Soluble guanylyl cyclase, the NO-receptor, regulates endothelium-dependent vascular relaxation via its transnitrosation activity

We previously demonstrated that the NO‐receptor soluble guanylyl cyclase (GC1) has the ability to  transnitrosate other proteins in a reaction that involves, in some cases, oxidized Thioredoxin 1 (oTrx1).  This transnitrosation cascade was established in vitro and we identified by mass spectrometry and  mutational analysis Cys 610 (C610) of GC1 α‐subuni t as a major donor of S‐nitrosothiols (SNO). To assay  the relevance of GC1 transnitrosation under physiological conditions and in oxidative pathologies, we  studied a knock‐in mouse in which C610 was replaced with a serine (KI αC610S) under basal or angiotensin  II (Ang II)–treated conditions. Despite similar GC1 expression and NO‐stimulated cGMP‐forming activity,  the Ang II‐treated KI mice displayed exacerbated oxidative pathologies including higher mean arterial  pressure and more severe cardiac dysfunctions compared to the Ang II‐treated WT. These phenotypes  were associated with a dra stic  decrease in global S‐nitrosation and in levels of SNO‐Trx1 and SNO‐RhoA  in the KI mice. To investigate the mechanism underlying the dysregulation of blood pressure despite an  intact NO‐cGMP axis, pressure myography and in vivo intravital microscopy were conducted to analyze  the vascular resistance tone.  Both appr oaches indicated that, even in the absence of oxidative stress,  the single mutation C610S led to a significant deficiency in acetylcholine‐induced vasorelaxation while  smooth muscle relaxation in response to NO remained unchanged.  These findings indicate that the  C610S mutation uncoupled the two NO signaling pathways involved in the e ndothelium  and smooth  muscle vasorelaxation and suggest that GC1‐dependent S‐nitrosation is a key player in endothelium‐ derived hyperpolarization.    (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint

Cardiovascular health is highly dependent on nitric oxide (NO) signaling and is extensively compromised  by oxidative stress. Soluble guanylyl cyclase (GC1) is a heme‐containing heterodimer, which catalyzes  the production of cGMP upon stimulation of NO binding to the heme. The NO‐GC1‐cGMP pathway is  critical to smooth muscle relaxation of blood vessels, as well as pro tecting the heart from myocardial  infarction, fibrosis and negatively modulating cardiac contractility(1‐3). In fact, GC1 is currently one of  the most sought‐after targets to treat cardiovascular diseases(4).  NO also signals in the cardiovascular  system by a non‐canonical pathway, S‐nitrosation (also called S‐ni trosylation),  which is the addition of a  NO moiety to a cysteine (Cys)(5). As other post‐translational modifications (PTMs), S‐nitrosation changes  protein function, localization or interaction.     We recently discovered that GC1 mediates as well the NO non‐canonical pathway. We showed in cardiac  and smooth muscle cell lines tha t  GC1 has the ability to drive S‐nitrosation of over 200 proteins via a  transnitrosation activity, i.e., the transfer of S‐nitrosothiol groups (SNO) through specific protein‐protein  interactions (6).  GC1 transnitrosation activity is favored under oxidative stress, a condition that could  lead to disruption of the NO‐GC1‐cG MP  by oxidation of the heme and thiols of GC1, reduction of NO  availability and increased S‐nitrosation levels in cells(6‐8). Interestingly, Thioredoxin 1 (Trx1) a major  regulator of cellular thiol redox is one of the GC1 transnitrosation targets. The transnitrosation reaction  was unidirectional from GC1 to Trx1 and took place with oxidized Trx1 (o Trx1), which acquires a  transnitrosation activity when oxidized(9) (10, 11). We showed that SNO‐GC1 “uses” oTrx1 as a SNO  relay to amplify the number of SNO‐targets.  In fact, using Angiotensin II (AngII) as an  oxidative/nitrosative inducer in cardiac cells, we discovered that SNO‐GC1/oTrx1 compl ex  S‐nitrosates  the small GTPase RhoA, in turn inhibiting its activity (6). Using Mass spectrometry, we identified Cys 610  (C610) of the α subunit of GC1 as the main SNO donor and Cys73 (C73) of Trx1 as the main SNO  recipient/acceptor. We confirmed the crucial role of αC610 in GC1 transnitrosation activity by  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint mutational analysis in smooth muscle cells. Of importance, the NO‐stimulated cGMP‐forming activity  per se was not affected in the mutant. (12)  To determine the (patho)physiological significance of GC1 transnitrosation activity in the cardiovascular  system, we created a knock‐in mouse for which αC610 was replaced by a serine (KI αC610S).  We used  chronic infusion of AngII, which is a well‐described model to increase blood pressure and to induce  cardiac hypertrophy and electrical dysfunction. We previously showed that oxidative stress generated  by Ang II infusion induces S‐nitrosation in rodent tissues, and affects vascular reactivity and cardiac  function (13, 14).  Toge ther  with the idea that S‐nitrosation could be cardioprotective (15, 16) and that it  modulates several signaling pathways involved in vascular reactivity, including calcium signaling (17, 18),  we sought to determine whether disruption of the transnitrosation cascade in the knock‐in (KI) mice  harboring the αC610S mutation would display cardiovascular pathologies.   Herein, we dem onstrate that the KIC610S mice lacking GC1 transnitrosation activity and treated with  Ang II display a higher increase in mean arterial pressure (MAP), compared to WT mice treated with Ang  II. The KI mice also suffered from more severe cardiac hypertrophy, fibrosis, higher oxidation and  electrical dysfunction in response to Ang II treatment, compared to WT.  Sur prisingly, the NO‐stimulated  GC1 activity did not decrease in the KI mice compared to the WT (± AngII). Further pressure myography  and intravital microscopy studies in small resistance mesenteric arteries (MA) indicated that the KI mice  has a significant decreased vasorelaxation in response to Acetyl choline (ACh) but vasorelaxation to NO  remains essentially unchanged, even in the absence of oxidative stress. Overall these results suggest  that GC1 transnitrosation activity modulates endothelium‐dependent relaxation in small resistance  vessels, hence regulates blood pressure.

Generation of knock‐in C610S mice.  C610S knock‐in mice were generated by the Genome Editing Shared Resource at Rutgers using  CRISPR/Cas9 technology. The gRNA sequence to replace cysteine 610 with a serine was  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint CTGCAGTGTGCCTCGGAAAATC →TAGCAGTGTGCCTCGGAAAATC and also included the restricƟon site  BfaI (5’‐C˅TAG‐3’) to facilitate screening of the Cys to Ser replacement, in addition to sequencing.  10  knock‐in founders heterozygotes for C610S were successfully generated, 5 were bred (3 males, 2  females) with wild‐type (WT) C57Bl/6J mice to expand the line. WT C57Bl/6 were pur chased from  Jackson laboratories and Charles River. The heterozygous C610S/+ first generation were backcrossed  with WT C57Bl/6 and maintained on the C57Bl/6 genetic background. The homozygous WT and αGC1  C610S/C610S were generated by C610S/+ heterozygous breeding and whenever possible, littermates  were used in the various e xperiments.  4 to 8‐month‐old male and female mice were used in the study.  Mice were maintained in the animal facility at 22–24°C with 12‐h light/dark cycles and 60%–70% of  humidity. The animals were fed ad libitum under a normal chow diet and sterilized water.All animal  experiments were c onducted  in accordance with policies of the NIH Guide for the Care and Use of  Laboratory Animals and approved by the Institutional Animal Care and Use Committee (IACUC), Rutgers,  Newark, NJ.     HD‐X11 telemetry device implantation and Angiotensin II (Ang II) infusion   Blood pressure (BP) and electrocardiogram (ECG) recordings were made  in awake, freely moving mice  using an implanted radio telemetry device (PhysioTel HD‐X11 transmitter, Data Sciences International).  Briefly, mice were anesthetized with 4‐5% isoflurane inhalation, followed by single dose of local anesthetic  Bupivacaine (2‐2.5 mg/kg, SC). During surgery, anesthesia was maintained with 1‐3% isoflurane during.  The pressure catheter was inserted through the left carotid artery into the aortic arc, while the two leads  were fixed subcutaneously in standard positions (positive lead was placed in left rib region and negative  lead  was  placed  to  the  right  pectoral  muscle).The  transmitter  body  was  secured  into  a  subcutaneous  pocket in the left flank. Buprenorphine (0.05 mg/kg, SC) was administered as an analgesic immediately  after  telemetry  device implantation  surgery  and  thereafter  mice  were  allowed  to  recover  in  cages  on  heating Pad.   (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint Angiotensin II (Ang II) infusion At 5 to 7 days following telemetry device implantation, recordings were  conducted as internal, untreated controls. At day 7, mice were treated with saline or AngII (0.8 mg/kg per  day) for 14 days via a miniosmotic pump (ALZET®, cat # 0000296) implanted subcutaneously, as indicated  in the scheme below.    Telemetry recordings. Mice were divided into 4 groups (WT ± Ang II and KI ± Ang II) and the data were  recorded using a LabChart analysis software with a PhysioTel/HD Hardware MX2 configuration. Various  pressures (systolic, diastolic and mean), heart rate (HR) and multiple ECG parameters, among them RR  interval, PR interval, QT interval, QTc interval, QRS and P wave duration and amplitude were recorded and  analyzed. The measurements were conducted in unrestrained mice, daily for 1 hour in the morning for 21  days. At the end of the experiment (day 28), mice were anesthetized and various organs including heart,  lungs and mesenteric artery were removed, washed in PBS, and processed for biochemical or histological  protocols.     Heart rate variability (HRV) analysis. HRV was performed on ECG tracings by using Labchart software.  Arrhythmias,  ectopic  beats  and  artifacts  were  discarded  from  ECG  tracing  before  HRV  analysis  by  excluding R–R values not contained between mean R–R interval ± 2 S.D. (95.5% confidence intervals)(19).    Pressure Myography.  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint Mice were sacrificed under anesthesia and the mesenteric tissue was rapidly harvested and placed in a  cold HEPES‐PSS buffer containing (mmol/L): NaCl 118, KCl 4.7, CaCl2 1.6, KH2PO4 1.2, MgSO4 1.2, NaHCO3  25, glucose 5.5, HEPES 10. The final pH was adjusted to 7.4. For each experiment, a second or third order  of  mesenteric  arteries  (without  any  branches)  was  isolated  and  cannulated  in  a  pressure  myography  chamber (Danish MyoTechnology A/S, model: 114P) using 60‐80 or 100‐120 µM cannulas. Each vessel was  perfused in o xygenated prewarmed HEPES‐PSS buffer (37°C, same composition that was used for vessel  dissection).  The  pressure  was  increased  gradually  from  20  to  60  mmHg  (with  intervals  of  10  mmHg).  Bending  of  the  vessel  (due  to  pressure)  was  adjusted  using  the  micro‐positioners  of  the  myography  chamber; the vessel was equilibrated fo r 30 min at 37°C with a pressure of 60 mmHg (20). To evaluate the  viability  of  vessel,  60  mM  KCL  solution  was  added  to  the  chamber  and  vessels  with  less  than  50%  constriction  were  excluded  from  analysis.  After  KCl  treatment,  the  chamber  was  washed  3  times  with  prewarmed  HEPES  buffer .  The  perfused  vessel  was  live‐tracked  at  10  X  magnification  using  a  Zeiss  AxioVert.A1 inverted microscope. Data including changes in outer and inner diameters were acquired and  analyzed using the Myoview v. 5.1 software.      The vessels were pre‐constricted with phenylephrine (PE at 10−5 M). Changes in vessel outer and inner  diameters were then assessed in response to a cumulative dose of acetylcholine  (ACh; 10−8‐10−4 M) or  Diethylamine  NONOate  diethylammonium  (DEA/NO;  10−8‐10−4 M).  Percentage  dilation  was  measured  using the formula % dilation=  ሾሺ஽௫ି஽௜ሻሿ ሺ஽௘ି஽௜ሻ∗ 100, where D is the measured lumen diameter and x, i, and e  indicate  the  measured  arterial  diameter  at  each  dose  of  agonist  (x),  initial  diameter  following  PE  constriction (i), and diameter at 60 mmHg pressure after equilibrium (e) (20). n=3‐7 mice per condition  and 1‐2 vessels were analyzed for each mouse.     Vascular vasomotion response in vivo using intravital microscopy    To assess in vivo relaxation, we employed an intravital microscopy protocol as previously described (13,  21).  Male  and  female  mice,  aged  4‐6  months,  were  anesthetized  with  isoflurane  (1.5‐2%)  for  the  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint procedure. The mesenteric bed was isolated for vessel visualization and continuously superfused with a  saline solution at 37°C at a rate of 1 mL per minute. For vessel visualization and diameter detection, we  inject  Dextran  70‐KDa‐FITC  conjugate  retro‐orbitally,  as  shown  in  Supplemental  Figure  1.  Vasodilators  agents  (10  µM  ACh,  10  µM  DEANO  donor)  were  topically  administered  two  minutes  after  10  µM  PE  administration,  during  which  time  the  peak  and  relative  maintenance  of  arteriolar  contraction  were  detected. The peak relaxation response was measured two minutes after administering ACh/NO, using  the same formula as  described in  the  pressure myography section. Diameter changes were quantified  with  Metamorph  software  (Molecular  Device,  USA).  Relaxation  was  monitored  using  a  time‐lapse  sequence, capturing images at one‐second intervals. For each experimental condition, 2 to 3 vessels per  animal were analyzed.     Measurement of reactive oxygen species   We measured reactive oxygen species (ROS) levels in mice myocardial tissue with dihydroethidium (DHE),  a redox‐sensitive fluorescent probe (Cayman chemical company, cat # 104821‐25‐2). Briefly, frozen heart  sections embedded with OCT (Tissue‐Tek®, cat# 4583) were cut into 8‐μm section, washed three times  with PBS and incubated with DHE (2.5 µM) for 30 min at 37 °C in a dark humidified box. Following three  washes with PBS, sections were incubated for 30 min at 37 °C with wheat germ agglutinin (WGA5µg/ml)  to stain cardiomyocytes’ plasma membrane. Following three additional washes with PBS, sections were  mounted in a medium‐containing DAPI for nuclei staining (Sigma Aldrich, DUO82040). After drying in the  dark, fluorescence images were captured using 200 Axiovert Zeiss fluorescence microscope, 20X objective  and quantified with Image J software. To calculate DHE fluorescence in ImageJ, DAPI‐stained nuclei were  identified and corresponding fluorescence intensities of DAPI and DHE were measured. The fluorescence  intensity of DHE was normalized to DAPI, and data are presented as the ratio of DHE/DAPI.       (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint Measurement of cardiac fibrosis.   Heart tissues were fixed with 10% buffered formalin (Fisher chemical SF93‐4), embedded in paraffin,  and sectioned at 5μm thickness. Interstitial and perivascular fibrosis was evaluated by picric acid Sirius  red staining. The sections were incubated with a 0.1% Sirius Red solution dissolved in aqueous saturated  picric acid for 1 h, washed in acidified wat er (0.5% glacial acetic acid), dehydrated, and mounted with  SignalStain medium (Cell Signaling, 14177S). Collagen is stained red, while non‐collagen tissues are  stained yellow. The positively stained (red) fibrotic area was measured and expressed as a percentage of  total area. For each section, 6‐10 fields at 10X magni fication were used for the analysis by ImageJ. n=5‐ 10 mice per condition.    Soluble guanylyl cyclase activity measurements.    Fresh or snap‐frozen lung tissues (20‐30 mg) were homogenized in a lysis buffer containing 50mM Tris‐ HCL pH 8.0, 150 mM NaCL, 1 mM EDTA and protease inhi bitor cocktail + PMSF (Sigma, # P7626), using a  Turax (VDI 12, VWR) on ice for 10‐20 seconds. Homogenates were first spun at 4⁰C at 500g for 1 min to  remove the biggest debris. The supernatant was then centrifuged at 14 000 g for 10 min at 4⁰ C. The  cytosolic fraction (superna tant) was used for Western blot and GC1 activity after measurement of  protein concentrations using Bradford reagent. NO‐stimulated GC1 activity was measured for 5 min. at  30⁰ C in a 50mM HEPES pH 8.0 buffer containing 1mM GTP, 5 mM MgCl2, GTP32 and stimulated with 100  μM DEA‐NO, as previously described (22). Each measurement was done in duplicate, n=4 mice for each  group (WT, WT+ AngII, KI C610S, KI C610S + AngII). Data are expressed in nmol cGMP.min‐1.mg‐1.    Biotin switch assays of mouse tissues.   Lung or heart tissues (20‐30 mg) were homogenized in lysis buffer containing 50 mM Tris‐HCL pH 7.5,  150 mM NaCl, 1 mM EDTA, 0.1 mM neocuproine, 0.2 mM PSMF and 40 mM N‐ethylmaleimide (NEM). 2  mg of the homogenates were diluted to 0.5mg/ ml  in blocking buffer containing 1% Triton X‐100 and 2%  SDS in 50 mM Tris‐HCL, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.1 mM neocuproine, 0.2 mM PSMF and 40  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint mM N‐ethylmaleimide (NEM). Samples were incubated at 50°C for 30 min in the dark. Excess NEM was  removed using cold acetone precipitation. The protein pellets were generated by centrifugation at 4000  rpm for 20 min at 4°C and washed once with cold acetone. The pellets were resuspended in 300 μl of a  buffer contai ning 25 mM HEPES, pH 7.7, 1 mM EDTA, and 1% SDS, supplemented with 0.1 mM biotin‐ HPDP, 10 mM ascorbate and 1μM CuCl, at room temperature for 1 h in the dark. Negative controls were  the blocked samples without ascorbate. Excess biotin‐HPDP was removed and bi otinylated  proteins  were precipitated using cold acetone at ‐20°C for 1 h followed by centrifugation at 5000 g for 10 min at  4°C. The pellets were dissolved in HENS buffer. For detection of biotinylated proteins, resuspended  samples were mixed with 4X Laemmli buffer without β‐Mercaptoethanol.   For avidin enrichment, the biotinylated samples wer e diluted in 700 μl PBS and mixed with 100 μl  streptavidin‐agarose beads. The mixture was incubated for 1 h at room temperature with regular  agitation. The beads were pelleted by centrifuging at 5000 g for 10 min and washed 3 times with 1 ml of  PBS. The washed beads we re mixed with 100 μl of 1X Laemmli loading buffer with 10% β‐ Mercaptoethanol and heated at 85°C for 5 min. The proteins released from the beads were then  subjected to Western blotting.     Statistical analysis:   Errors  bars  represent  the  mean  ±  SEM.  Statistical  analyses  were  performed  using  GraphPad  Prism  software  (9. 5.0).   Two‐way  analysis  of  variance  (ANOVA)  followed  by  post‐hoc  Tukey's  multiple  comparisons test were used when necessary. P values < 0.05 were considered significant for all statistical  tests. Data collection and analyses were done blinded to the samples, whenever feasible.            (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint

To determine the physiological significance of GC1‐dependent transnitrosation activity, we created  knock‐in mice lacking this activity by replacing αC610, the main SNO donor cysteine of GC1, with a serine  (αC610S). As previously, we used infusion of Angiotensin II to increase S‐nitrosation and compromise  vascular reactivity and cardiac homeostasis by augmenting oxidative stress (13, 14). Along the study, the  4 groups of mice were WT and KI αC610S treated with AngII or vehicle. We first assayed whether the  expression of GC1 and its activity were changed by the point mutation GC1‐αC610S compared to WT mice  and in response to Ang II‐induced oxidative stress.  1. The expression and NO‐stimulated activity of GC1 are similar in WT and KI αC610S mice ± AngII  treatment. Lysates of lungs of the 4 groups of mice were prepared and the expression of GC1 α and β  subunits assessed (Figure 1A). As previously observed (13, 14), the Ang II treatment did not affect GC1  expression, nor was the KI mutation, indicating that any difference in phenotype between WT and KI  could not be attribu ted to a difference in expression. Likewise, the NO‐stimulated activity of GC1 in  lungs of WT and KI C610S mice treated with vehicle or Ang II was not significantly different between the 4  groups (Figure 1B).  As previously observed, Ang II treatment induces a decrease in NO‐stimulated  Figure 1. Assays of expression and NO-stimulated acti vity of WT and KI C610S mice ± Ang II. ( A). Representative Western blot showing similar expression, albeit slightly less for the KI (n>3). Fifty μg of each lysate was electrophoresed on 12 % SDS gel then blotted and probed with antibodies against GC1 α and GC1β subunits. β actin was used as loading control. (B) 10-50 μg lysates of lungs from the 4 groups of mice were assayed for basal (not shown) and NO-stimulated activity (the NO-donor DEA-NO was used at 100 μM). Lungs were used because they are one of the riches t sources of GC1. n=4 mi ce. Measurements of GC1 activity were done in duplicate. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint activity in the WT mice; however, it did not reach significance.  The untreated KI C610S mice has a NO‐ stimulated activity similar to untreated WT mice. In contrast to WT mice treated with AngII, the KI C610S  did not show any decrease in NO‐stimulated activity when treated with AngII.  Overall, while there might  be a slight impairment of GC1 activity by oxidation in the WT, the expression and activities of GC1 in the  4 groups of mice are not altered by the point mutation C610S in the KI mi ce.        2. Ang II‐induced global and specific S‐nitrosation is drastically decreased in KI αC610S mice compared to  WT mice. We next analyzed and compared to the WT mice, the S‐nitrosation status of the KI C610S mice  under vehicle or Ang II treatment (Figure 2). For this, we conducted a biotin switch assay showing that  biotinylation, hence nitrosation, was not detectable in the lung tissues of untreated WT and KI mice. In  Figure 2. Decreased S-nitrosation in KI mice is associated with increased Ang II-induced blood pressure compared to WT. Left panels: S-nitrosation levels in WT and KI C610S mice ± Ang II. (A). Representative Western blot of biotin ylated samples from the 4 groups el ectrophoresed on a non-reducing 12 % SDS- PAGE and probed with anti-biotin ( n=3). (B) Following avidin purification, the biotinylated samples were separated by electrophoresis of a 12 % SDS-PAGE r educing gel, blotted and probed with antibodies against GC1 α and β, RhoA and Trx1. n=3. The uncut Ponceau red stained blots showing similar protein amount and the “no ascorbat e” control are shown in Supplemental Figure 2 for both Fig 2A and 2B. M.W.: Molecular Weight markers. Right panel (C): Mean blood pressure (MBP) in WT and KI C610S mice ± Ang II. Telemetry recording of BP analyzed with LabC hart software. n=5-7 for each group, expressed in mmHg ± SEM. Statistical analysis was performed with a two-way ANOVA-Tukey's multiple comparisons test with *, p< 0.05, and ****, p< 0.001 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint contrast,  treatment  with  AngII  led  to  high  levels  of  S‐nitrosation  in  WT  mice  but  this  increase  was  considerably blunted in KI mice (Figure 2A). Following avidin enrichment, specific S‐nitrosation of GC1 was  detected in WT and in KI mice (though with a slight decrease) with or without Ang II infusio n.  In the WT  mice,  S‐nitrosation  of  RhoA  and  Trx1  were  detected  and  increased  with  AngII.  In  sharp  contrast,  S‐ nitrosation  was  very  faint  in  the  KI  mice  whether  they  were  treated  or  not  with  AngII.  These  results  indicate that S‐nitrosation of tissues in response to oxidative stress is largely m odulated  by GC1 and that  αCys 610 is the main driver of GC1’ transnitrosation activity. As we previously observed in cells (6, 23) and  now  confirmed  in  vivo,  GC1  is  a  major  source  of  global  S‐nitrosation,  S‐nitrosated  Trx1  and  is  also  responsible for RhoA S‐nitrosation probably via a transnitrosation cascade i nitiated by GC1.        3. AngII‐dependent hypertension in WT mice is further increased in KI αC610S mice.    Next we aimed to test whether this deficit in S‐nitrosation, in particular under AngII‐induced oxidative  stress,  had  any  impact  on  the  cardiovascular  system.  For  this,  we  first  assayed  the  changes  in  blood  pressure.  Using  a  telemetry  system,  we  measured  different  pressures  (systolic,  diastolic  and  mean)  in  unrestrained mice, daily for 1 hour during a 21‐day period. The telemetry device was implanted with a  recovery period of 7 days and then the osmotic pump with AngII or vehicle was implanted for 14 days.  Figure  2C  (right  panel)  shows  the  mean  blood  pressure  for  each  group  at  7th  day  after  the  device  implantation (vehicle, Ctrl) and at 14 days of AngII. Prior to AngII infusion, the baseline MBP measured at  day 7 was similar between WT and KI, i.e., 105.9 ± 2.1 and 105.3 ± 3.3 mm Hg for the WT and KI mice,  respectively. After 2 weeks of AngII treatment, telemetry recordings indicated significant increase in BP  in both KI and WT mice, as expected(24) (25). However, the AngII‐dependent rise in blood pressure was  significantly higher (29.4%) in the KI mice compared to WT mice (20.9%), with a MBP of 130.6 ± 1.9 vs.  141.2 ± 3.3 mm Hg in the WT and KI mice, respectively. The increased pressure values in the KI mice imply  that the cardiac output or/and the total resistance (vasorelaxation) is more affected by oxidative stress  and correlate with decreased S‐nitrosation in KI mice. This suggests that GC1‐dependent transnitrosation  activity could protect from cardiovascular oxidative pathologies.  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint 4. Cardiac health is more compromised in KI mice treated with AngII than in WT mice treated with AngII.   Because  of  a  direct  correlation  between  sustained  elevated  BP  and  cardiac  health,  we  next  assessed  cardiac hypertrophy, oxidation, fibrosis and electrical properties in each group of mice.  Figure 3A shows  that there was no apparent cardiac hypertrophy, measured as the ratio of heart weight (mg) over body   weight (g), in untreated WT and KI mice. AngII treatment induces hypertrophy in both WT and KI mice and  was significantly higher in KI mice compared to WT mice treated with AngII (12.1% vs. 6.9% increase in KI  and WT mice, respectively). As myocardial superoxide generation is a marker of Ang II‐induced cardiac  remodeling (26), we measured the levels of oxidation in the heart of the 4 groups of mice (Figure 3B and  supplementary Figure 3). While DHE staining is increased by AngII treatment in both WT and KI mice,  Figure 3: KI mice treated with AngII have more severe cardiac hypertrophy (A), higher cardiac oxidation (B), increased collagen deposition (C), longer QTc interval (D) and higher number of sinoatrial (SAN) pauses (E) compared to WT mice treated with AngII. Cardiac hypertrophy is expressed as HW (mg)/BW (g). Oxidation was assayed by DHE staining and fibrosis was assessed by Picrosirius red staining (PSR). Electrocardiogram (D and E) of the 4 groups of mice were recorded by telemetry and data were analyzed with labchart software. n=5-11 for each group. Values are expressed as S.E.M. Statistical analysis was performed with a two-way ANOVA- multiple comparison s test, with *, p< 0.05, **, p<0.01, and ****, p< 0.0001 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint there was a significantly higher oxidation in KI mice in comparison to WT mice (ROS production was 1.5‐ fold  higher  in  KI  mice  than  WT  mice  after  AngII  treatment).  These  results  indicate  that  reduced  S‐ nitrosation in KI mice is associated with increased ROS and that the heart of KI mice is less protected from  oxidative  stress.  Cardiac fibrosis is  usually  observed  in  Ang  II‐induced  hypertension  (27,  28).  Using  Picrosirius red staining of heart cryosections, we confirmed that AngII significantly increases interstitial  and perivascular collagen deposition in both WT and KI mice. Importantly, KI mice exhibited more collagen  deposition,  hence  more  severe  cardiac  fibrosis  than  WT  mice  after  AngII  treatment  (Figure  3C  and  supplementary Figure 4). The enhanced collagen deposition in KI mice suggests a potential protective  effect  of  GC1‐transnitrosation  activity  under  oxidative  stress  conditions.  To  determine  whether  the  cardiac fibrosis and hypertrophy were associated  with electrical dysfunction, we conducted  telemetric  ECG recording in the same 4 groups of mice.   While AngII treatment led to a prolonged QTc interval in  both WT and KI, the increase in the duration was only significant in the KI mice (26.2% vs a 13.8% increase  in WT + AngII).  Consequently, the increase in QTc interval of KI + AngII mice was also significantly higher  than in WT + AngII mice (Figure 4D). These data suggest that ventricular repolarization is delayed in KI  mice.  These results are consistent with previous studies that showed prolonged action potential durations  in  cardiomyocytes  from  hypertrophic  hearts.  The  number  of  sinoatrial  node  (SAN)  pauses  was  also  significantly increased in KI mice treated with AngII; it was also higher compared to WT treated with AngII  (Figure 4E), indicating a supraventricular dysfunction. Taken together, these results indicate that the KI  mice  develop  hypertrophic  cardiomyopathy  accompanied  with  typical  electrical  alterations  following  AngII treatment. We further investigated the cardiac rhythm changes by extracting heart rate variability  parameters (HRV) from the ECG recordings. We observed that the HRV was significantly decreased in KI  mice compared to WT mice when challenged with Ang II (supplementary Figure 5).   (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint 5. The endothelium‐dependent relaxation in the resistance vasculature is significantly impaired in KI  mice.  To investigate the potential mechanism(s) of dysregulated BP in KI mice, we assessed the relaxation of the  small  resistance  mesenteric  arteries  (MA)  by  pressure  myography.  The  two  main  vasodilators  of  the  resistance vessels are NO and endothelium hyperpolarization. NO induces relaxation of smooth muscle  cells (SMC) through direct activation of GC1 (“ muscle  component” of relaxation), while hyperpolarization  is  usually  considered  the  “endothelial  component”  of  vasorelaxation.  Acetylcholine  (ACh)  is  the  quintessential  endothelial‐dependent  vasodilator,  which  triggers  endothelial  cell  hyperpolarization  in  small  resistance  arteries  leading  to  relaxation,  while  in  conduit  (large)  arteries  the  ACh‐induced  NO  release, in turn stimulating GC1 activity, is the predo minant  mechanism of vasorelaxation. We measured  vascular resistance in isolated pressurized MA in the 4 groups of mice (WT, KI ± AngII) in response to ACh  and the NO donor, DEA‐NO. MA of 3‐4th order were pressurized at 60 mmHg, pre‐contracted with 10 µM  phenylephrine  (PE)  and  increases  in  luminal  diameter  were  assessed  as  a  function  of  increasing  Figure 4: Cumulative ACh and DEA-NO dose-response curves of WT and KI C 610S mice untreated or treated with AngII. (A) Vasorelaxation to ACh was significantly impaired in the KI mice, as well as in the WT and KI treated with AngII, compared to untreated WT. There was no significant difference between KI, KI + AngII and WT + AngII. (B) The 4 groups showed a similar response to increasing DEA-NO concentrations. Vasorelaxation was assayed by changes in luminal diameter; data were recorded and analyzed with Myoview software. n=3 -6 for each group.. Statistical analysis was performed with a two- way ANOVA-Tukey's multiple comparisons test, with **, p<0.01, and ***, p< 0.0001 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint (cumulative) concentrations of ACh and DEA‐NO. We observed a significant decrease in ACh‐dependent  vasorelaxation in the KI mice compared to the WT. This decreased vascular response in the KI was similar  in the WT and KI mice treated with AngII and significant compared to WT (Figure 4A). In sharp contrast ,   there was no significant changes in the vasorelaxation of the 4 groups of mice in response to DEA‐NO,  which  directly  stimulates  GC1  activity  in  the  SMC  (Figure  4B).  The  lack  of  significant  alteration  in  the  response to NO in the resistance vasculature of the KI mice indicates that the NO‐GC1‐cG MP axis is not  affected  by  the  C610S  replacement,  in  line  with  our  observation  that  the  levels  of  NO‐stimulated  production of cGMP remained unchanged in the KI mice. The impaired ACh‐dependent vasorelaxation  with maintenance of the NO‐dependent response indicates that the C610S mutation does not affect the  SMC compon ent of vasorelaxation but leads to endothelium‐dependent vascular dysfunction, probably at  the origin of the increased BP in the KI mice. Importantly, the deficient response to ACh in the KI mice was  observed  in  the  absence  of  Ang  II‐induced  oxidative  stress  suggesting  that  the  mutation  affects  the  physiological vasorelaxation signalin g, even in the absence of oxidative stress.     6‐ KI C610S Mice show reduced relaxation in PE‐precontracted vessels in response to ACh stimulation  in vivo  Figure 4 illustrates that the endothelial response is significantly diminished in KI mice with impaired S‐ nitrosation.  To  further  evaluate  these  find ings,   we  measured  vasomotion  in  vivo  in  the  mesenteric  arteries,  accounting  for  the  influence  of  the  surrounding  microenvironment,  such  as  adipocytes,  sympathetic system and blood cells, among others. For this, we used intravital microscopy (Supplemental  Figure  1).  Under  control  conditions,  arterioles  ranging  from  100  to  130  µm  in  outer  diameter  wer e  precontracted with 10 µM PE. After two minutes of PE, these vessels were stimulated with 10 µM ACh or  10 µM DEA‐NO. Figure 5A shows representative traces of the vasomotion response of arterioles from WT,  WT  +  Ang  II,  KI,  and  KI  +  Ang  II  mice  under  baseline  condi tions  and  following  PE,  ACh,  and  NO‐donor  treatments.    (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint                                                                                                                                                                                       Figure 5. KI C610S mice exhibit diminished relaxation to ACh stimulation in PE-precontracted vessels in vivo. A) Representative traces showing vasomotion chang es in the mesenteric bed of WT and KI mice under control conditions and AngII treatment. Vessels were stimulated with 10 µM PE, followed by 10 µM ACh or 10 µM DEANO to assess vasorelaxation. For each group of mice, average vascular response to ACh (B), and to DEANO (C) were plotted (5-9 vessels, n>3 mice). D) Percentage of maximum relaxation response induced by ACh from data in B. E) Percentage of maximum relaxation response induced by DEA- NO, from data in C. From data in B, percentage of PE-induced contraction (F), and time to achieve maximum contraction (G). Time to achieve maximum dilation in PE-contracted vessels upon ACh (H) and upon DEA-NO (I). Statistical analysis was performed with a two-way ANOVA-Tukey's multiple comparisons test, with **, p<0.01 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint Data analyses indicate that vasorelaxation peak in response to ACh was significantly impaired in KI mice  as well as in Ang II‐treated WT and KI mice compared to untreated WT (Figure 5B and 5D). In contrast,  the response to NO remained unchanged in WT and KI mice untreated or treate d  with Ang II, aligning with  pressure myography results that showed no difference in NO‐smooth muscle relaxation (Figure 5C and  5E). Additionally, while the extent of contraction induced by PE was similar between WT mice with and  without Ang II treatment, it was significantly reduced in KI mice under both co nditions (control and Ang  II, Figure 5F). Moreover, the time to reach peak contraction was significantly shorter (10‐15 seconds) in KI  mice and Ang II‐treated WT mice, compared to WT mice for which the peak contraction typically occurs  around 20‐25 seconds. The shorter time to reach peak contraction in these mode ls suggest faster smooth  muscle contraction compared to WT mice (Figure 5G). Following ACh stimulation, the time required to  achieve maximum relaxation was significantly prolonged in KI mouse models compared to WT mice. In  contrast, this delay in relaxation was not observed with NO donor treatment (Fig ures 5H and 5I).   Collectively,  the  pressure  myography  and  in  vivo  findings  suggest  that  the  endothelium‐mediated  vasorelaxation  is  specifically  compromised  by  the  C610S  point  mutation  in  the α ‐subunit  of  GC1.  This  mutation is linked to a reduction in GC1 transnitrosation activity while leaving the NO‐GC1‐cGMP signaling  pathway  inta ct.  The  fact  that  the  defect  in  ACh‐dependent  relaxation  takes  place  in  the  absence  of  oxidative conditions suggests that the mutation affects a physiological contractile signal.

In this study, we established that the ability of the soluble guanylyl cyclase (GC1) to transfer S‐nitrosothiol  (SNO)  groups,  i.e.,  promotes  S‐nitrosation  in  other  proteins,  is  involved  in  the  vasorelaxation  of  small  resistance  vessels.  This  is  an  important  finding  as  it  indicates  that  the  transnitrosation  activity  of  GC1  contributes  to  regulation  of  blood  pressure,  which  is  largely  det ermined  by  the  peripheral  vascular  resistance. In the large conduit arteries, NO induces vasorelaxation by increasing cGMP production via  stimulation of GC1 in the smooth muscle (SM) cells. On the other hand, vasorelaxation of small resistance  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint vessels is initiated by endothelium hyperpolarization, which in turn relaxes SM cells. While the identity of  endothelium–derived hyperpolarization factors and the exact mechanism(s)  are still highly debated, S‐ nitrosation appears to be one of the contributing factors of endothelium‐dependent vasorelaxation(3, 29‐ 31). Acetylcholine (ACh) the quintessential endothelium‐dependent vasodilator also activates endothe lial  NO synthases leading to NO production and subsequent activation of GC1 in the SMC. For this reason it  has  been  very  difficult  to  distinguish  the  contribution  of  the  endothelium  vs.  SM  component  of  vasorelaxation regulated by the NO/SNO vasodilation pathways. By introducing in mice a single mutation  of GC1  (C610 S)  that  affects its  transnitrosation activity but  leaves intact its “canonical”  NO‐stimulated  cGMP forming activity, we were able to uncouple two keys NO signaling pathways that are involved in the  endothelial and SM components of vasorelaxation.     We have shown that the NO‐stimulated activity of GC1 is inhibited by S‐ni trosation  under oxidative  stress. Many reports demonstrated that excess S‐nitrosation was associated with endothelial  dysfunction(13, 32). When we treated the WT and KI C610S mice with Ang II, our intent was to  determine whether the mutation, by potentially lowering the levels of S‐nitrosation in the KI, will be  protective fro m extensive cardiovascular pathologies. The opposite took place as shown by exacerbated  cardiac pathologies and a higher rise in MAP in the KI under Ang II treatment. Remarkably, the NO‐cGMP  axis did not appear to be involved, because the mutation did not decrease NO‐stimulated cGMP activity  and be cause  NO‐dependent vasorelaxation of SMC still occurred in the isolated MA and in vivo. In  contrast, the ACh‐dependent vasorelaxation in the resistance vessels was strongly and significantly  decreased and the alteration was maximal in the KI, even in the absence of AngII treatment. One  potential explanation was that the mu tation  C610S, considering its overall effect on global S‐nitrosation  levels removes an attributed function of SNO, which is to protect the tissues from more deleterious thiol  oxidations, in particular in the cardiac tissues (15). This could be the explanation for the compromised  cardiac heath observed in the KI mice tr eated  with AngII. Nonetheless, we observed the decreased ACh‐ dependent relaxation in the absence of oxidative/nitrosative stress suggesting that the mutation C610S  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint impaired a cGMP‐independent physiological function of GC1, probably unrelated to a mechanism of  protection in oxidative pathologies. We did not observe an increased MAP in untreated KI mice and  inferred that this could be due to compensatory mechanism(s) from the multiple regulators of BP.     In summary, we propose that GC1‐dep endent  transnitrosation is involved in the endothelium– dependent vasorelaxation of resistance vessels and our next challenge is to identify and assess the  involvement of SNO targets, known to participate in endothelium‐dependent hyperpolarization  mechanism. We also currently investigate the role of RhoA in these phenotypes because it is a GC1/Trx1  transnitrosation cascade ta rget in vivo, and its S‐nitrosation leads to inhibition of its contractile  pathway(33). Likewise, we will assess whether C610 is the potential cys that was proposed to interact  with additional NO to maximally stimulate GC1, a somewhat controversial mechanism (34) (addition of  excess NO in the pressure myography an d in vivo experiments might have masked this mechanism).  Likewise, the impact on cardiac pathologies of the mutation C610S and the underlying mechanisms need  to be further explored (5).

1.  J. Erdmann et al., Dysfunctional nitric oxide signalling increases risk of myocardial infarction.  Nature 10.1038/nature12722 (2013).  2.  E. J. Tsai, D. A. Kass, Cyclic GMP signaling in cardiovascular pathophysiology and therapeutics.  Pharmacol Ther 122, 216‐238 (2009).  3.  Y. Zhao, P. M. Vanhoutte, S. W. Leung, Vascular nitric oxide: Beyond eN OS. J Pharmacol Sci 129,  83‐94 (2015).  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint 4.  P. Sandner et al., Soluble Guanylate Cyclase Stimulators and Activators. Handb Exp Pharmacol  264, 355‐394 (2021).  5.  C. T. Stomberski, D. T. Hess, J. S. Stamler, Protein S‐Nitrosylation: Determinants of Specificity and  Enzymatic Regulation of S‐Nitrosothiol‐Based Signaling. Antioxid Redox Signal  10.1089/ars.2017.7403 (2018).  6.  C. Cui et al., S oluble  guanylyl cyclase mediates noncanonical nitric oxide signaling by nitrosothiol  transfer under oxidative stress. Redox biology 55, 102425 (2022).  7.  R. C. Shah, S. Sanker, K. C. Wood, B. G. Durgin, A. C. Straub, Redox regulation of soluble guanylyl  cyclase. Nitric Oxide 76, 97‐104 (2018).  8.  E. Schulz, T. Go ri, T. Munzel, Oxidative stress and endothelial dysfunction in hypertension.  Hypertens Res 34, 665‐673 (2011).  9.  E. S. Arner, A. Holmgren, Physiological functions of thioredoxin and thioredoxin reductase. Eur J  Biochem 267, 6102‐6109 (2000).  10.  S. I. Hashemy, A. Holmgren, Regulation of the catalytic activity and structure of human  thioredoxin 1 via oxidation and S‐nitrosy lation of cysteine residues. J Biol Chem 283, 21890‐ 21898 (2008).  11.  C. Wu et al., Thioredoxin 1‐Mediated Post‐Translational Modifications: Reduction,  Transnitrosylation, Denitrosylation, and Related Proteomics Methodologies. Antioxid Redox  Signal In press (2011).  12.  C. Huang et al., Guanylyl cyc lase sensitivity to nitric oxide is protected by a thiol oxidation‐driven  interaction with thioredoxin‐1. J Biol Chem 292, 14362‐14370 (2017).  13.  P. A. Crassous et al., Soluble guanylyl cyclase is a target of angiotensin II‐induced nitrosative  stress in a hypertensive rat model. American journal of physio logy. Heart and circulatory  physiology 303, H597‐604 (2012).  14.  P. A. Crassous et al., Newly Identified NO‐Sensor Guanylyl Cyclase/Connexin 43 Association Is  Involved in Cardiac Electrical Function. Journal of the American Heart Association 6 (2017).  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint 15.  E. Murphy, M. Kohr, J. Sun, T. Nguyen, C. Steenbergen, S‐nitrosylation: a radical way to protect  the heart. J Mol Cell Cardiol 52, 568‐577 (2012).  16.  J. Sun, M. Morgan, R. F. Shen, C. Steenbergen, E. Murphy, Preconditioning results in S‐ nitrosylation of proteins involved in regulation of mitochondrial en ergetics and calcium  transport. Circ Res 101, 1155‐1163 (2007).  17.  B. Lima, M. T. Forrester, D. T. Hess, J. S. Stamler, S‐nitrosylation in cardiovascular signaling. Circ  Res 106, 633‐646 (2010).  18.  I. H. Schulman, J. M. Hare, Regulation of cardiovascular cellular processes by S‐nitrosylation.  Biochim Biophys Acta 182 0, 752‐762 (2012).  19.  J. Thireau, B. L. Zhang, D. Poisson, D. Babuty, Heart rate variability in mice: a theoretical and  practical guide. Exp Physiol 93, 83‐94 (2008).  20.  M. Shahid, E. S. Buys, Assessing murine resistance artery function using pressure myography.  Journal of visualized experi ments : JoVE 10.3791/50328 (2013).  21.  N. Sayed et al., Nitroglycerin‐induced S‐nitrosylation and desensitization of soluble guanylyl  cyclase contribute to nitrate tolerance. Circ Res 103, 606‐614 (2008).  22.  A. C. Straub, A. Beuve, A primer for measuring cGMP signaling and cGMP‐mediated vascular  relaxation. Nitric Oxide 11 7 , 40‐45 (2021).  23.  C. Cui et al., Inhibitory Peptide of Soluble Guanylyl Cyclase/Trx1 Interface Blunts the Dual Redox  Signaling Functions of the Complex. Antioxidants (Basel) 12 (2023).  24.  K. Okuno et al., Angiotensin II Type 1A Receptor Expressed in Smooth Muscle Cells is Required  for Hypertensive Vascular Remodel ing  in Mice Infused With Angiotensin II. Hypertension 80,  668‐677 (2023).  25.  J. C. Romero, J. F. Reckelhoff, State‐of‐the‐Art lecture. Role of angiotensin and oxidative stress in  essential hypertension. Hypertension 34, 943‐949 (1999).  26.  E. Takimoto, D. A. Kass, Role of oxidative stress in cardiac hy pertrophy  and remodeling.  Hypertension 49, 241‐248 (2007).  (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint 27.  K. Broekmans, J. Giesen, L. Menges, D. Koesling, M. Russwurm, Angiotensin II‐Induced  Cardiovascular Fibrosis Is Attenuated by NO‐Sensitive Guanylyl Cyclase1. Cells 9 (2020).  28.  J. M. Schnee, W. A. Hsueh, Angiotensin II, adhesion, and cardiac fibrosis. Cardiovasc Res 46, 264‐ 268 (2000).  29.  S. M. Mutchler, A. C. Strau b,  Compartmentalized nitric oxide signaling in the resistance  vasculature. Nitric Oxide 49, 8‐15 (2015).  30.  Y. Iwakiri, S‐nitrosylation of proteins: a new insight into endothelial cell function regulated by  eNOS‐derived NO. Nitric Oxide 25, 95‐101 (2011).  31.  S. Luo et al., Roles of Protein S‐Nitrosyl ation  in Endothelial Homeostasis and Dysfunction.  Antioxid Redox Signal 40, 186‐205 (2024).  32.  H. Choi, K. J. Allahdadi, R. C. Tostes, R. C. Webb, Augmented S‐nitrosylation contributes to  impaired relaxation in angiotensin II hypertensive mouse aorta: role of thioredoxin reductase. J  Hypertens 29, 2359‐2368 (2011).  33.  L. Lin et al ., RhoA inactivation by S‐nitrosylation regulates vascular smooth muscle contractive  signaling. Nitric Oxide 74, 56‐64 (2018).  34.  N. B. Fernhoff, E. R. Derbyshire, M. A. Marletta, A nitric oxide/cysteine interaction mediates the  activation of soluble guanylate cyclase. Proc Natl Acad Sci U S A 106, 21602‐21607 (2009).  ACKNOWLEDGMENTS:   This work was supported by the National Institutes of Health, R01 GM 067640 and R01 GM112415  (A.B.); R01 HL157116 and R01HL133294 (L.H.X).  American Heart Association, 19TPA34900003 (L.H.X.)  Career Development Award 932684 (M.L.); AHA Research Supplement to Promote Diversity in Science  23DIVSUP1054931 (P.B.).       (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint   (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted October 28, 2024. ; https://doi.org/10.1101/2024.10.28.620487doi: bioRxiv preprint