Mp ERF13 (Mp6g08690), designed with Gateway attB sites and lacking the stop codon, was synthesized by Integrated DNA Technolgies (IDT, Coralville, Iowa, USA). The gene was cloned into pDONR207 vector with a Gateway BP Clonase II kit (Invitrogen) and verified by sequencing. Both Mp ERF13 and Mp NPR were then transferred into the pGADT7 (AD-Gal4) and Gal4-based pGBKT7 (BD-Gal4) vectors (Clontech Laboratories Inc.), respectively, using the Gateway system (Invitrogen). The bait and prey plasmids were transformed into S. cerevisiae strain AH109, and transformants were grown on plasmid-selective media (SD/-Trp-Leu). Plates were incubated at 28°C for 4 days and independent colonies for each bait-prey combination were resuspended in sterile water. Five microliters of each suspension were spotted onto two alternative interaction-selective media (SD/-Trp-Leu-Ade-His, and SD/-Trp-Leu-Ade-His + 10mM 3-amino-1,2,4-triazole). Plates were incubated at 28°C and photographed after 4 or 7 days of incubation. Protein extract and western blotting For detection of the MpNPR-citrine, total proteins from Marchantia Tak-1 and Mp NPR OX ( pro Mp EF1a: Mp TGA-citrine/ Tak-1) plants were extracted in extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM DTT, 1 mM PMSF, 10% Glycerol, protease inhibitors cocktail EDTA-free (Roche), 2mM EDTA, and 1 % Triton X-100). Protein extracts were sonicated (5 cycles 15 sec on / 15 sec off at 4°C) and then centrifuged twice at 20,000 g for 10 min at 4°C. Western blots were performed with anti-GFP-horseradish peroxidase-conjugated antibody (Miltenyi Biotec). Pull-down assays For MBP-MpERF13 fusion protein, MpERF13 was transferred from pDONR207 into pKM596 by recombination (Gateway, Invitrogen) 52 . Recombinant protein purification from E. coli was performed as described 53 . Total proteins from 12-days-old Marchantia Tak-1 and Mp NPR OX ( pro Mp EF1a: Mp TGA-citrine/ Tak-1) plants were extracted as described here before, and used for pull-down assays as described 53 . Statistical methods The data generated were statistically analysed using GraphPad Prism software. Two-tailed Student’s t-test was used to identify statistical differences between two means. For comparisons of more than two groups, statistical confidence was established using One-way ANOVA followed by Tukey’s HSD correction for multiple comparisons. List of primers used in this work CRISPR-Cas9: NPR-gRNA1A: CTCGCAAGATCTACTCCTAATCTC NPR-gRNA1B: AAACGAGATTAGGAGTAGATCTTG NPR-gRNA2A: CTCGGATTTCACAATCACAGTGCA NPR-gRNA2B: AAACTGCACTGTGATTGTGAAATC NPR-gRNA3A: CTCGATACTCGTCAGATATTCTCC NPR-gRNA3B: AAACGGAGAATATCTGACGAGTAT NPR-gRNA4A: CTCGATGAAAGTCGCGAAGACTCA NPR-gRNA4B: AAACTGAGTCTTCGCGACTTTCAT Genotyping: MpNPR1_3’intron1_R: CATAGCACTGGGGAAAGGAA MpNPR1_5’intron1_F: TGACATGAGCTGGTTTGAGC Quantitative RT-PCR: Mp1g02380 MpNPR_F: CCTGGAGAATATCTGACGAGTA Mp1g02380 MpNPR_R: GTCTTCCTAAGCTCCTTCACTT Mp6g08690 MpERF13_ F: TCGGAATCTGATCAGGCCTC Mp6g08690 MpERF13_ R: CTGAGGTTTTCTACGAGCGC Mp4g20670 MpSYP12B_F: CTTCATCCAGAGAGCCATAC Mp4g20670 MpSYP12B_R: TTTGGTGTAGGAATCTGCTC Mp3g07510 MpMYB02_F: CCAGAAGATGTTGTTCAACG Mp3g07510 MpMYB02_R: CAGAGAGTTGCTGGGTTATT Mp8g13070 MpABCG1_F: TGAGATTCTTTCCCGCATGG Mp8g13070 MpABCG1_R: GTCAGCGATCCCAATGAGTT Mp3g23400 Mp EF1⍺_ F: CCGAGATCCTGACCAAGG Mp3g23400 Mp EF1⍺_ R: GAGGTGGGTACTCAGCGAAG SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Development of mutants for Mp NPR in Marchantia by CRISPR/Cas9 technology. (A) Mutants generated by CRISPR-Cas9 D10A nickase-mediated mutagenesis. Schematic diagram of the Mp1g02380 WT Tak-1 locus and mutant alleles. Light grey boxes represent exons. Conserved domain of NPR proteins is shown as a green box (BTB/POZ domain) and a pink box (the ankyrin repeat-containing region). Mp npr - 3 ge contains a deletion of 22 bp while Mp npr - 4 ge contains an insertion of 37 bp in the first exon of Mp NPR, that in both cases generate premature stop codons. Deletions are indicated by red dashes and insertions by blue lowercase letters. (B) 12-days-old Tak-1 and Mp npr mutants (Mp npr-3 ge and Mp npr-4 ge ), showing a normal developmental phenotype. Supplemental Figure 2. Oil body formation WT Tak-1 grown under different conditions. Number of oil bodies in 0-d-old gemmae of WT Tak-1 plants grown under in vitro conditions (1/5 GB5 medium) or vermiculite. Bars indicate means ± SD (n = 60). Asterisk indicate statistically significant differences based on a two-tailed Student’s t -test. * , p < 0.001. Supplemental Figure 3. Oil body formation in Mp npr mutants grown on agar plates (1/2 GB5 medium) under in vitro conditions. (A) Phenotype of BODIPY-stained 0-d-old gemmae from WT Tak-1 and Mp npr mutant plants under fluorescence microscopy grown on agar plates (1/2 GB5 medium) under in vitro conditions. Oil bodies are indicated by arrows. (B) Number of oil bodies visualized by BODIPY-staining in 0-d-old gemmae of WT Tak-1 and Mp npr mutant plants grown on agar plates (1/2 GB5 medium) under in vitro conditions. Bars indicate means ± SD (n = 50). Letters indicate statistically significant groups (one-way ANOVA, Tukey’s HSD, p < 0.01). Supplemental Figure 4. Development of Marchantia plants overexpressing Mp NPR - citrine . (A) Immunoblots showing MpNPR accumulation in developed independent lines of pro Mp EF1α: Mp NPR-citrine in Tak-1 or WT Tak-1 control plants. (B) Phenotype of 12- and 25-days-old WT Tak-1 and Mp NPR overexpression plants, which show a delayed growth rate. (C) Subcellular localization of MpNPR in Mp NPR-4 ox ( pro Mp EF1α: Mp NPR-citrine/ Tak-1) plants by confocal microscopy. Scale bar 5 μm. Supplemental Figure 5. MpNPR accumulation in developed independent lines of pro Mp EF1α: Mp NPR-citrine in the Tak-1 and Mp erf13-1 ge backgrounds. Immunoblots showing MpNPR accumulation in developed independent lines of pro Mp EF1α: Mp NPR-citrine in the Tak-1 and Mp erf13-1 ge backgrounds. Independent lines with similar levels of MpNPR accumulation in both Tak-1 and Mp erf13-1 ge backgrounds were selected for further studies. ACKNOWLEDGEMENTS The authors are grateful to the Department of “Advanced Optical Microscopy” at CNB-CSIC for technical assistance in the confocal analyses of MpNPR-citrine. We thank Prof. T. Ueda for the Mp erf13-1 ge and Mp erf13 GOF mutant plants. We thank Jose Antonio Marcelo from Cargols de Cal Jep for providing juvenile common land snails ( Helix aspersa ). S.M. was funded by a PRE2020-093780 grant by MCIN/AEI/10.13039/501100011033. R.S. was funded by a PID2022-140766OB-I00 grant by the MCIN/AEI/10.13039/501100011033 and ‘‘ERDF/EU’’. This work was funded by the PID2022-136746OB-I00 Grant by the MCIN/AEI/10.13039/501100011033 and ‘‘ERDF/EU’’ to S.G.-I. Funder Information Declared MCIN/AEI/10.13039/501100011033 , PRE2020-093780 MCIN/AEI/10.13039/501100011033 and “ERDF/EU” MCIN/AEI/10.13039/501100011033 and “ERDF/EU” Footnotes Lead contact: selena.gimenez{at}cnb.csic.es . REFERENCES 1. ↵ Delaux , P.-M. , and Schornack , S.D . ( 2021 ). Plant evolution driven by interactions with symbiotic and pathogenic microbes . Science 371 , eaba6605 . doi: 10.1126/science.aba6605 . OpenUrl Abstract / FREE Full Text 2. ↵ Castel , B. , El Mahboubi , K. , Jacquet , C. , and Delaux , P.M . ( 2024 ). Immunobiodiversity: Conserved and specific immunity across land plants and beyond . Mol. Plant 17 , 92 – 111 . doi: 10.1016/j.molp.2023.12.005 . OpenUrl CrossRef PubMed 3. ↵ Rensing , S.A . ( 2018 ). Great moments in evolution: the conquest of land by plants . Curr. Opin. Plant Biol . 42 , 49 – 54 . doi: 10.1016/j.pbi.2018.02.006 . OpenUrl CrossRef PubMed 4. Fürst-Jansen , J.M.R. , De Vries , S. , De Vries , J. , and De Vries , J. ( 2020 ). Evo-physio: On stress responses and the earliest land plants . J. Exp. Bot . 71 , 3254 – 3269 . doi: 10.1093/jxb/eraa007 . OpenUrl CrossRef PubMed 5. ↵ Morris , J.L. , Puttick , M.N. , Clark , J.W. , Edwards , D. , Kenrick , P. , Pressel , S. , Wellman , C.H. , Yang , Z. , Schneider , H. , and Donoghue , P.C.J . ( 2018 ). The timescale of early land plant evolution . Proc. Natl. Acad. Sci. U. S. A . 115 , E2274 – E2283 . doi: 10.1073/pnas.1719588115 . OpenUrl Abstract / FREE Full Text 6. ↵ Romani , F. , Banić , E. , Florent , S.N. , Kanazawa , T. , Goodger , J.Q.D. , Mentink , R.A. , Dierschke , T. , Zachgo , S. , Ueda , T. , Bowman , J.L. , et al. ( 2020 ). Oil Body Formation in Marchantia polymorpha Is Controlled by MpC1HDZ and Serves as a Defense against Arthropod Herbivores . Curr. Biol . 30 , 2815 – 2828.e8 . doi: 10.1016/j.cub.2020.05.081 . OpenUrl CrossRef PubMed 7. ↵ Kanazawa , T. , Morinaka , H. , Ebine , K. , Shimada , T.L. , Ishida , S. , Minamino , N. , Yamaguchi , K. , Shigenobu , S. , Kohchi , T. , Nakano , A. , et al. ( 2020 ). The liverwort oil body is formed by redirection of the secretory pathway . Nat. Commun . 11 , 1 – 11 . doi: 10.1038/s41467-020-19978-1 . OpenUrl CrossRef PubMed 8. ↵ Romani , F. , Flores , J.R. , Tolopka , J.I. , Suárez , G. , He , X. , and Moreno , J.E . ( 2022 ). Liverwort oil bodies: diversity, biochemistry, and molecular cell biology of the earliest secretory structure of land plants . J. Exp. Bot . 73 , 4427 – 4439 . doi: 10.1093/jxb/erac134 . OpenUrl CrossRef PubMed 9. ↵ Hassani , D. , Lu , Y. , Ni , B. , Zhu , R.L. , and Zhao , Q . ( 2023 ). The endomembrane system: how does it contribute to plant secondary metabolism? Trends Plant Sci . 28 , 1222 – 1236 . doi: 10.1016/j.tplants.2023.04.013 . OpenUrl CrossRef PubMed 10. ↵ Tanaka , M. , Esaki , T. , Kenmoku , H. , Koeduka , T. , Kiyoyama , Y. , Masujima , T. , Asakawa , Y. , and Matsui , K . ( 2016 ). Direct evidence of specific localization of sesquiterpenes and marchantin A in oil body cells of Marchantia polymorpha L . Phytochemistry 130 , 77 – 84 . doi: 10.1016/j.phytochem.2016.06.008 . OpenUrl CrossRef PubMed 11. Suire , C. , Bouvier , F. , Backhaus , R.A. , Begu , D. , Bonneu , M. , and Camara , B . ( 2000 ). Cellular localization of isoprenoid biosynthetic enzymes in Marchantia polymorpha. Uncovering a new role of oil bodies . Plant Physiol . 124 , 971 – 978 . doi: 10.1104/pp.124.3.971 . OpenUrl Abstract / FREE Full Text 12. ↵ Forestier , E.C.F. , Asprilla , P. , Romani , F. , Bonter , I. , Frangedakis , E. , and Haseloff , J . ( 2025 ). The ABCG1 transporter facilitates sesquiterpene accumulation in Marchantia polymorpha oil bodies . bioRxiv , 2025.02.05.636625 . doi: 10.1101/2025.02.05.636625 . OpenUrl Abstract / FREE Full Text 13. ↵ Chen , F. , Ludwiczuk , A. , Wei , G. , Chen , X. , Crandall-Stotler , B. , and Bowman , J.L . ( 2018 ). Terpenoid Secondary Metabolites in Bryophytes: Chemical Diversity, Biosynthesis and Biological Functions . CRC. Crit. Rev. Plant Sci . 37 , 210 – 231 . doi: 10.1080/07352689.2018.1482397 . OpenUrl CrossRef 14. ↵ He , X. , Sun , Y. , and Zhu , R.L . ( 2013 ). The Oil Bodies of Liverworts: Unique and Important Organelles in Land Plants . CRC. Crit. Rev. Plant Sci . 32 , 293 – 302 . doi: 10.1080/07352689.2013.765765 . OpenUrl CrossRef Web of Science 15. ↵ Kubo , H. , Sunhwa , K. , Teramori , H. , and Takanashi , K . ( 2024 ). MpR2R3-MYB2 is a key regulator of oil body formation in Marchantia polymorpha . Planta 260 , 1 – 8 . doi: 10.1007/s00425-024-04498-9 . OpenUrl CrossRef PubMed 16. ↵ Gutsche , N. , Koczula , J. , Trupp , M. , Holtmannspötter , M. , Appelfeller , M. , Rupp , O. , Busch , A. , and Zachgo , S . ( 2024 ). MpTGA, together with MpNPR, regulates sexual reproduction and independently affects oil body formation in Marchantia polymorpha . New Phytol . 241 , 1559 – 1573 . doi: 10.1111/nph.19472 . OpenUrl CrossRef PubMed 17. ↵ Kubo , H. , Nozawa , S. , Hiwatashi , T. , Kondou , Y. , Nakabayashi , R. , Mori , T. , Saito , K. , Takanashi , K. , Kohchi , T. , and Ishizaki , K . ( 2018 ). Biosynthesis of riccionidins and marchantins is regulated by R2R3-MYB transcription factors in Marchantia polymorpha . J. Plant Res . 131 , 849 – 864 . doi: 10.1007/s10265-018-1044-7 . OpenUrl CrossRef PubMed 18. ↵ Stahl , E . ( 1888 ). Pflanzen und Schnecken: eine biologische Studie über die Schutzmittel der Pflanzen gegen Schneckenfrass . Jenaishe Zeitschrift fur Naturwiss . 22 , 557 – 684 . OpenUrl 19. ↵ Wu , Y. , Zhang , D. , Chu , J.Y. , Boyle , P. , Wang , Y. , Brindle , I.D. , De Luca , V. , Després , C. , Luca , V. De , and Després , C. ( 2012 ). The Arabidopsis NPR1 Protein Is a Receptor for the Plant Defense Hormone Salicylic Acid . Cell Rep . 1 , 639 – 647 . doi: 10.1016/j.celrep.2012.05.008 . OpenUrl CrossRef PubMed 20. ↵ Kumar , S. , Zavaliev , R. , Wu , Q. , Zhou , Y. , Cheng , J. , Dillard , L. , Powers , J. , Withers , J. , Zhao , J. , Guan , Z. , et al. ( 2022 ). Structural basis of NPR1 in activating plant immunity . Nature 605 , 561 – 566 . doi: 10.1038/s41586-022-04699-w . OpenUrl CrossRef PubMed 21. ↵ Ding , Y. , Sun , T. , Ao , K. , Peng , Y. , Zhang , Y. , Li , X. , and Zhang , Y . ( 2018 ). Opposite Roles of Salicylic Acid Receptors NPR1 and NPR3/NPR4 in Transcriptional Regulation of Plant Immunity . Cell 173 , 1454 – 1467.e10 . doi: 10.1016/j.cell.2018.03.044 . OpenUrl CrossRef PubMed 22. Wang , W. , Withers , J. , Li , H. , Zwack , P.J. , Rusnac , D.V. , Shi , H. , Liu , L. , Yan , S. , Hinds , T.R. , Guttman , M. , et al. ( 2020 ). Structural basis of salicylic acid perception by Arabidopsis NPR proteins . Nature 586 , 311 – 316 . doi: 10.1038/s41586-020-2596-y . OpenUrl CrossRef 23. ↵ Fu , Z.Q. , Yan , S. , Saleh , A. , Wang , W. , Ruble , J. , Oka , N. , Mohan , R. , Spoel , S.H. , Tada , Y. , Zheng , N. , et al. ( 2012 ). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants . Nature 486 , 228 – 232 . doi: 10.1038/nature11162 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Backer , R. , Naidoo , S. , and van den Berg , N. ( 2019 ). The NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) and related family: Mechanistic insights in plant disease resistance . Front. Plant Sci . 10 , 1 – 21 . doi: 10.3389/fpls.2019.00102 . OpenUrl CrossRef PubMed 25. ↵ Jeon , H.W. , Iwakawa , H. , Naramoto , S. , Herrfurth , C. , Gutsche , N. , Schlüter , T. , Kyozuka , J. , Miyauchi , S. , Feussner , I. , Zachgo , S. , et al. ( 2024 ). Contrasting and conserved roles of NPR pathways in diverged land plant lineages . New Phytol . 243 , 2295 – 2310 . doi: 10.1111/nph.19981 . OpenUrl CrossRef PubMed 26. ↵ Jia , X. , Wang , L. , Zhao , H. , Zhang , Y. , Chen , Z. , Xu , L. , and Yi , K . ( 2023 ). The origin and evolution of salicylic acid signaling and biosynthesis in plants . Mol. Plant 16 , 245 – 259 . doi: 10.1016/j.molp.2022.12.002 . OpenUrl CrossRef PubMed 27. ↵ Peng , Y. , Sun , T. , and Zhang , Y . ( 2017 ). Perception of salicylic acid in physcomitrella patens . Front. Plant Sci . 8 , 1 – 5 . doi: 10.3389/fpls.2017.02145 . OpenUrl CrossRef PubMed 28. ↵ Li , F.W. , Nishiyama , T. , Waller , M. , Frangedakis , E. , Keller , J. , Li , Z. , Fernandez-Pozo , N. , Barker , M.S. , Bennett , T. , Blázquez , M.A. , et al. ( 2020 ). Anthoceros genomes illuminate the origin of land plants and the unique biology of hornworts . Nat. Plants 6 , 259 – 272 . doi: 10.1038/s41477-020-0618-2 . OpenUrl CrossRef PubMed 29. Zhang , J. , Fu , X.X. , Li , R.Q. , Zhao , X. , Liu , Y. , Li , M.H. , Zwaenepoel , A. , Ma , H. , Goffinet , B. , Guan , Y.L. , et al. ( 2020 ). The hornwort genome and early land plant evolution . Nat. Plants 6 , 107 – 118 . doi: 10.1038/s41477-019-0588-4 . OpenUrl CrossRef PubMed 30. ↵ Rieseberg , T.P. , Dadras , A. , Fürst-Jansen , J.M.R. , Dhabalia Ashok , A. , Darienko , T. , de Vries , S. , Irisarri , I. , and de Vries , J. ( 2023 ). Crossroads in the evolution of plant specialized metabolism . Semin. Cell Dev. Biol . 134 , 37 – 58 . doi: 10.1016/j.semcdb.2022.03.004 . OpenUrl CrossRef 31. ↵ Sugano , S.S. , Shirakawa , M. , Takagi , J. , Matsuda , Y. , Shimada , T. , Hara-Nishimura , I. , and Kohchi , T . ( 2014 ). CRISPR/Cas9-mediated targeted mutagenesis in the liverwort Marchantia polymorpha L . Plant Cell Physiol . 55 , 475 – 481 . doi: 10.1093/pcp/pcu014 . OpenUrl CrossRef PubMed Web of Science 32. ↵ Zhang , Y. , Fan , W. , Kinkema , M. , Li , X. , and Dong , X . ( 1999 ). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene . Proc. Natl. Acad. Sci. U. S. A . 96 , 6523 – 6528 . doi: 10.1073/pnas.96.11.6523 . OpenUrl Abstract / FREE Full Text 33. Saleh , A. , Withers , J. , Mohan , R. , Marqués , J. , Gu , Y. , Yan , S. , Zavaliev , R. , Nomoto , M. , Tada , Y. , and Dong , X . ( 2015 ). Posttranslational modifications of the master transcriptional regulator NPR1 enable dynamic but tight control of plant immune responses . Cell Host Microbe 18 , 169 – 182 . doi: 10.1016/j.chom.2015.07.005 . OpenUrl CrossRef PubMed 34. Li , M. , Chen , H. , Chen , J. , Chang , M. , Palmer , I.A. , Gassmann , W. , Liu , F. , and Fu , Z.Q . ( 2018 ). Tcp transcription factors interact with npr1 and contribute redundantly to systemic acquired resistance . Front. Plant Sci . 9 , 1 – 12 . doi: 10.3389/fpls.2018.01153 . OpenUrl CrossRef PubMed 35. Olate , E. , Jiménez-Gómez , J.M. , Holuigue , L. , and Salinas , J . ( 2018 ). NPR1 mediates a novel regulatory pathway in cold acclimation by interacting with HSFA1 factors . Nat. Plants 4 , 811 – 823 . doi: 10.1038/s41477-018-0254-2 . OpenUrl CrossRef PubMed 36. Huang , P. , Dong , Z. , Guo , P. , Zhang , X. , Qiu , Y. , Li , B. , Wang , Y. , and Guo , H . ( 2020 ). Salicylic acid suppresses apical hook formation via NPR1-mediated repression of EIN3 and EIL1 in Arabidopsis . Plant Cell 32 , 612 – 629 . doi: 10.1105/tpc.19.00658 . OpenUrl Abstract / FREE Full Text 37. ↵ Nomoto , M. , Skelly , M.J. , Itaya , T. , Mori , T. , Suzuki , T. , Matsushita , T. , Tokizawa , M. , Kuwata , K. , Mori , H. , Yamamoto , Y.Y. , et al. ( 2021 ). Suppression of MYC transcription activators by the immune cofactor NPR1 fine-tunes plant immune responses . Cell Rep . 37 , 110125 . doi: 10.1016/j.celrep.2021.110125 . OpenUrl CrossRef PubMed 38. ↵ Schweizer , F. , Monte , I. , Solano , R. , and Reymond , P . ( 2025 ). Marchantia polymorpha Defense Against Snail Herbivory . Plant-Environment Interact . 6 , 1 – 5 . doi: 10.1002/pei3.70052 . OpenUrl CrossRef 39. ↵ Pokotylo , I. , Kravets , V. , and Ruelland , E . ( 2019 ). Salicylic acid binding proteins (SABPs): The hidden forefront of salicylic acid signalling at MDPI AG , doi: 10.3390/ijms20184377 https://doi.org/10.3390/ijms20184377. OpenUrl CrossRef 40. ↵ Romani , F. , Sauret-Güeto , S. , Rebmann , M. , Annese , D. , Bonter , I. , Tomaselli , M. , Dierschke , T. , Delmans , M. , Frangedakis , E. , Silvestri , L. , et al. ( 2024 ). The landscape of transcription factor promoter activity during vegetative development in Marchantia . Plant Cell 36 , 2140 – 2159 . doi: 10.1093/plcell/koae053 . OpenUrl CrossRef PubMed 41. ↵ Peñuelas , M. , Monte , I. , Schweizer , F. , Vallat , A. , Reymond , P. , García-Casado , G. , Franco-Zorrilla , J.M. , and Solano , R . ( 2019 ). Jasmonate-related MYC transcription factors are functionally conserved in marchantia polymorpha . Plant Cell 31 , 2491 – 2509 . doi: 10.1105/tpc.18.00974 . OpenUrl Abstract / FREE Full Text 42. ↵ Monte , I. , Ishida , S. , Zamarreño , A.M. , Hamberg , M. , Franco-Zorrilla , J.M. , García-Casado , G. , Gouhier-Darimont , C. , Reymond , P. , Takahashi , K. , García-Mina , J.M. , et al. ( 2018 ). Ligand-receptor co-evolution shaped the jasmonate pathway in land plants . Nat. Chem. Biol . doi: 10.1038/s41589-018-0033-4 . OpenUrl CrossRef PubMed 43. ↵ Monte , I. , Franco-Zorrilla , J.M. , García-Casado , G. , Zamarreño , A.M. , García-Mina , J.M. , Nishihama , R. , Kohchi , T. , and Solano , R . ( 2019 ). A Single JAZ Repressor Controls the Jasmonate Pathway in Marchantia polymorpha . Mol. Plant 12 , 185 – 198 . doi: 10.1016/j.molp.2018.12.017 . OpenUrl CrossRef PubMed 44. ↵ Kageyama , A. , Ishizaki , K. , Kohchi , T. , Matsuura , H. , and Takahashi , K . ( 2015 ). Abscisic acid induces biosynthesis of bisbibenzyls and tolerance to UV-C in the liverwort Marchantia polymorpha . Phytochemistry 117 , 547 – 553 . doi: 10.1016/j.phytochem.2015.05.009 . OpenUrl CrossRef PubMed 45. ↵ Wu , Y.F. , Zhao , Y. , Liu , X.Y. , Gao , S. , Cheng , A.X. , and Lou , H.X . ( 2018 ). A bHLH transcription factor regulates bisbibenzyl biosynthesis in the liverwort plagiochasma appendiculatum . Plant Cell Physiol . 59 , 1187 – 1199 . doi: 10.1093/pcp/pcy053 . OpenUrl CrossRef PubMed 46. ↵ Labandeira , C.C. , Tremblay , S.L. , Bartowski , K.E. , and Vanaller Hernick , L . ( 2014 ). Middle Devonian liverwort herbivory and antiherbivore defence . New Phytol . 202 , 247 – 258 . doi: 10.1111/nph.12643 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Labandeira , C . ( 2007 ). The origin of herbivory on land: Initial patterns of plant tissue consumption by arthropods . Insect Sci . 14 , 259 – 275 . doi: 10.1111/j.1744-7917.2007.00141.x-i1 . OpenUrl CrossRef Web of Science 48. ↵ Kubota , A. , Ishizaki , K. , Hosaka , M. , and Kohchi , T . ( 2013 ). Efficient Agrobacterium-mediated transformation of the liverwort Marchantia polymorpha using regenerating thalli . Biosci. Biotechnol. Biochem . 77 , 167 – 172 . doi: 10.1271/bbb.120700 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Ishizaki , K. , Nishihama , R. , Ueda , M. , Inoue , K. , Ishida , S. , Nishimura , Y. , Shikanai , T. , and Kohchi , T . ( 2015 ). Development of gateway binary vector series with four different selection markers for the liverwort marchantia polymorpha . PLoS One 10 . doi: 10.1371/journal.pone.0138876 . OpenUrl CrossRef PubMed 50. ↵ Schneider , C.A. , Rasband , W.S. , and Eliceiri , K.W . ( 2012 ). NIH Image to ImageJ: 25 years of image analysis . Nat. Methods 9 , 671 – 675 . doi: 10.1038/nmeth.2089 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Gimenez-Ibanez , S. , Zamarreño , A.M. , García-Mina , J.M. , and Solano , R . ( 2019 ). An Evolutionarily Ancient Immune System Governs the Interactions between Pseudomonas syringae and an Early-Diverging Land Plant Lineage . Curr. Biol . 29 , 2270 – 2281.e4 . doi: 10.1016/j.cub.2019.05.079 . OpenUrl CrossRef PubMed 52. ↵ D. Fox, J., M. Routzahn, K., H. Butcher, M., and S. Waugh, D . ( 2003 ). Maltodextrin-binding proteins from diverse bacteria and archaea are potent solubility enhancers . FEBS Lett . 537 , 53 – 57 . doi: 10.1016/S0014-5793 . OpenUrl CrossRef PubMed Web of Science 53. ↵ Fonseca , S. , and Solano , R . ( 2013 ). Pull-Down Analysis of Interactions Among Jasmonic Acid Core Signaling Proteins . Methods Mol. Biol . 1011 , 159 – 171 . doi: 10.1007/978-1-62703-414-2 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted November 17, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following MpNPR modulates lineage-specific oil body development and defence against gastropod herbivory in Marchantia polymorpha Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share MpNPR modulates lineage-specific oil body development and defence against gastropod herbivory in Marchantia polymorpha Loreto Espinosa-Cores , Santiago Michavila , Marina Gonzalez-Zuloaga , Roberto Solano , Selena Gimenez-Ibanez bioRxiv 2025.11.17.688000; doi: https://doi.org/10.1101/2025.11.17.688000 Share This Article: Copy Citation Tools MpNPR modulates lineage-specific oil body development and defence against gastropod herbivory in Marchantia polymorpha Loreto Espinosa-Cores , Santiago Michavila , Marina Gonzalez-Zuloaga , Roberto Solano , Selena Gimenez-Ibanez bioRxiv 2025.11.17.688000; doi: https://doi.org/10.1101/2025.11.17.688000 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Plant Biology Subject Areas All Articles Animal Behavior and Cognition (7633) Biochemistry (17681) Bioengineering (13890) Bioinformatics (41930) Biophysics (21446) Cancer Biology (18586) Cell Biology (25493) Clinical Trials (138) Developmental Biology (13374) Ecology (19897) Epidemiology (2067) Evolutionary Biology (24308) Genetics (15607) Genomics (22498) Immunology (17736) Microbiology (40385) Molecular Biology (17175) Neuroscience (88584) Paleontology (666) Pathology (2831) Pharmacology and Toxicology (4823) Physiology (7641) Plant Biology (15149) Scientific Communication and Education (2045) Synthetic Biology (4293) Systems Biology (9823) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.