Mechanosensitive Cation Channel Piezo1 Contributes To Ventilator-Induced Lung Injury By Activating RhoA/ROCK1 In Rats

Mechanosensitive Cation Channel Piezo1 Contributes To Ventilator-Induced Lung Injury By Activating RhoA/ROCK1 In Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanosensitive Cation Channel Piezo1 Contributes To Ventilator-Induced Lung Injury By Activating RhoA/ROCK1 In Rats Yang Zhang, Lulu Jiang, Tianfeng Huang, Dahao Lu, Yue Song, Lihui Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-555235/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Background: Mechanical ventilation can induce or aggravate lung injury, which is termed ventilator‑induced lung injury. Piezo1 is a key element of the mechanotransduction process and can transduce mechanical signals into biological signals by mediating Ca2+ influx, which in turn regulates cytoskeletal remodeling and stress alterations. We hypothesized that it plays an important role in the occurrence of ventilator‑induced lung injury, and we investigated the underlying mechanisms. Methods: High tidal volume mechanical ventilation and high magnitude cyclic stretch were performed on Sprague Dawley rats, and A549 and human pulmonary microvascular endothelial cells, respectively, to establish ventilator‑induced lung injury models. Immunohistochemical staining, flow cytometry, histological examination, enzyme-linked immunosorbent assay, western blotting, quantitative real-time reverse transcription-PCR and survival curves were used to assess the effect of Piezo1 on induction of lung injury, as well as the signaling pathways involved. Results: We observed that Piezo1 expression increased in the lungs after high tidal volume mechanical ventilation and in cyclic stretch-treated cells. Mechanistically, we observed the enhanced expression of RhoA/ROCK1 in both cyclic stretch and Yoda1-treated cells, while the deficiency or inhibition of Piezo1 dramatically antagonized RhoA/ROCK1 expression. Furthermore, blockade of RhoA/ROCK1 signaling using an inhibitor did not affect Piezo1 expression. GSMTx4 was used to inhibit Piezo1, which alleviated ventilator‑induced lung injury-induced pathologic changes, water content and protein leakage in the lungs, and the induction of systemic inflammatory mediators, and improved the 7-day mortality rate in the model rats. Conclusions: These findings indicate that Piezo1 affects the development and progression of ventilator‑induced lung injury through promotion of RhoA/ROCK1 signaling. Pulmonology Piezo1 ventilator-induced lung injury RhoA/ROCK1 Acute lung injury Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Mechanical ventilation (MV) is a common method of respiratory support during clinical anesthesia. In many critical diseases, especially acute lung injury (ALI) and acute respiratory distress syndrome (ARDS), MV is an important means of first aid and respiratory treatment. However, in recent years, people have gradually realized that MV is a double-edged sword. MV itself can also induce or aggravate the injury of important target organs. For example, the incidence of ventilator-induced lung injury (VILI), also known as mechanical ventilation related lung injury [ 1 , 2 ], accounted for 22–39% of mechanical ventilation, and the incidence of patients with lung disease could be as high as 83% [ 3 ]. Unfortunately, ALI and ARDS-related mortality is very high, and prevention or treatment measures are still limited, possibly because of the complex and unclear pathogenesis of ALI. Therefore, understanding the pathological mechanisms of lung injury is imperative to develop prevention and treatment strategies for ALI. Piezo1 is a mechanosensitive ion channel protein in mammals that can be directly activated by mechanical stimuli, and can transduce mechanical signals into biological signals by mediating Ca2 + influx, which in turn regulates vascular development, erythrocyte volume, and urothelial cell tone [ 4 – 6 ]. Endothelial-expressed Piezo1 can sense disturbed blood flow and is linked to inflammatory signaling and atherosclerosis progression [ 7 ]. As a specific mechanosensitive protein, whether Piezo1 plays an important role in the occurrence of VILI is not clear RhoA is a small GTPase protein in the Rho family that is primarily associated with cytoskeleton regulation, mostly actin organization and actomyosin contractility [ 8 ]. Our previous study found that the RhoA/Rho associated coiled-coil containing protein kinase (ROCK) signaling pathway was activated and the expression levels of its members was significantly upregulated in the lung tissues of septic rats [ 9 ]. Similarly, it was reported that RhoA activation is involved in lipopolysaccharide-mediated endothelial barrier dysfunction in ALI mice [ 10 ]. Further study showed that inhibition of RhoA could rescue high ventilation and lipopolysaccharide induced lung injury significantly [ 11 , 12 ]. All the above studies confirmed the critical role of the RhoA/ROCK signaling pathway in ALI; however, the upstream regulatory mechanisms are not fully determine and require further study. In the present study, the role of Piezo1 in VILI was investigated. The findings of both in vivo and in vitro experiments demonstrated that Piezo1 expression is required for the high tidal volume ventilation-induced lung injury in rats and this process likely acts through regulating the RhoA/ROCK pathway. Methods Animal preparation Adult male Sprague–Dawley rats (250–300 g) were purchased from the Animal Center of the School of Medicine, Yangzhou University. The rats were housed in air-filtered rooms and were given ad libitum access to food and water. Animals were housed at a constant temperature (20–24 °C) and constant humidity (50–70%) with a 12/12-h light/dark cycle. The study protocol was approved by the Animal Care and Use Committee of Yangzhou University (Yangzhou, China) and was in accordance with the guidelines for the care and use of animals set by the Chinese government. Experimental procedure and animal model of VILI Lung injury was induced in the rats using high tidal volume mechanical ventilation (HVMV), based on a previously published VILI model [13]. Briefly, all animals were anesthetized via an intraperitoneal injection of pentobarbital sodium (40 mg/kg, Merck, Darmstadt, Germany). After induction of anesthesia, the rats underwent an oral endotracheal intubation with a 16 G trocar and were ventilated for hours in a volume-controlled ventilation mode (DW 3000, Zhenghua Biologic, Anhui Province, China). Animals were ventilated with a high tidal volume (Vt) of 22 ml/kg and zero positive end-expiratory pressure (PEEP) at a respiratory rate of 16–18 breaths/min, whereas control (sham) rats were ventilated with a Vt of 6 ml/kg and PEEP of 5 cm H 2 O at a rate of 45–55 breaths/min. The fraction of inspired oxygen (FiO2) remained constant at 0.21. The rats were placed in the supine position on a heating blanket and under a heating lamp, to ensure a body temperature of 37 °C throughout the experiment. A polyethylene catheter was placed in the femoral artery to monitor mean arterial pressure and heart rate, as well as for blood sampling. The arterial catheter was infused with physiological saline at 0.5 mL/h and anesthesia was maintained by additional injections (15 mg/kg, i.p.) administered every hour under hemodynamic monitoring. After mechanical ventilation, the rats were returned to their cages and provided food and water ad libitum . 10 μg of GsMTx4 (dissolved in 0.2 mL of saline) or vehicle was injected via arterial supply of the hindlimb for thirty minutes before the VILI procedure. Rats were killed by heart bloodletting 6 h after administration of ventilation. Cell culture and transfection The human alveolar epithelial cell line (A549) and the human pulmonary microvascular endothelial cell line (HPMEC) were purchased from the BNCC Biotechnology Research Institute (Beijing, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)and M199 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in an atmosphere of 95% air and 5% CO 2 . When the cells reached 80% confluence, they were seeded into 24-well or 6-well plates for further experiments. For small interfering RNA (siRNA) transfection, the Piezo1 siRNA (Thermo Fisher Scientific, Waltham, MA, USA) and its negative control siRNA (Invitrogen) were transfected into the cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Three days later, the cells were collected. HPMEC monolayers were pre-treated with different concentration of Yoda-1 (Tocris/BioTechne, Bristol, UK), 5 μM GSMTx4, 10 μM Y-27632 or fasudil (Merck Millipore, Burlington, MA, USA) for 24 h before cell deformation or collection. Cell deformation Cell deformation was achieved by stretching with a Flexercell Tension Plusä FX-4000T system (Flexcell International, Burlington, NC, USA) equipped with a loading station, which was designed to provide uniform strain to the cultured cells. The vacuum pressure was controlled by the computer, allowing cell monolayers to receive different levels of elongation. These deformations were selected as previously described [14]. Briefly, cells were seeded at 2.0 × 10 5 cells/cm 2 on type I collagen-coated flexible bottom BioFlex plates (Flexcell international) and allowed to reach 50% confluence after 24 h. Then, the culture medium was changed to serum-deprived medium in each plate and the experimental plates with monolayer cell were mounted onto the Flexcell system. Cells were then exposed to cyclic stretch (CS) of high magnitude (20% elongation) for different durations (0–6 h) with a frequency of 15 cycles/min. Flow cytometric analysis of cell apoptosis To investigate the time-dependent effects of CS on cell apoptosis, the cells after CS exposures were stained with FITC-conjugated Annexin V and propidium iodide (PI) following manufacturer’s instructions (KeyGEN Biotech Co. Ltd, China) and was analyzed by flow cytometry (Beckman Coulter Co, USA). Determination of water content and histological examination To evaluate the severity of lung injury, ventilator-induced pulmonary edema was assessed based on the wet-to-dry weight ratio of the lung. The right upper lobe of each lung was weighed immediately after extraction and placed in a 60 °C oven for 72 h. The dried tissue was then weighed to determine the wet-to-dry weight ratio. Samples from the inferior lobe of the right lung were fixed in 4% paraformaldehyde solution, dehydrated sequentially in 50% to 100% alcohol, and treated with xylene solution. Then, the tissues were embedded in paraffin, sectioned (thickness, 6 μm), and stained with hematoxylin and eosin (H&E). The samples were assigned an injury score for each of these four categories: Alveolar and interstitial edema, microhemorrhage, inflammatory infiltration, and microatelectasis or alveolar overdistension. The injury scores were assigned as follows: 0, absent with normal appearance; 1, slight; 2, intermediate; and 3, severe [9, 15, 16]. The lung injury score was calculated by adding the individual injury scores for each category. The scoring was performed by a pathologist who was blinded to the data, using a light microscope (×40, Olympus, Tokyo, Japan) to view the stained tissue samples. Protein leakage from capillaries Pulmonary microvascular permeability was determined using the Evans blue dye extravasation method at 6 h after MV. Evans blue dye (30 mg/kg, Sigma-Aldrich, St. Louis, MO, USA) was administered intravenously at 30 min before the rats were sacrificed. Lungs were perfused to remove blood and extracted. The dye content in lung the tissue was determined spectrophotometry at an optical density of 620 nm [17]. Immunofluorescence After animals were deeply anesthetized with pentobarbital sodium, they were perfused with 100–300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The lung was harvested and post-fixed at 4 ℃ for 24 h. The lung tissues were embedded in Tissue-Tek (optimal cutting temperature (OCT) compound; SAKURA Finetek, Tokyo, Japan) and frozen in liquid nitrogen for the preparation of cryosections. Frozen lung tissues were cut to a thickness of 20 μm. After being blocked with phosphate-buffered saline (PBS) containing 10% goat serum and 0.3% Triton X-100 for 1–2 h at 37 ℃, the sections were incubated overnight at 4 ℃ with rabbit anti-Piezo1 (1:300, ProteinTech Group, Rosemont, IL, USA). The sections were then incubated with goat anti-rabbit IgG conjugated with Cy3 (1:500, Jackson ImmunoResearch, West Grove, PA, USA) for 1 h at room temperature. The sections were finally mounted using Vectashield plus 4', 6-diamidino-2-phenylindole (DAPI) mounting medium (Vector Laboratories, Burlingame, CA, USA). HPMEC cells were fixed in 4% paraformaldehyde, and then incubated with anti-Piezo1 antibody (1:400) overnight at 4 °C. After washing five times with PBS, the cells were incubated with Cy3 (1:500) for 1 h at room temperature. Then, the cells were washed with PBS again five times for 1 h before being stained using DAPI for 2 min. After three further washes, the dishes were observed under a fluorescence microscope. All images were observed using a Leica DMI4000 fluorescence microscope and captured with a DFC365FX camera (Leica, Wetzlar, Germany). Enzyme-linked immunosorbent assay Bronchoalveolar lavage fluid (BALF) was collected and centrifuged at 6 h after MV was performed. The concentrations of tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, IL-6, and monocyte chemotactic protein 1 (MCP-1) were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN, USA). Western blotting analysis Lung tissues were homogenized and the cultured cells ultrasonicated in chilled lysis buffer (10 mM Tris, 1 mM phenylmethylsulfonyl fluoride, 5 mM MgCl 2 , 5 mM EGTA, 1 mM EDTA, 1 mM DTT, 40 μM leupeptin, 250 mM sucrose). Approximately 10% of the homogenates (by volume) were used to determine total protein levels. The remained was centrifuged at 4 °C for 15 min at 1000 ´ g . The supernatant was collected as cytosolic proteins. After the concentrations of the proteins were measured using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA), equal amounts of total proteins were heated at 99 °C for 5 min and loaded onto a 4–15% stacking/7.5% separating SDS‑polyacrylamide gel (Bio-Rad). The proteins were then electrophoretically transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membrane was blocked for 2 h at room temperature, and then incubated at 4 °C overnight with the following primary antibodies: rabbit anti-synaptotagmin binding cytoplasmic RNA interacting protein (Syncrip) (1:1000; ProteinTech Group), rabbit anti-RhoA (1:5000; Abcam, Cambridge, MA, USA), rabbit anti-ROCK1 (1:1000; Abcam), and rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:2000; Sigma). The proteins were detected using horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:3000; Jackson ImmunoResearch), and exposed using the ChemiDoc XRS System with Image Lab software (Bio-Rad). The intensity of immunoreactive protein bands was quantified using densitometry with the Image Lab software (Bio-Rad). RhoA activity assay Active GTP-bound RhoA was detected in lysates collected from cells subjected to a pull‑down assay using a RhoA activation assay kit (Abcam) according to manufacturer’s indications. Briefly, supernatants were incubated with an anti-active RhoA Rabbit monoclonal antibody and protein A/G Agarose bead slurry at 4 °C (×1 h) on a rotator. Bead-precipitated proteins were fractionated and immunoblotted using antibodies against RhoA. Quantitative real-time reverse transcription-PCR Lung tissues and cells were collected rapidly and pooled together to achieve sufficient RNA. Total RNA was extracted using a miRNeasy kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions. Reverse-transcription to cDNA was achieved using ThermoScript Reverse Transcriptase (Invitrogen/Thermo Fisher Scientific) with oligo (dT) primers (Invitrogen/Thermo Fisher Scientific). The cDNA was then used in a quantitative real-time PCR amplification consisting of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C for 40 cycles. Tubulin was used as an internal control. Relative changes of mRNA levels were calculated by using the △Ct method (2 −△△Ct ). The primers used in this study were as follows: Piezo1 Forward: 5’- GGACTCTCGCTGGTCTACCT-3’; Piezo1 Reverse: 5’- GGGCACAATATGCAGGCAGA -3’; ROCK1 Forward: 5’- GACTGGGGACAGTTTTGAGAC-3’; ROCK1 Reverse: 5’- GGGCATCCAATCCATCCAGC-3’; Tubulin Forward: 5’-GCCTTCTGAGAGAGTTAAG-3’; Tubulin Reverse: 5’-AGACTGGACCACCGGAGA-3’. Survival curves To observe the effect of Piezo1 on survival, 40 rats were randomly divided into four experimental groups as described earlier (n = 10 per group). Survival was assessed every day until the endpoint of 7 days. Survival data were analyzed using log-rank or χ2 tests. A p-value of less than 0.05 was considered statistically significant. Statistical analyses All data are presented as the mean ± SEM. The data were analyzed statistically using two-tailed, unpaired Student’s t tests and a one-way or two-way analysis of variance (ANOVA). When ANOVA showed a significant difference, pairwise comparisons between means were tested using the post hoc Tukey method (Sigma-Aldrich, Plot 12.5). P < 0.05 was considered statistically significant in all analyses. Results Piezo1 expression was increased in the lungs after high tidal volume mechanical ventilation Photomicrographs showed that, compared with that in the sham group, different degrees of lung tissue injury occurred at 2, 4, and 6 h after HVMV, and the following effects were seen: Infiltration of inflammatory cells into the lung interstitium and alveolar spaces; thickening of alveolar walls; and intra-alveolar exudation (Fig. 1A–D). Semi-quantitative assessment using a lung injury score demonstrated that the degree of lung injury in the HVMV groups was higher than that in the sham group (Fig. 1E), and the ratio of PaO2/FiO2 in the HVMV groups was lower than that in sham group (Fig. 1F). To explore the potential role of Piezo1 in acute lung injury, we examined whether Piezo1 expression was altered in the lung following HVMV. The expression of Piezo1 mRNA and protein increased in a time-dependently manner in the lungs at 2, 4, and 6 h after HVMV (Fig. 1G and H), which was consistent with the observations from the western blotting analysis above. Immunofluorescence images showed that the expression of Piezo1 in rat lung tissue increased significantly increased at 6 h after HVMV (Fig. 1I). Piezo1 expression and cell apoptosis both increased in CS-treated cells Annexin V binding and propidium iodide (PI) staining were used for cell apoptosis analysis, and a series of the representative plots of the flow cytometry analysis were presented (Fig. 2A and B). The results showed that the apoptosis rate increased in a time-dependent manner following CS treatment, and apoptosis was significantly increased in A549 cells and HPMECs compared with that in the sham group after 6 h (Fig. 2C and D). Besides, the expression of Piezo1 mRNA and protein were also time dependently increased in A549s cells after CS (Fig. 2E and F). Increased Piezo1 activated the RhoA/ROCK1 pathway in CS-treated HPMECs How did increased Piezo1 participate in VILI? We further examined whether Piezo1 expression was altered in HPMECs following CS. The expression of Piezo1 mRNA and protein increased in a time-dependent manner in CS-treated HPMECs (Fig. 3A–C). We also determined whether the Rho pathway might act on the CS-treated HPMECs. GTP‑bound (active) RhoA in cells was measured using a RhoA activity assay, and total‑RhoA was examined using western blotting. The results demonstrated that the levels of GTP-bound RhoA increased in a time-dependent manner following CS of different durations (Fig. 3A and D). Similar results were also obtained for its downstream effectors. The expression of ROCK1 mRNA and its protein increased in a time-dependent manner following CS (Fig. 3E and F). To confirm this result, we used different concentrations of Yoda1, a Piezo1 agonist, to stimulate cells, which conformed Yoda1 as a Piezo1 selective agonist [18, 19]. To minimize the toxicity and side effects of Yoda1, a low dose of the agonist was used (~5 μM), this represents a moderate stimulus, because the EC50 of Yoda1 activation of Piezo1 is ∼25 μM [20]. As expected, the level of ROCK1 mRNA increased in a time-dependent manner in Yoda1-treated cells (Fig. 3G). Finally, immunohistochemistry revealed the expression of Piezo1 in HPMECs (Fig. 3H). Blocking the increase in Piezo1 inhibited RhoA/ROCK1 pathway activation in CS-treated HPMECs We next investigated whether blocking the CS-induced increase in Piezo1 through Piezo1-specific siRNA transfection into the HPVECs changed the RhoA/ROCK1 pathway status; a control scrambled siRNA was used as a control. The level of Piezo1 mRNA and protein increased significantly in scrambled siRNA-treated HPVECs following CS for 6 h (Fig. 4A–C). However, this increase was not seen in the Piezo1 siRNA-treated cells (Fig. 4A–C). Neither of the siRNAs altered the basal expression of Piezo1 in the sham cells. We also found that transfection with Piezo1 siRNA affected CS-induced RhoA/ROCK1 pathway activation, as revealed by increases in the levels of GTP-bound RhoA and ROCK1 in the scrambled siRNA-treated cells following CS for 6h compared with those in the sham group (Fig. 4D–F). These increases were absent in the Piezo1 siRNA-treated cells (Fig. 4D–F). Moreover, Piezo1 siRNA pretreatment also reduced the increased ROCK1 induced by Yoda-1(Fig. 4G). For confirmation, we used GSMTx4 (an inactivated non-selective cationic MSC inhibitor) to inhibit Piezo1 activity. GSMTx4 pretreatment could effectively reduce the expression of ROCK1 induced by CS in cells (Fig. 4H). Inhibition of the RhoA/ROCK1 pathway did not affect the expression of Piezo1 in HPMECs To further verify the possible correlation of Piezo1 and the RhoA/ROCK1 pathway, we used fasudil or Y27632, an inhibitor of the RhoA/Rho kinase (ROCK) signaling pathway, to explore the effects of RhoA/ROCK signaling on Piezo1 overexpression. After fasudil treatment for 24 h, the increase in RhoA protein levels induced by CS was blocked (Fig. 5A and B). However, the expression of Piezo1 was significantly upregulated in CS-treated cells, with or without fasudil pretreatment (Fig. 5A and C). Similarly, after Y27632 treatment for 24 h, the increases of both ROCK1 mRNA and protein induced by CS were blocked (Fig. 5D–F). However, after preconditioning with or without Y27632, the expression of Piezo1 mRNA and protein had no affected in CS‑treated HPMECs (Fig. 5G and H). These data indicated that Piezo1 acts as an upstream regulator of the RhoA/ROCK1 signaling pathway. Blocking the increased Piezo1 level attenuates VILI and improves survival in rats Photomicrographs showed that, at 6 h after HVMV, the following effects were seen: Infiltration of inflammatory cells into the lung interstitium and alveolar spaces; thickening of alveolar walls; and intra-alveolar exudation (Fig. 6A–D). However, GSMTx4 preconditioning attenuated these histological changes. Semi-quantitative assessment using a lung injury score demonstrated that the degree of lung injury in the MG132 + VILI group was lower than that in the VILI + vehicle group (Fig. 6E). The lung wet-to-dry-weight ratio increased significantly at 6 h after VILI administration (Fig. 6F). Extravasation of Evans Blue Dye showed that VILI induced a significant increase in leakage into the lung (Fig. 6G). When the animals were pretreated with 10 μg GSMTx4, lung edema and capillary leakage were reduced significantly at 6 h after VILI administration (Fig. 6F and G). GSMTx4 alone did not affect these variables in the sham rats. Six hours after HVMV, BALF was collected and the concentration of inflammatory cytokines in BALF was detected using ELISA. The results showed that the concentration of pro-inflammatory cytokines, e.g., TNF-α, IL-1β, IL-6, and MCP‑1, increased significantly in lung tissue (Fig. 6H). However, after GSMTx4 pretreatment, the concentration of TNF-α, IL-1β, and IL-6 in BALF decreased significantly (Fig. 6H). These findings indicated that blocking Piezo1 could alleviate the inflammatory reaction of lung tissue in VILI rats. As shown in Fig. 6I, the survival rate of rats in the sham group was 100%, and the survival rate was significantly decreased in the VILI group compared with that in the sham operation group. The survival rate after HVMV was 50% on the second day, which decreased to 0% on the fifth day. Pretreatment with GSMTx4, however, improved the survival rate to 70% on second day and 30% on day 7, and at least 30% of the rats survived. This result confirmed the protective effect of blocking Piezo1 on mortality in rats with VILI. Discussion Mechanical ventilation can both provide respiratory support to patients with ALI and aggravate pre-existing lung injury, prompting the progression of ALI to ARDS, as well as increasing patient mortality in an effort to mitigate injury as much as possible. In recent years, some scholars have proposed and developed a lung protective ventilation strategy using low tidal volume combined with lung recruitment and PEEP as the main component, which achieved certain effects while also increasing the risk of patients with diaphragmatic function barriers [ 21 , 22 ]. Further understanding of the pathogenic mechanisms of VILI may provide a new avenue for the management of this disorder. In the present study, we demonstrated that Piezo1 participates in the mechanisms of ventilator-induced lung injury in rats and CSinduced cell apoptosis by activating RhoA/ROCK1 signaling in rats. Traction of the alveoli by large tidal volumes is an important etiology of VILI, with distortion of the alveolar epithelium versus the pulmonary endothelium from stress, both of which are mechanically damaged when high tidal volumes are ventilated. More importantly, the pulmonary vascular endothelium is subjected to mechanical stretch leading to increased cell membrane permeability; intravascular exudation of substances such as albumin and erythrocyte debris into the pulmonary interstitium; and products such as phospholipase released by neutrophils and macrophages after activation; can interfere with and inactivate alveolar surfactant, thereby affecting alveolar function [ 23 ]. Given that MV can activate Piezo1 channels in the lungs of ARDS rats, which increased the intracellular Ca2 + content in alveolar epithelial cells, downregulated the expression of anti-apoptotic protein Bcl-2, and increased alveolar epithelial cell apoptosis [ 24 ]. Further studies showed that increasing pulmonary vascular hydrostatic pressure in mice, either using aortic constriction or elevating the left atrial pressure, resulted in severe pulmonary edema after disruption of the pulmonary vascular barrier in wild-type mice, whereas specifically knocking out Piezo1 in mouse pulmonary endothelial cells significantly reduced pulmonary vascular permeability and the extent of pulmonary edema in mice. In addition, degradation of adherens junction proteins VE-cadherin, β-catenin, and p120-catenin was not significant [ 25 ]. In the present study, we found that high tidal volume mechanical ventilation significantly induced pulmonary interstitial edema, alveolar wall thickening, and destruction of alveolar morphology in rat lung tissue, and the injury was more pronounced and the oxygenation index was significantly reduced as the duration of mechanical ventilation increased. During this process, Piezo1 expression in rat lung tissue also showed significant upregulation with increased ventilation time. By immunohistochemical staining, we found that Piezo1 was widely expressed in rat lung tissue. Alveolar epithelial and endothelial cells, the earliest effector cells to appear altered within the lung, bear the brunt of alveolar epithelial and endothelial cell involvement when ALI is initiated. In this study, we found that after massive mechanical stretching of the lung epithelium and endothelium (20%) [ 26 ], mimicking VILI in vitro , both the epithelium and endothelium were significantly damaged and the apoptosis rate increased in a time-dependent manner. Consistent with the injury, Piezo1 expression also showed time-dependent upregulation, suggesting that upregulated Piezo1 gene expression in the lung might be an important risk factor for the pathogenesis of VILI. This could be related to the fact that Piezo1 acts as a nonselective cation channel and is permeable to extracellular calcium (Ca2+) influx [ 27 ]. Intracellular Ca2 + acts as a second messenger that can activate different downstream biochemical signaling pathways and biological effects. It reported that loading mice with ex vivo perfused lungs with high PIP ventilation increased their pulmonary vascular barrier permeability, and that reducing Ca2 + influx caused by channel activation, by means of pretreatment with TRPV4 inhibitors or gene knockout, could partially abolish pulmonary edema resulting from disruption of the air-blood barrier [ 28 ]. In addition, high PIP ventilation can activate TRPV4 channels on the surface of alveolar macrophages to trigger Ca2 + signals, leading to a large production of NO and O 2 − , which cause oxidative damage [ 29 ]. Using real-time Ca2 + imaging, we observed that acute elevation of airway pressure in healthy mice induced a significant increase in free Ca2 + in endothelial cells that lasted for more than 15 min. Alveolar capillary barrier dysfunction is one of the important pathological features of ALI [ 30 ]. The alveolar capillary barrier compositional structure includes pulmonary microvascular endothelial cells and alveolar epithelial cells, either of which, when damaged, affects the homeostasis of lung function. However, endothelial cells are the first defense barrier, and when inflammatory injury occurs, pulmonary microvascular endothelial cells are first damaged, and cell permeability rapidly increases, causing capillary leakage. Therefore, we further explored how Piezo1 plays a role in VILI and its possible downstream regulatory mechanisms by mechanically stretching HPMECs. Previous studies have reported that the RhoA/ROCK pathway, an intracellular signaling pathway, is involved in the development of ALI induced by LPS [ 31 , 32 ]. Similarly, our previous study also found abnormal accumulation of ROCK1 protein and increased expression of RhoA and Rock2 mRNA in the rat lung under exogenous endotoxin stimulation. Significantly higher mean optical density values of pulmonary perivascular ROCK1 protein were observed in rat lung sections. Small tidal volume ventilation reduces the degree of early lung injury in LPS rats, and the reason may be related to the inhibition of the RhoA/ROCK1 signaling pathway [ 9 ]. In vitro studies have found that cyclic stretch at a strain of 15% activates RhoA through the protein kinase activated receptor 1 pathway, causes cytoskeletal rearrangements, forms actin tension filaments, and increases endothelial permeability [ 33 , 34 ]. In this study, we showed that a strain of 20% of periodically pulled endothelial cells showed a time-dependent upregulation of Piezo1 expression, along with the activation of the intracellular RhoA / ROCK1 signaling pathway. The expression of ROCK was also upregulated in a timedependent manner. Interestingly, pretreatment with different concentrations of Yoda-1 (a Piezo1 selective agonist [18]) in cells activated Piezo1 channel activity, and the expression of ROCK1 also appeared tom be significantly upregulated, thus Piezo1 might act as an upstream regulatory molecule of the RhoA/Rock1 signaling pathway. To further test this hypothesis, we pretreated cells with siRNA to knockdown Piezo1 expression and found that the RhoA /ROCK1 signaling pathway was significantly inhibited, and the expression of ROCK1 also decreased significantly. Similarly, pretreatment with Piezo1 siRNA caused downregulation of ROCK1 expression in the presence of pre-activated cellular Piezo1 channel activity. We also further confirmed this result using GsMTx4, an endogenous cation channel inhibitor [35]. Conversely, when we pretreated endothelial cells with fasudil and Y27632 [36], which inhibit RhoA and Rock1 protein expression, Piezo1 expression did not show significant alterations, thus, Piezo1 might participate in VILI through the downstream activation of the RhoA / Rock1 signaling pathway. The Rho family of small G proteins is an important molecule in the regulation of intercellular adherens junctions and intracellular actin junctions, and plays an important regulatory role in pulmonary vascular endothelial barrier function [ 37 ]. A large amount of Ca2 + influx causes the intracellular Ca2 + concentration to become too high, which causes an inflammatory response and disrupts intercellular junctional junctions; and the Ca2 + influx also significantly upregulates Rho GTPase activity [ 38 , 39 ]. By contrast Piezo1 is a bona fide mechanosensitive ion channel protein in mammals and allows Ca2 + passage, and mediates remodeling of the cytoskeleton and stress alterations, representing a key element of the mechanotransduction process [ 40 – 42 ]. This may partly explain why Piezo1 is able to regulate the RhoA / Rock1 signaling pathway and is involved in ventilator-associated lung injury. In the present study, ventilator-associated lung injury was confirmed by histological analysis, in which HVMV was performed to induce ALI. In keeping with the pathogenesis of VILI, HVMV was confirmed by an increase in the water content and protein leakage in the lungs. GsMTx4 was used to inhibit Piezo1 channel activity, which significantly attenuated these abnormalities, indicating the therapeutic role of Piezo1 in VILI in rats. Our data demonstrate that pulmonary levels of pro-inflammatory cytokines increased markedly in rats that underwent HVMV, and that Piezo1 inhibition resulted in a decrease in the accumulation of these cytokines. Furthermore, although the 7-day survival rate of rats in the GSMTx4 group was not different to that in the sham group, inhibition of Piezo1 ultimately resulted in an improvement in the overall survival rate of the model rats. Thus, these findings are consistent with the above data. We must acknowledge the limitations of our study. One of the limitations was that the observation period was limited to 6 h, and for several chemicals involved in this study, the use of a larger concentration range was not adopted. Moreover, indicators of cellular electrophysiology were not assessed in this study, such as the ability to observe the concentration changes and flow of intracellular and extracellular Ca2 + in real time, which would have improved this study and thus require further investigation. Conclusions Using an HVMV-induced model of VILI in rats, we demonstrated that Piezo1 might have a role in VILI-induced pathological changes and apoptosis of endothelial and epithelial cells; the water content and protein leakage in lungs; the induction of systemic inflammatory mediators; and the 7-day mortality rate in rats. Furthermore, the results of the molecular analysis indicated that Piezo1 contributes to VILI by activating RhoA/ROCK1 in rats. Thus, Piezo1 might represent an effective therapeutic agent for the treatment of lung injury. Abbreviations MV: Mechanical ventilation; ALI: acute lung injury; ARDS: acute respiratory distress syndrome; HVMV: high tidal volume mechanical ventilation; PEEP:positive end-expiratory pressure; CS:cyclic stretch; BALF: bronchoalveolar lavage fluid; HPMEC:human pulmonary microvascular endothelial cell line; qRT-PCR: quantitative real-time reverse transcription PCR; ELISA, enzyme-linked immunosorbent assay. Declarations Ethics approval and consent to participate All experiments were performed in accordance with relevant guidelines and regulations. The study protocol was approved by the Animal Care and Use Committee of Yangzhou University (Yangzhou, China) and was in accordance with the guidelines for the care and use of animals set by the Chinese government. Consent for publication All list authors consent to the submission and all data are used with the consent of the person generating the data. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was supported by The National Natural Science Fund, China (81601679) and 333 Scientific Research Project of Jiangsu Province (BRA2018020). Authors' contributions Y.Z. and J.G. conceived and designed the research; Y.Z., L.J. and T.H. performed the experiments; D.L., S.Y. and L.W. analyzed the data; L.J., J.G., and T.H. interpreted the results; Y.Z. prepared the figures; Y.Z. and J.G. drafted the manuscript; J.G. approved the final version of the manuscript. Acknowledgments Not applicable. References Carrasco Loza R, Villamizar Rodriguez G, Medel Fernandez N: Ventilator-Induced Lung Injury (VILI) in Acute Respiratory Distress Syndrome (ARDS): Volutrauma and Molecular Effects. Open Respir Med J 2015, 9: 112-119. Vieillard-Baron A, Dreyfuss D: Ventilator-induced Lung Injury: Follow the Right Direction! Another Piece of the Puzzle in the Ventilator-induced Lung Injury Epic. Am J Respir Crit Care Med 2017, 196: 1366-1368. Gattinoni L, Protti A, Caironi P, Carlesso E: Ventilator-induced lung injury: the anatomical and physiological framework. Crit Care Med 2010, 38: S539-548. Miyamoto T, Mochizuki T, Nakagomi H, Kira S, Watanabe M, Takayama Y, Suzuki Y, Koizumi S, Takeda M, Tominaga M: Functional role for Piezo1 in stretch-evoked Ca(2)(+) influx and ATP release in urothelial cell cultures. J Biol Chem 2014, 289: 16565-16575. Cinar E, Zhou S, DeCourcey J, Wang Y, Waugh RE, Wan J: Piezo1 regulates mechanotransductive release of ATP from human RBCs. Proc Natl Acad Sci U S A 2015, 112: 11783-11788. Rode B, Shi J, Endesh N, Drinkhill MJ, Webster PJ, Lotteau SJ, Bailey MA, Yuldasheva NY, Ludlow MJ, Cubbon RM, et al: Piezo1 channels sense whole body physical activity to reset cardiovascular homeostasis and enhance performance. Nat Commun 2017, 8: 350. Albarran-Juarez J, Iring A, Wang S, Joseph S, Grimm M, Strilic B, Wettschureck N, Althoff TF, Offermanns S: Piezo1 and Gq/G11 promote endothelial inflammation depending on flow pattern and integrin activation. J Exp Med 2018, 215: 2655-2672. Yoo HY, Sung MK, Lee SH, Kim S, Lee H, Park S, Kim SC, Lee B, Rho K, Lee JE, et al: A recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma. Nat Genet 2014, 46: 371-375. Zhang Y, Gao J, Wang CJ, Zhou LJ, Fang XZ, Yang LQ: Low tidal volume ventilation preconditioning ameliorates lipopolysaccharide-induced acute lung injury in rats. Acta Anaesthesiol Scand 2016, 60: 780-789. Rafikov R, Dimitropoulou C, Aggarwal S, Kangath A, Gross C, Pardo D, Sharma S, Jezierska-Drutel A, Patel V, Snead C, et al: Lipopolysaccharide-induced lung injury involves the nitration-mediated activation of RhoA. J Biol Chem 2014, 289: 4710-4722. Dai H, Zhang S, Du X, Zhang W, Jing R, Wang X, Pan L: RhoA inhibitor suppresses the production of microvesicles and rescues high ventilation induced lung injury. Int Immunopharmacol 2019, 72: 74-81. Zhang C, Guo F, Chang M, Zhou Z, Yi L, Gao C, Huang X, Huan J: Exosome-delivered syndecan-1 rescues acute lung injury via a FAK/p190RhoGAP/RhoA/ROCK/NF-kappaB signaling axis and glycocalyx enhancement. Exp Cell Res 2019, 384: 111596. Huang T, Zhang Y, Wang C, Gao J: Propofol reduces acute lung injury by up-regulating gamma-aminobutyric acid type a receptors. Exp Mol Pathol 2019, 110: 104295. Tschumperlin DJ, Margulies SS: Equibiaxial deformation-induced injury of alveolar epithelial cells in vitro. Am J Physiol 1998, 275: L1173-1183. Kozian A, Schilling T, Freden F, Maripuu E, Rocken C, Strang C, Hachenberg T, Hedenstierna G: One-lung ventilation induces hyperperfusion and alveolar damage in the ventilated lung: an experimental study. Br J Anaesth 2008, 100: 549-559. Zhang Y, Huang T, Jiang L, Gao J, Yu D, Ge Y, Lin S: MCP-induced protein 1 attenuates sepsis-induced acute lung injury by modulating macrophage polarization via the JNK/c-Myc pathway. Int Immunopharmacol 2019, 75: 105741. Green TP, Johnson DE, Marchessault RP, Gatto CW: Transvascular flux and tissue accrual of Evans blue: effects of endotoxin and histamine. J Lab Clin Med 1988, 111: 173-183. Syeda R, Xu J, Dubin AE, Coste B, Mathur J, Huynh T, Matzen J, Lao J, Tully DC, Engels IH, et al: Chemical activation of the mechanotransduction channel Piezo1. Elife 2015, 4 . Coste B, Xiao B, Santos JS, Syeda R, Grandl J, Spencer KS, Kim SE, Schmidt M, Mathur J, Dubin AE, et al: Piezo proteins are pore-forming subunits of mechanically activated channels. Nature 2012, 483: 176-181. Nonomura K, Lukacs V, Sweet DT, Goddard LM, Kanie A, Whitwam T, Ranade SS, Fujimori T, Kahn ML, Patapoutian A: Mechanically activated ion channel PIEZO1 is required for lymphatic valve formation. Proc Natl Acad Sci U S A 2018, 115: 12817-12822. Young CC, Harris EM, Vacchiano C, Bodnar S, Bukowy B, Elliott RRD, Migliarese J, Ragains C, Trethewey B, Woodward A, et al: Lung-protective ventilation for the surgical patient: international expert panel-based consensus recommendations. Br J Anaesth 2019, 123: 898-913. Zhou XL, Wei XJ, Li SP, Ma HL, Zhao Y: Lung-protective ventilation worsens ventilator-induced diaphragm atrophy and weakness. Respir Res 2020, 21: 16. Tana M, Polglase GR, Cota F, Tirone C, Aurilia C, Lio A, Ricci C, Romagnoli C, Vento G: Determination of Lung Volume and Hemodynamic Changes During High-Frequency Ventilation Recruitment in Preterm Neonates With Respiratory Distress Syndrome. Crit Care Med 2015, 43: 1685-1691. Liang GP, Xu J, Cao LL, Zeng YH, Chen BX, Yang J, Zhang ZW, Kang Y: Piezo1 induced apoptosis of type II pneumocytes during ARDS. Respir Res 2019, 20: 118. Friedrich EE, Hong Z, Xiong S, Zhong M, Di A, Rehman J, Komarova YA, Malik AB: Endothelial cell Piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions. Proc Natl Acad Sci U S A 2019, 116: 12980-12985. Gawlak G, Son S, Tian Y, O'Donnell JJ, 3rd, Birukov KG, Birukova AA: Chronic high-magnitude cyclic stretch stimulates EC inflammatory response via VEGF receptor 2-dependent mechanism. Am J Physiol Lung Cell Mol Physiol 2016, 310: L1062-1070. Gottlieb PA, Sachs F: Piezo1: properties of a cation selective mechanical channel. Channels (Austin) 2012, 6: 214-219. Pairet N, Mang S, Fois G, Keck M, Kuhnbach M, Gindele J, Frick M, Dietl P, Lamb DJ: TRPV4 inhibition attenuates stretch-induced inflammatory cellular responses and lung barrier dysfunction during mechanical ventilation. PLoS One 2018, 13: e0196055. Hamanaka K, Jian MY, Townsley MI, King JA, Liedtke W, Weber DS, Eyal FG, Clapp MM, Parker JC: TRPV4 channels augment macrophage activation and ventilator-induced lung injury. Am J Physiol Lung Cell Mol Physiol 2010, 299: L353-362. Bogatcheva NV, Zemskova MA, Kovalenkov Y, Poirier C, Verin AD: Molecular mechanisms mediating protective effect of cAMP on lipopolysaccharide (LPS)-induced human lung microvascular endothelial cells (HLMVEC) hyperpermeability. J Cell Physiol 2009, 221: 750-759. Tasaka S, Koh H, Yamada W, Shimizu M, Ogawa Y, Hasegawa N, Yamaguchi K, Ishii Y, Richer SE, Doerschuk CM, Ishizaka A: Attenuation of endotoxin-induced acute lung injury by the Rho-associated kinase inhibitor, Y-27632. Am J Respir Cell Mol Biol 2005, 32: 504-510. Li Y, Wu Y, Wang Z, Zhang XH, Wu WK: Fasudil attenuates lipopolysaccharide-induced acute lung injury in mice through the Rho/Rho kinase pathway. Med Sci Monit 2010, 16: BR112-118. Birukova AA, Chatchavalvanich S, Rios A, Kawkitinarong K, Garcia JG, Birukov KG: Differential regulation of pulmonary endothelial monolayer integrity by varying degrees of cyclic stretch. Am J Pathol 2006, 168: 1749-1761. Shikata Y, Rios A, Kawkitinarong K, DePaola N, Garcia JG, Birukov KG: Differential effects of shear stress and cyclic stretch on focal adhesion remodeling, site-specific FAK phosphorylation, and small GTPases in human lung endothelial cells. Exp Cell Res 2005, 304: 40-49. Bowman CL, Gottlieb PA, Suchyna TM, Murphy YK, Sachs F: Mechanosensitive ion channels and the peptide inhibitor GsMTx-4: history, properties, mechanisms and pharmacology. Toxicon 2007, 49: 249-270. Hamano T, Shirafuji N, Yen SH, Yoshida H, Kanaan NM, Hayashi K, Ikawa M, Yamamura O, Fujita Y, Kuriyama M, Nakamoto Y: Rho-kinase ROCK inhibitors reduce oligomeric tau protein. Neurobiol Aging 2020, 89: 41-54. Spindler V, Schlegel N, Waschke J: Role of GTPases in control of microvascular permeability. Cardiovasc Res 2010, 87: 243-253. Kandasamy K, Bezavada L, Escue RB, Parthasarathi K: Lipopolysaccharide induces endoplasmic store Ca2+-dependent inflammatory responses in lung microvessels. PLoS One 2013, 8: e63465. Limanjaya I, Hsu TI, Chuang JY, Kao TJ: L-selectin activation regulates Rho GTPase activity via Ca(+2) influx in Sertoli cell line, ASC-17D cells. Biochem Biophys Res Commun 2020, 525: 1011-1017. Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, Patapoutian A: Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Science 2010, 330: 55-60. Nourse JL, Pathak MM: How cells channel their stress: Interplay between Piezo1 and the cytoskeleton. Semin Cell Dev Biol 2017, 71: 3-12. Zhao Q, Wu K, Geng J, Chi S, Wang Y, Zhi P, Zhang M, Xiao B: Ion Permeation and Mechanotransduction Mechanisms of Mechanosensitive Piezo Channels. Neuron 2016, 89: 1248-1263. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 29 Jun, 2021 Review # 2 received at journal 28 Jun, 2021 Reviewer # 2 agreed at journal 22 Jun, 2021 Review # 1 received at journal 07 Jun, 2021 Reviews received at journal 06 Jun, 2021 Reviewers invited by journal 06 Jun, 2021 Reviewer # 1 agreed at journal 06 Jun, 2021 Editor invited by journal 29 May, 2021 Editor assigned by journal 23 May, 2021 Submission checks completed at journal 23 May, 2021 First submitted to journal 23 May, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-555235","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":31767832,"identity":"447f0c93-704b-4731-8712-eb78df1d2c1e","order_by":0,"name":"Yang Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIie2PsWrDMBRFnzDIyyvq+ExK/QvqXEN+xSYQLxkKXTLGGF6WePdvZMtoI+jkD2jpYi+dOqRbAqFUabdC5YwddAYNkg73XgCP518iin6/JJTxUPQ/N+mYEpR3dZfcKJiV+kIl5MkVz5NolTNdpMR1ZlOkQd20vDycDKhwoeG4cyypM7sFrdIW/FKxgWjzrkXVOZbQOYWsYgS/ipUB/bzQgeC/FUkZT+x/1E+CH8EWm44p+K2kc4w2ggOQNoVGFMLBFmsSVCTKqOIcqXt7aCuHEq/zof/4pKmkcNgfTve3aj3b9keHAtfpr6bno3EIAMr97PF4PB6AL5STU4awLyzNAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-5760-8904","institution":"Second Xiangya Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Zhang","suffix":""},{"id":31767833,"identity":"43059160-f87d-4896-b4cc-69bc3ebeb29a","order_by":1,"name":"Lulu Jiang","email":"","orcid":"","institution":"Second Xiangya Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lulu","middleName":"","lastName":"Jiang","suffix":""},{"id":31767834,"identity":"91626125-e113-4750-89c8-0a4d47b2d81e","order_by":2,"name":"Tianfeng Huang","email":"","orcid":"","institution":"Yangzhou University Affiliated Northern Jiangsu People's Hospital: Northern Jiangsu People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tianfeng","middleName":"","lastName":"Huang","suffix":""},{"id":31767835,"identity":"1b434f43-0272-42e3-b8b7-0acc789a5e51","order_by":3,"name":"Dahao Lu","email":"","orcid":"","institution":"Yangzhou University Affiliated Northern Jiangsu People's Hospital: Northern Jiangsu People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dahao","middleName":"","lastName":"Lu","suffix":""},{"id":31767836,"identity":"63ae3a82-f5e0-4c14-95ce-c79a0683e876","order_by":4,"name":"Yue Song","email":"","orcid":"","institution":"Yangzhou University Affiliated Northern Jiangsu People's Hospital: Northern Jiangsu People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Song","suffix":""},{"id":31767837,"identity":"6bc549dc-6095-405f-8df8-d0c456a589d0","order_by":5,"name":"Lihui Wang","email":"","orcid":"","institution":"Yangzhou University Affiliated Northern Jiangsu People's Hospital: Northern Jiangsu People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lihui","middleName":"","lastName":"Wang","suffix":""},{"id":31767838,"identity":"bb69cff1-eede-40b2-83e5-f93ad13651e1","order_by":6,"name":"Ju Gao","email":"","orcid":"","institution":"Yangzhou University Affiliated Northern Jiangsu People's Hospital: Northern Jiangsu People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ju","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2021-05-23 17:33:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-555235/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-555235/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":10177291,"identity":"cb195045-075d-4c29-a4c7-796c9f834de7","added_by":"auto","created_at":"2021-06-09 20:49:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6999656,"visible":true,"origin":"","legend":"Piezo1 expression was increased in the lungs after high tidal volume mechanical ventilation. (A-D) Representative photomicrographs of lung tissues with H\u0026E staining (original magnification ×40) in rats in sham, HVMV 2 h, 4 h, and 6h groups. (E) Semi-quantitative analysis of lung tissues based on the lung injury score and (F) oxygenation index (PaO2/FiO2) in the above groups (n = 6).(G) Quantitative analysis of Piezo1 mRNA expression using qRT-PCR in the above groups rats(n = 3).(H) Western blotting and quantitative analysis of Piezo1 protein levels in the above groups of rats (n = 3). (I) Representative immunocytochemical images in rats in the sham and HVMV 6 h groups. Piezo1, and DAPI were used as markers for Piezo1 protein expression and nuclei, respectively. Scale bar = 50 μm. Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the sham group. ","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/d00cdaa21087e854274a86c4.png"},{"id":10177266,"identity":"21f4776d-c7c7-4659-aaf1-30da6df6b8bf","added_by":"auto","created_at":"2021-06-09 20:46:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1419226,"visible":true,"origin":"","legend":"Piezo1 expression and cell apoptosis both increased in CS-treated cells. Apoptosis of A549(A) and HPMECs (B) assessed by flow cytometry to detect Annexin V/FITC staining. (C-D) The relative apoptosis ratio was calculated using Annexin V-positive apoptotic cells (n = 3). (E) Quantitative analysis of Piezo1 mRNA expression by qRT-PCR in CS-treated cells (n = 3). (F) Western blotting and quantitative analysis of Piezo1 protein levels in CS-treated cells (n = 3). Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the sham group. ","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/2c2f37f92962fd4812d2ada7.png"},{"id":10177270,"identity":"5aa544f7-0df6-4771-9eea-b3d4792fff2a","added_by":"auto","created_at":"2021-06-09 20:46:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2404457,"visible":true,"origin":"","legend":"Increased Piezo1 activated the RhoA/ROCK1 pathway in CS-treated HPMECs. (A) Western blotting showing Piezo1, ROCK1, RhoA, and GAPDH levels in the sham, CS 2h, 4h, and 6h cells. (B) Quantitative analysis of Piezo1 mRNA expression using qRT-PCR in CS-treated cells (n = 3). (C) Quantitative analysis of Piezo1 protein levels in CS-treated cells (n = 3). (D) Active GTP-RhoA was assessed using a pull-down assay after CS treatment (n = 3). (E) Quantitative analysis of ROCK1 mRNA expression by qRT-PCR in CS-treated cells (n = 3). (F) Quantitative analysis of ROCK1 protein levels in CS-treated cells (n = 3). (G) Quantitative analysis of ROCK1 mRNA expression using qRT-PCR in Yoda1-treated cells (n = 3). (H) Representative immunocytochemical images in HPMECs. Piezo1, and DAPI were used as markers for Piezo1 protein expression and nuclei, respectively. Scale bar = 50 μm. Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the sham group. ","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/42ccaa2a55ec36e6c606debb.png"},{"id":10177268,"identity":"e9fd3fda-3434-44b0-8f62-43c83e509338","added_by":"auto","created_at":"2021-06-09 20:46:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":547254,"visible":true,"origin":"","legend":"Blocking increased Piezo1 expression inhibited RhoA/ROCK1 pathway activation in CS-treated HPMECs. (A) Western blotting showed Piezo1, ROCK1, RhoA, and GAPDH levels in ad-scramble+sham, ad-scramble+CS, ad-siRNA+CS, and ad-siRNA+sham cells. Quantitative analysis of Piezo1 (B) and ROCK1 (E) mRNA expression using qRT-PCR in the above cells (n = 3). Quantitative analysis of Piezo1 (C) and ROCK1 (F) protein levels in the above cells (n = 3). (D) Active GTP-RhoA was assessed using a pull-down assay in the above cells (n = 3). (G) Quantitative analysis of ROCK1 mRNA expression using qRT-PCR in the sham, ad-Yoda1, ad-Yoda1+siRNA, and ad-siRNA cells (n = 3). (H) Quantitative analysis of ROCK1 mRNA expression using qRT-PCR in sham, CS, ad-GSMTx4+CS, and ad-GSMTx4 cells (n = 3). Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the sham group and #P \u003c 0.05, ##P \u003c 0.01 versus the scramble+CS or Yoda1 group.","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/ec338ee583f82a0df520e5d5.png"},{"id":10177445,"identity":"eeb68a99-017d-4c20-8e7e-647db2c43364","added_by":"auto","created_at":"2021-06-09 20:52:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":618184,"visible":true,"origin":"","legend":"Inhibition of the RhoA/ROCK1 pathway did not affect the expression of Piezo1 in HPMECs. (A) Western blotting showed Piezo1, RhoA, and GAPDH levels in sham, CS, ad-fasudil+CS, and ad-fasudil cells. Quantitative analysis of RhoA (B) and Piezo1 (C) protein levels in the above cells (n = 3). (D) Western blotting showing ROCK1, Piezo1 and GAPDH level in sham, CS, ad-Y27632+CS, and ad-Y27632 cells. Quantitative analysis of ROCK1 (E) and Piezo1(G) protein levels in the above cells (n = 3).Quantitative analysis of ROCK1 (F) and Piezo1 (H) mRNA expression using qRT-PCR in above cells (n = 3). Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the sham group and #P \u003c 0.05, ##P \u003c 0.01 versus the CS group. ","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/e4e3b14eb2c86029dd7ea06d.png"},{"id":10177293,"identity":"ceebdc34-130b-4d9f-9ccb-e9d3d8d0caea","added_by":"auto","created_at":"2021-06-09 20:49:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3683861,"visible":true,"origin":"","legend":"Blocking increased Piezo1 expression attenuates VILI and improves survival in rats. (A-D) Representative photomicrographs of lung tissues with H\u0026E staining (original magnification × 40) in rats in the vehicle+sham, vehicle+VILI, GSMTx4+VILI, and GSMTx4+sham groups. (E) Semi-quantitative analysis of lung tissues based on the lung injury score (n = 6). (F) Lung edema determined based on the wet-to-dry lung weight ratio (n = 3), and (G) protein leakage from capillaries measured by Evans blue dye extravasation in rats (n = 6). (H) The levels of TNF-α, IL-1β, IL-6, and MCP-1 in BALF, as determined by ELISA (n = 6). (E) Survival rate of rats in the above groups (n = 10). Data are shown as the mean ± SEM. *P \u003c 0.05, **P \u003c 0.01 versus the vehicle+sham group and #P \u003c 0.05, ##P \u003c 0.01 versus the vehicle+VILI group. ","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/9661572208d91e97eb0d2a97.png"},{"id":13697801,"identity":"e1537eb5-ff87-41b0-817d-fd427ed23902","added_by":"auto","created_at":"2021-09-17 13:11:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4392242,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-555235/v1/46ca1366-de88-4465-a5ac-4fabc0caa00d.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eMechanosensitive Cation Channel Piezo1 Contributes To Ventilator-Induced Lung Injury By Activating RhoA/ROCK1 In Rats\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eMechanical ventilation (MV) is a common method of respiratory support during clinical anesthesia. In many critical diseases, especially acute lung injury (ALI) and acute respiratory distress syndrome (ARDS), MV is an important means of first aid and respiratory treatment. However, in recent years, people have gradually realized that MV is a double-edged sword. MV itself can also induce or aggravate the injury of important target organs. For example, the incidence of ventilator-induced lung injury (VILI), also known as mechanical ventilation related lung injury [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], accounted for 22\u0026ndash;39% of mechanical ventilation, and the incidence of patients with lung disease could be as high as 83% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Unfortunately, ALI and ARDS-related mortality is very high, and prevention or treatment measures are still limited, possibly because of the complex and unclear pathogenesis of ALI. Therefore, understanding the pathological mechanisms of lung injury is imperative to develop prevention and treatment strategies for ALI.\u003c/p\u003e \u003cp\u003ePiezo1 is a mechanosensitive ion channel protein in mammals that can be directly activated by mechanical stimuli, and can transduce mechanical signals into biological signals by mediating Ca2\u0026thinsp;+\u0026thinsp;influx, which in turn regulates vascular development, erythrocyte volume, and urothelial cell tone [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Endothelial-expressed Piezo1 can sense disturbed blood flow and is linked to inflammatory signaling and atherosclerosis progression [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. As a specific mechanosensitive protein, whether Piezo1 plays an important role in the occurrence of VILI is not clear\u003c/p\u003e \u003cp\u003eRhoA is a small GTPase protein in the Rho family that is primarily associated with cytoskeleton regulation, mostly actin organization and actomyosin contractility [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Our previous study found that the RhoA/Rho associated coiled-coil containing protein kinase (ROCK) signaling pathway was activated and the expression levels of its members was significantly upregulated in the lung tissues of septic rats [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Similarly, it was reported that RhoA activation is involved in lipopolysaccharide-mediated endothelial barrier dysfunction in ALI mice [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Further study showed that inhibition of RhoA could rescue high ventilation and lipopolysaccharide induced lung injury significantly [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. All the above studies confirmed the critical role of the RhoA/ROCK signaling pathway in ALI; however, the upstream regulatory mechanisms are not fully determine and require further study.\u003c/p\u003e \u003cp\u003eIn the present study, the role of Piezo1 in VILI was investigated. The findings of both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e experiments demonstrated that Piezo1 expression is required for the high tidal volume ventilation-induced lung injury in rats and this process likely acts through regulating the RhoA/ROCK pathway.\u003c/p\u003e "},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimal preparation \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdult male Sprague\u0026ndash;Dawley rats (250\u0026ndash;300 g) were purchased from the Animal Center of the School of Medicine, Yangzhou University. The rats were housed in air-filtered rooms and were given\u003cem\u003e ad libitum\u003c/em\u003e access to food and water. Animals were housed at a constant temperature (20\u0026ndash;24 \u0026deg;C) and constant humidity (50\u0026ndash;70%) with a 12/12-h light/dark cycle. The study protocol was approved by the Animal Care and Use Committee of Yangzhou University (Yangzhou, China) and was in accordance with the guidelines for the care and use of animals set by the Chinese government.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental procedure and animal model of VILI\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLung injury was induced in the rats using high tidal volume mechanical ventilation (HVMV), based on a previously published VILI model [13]. Briefly, all animals were anesthetized via an intraperitoneal injection of pentobarbital sodium (40 mg/kg, Merck, Darmstadt, Germany). After induction of anesthesia, the rats underwent an oral endotracheal intubation with a 16 G trocar and were ventilated for hours in a volume-controlled ventilation mode (DW 3000, Zhenghua Biologic, Anhui Province, China). Animals were ventilated with a high tidal volume (Vt) of 22 ml/kg and zero positive end-expiratory pressure (PEEP) at a respiratory rate of 16\u0026ndash;18 breaths/min, whereas control (sham) rats were ventilated with a Vt of 6 ml/kg and PEEP of 5 cm H\u003csub\u003e2\u003c/sub\u003eO at a rate of 45\u0026ndash;55 breaths/min. The fraction of inspired oxygen (FiO2) remained constant at 0.21. The rats were placed in the supine position on a heating blanket and under a heating lamp, to ensure a body temperature of 37 \u0026deg;C throughout the experiment. A polyethylene catheter was placed in the femoral artery to monitor mean arterial pressure and heart rate, as well as for blood sampling. The arterial catheter was infused with physiological saline at 0.5 mL/h and anesthesia was maintained by additional injections (15 mg/kg, i.p.) administered every hour under hemodynamic monitoring. After mechanical ventilation, the rats were returned to their cages and provided food and water \u003cem\u003ead libitum\u003c/em\u003e. 10 \u0026mu;g of GsMTx4 (dissolved in 0.2 mL of saline) or vehicle was injected via arterial supply of the hindlimb for thirty minutes before the VILI procedure. Rats were killed by heart bloodletting 6 h after administration of ventilation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human alveolar epithelial cell line (A549) and the human pulmonary microvascular endothelial cell line (HPMEC) were purchased from the BNCC Biotechnology Research Institute (Beijing, China). The cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM)and M199 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 \u0026mu;g/ml streptomycin at 37 \u0026deg;C in an atmosphere of 95% air and 5% CO\u003csub\u003e2\u003c/sub\u003e. When the cells reached 80% confluence, they were seeded into 24-well or 6-well plates for further experiments. For small interfering RNA (siRNA) transfection, the \u003cem\u003ePiezo1\u003c/em\u003e siRNA (Thermo Fisher Scientific, Waltham, MA, USA) and its negative control siRNA (Invitrogen) were transfected into the cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s instructions. Three days later, the cells were collected. HPMEC monolayers were pre-treated with different concentration of Yoda-1 (Tocris/BioTechne, Bristol, UK), 5 \u0026mu;M GSMTx4, 10 \u0026mu;M Y-27632 or fasudil (Merck Millipore, Burlington, MA, USA) for 24 h before cell deformation or collection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell deformation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell deformation was achieved by stretching with a Flexercell Tension Plus\u0026auml; FX-4000T system (Flexcell International, Burlington, NC, USA) equipped with a loading station, which was designed to provide uniform strain to the cultured cells. The vacuum pressure was controlled by the computer, allowing cell monolayers to receive different levels of elongation. These deformations were selected as previously described [14]. Briefly, cells were seeded at 2.0 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e on type I collagen-coated flexible bottom BioFlex plates (Flexcell international) and allowed to reach 50% confluence after 24 h. Then, the culture medium was changed to serum-deprived medium in each plate and the experimental plates with monolayer cell were mounted onto the Flexcell system. Cells were then exposed to cyclic stretch (CS) of high magnitude (20% elongation) for different durations (0\u0026ndash;6 h) with a frequency of 15 cycles/min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometric analysis of cell apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the time-dependent effects of CS on cell apoptosis, the cells after CS exposures were stained with FITC-conjugated Annexin V and propidium iodide (PI) following manufacturer\u0026rsquo;s instructions (KeyGEN Biotech Co. Ltd, China) and was analyzed by flow cytometry (Beckman Coulter Co, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of water content and histological examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the severity of lung injury, ventilator-induced pulmonary edema was assessed based on the wet-to-dry weight ratio of the lung. The right upper lobe of each lung was weighed immediately after extraction and placed in a 60 \u0026deg;C oven for 72 h. The dried tissue was then weighed to determine the wet-to-dry weight ratio. Samples from the inferior lobe of the right lung were fixed in 4% paraformaldehyde solution, dehydrated sequentially in 50% to 100% alcohol, and treated with xylene solution. Then, the tissues were embedded in paraffin, sectioned (thickness, 6 \u0026mu;m), and stained with hematoxylin and eosin (H\u0026amp;E). The samples were assigned an injury score for each of these four categories: Alveolar and interstitial edema, microhemorrhage, inflammatory infiltration, and microatelectasis or alveolar overdistension. The injury scores were assigned as follows: 0, absent with normal appearance; 1, slight; 2, intermediate; and 3, severe [9, 15, 16]. The lung injury score was calculated by adding the individual injury scores for each category. The scoring was performed by a pathologist who was blinded to the data, using a light microscope (\u0026times;40, Olympus, Tokyo, Japan) to view the stained tissue samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein leakage from capillaries\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePulmonary microvascular permeability was determined using the Evans blue dye extravasation method at 6 h after MV. Evans blue dye (30 mg/kg, Sigma-Aldrich, St. Louis, MO, USA) was administered intravenously at 30 min before the rats were sacrificed. Lungs were perfused to remove blood and extracted. The dye content in lung the tissue was determined spectrophotometry at an optical density of 620 nm [17].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter animals were deeply anesthetized with pentobarbital sodium, they were perfused with 100\u0026ndash;300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The lung was harvested and post-fixed at 4 ℃ for 24 h. The lung tissues were embedded in Tissue-Tek (optimal cutting temperature (OCT) compound; SAKURA Finetek, Tokyo, Japan) and frozen in liquid nitrogen for the preparation of cryosections. Frozen lung tissues were cut to a thickness of 20 \u0026mu;m. After being blocked with phosphate-buffered saline (PBS) containing 10% goat serum and 0.3% Triton X-100 for 1\u0026ndash;2 h at 37 ℃, the sections were incubated overnight at 4 ℃ with rabbit anti-Piezo1 (1:300, ProteinTech Group, Rosemont, IL, USA). The sections were then incubated with goat anti-rabbit IgG conjugated with Cy3 (1:500, Jackson ImmunoResearch, West Grove, PA, USA) for 1 h at room temperature. The sections were finally mounted using Vectashield plus 4', 6-diamidino-2-phenylindole (DAPI) mounting medium (Vector Laboratories, Burlingame, CA, USA). HPMEC cells were fixed in 4% paraformaldehyde, and then incubated with anti-Piezo1 antibody (1:400) overnight at 4 \u0026deg;C. After washing five times with PBS, the cells were incubated with Cy3 (1:500) for 1 h at room temperature. Then, the cells were washed with PBS again five times for 1 h before being stained using DAPI for 2 min. After three further washes, the dishes were observed under a fluorescence microscope. All images were observed using a Leica DMI4000 fluorescence microscope and captured with a DFC365FX camera (Leica, Wetzlar, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBronchoalveolar lavage fluid (BALF) was collected and centrifuged at 6 h after MV was performed. The concentrations of tumor necrosis factor alpha (TNF-\u0026alpha;), interleukin (IL)-1\u0026beta;, IL-6, and monocyte chemotactic protein 1 (MCP-1) were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer\u0026rsquo;s instructions (R\u0026amp;D Systems, Minneapolis, MN, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003cstrong\u003eanalysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLung tissues were homogenized and the cultured cells ultrasonicated in chilled lysis buffer (10 mM Tris, 1 mM phenylmethylsulfonyl fluoride, 5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, 40 \u0026mu;M leupeptin, 250 mM sucrose). Approximately 10% of the homogenates (by volume) were used to determine total protein levels. The remained was centrifuged at 4 \u0026deg;C for 15 min at 1000 \u0026acute; \u003cem\u003eg\u003c/em\u003e. The supernatant was collected as cytosolic proteins. After the concentrations of the proteins were measured using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA), equal amounts of total proteins were heated at 99 \u0026deg;C for 5 min and loaded onto a 4\u0026ndash;15% stacking/7.5% separating SDS‑polyacrylamide gel (Bio-Rad). The proteins were then electrophoretically transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membrane was blocked for 2 h at room temperature, and then incubated at 4 \u0026deg;C overnight with the following primary antibodies: rabbit anti-synaptotagmin binding cytoplasmic RNA interacting protein (Syncrip) (1:1000; ProteinTech Group), rabbit anti-RhoA (1:5000; Abcam, Cambridge, MA, USA), rabbit anti-ROCK1 (1:1000; Abcam), and rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:2000; Sigma). The proteins were detected using horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:3000; Jackson ImmunoResearch), and exposed using the ChemiDoc XRS System with Image Lab software (Bio-Rad). The intensity of immunoreactive protein bands was quantified using densitometry with the Image Lab software (Bio-Rad).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRhoA activity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eActive GTP-bound RhoA was detected in lysates collected from cells subjected to a pull‑down assay using a RhoA activation assay kit (Abcam) according to manufacturer\u0026rsquo;s indications. Briefly, supernatants were incubated with an anti-active RhoA Rabbit monoclonal antibody and protein A/G Agarose bead slurry at 4\u0026thinsp;\u0026deg;C (\u0026times;1\u0026thinsp;h) on a rotator. Bead-precipitated proteins were fractionated and immunoblotted using antibodies against RhoA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time reverse transcription-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLung tissues and cells were collected rapidly and pooled together to achieve sufficient RNA. Total RNA was extracted using a miRNeasy kit (Qiagen, Valencia, CA, USA) according to manufacturer\u0026rsquo;s instructions. Reverse-transcription to cDNA was achieved using ThermoScript Reverse Transcriptase (Invitrogen/Thermo Fisher Scientific) with oligo (dT) primers (Invitrogen/Thermo Fisher Scientific). The cDNA was then used in a quantitative real-time PCR amplification consisting of 30 s at 95 \u0026deg;C, 30 s at 60 \u0026deg;C, and 30 s at 72 \u0026deg;C for 40 cycles. Tubulin was used as an internal control. Relative changes of mRNA levels were calculated by using the △Ct method (2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e). The primers used in this study were as follows:\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePiezo1\u003c/em\u003e Forward: 5\u0026rsquo;- GGACTCTCGCTGGTCTACCT-3\u0026rsquo;;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePiezo1 \u003c/em\u003eReverse: 5\u0026rsquo;- GGGCACAATATGCAGGCAGA -3\u0026rsquo;;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eROCK1\u003c/em\u003e Forward: 5\u0026rsquo;- GACTGGGGACAGTTTTGAGAC-3\u0026rsquo;;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eROCK1 \u003c/em\u003eReverse: 5\u0026rsquo;- GGGCATCCAATCCATCCAGC-3\u0026rsquo;;\u003c/p\u003e\n\u003cp\u003eTubulin Forward: 5\u0026rsquo;-GCCTTCTGAGAGAGTTAAG-3\u0026rsquo;;\u003c/p\u003e\n\u003cp\u003eTubulin Reverse: 5\u0026rsquo;-AGACTGGACCACCGGAGA-3\u0026rsquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSurvival curves\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo observe the effect of Piezo1 on survival, 40 rats were randomly divided into four experimental groups as described earlier (n = 10 per group). Survival was assessed every day until the endpoint of 7 days. Survival data were analyzed using log-rank or \u0026chi;2 tests. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are presented as the mean \u0026plusmn; SEM. The data were analyzed statistically using two-tailed, unpaired Student\u0026rsquo;s t tests and a one-way or two-way analysis of variance (ANOVA). When ANOVA showed a significant difference, pairwise comparisons between means were tested using the post hoc Tukey method (Sigma-Aldrich, Plot 12.5). P \u0026lt; 0.05 was considered statistically significant in all analyses.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePiezo1 expression was increased in the lungs after \u003c/strong\u003e\u003cstrong\u003ehigh tidal volume mechanical ventilation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePhotomicrographs showed that, compared with that in the sham group, different degrees of lung tissue injury occurred at 2, 4, and 6 h after HVMV, and the following effects were seen: Infiltration of inflammatory cells into the lung interstitium and alveolar spaces; thickening of alveolar walls; and intra-alveolar exudation (Fig. 1A\u0026ndash;D). Semi-quantitative assessment using a lung injury score demonstrated that the degree of lung injury in the HVMV groups was higher than that in the sham group (Fig. 1E), and the ratio of PaO2/FiO2 in the HVMV groups was lower than that in sham group (Fig. 1F). To explore the potential role of Piezo1 in acute lung injury, we examined whether Piezo1 expression was altered in the lung following HVMV. The expression of Piezo1 mRNA and protein increased in a time-dependently manner in the lungs at 2, 4, and 6 h after HVMV (Fig. 1G and H), which was consistent with the observations from the western blotting analysis above. Immunofluorescence images showed that the expression of Piezo1 in rat lung tissue increased significantly increased at 6 h after HVMV (Fig. 1I).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePiezo1 expression and cell apoptosis both increased in CS-treated cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnnexin V binding and propidium iodide (PI) staining were used for cell apoptosis analysis, and a series of the representative plots of the flow cytometry analysis were presented (Fig. 2A and B). The results showed that the apoptosis rate increased in a time-dependent manner following CS treatment, and apoptosis was significantly increased in A549 cells and HPMECs compared with that in the sham group after 6\u0026thinsp;h (Fig. 2C and D). Besides, the expression of Piezo1 mRNA and protein were also time dependently increased in A549s cells after CS (Fig. 2E and F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIncreased Piezo1 activated the RhoA/ROCK1 pathway in CS-treated HPMECs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHow did increased Piezo1 participate in VILI? We further examined whether Piezo1 expression was altered in HPMECs following CS. The expression of Piezo1 mRNA and protein increased in a time-dependent manner in CS-treated HPMECs (Fig. 3A\u0026ndash;C). We also determined whether the Rho pathway might act on the CS-treated HPMECs. GTP‑bound (active) RhoA in cells was measured using a RhoA activity assay, and total‑RhoA was examined using western blotting. The results demonstrated that the levels of GTP-bound RhoA increased in a time-dependent manner following CS of different durations (Fig. 3A and D). Similar results were also obtained for its downstream effectors. The expression of ROCK1 mRNA and its protein increased in a time-dependent manner following CS (Fig. 3E and F). To confirm this result, we used different concentrations of Yoda1, a Piezo1 agonist, to stimulate cells, which conformed Yoda1 as a Piezo1 selective agonist [18, 19]. To minimize the toxicity and side effects of Yoda1, a low dose of the agonist was used (~5 \u0026mu;M), this represents a moderate stimulus, because the EC50 of Yoda1 activation of Piezo1 is \u0026sim;25 \u0026mu;M [20]. As expected, the level of \u003cem\u003eROCK1\u003c/em\u003e mRNA increased in a time-dependent manner in Yoda1-treated cells (Fig. 3G). Finally, immunohistochemistry revealed the expression of Piezo1 in HPMECs (Fig. 3H).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlocking the increase in Piezo1 inhibited RhoA/ROCK1 pathway activation in CS-treated HPMECs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe next investigated whether blocking the CS-induced increase in Piezo1 through Piezo1-specific siRNA transfection into the HPVECs changed the RhoA/ROCK1 pathway status; a control scrambled siRNA was used as a control. The level of Piezo1 mRNA and protein increased significantly in scrambled siRNA-treated HPVECs following CS for 6 h (Fig. 4A\u0026ndash;C). However, this increase was not seen in the\u003cem\u003e Piezo1\u003c/em\u003e siRNA-treated cells (Fig. 4A\u0026ndash;C). Neither of the siRNAs altered the basal expression of Piezo1 in the sham cells. We also found that transfection with\u003cem\u003e Piezo1\u003c/em\u003e siRNA affected CS-induced RhoA/ROCK1 pathway activation, as revealed by increases in the levels of GTP-bound RhoA and ROCK1 in the scrambled siRNA-treated cells following CS for 6h compared with those in the sham group (Fig. 4D\u0026ndash;F). These increases were absent in the\u003cem\u003e Piezo1 \u003c/em\u003esiRNA-treated cells (Fig. 4D\u0026ndash;F). Moreover, \u003cem\u003ePiezo1 \u003c/em\u003esiRNA pretreatment also reduced the increased ROCK1 induced by Yoda-1(Fig. 4G). For confirmation, we used GSMTx4 (an inactivated non-selective cationic MSC inhibitor) to inhibit Piezo1 activity. GSMTx4 pretreatment could effectively reduce the expression of ROCK1 induced by CS in cells (Fig. 4H).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of the RhoA/ROCK1 pathway did not affect the expression of Piezo1 in HPMECs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further verify the possible correlation of Piezo1 and the RhoA/ROCK1 pathway, we used fasudil or Y27632, an inhibitor of the RhoA/Rho kinase (ROCK) signaling pathway, to explore the effects of RhoA/ROCK signaling on Piezo1 overexpression. After fasudil treatment for 24 h, the increase in RhoA protein levels induced by CS was blocked (Fig. 5A and B). However, the expression of Piezo1 was significantly upregulated in CS-treated cells, with or without fasudil pretreatment (Fig. 5A and C).\u003c/p\u003e\n\u003cp\u003eSimilarly, after Y27632 treatment for 24 h, the increases of both ROCK1 mRNA and protein induced by CS were blocked (Fig. 5D\u0026ndash;F). However, after preconditioning with or without Y27632, the expression of Piezo1 mRNA and protein had no affected in CS‑treated HPMECs (Fig. 5G and H). These data indicated that Piezo1 acts as an upstream regulator of the RhoA/ROCK1 signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlocking the increased Piezo1 level attenuates VILI and improves survival in rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePhotomicrographs showed that, at 6 h after HVMV, the following effects were seen: Infiltration of inflammatory cells into the lung interstitium and alveolar spaces; thickening of alveolar walls; and intra-alveolar exudation (Fig. 6A\u0026ndash;D). However, GSMTx4 preconditioning attenuated these histological changes. Semi-quantitative assessment using a lung injury score demonstrated that the degree of lung injury in the MG132 + VILI group was lower than that in the VILI + vehicle group (Fig. 6E). The lung wet-to-dry-weight ratio increased significantly at 6 h after VILI administration (Fig. 6F). Extravasation of Evans Blue Dye showed that VILI induced a significant increase in leakage into the lung (Fig. 6G). When the animals were pretreated with 10 \u0026mu;g GSMTx4, lung edema and capillary leakage were reduced significantly at 6 h after VILI administration (Fig. 6F and G). GSMTx4 alone did not affect these variables in the sham rats. Six hours after HVMV, BALF was collected and the concentration of inflammatory cytokines in BALF was detected using ELISA. The results showed that the concentration of pro-inflammatory cytokines, e.g., TNF-\u0026alpha;, IL-1\u0026beta;, IL-6, and MCP‑1, increased significantly in lung tissue (Fig. 6H). However, after GSMTx4 pretreatment, the concentration of TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6 in BALF decreased significantly (Fig. 6H). These findings indicated that blocking Piezo1 could alleviate the inflammatory reaction of lung tissue in VILI rats.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. 6I, the survival rate of rats in the sham group was 100%, and the survival rate was significantly decreased in the VILI group compared with that in the sham operation group. The survival rate after HVMV was 50% on the second day, which decreased to 0% on the fifth day. Pretreatment with GSMTx4, however, improved the survival rate to 70% on second day and 30% on day 7, and at least 30% of the rats survived. This result confirmed the protective effect of blocking Piezo1 on mortality in rats with VILI.\u003c/p\u003e"},{"header":"Discussion","content":" \u003cp\u003eMechanical ventilation can both provide respiratory support to patients with ALI and aggravate pre-existing lung injury, prompting the progression of ALI to ARDS, as well as increasing patient mortality in an effort to mitigate injury as much as possible. In recent years, some scholars have proposed and developed a lung protective ventilation strategy using low tidal volume combined with lung recruitment and PEEP as the main component, which achieved certain effects while also increasing the risk of patients with diaphragmatic function barriers [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Further understanding of the pathogenic mechanisms of VILI may provide a new avenue for the management of this disorder. In the present study, we demonstrated that Piezo1 participates in the mechanisms of ventilator-induced lung injury in rats and CSinduced cell apoptosis by activating RhoA/ROCK1 signaling in rats.\u003c/p\u003e \u003cp\u003eTraction of the alveoli by large tidal volumes is an important etiology of VILI, with distortion of the alveolar epithelium versus the pulmonary endothelium from stress, both of which are mechanically damaged when high tidal volumes are ventilated. More importantly, the pulmonary vascular endothelium is subjected to mechanical stretch leading to increased cell membrane permeability; intravascular exudation of substances such as albumin and erythrocyte debris into the pulmonary interstitium; and products such as phospholipase released by neutrophils and macrophages after activation; can interfere with and inactivate alveolar surfactant, thereby affecting alveolar function [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Given that MV can activate Piezo1 channels in the lungs of ARDS rats, which increased the intracellular Ca2\u0026thinsp;+\u0026thinsp;content in alveolar epithelial cells, downregulated the expression of anti-apoptotic protein Bcl-2, and increased alveolar epithelial cell apoptosis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Further studies showed that increasing pulmonary vascular hydrostatic pressure in mice, either using aortic constriction or elevating the left atrial pressure, resulted in severe pulmonary edema after disruption of the pulmonary vascular barrier in wild-type mice, whereas specifically knocking out \u003cem\u003ePiezo1\u003c/em\u003e in mouse pulmonary endothelial cells significantly reduced pulmonary vascular permeability and the extent of pulmonary edema in mice. In addition, degradation of adherens junction proteins VE-cadherin, β-catenin, and p120-catenin was not significant [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the present study, we found that high tidal volume mechanical ventilation significantly induced pulmonary interstitial edema, alveolar wall thickening, and destruction of alveolar morphology in rat lung tissue, and the injury was more pronounced and the oxygenation index was significantly reduced as the duration of mechanical ventilation increased. During this process, Piezo1 expression in rat lung tissue also showed significant upregulation with increased ventilation time. By immunohistochemical staining, we found that Piezo1 was widely expressed in rat lung tissue. Alveolar epithelial and endothelial cells, the earliest effector cells to appear altered within the lung, bear the brunt of alveolar epithelial and endothelial cell involvement when ALI is initiated. In this study, we found that after massive mechanical stretching of the lung epithelium and endothelium (20%) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], mimicking VILI \u003cem\u003ein vitro\u003c/em\u003e, both the epithelium and endothelium were significantly damaged and the apoptosis rate increased in a time-dependent manner. Consistent with the injury, Piezo1 expression also showed time-dependent upregulation, suggesting that upregulated \u003cem\u003ePiezo1\u003c/em\u003e gene expression in the lung might be an important risk factor for the pathogenesis of VILI. This could be related to the fact that Piezo1 acts as a nonselective cation channel and is permeable to extracellular calcium (Ca2+) influx [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Intracellular Ca2\u0026thinsp;+\u0026thinsp;acts as a second messenger that can activate different downstream biochemical signaling pathways and biological effects. It reported that loading mice with \u003cem\u003eex vivo\u003c/em\u003e perfused lungs with high PIP ventilation increased their pulmonary vascular barrier permeability, and that reducing Ca2\u0026thinsp;+\u0026thinsp;influx caused by channel activation, by means of pretreatment with TRPV4 inhibitors or gene knockout, could partially abolish pulmonary edema resulting from disruption of the air-blood barrier [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition, high PIP ventilation can activate TRPV4 channels on the surface of alveolar macrophages to trigger Ca2\u0026thinsp;+\u0026thinsp;signals, leading to a large production of NO and O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e, which cause oxidative damage [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Using real-time Ca2\u0026thinsp;+\u0026thinsp;imaging, we observed that acute elevation of airway pressure in healthy mice induced a significant increase in free Ca2\u0026thinsp;+\u0026thinsp;in endothelial cells that lasted for more than 15 min.\u003c/p\u003e \u003cp\u003eAlveolar capillary barrier dysfunction is one of the important pathological features of ALI [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The alveolar capillary barrier compositional structure includes pulmonary microvascular endothelial cells and alveolar epithelial cells, either of which, when damaged, affects the homeostasis of lung function. However, endothelial cells are the first defense barrier, and when inflammatory injury occurs, pulmonary microvascular endothelial cells are first damaged, and cell permeability rapidly increases, causing capillary leakage. Therefore, we further explored how Piezo1 plays a role in VILI and its possible downstream regulatory mechanisms by mechanically stretching HPMECs. Previous studies have reported that the RhoA/ROCK pathway, an intracellular signaling pathway, is involved in the development of ALI induced by LPS [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Similarly, our previous study also found abnormal accumulation of ROCK1 protein and increased expression of \u003cem\u003eRhoA\u003c/em\u003e and \u003cem\u003eRock2\u003c/em\u003e mRNA in the rat lung under exogenous endotoxin stimulation. Significantly higher mean optical density values of pulmonary perivascular ROCK1 protein were observed in rat lung sections. Small tidal volume ventilation reduces the degree of early lung injury in LPS rats, and the reason may be related to the inhibition of the RhoA/ROCK1 signaling pathway [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. \u003cem\u003eIn vitro\u003c/em\u003e studies have found that cyclic stretch at a strain of 15% activates RhoA through the protein kinase activated receptor 1 pathway, causes cytoskeletal rearrangements, forms actin tension filaments, and increases endothelial permeability [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In this study, we showed that a strain of 20% of periodically pulled endothelial cells showed a time-dependent upregulation of Piezo1 expression, along with the activation of the intracellular RhoA / ROCK1 signaling pathway. The expression of ROCK was also upregulated in a timedependent manner. Interestingly, pretreatment with different concentrations of Yoda-1 (a Piezo1 selective agonist [18]) in cells activated Piezo1 channel activity, and the expression of ROCK1 also appeared tom be significantly upregulated, thus Piezo1 might act as an upstream regulatory molecule of the RhoA/Rock1 signaling pathway. To further test this hypothesis, we pretreated cells with siRNA to knockdown \u003cem\u003ePiezo1\u003c/em\u003e expression and found that the RhoA /ROCK1 signaling pathway was significantly inhibited, and the expression of ROCK1 also decreased significantly. Similarly, pretreatment with \u003cem\u003ePiezo1\u003c/em\u003e siRNA caused downregulation of ROCK1 expression in the presence of pre-activated cellular Piezo1 channel activity. We also further confirmed this result using GsMTx4, an endogenous cation channel inhibitor [35]. Conversely, when we pretreated endothelial cells with fasudil and Y27632 [36], which inhibit RhoA and Rock1 protein expression, Piezo1 expression did not show significant alterations, thus, Piezo1 might participate in VILI through the downstream activation of the RhoA / Rock1 signaling pathway.\u003c/p\u003e \u003cp\u003eThe Rho family of small G proteins is an important molecule in the regulation of intercellular adherens junctions and intracellular actin junctions, and plays an important regulatory role in pulmonary vascular endothelial barrier function [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. A large amount of Ca2\u0026thinsp;+\u0026thinsp;influx causes the intracellular Ca2\u0026thinsp;+\u0026thinsp;concentration to become too high, which causes an inflammatory response and disrupts intercellular junctional junctions; and the Ca2\u0026thinsp;+\u0026thinsp;influx also significantly upregulates Rho GTPase activity [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. By contrast Piezo1 is a bona fide mechanosensitive ion channel protein in mammals and allows Ca2\u0026thinsp;+\u0026thinsp;passage, and mediates remodeling of the cytoskeleton and stress alterations, representing a key element of the mechanotransduction process [\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. This may partly explain why Piezo1 is able to regulate the RhoA / Rock1 signaling pathway and is involved in ventilator-associated lung injury.\u003c/p\u003e \u003cp\u003eIn the present study, ventilator-associated lung injury was confirmed by histological analysis, in which HVMV was performed to induce ALI. In keeping with the pathogenesis of VILI, HVMV was confirmed by an increase in the water content and protein leakage in the lungs. GsMTx4 was used to inhibit Piezo1 channel activity, which significantly attenuated these abnormalities, indicating the therapeutic role of Piezo1 in VILI in rats. Our data demonstrate that pulmonary levels of pro-inflammatory cytokines increased markedly in rats that underwent HVMV, and that Piezo1 inhibition resulted in a decrease in the accumulation of these cytokines. Furthermore, although the 7-day survival rate of rats in the GSMTx4 group was not different to that in the sham group, inhibition of Piezo1 ultimately resulted in an improvement in the overall survival rate of the model rats. Thus, these findings are consistent with the above data.\u003c/p\u003e \u003cp\u003eWe must acknowledge the limitations of our study. One of the limitations was that the observation period was limited to 6 h, and for several chemicals involved in this study, the use of a larger concentration range was not adopted. Moreover, indicators of cellular electrophysiology were not assessed in this study, such as the ability to observe the concentration changes and flow of intracellular and extracellular Ca2\u0026thinsp;+\u0026thinsp;in real time, which would have improved this study and thus require further investigation.\u003c/p\u003e "},{"header":"Conclusions","content":" \u003cp\u003eUsing an HVMV-induced model of VILI in rats, we demonstrated that Piezo1 might have a role in VILI-induced pathological changes and apoptosis of endothelial and epithelial cells; the water content and protein leakage in lungs; the induction of systemic inflammatory mediators; and the 7-day mortality rate in rats. Furthermore, the results of the molecular analysis indicated that Piezo1 contributes to VILI by activating RhoA/ROCK1 in rats. Thus, Piezo1 might represent an effective therapeutic agent for the treatment of lung injury.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eMV: Mechanical ventilation;\u0026nbsp;ALI: acute lung injury; ARDS: acute respiratory distress syndrome; HVMV: high tidal volume mechanical ventilation; PEEP:positive end-expiratory pressure; CS:cyclic stretch; BALF: bronchoalveolar lavage fluid; HPMEC:human pulmonary microvascular endothelial cell line; qRT-PCR: quantitative real-time reverse transcription PCR; ELISA, enzyme-linked immunosorbent assay.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed in accordance with relevant guidelines and regulations. The study protocol was approved by the Animal Care and Use Committee of Yangzhou University (Yangzhou, China) and was in accordance with the guidelines for the care and use of animals set by the Chinese government.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll list authors consent to the submission and all data are used with the consent of the person generating the data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by The National Natural Science Fund, China (81601679) and 333 Scientific Research Project of Jiangsu Province (BRA2018020).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.Z. and J.G. conceived and designed the research; Y.Z., L.J. and T.H. performed the experiments; D.L., S.Y. and L.W. analyzed the data; L.J., J.G., and T.H. interpreted the results; Y.Z. prepared the figures; Y.Z. and J.G. drafted the manuscript; J.G. approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCarrasco Loza R, Villamizar Rodriguez G, Medel Fernandez N: \u003cstrong\u003eVentilator-Induced Lung Injury (VILI) in Acute Respiratory Distress Syndrome (ARDS): Volutrauma and Molecular Effects.\u003c/strong\u003e\u003cem\u003eOpen Respir Med J \u003c/em\u003e2015, \u003cstrong\u003e9:\u003c/strong\u003e112-119.\u003c/li\u003e\n\u003cli\u003eVieillard-Baron A, Dreyfuss D: \u003cstrong\u003eVentilator-induced Lung Injury: Follow the Right Direction! Another Piece of the Puzzle in the Ventilator-induced Lung Injury Epic.\u003c/strong\u003e\u003cem\u003eAm J Respir Crit Care Med \u003c/em\u003e2017, \u003cstrong\u003e196:\u003c/strong\u003e1366-1368.\u003c/li\u003e\n\u003cli\u003eGattinoni L, Protti A, Caironi P, Carlesso E: \u003cstrong\u003eVentilator-induced lung injury: the anatomical and physiological framework.\u003c/strong\u003e\u003cem\u003eCrit Care Med \u003c/em\u003e2010, \u003cstrong\u003e38:\u003c/strong\u003eS539-548.\u003c/li\u003e\n\u003cli\u003eMiyamoto T, Mochizuki T, Nakagomi H, Kira S, Watanabe M, Takayama Y, Suzuki Y, Koizumi S, Takeda M, Tominaga M: \u003cstrong\u003eFunctional role for Piezo1 in stretch-evoked Ca(2)(+) influx and ATP release in urothelial cell cultures.\u003c/strong\u003e\u003cem\u003eJ Biol Chem \u003c/em\u003e2014, \u003cstrong\u003e289:\u003c/strong\u003e16565-16575.\u003c/li\u003e\n\u003cli\u003eCinar E, Zhou S, DeCourcey J, Wang Y, Waugh RE, Wan J: \u003cstrong\u003ePiezo1 regulates mechanotransductive release of ATP from human RBCs.\u003c/strong\u003e\u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2015, \u003cstrong\u003e112:\u003c/strong\u003e11783-11788.\u003c/li\u003e\n\u003cli\u003eRode B, Shi J, Endesh N, Drinkhill MJ, Webster PJ, Lotteau SJ, Bailey MA, Yuldasheva NY, Ludlow MJ, Cubbon RM, et al: \u003cstrong\u003ePiezo1 channels sense whole body physical activity to reset cardiovascular homeostasis and enhance performance.\u003c/strong\u003e\u003cem\u003eNat Commun \u003c/em\u003e2017, \u003cstrong\u003e8:\u003c/strong\u003e350.\u003c/li\u003e\n\u003cli\u003eAlbarran-Juarez J, Iring A, Wang S, Joseph S, Grimm M, Strilic B, Wettschureck N, Althoff TF, Offermanns S: \u003cstrong\u003ePiezo1 and Gq/G11 promote endothelial inflammation depending on flow pattern and integrin activation.\u003c/strong\u003e\u003cem\u003eJ Exp Med \u003c/em\u003e2018, \u003cstrong\u003e215:\u003c/strong\u003e2655-2672.\u003c/li\u003e\n\u003cli\u003eYoo HY, Sung MK, Lee SH, Kim S, Lee H, Park S, Kim SC, Lee B, Rho K, Lee JE, et al: \u003cstrong\u003eA recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma.\u003c/strong\u003e\u003cem\u003eNat Genet \u003c/em\u003e2014, \u003cstrong\u003e46:\u003c/strong\u003e371-375.\u003c/li\u003e\n\u003cli\u003eZhang Y, Gao J, Wang CJ, Zhou LJ, Fang XZ, Yang LQ: \u003cstrong\u003eLow tidal volume ventilation preconditioning ameliorates lipopolysaccharide-induced acute lung injury in rats.\u003c/strong\u003e\u003cem\u003eActa Anaesthesiol Scand \u003c/em\u003e2016, \u003cstrong\u003e60:\u003c/strong\u003e780-789.\u003c/li\u003e\n\u003cli\u003eRafikov R, Dimitropoulou C, Aggarwal S, Kangath A, Gross C, Pardo D, Sharma S, Jezierska-Drutel A, Patel V, Snead C, et al: \u003cstrong\u003eLipopolysaccharide-induced lung injury involves the nitration-mediated activation of RhoA.\u003c/strong\u003e\u003cem\u003eJ Biol Chem \u003c/em\u003e2014, \u003cstrong\u003e289:\u003c/strong\u003e4710-4722.\u003c/li\u003e\n\u003cli\u003eDai H, Zhang S, Du X, Zhang W, Jing R, Wang X, Pan L: \u003cstrong\u003eRhoA inhibitor suppresses the production of microvesicles and rescues high ventilation induced lung injury.\u003c/strong\u003e\u003cem\u003eInt Immunopharmacol \u003c/em\u003e2019, \u003cstrong\u003e72:\u003c/strong\u003e74-81.\u003c/li\u003e\n\u003cli\u003eZhang C, Guo F, Chang M, Zhou Z, Yi L, Gao C, Huang X, Huan J: \u003cstrong\u003eExosome-delivered syndecan-1 rescues acute lung injury via a FAK/p190RhoGAP/RhoA/ROCK/NF-kappaB signaling axis and glycocalyx enhancement.\u003c/strong\u003e\u003cem\u003eExp Cell Res \u003c/em\u003e2019, \u003cstrong\u003e384:\u003c/strong\u003e111596.\u003c/li\u003e\n\u003cli\u003eHuang T, Zhang Y, Wang C, Gao J: \u003cstrong\u003ePropofol reduces acute lung injury by up-regulating gamma-aminobutyric acid type a receptors.\u003c/strong\u003e\u003cem\u003eExp Mol Pathol \u003c/em\u003e2019, \u003cstrong\u003e110:\u003c/strong\u003e104295.\u003c/li\u003e\n\u003cli\u003eTschumperlin DJ, Margulies SS: \u003cstrong\u003eEquibiaxial deformation-induced injury of alveolar epithelial cells in vitro.\u003c/strong\u003e\u003cem\u003eAm J Physiol \u003c/em\u003e1998, \u003cstrong\u003e275:\u003c/strong\u003eL1173-1183.\u003c/li\u003e\n\u003cli\u003eKozian A, Schilling T, Freden F, Maripuu E, Rocken C, Strang C, Hachenberg T, Hedenstierna G: \u003cstrong\u003eOne-lung ventilation induces hyperperfusion and alveolar damage in the ventilated lung: an experimental study.\u003c/strong\u003e\u003cem\u003eBr J Anaesth \u003c/em\u003e2008, \u003cstrong\u003e100:\u003c/strong\u003e549-559.\u003c/li\u003e\n\u003cli\u003eZhang Y, Huang T, Jiang L, Gao J, Yu D, Ge Y, Lin S: \u003cstrong\u003eMCP-induced protein 1 attenuates sepsis-induced acute lung injury by modulating macrophage polarization via the JNK/c-Myc pathway.\u003c/strong\u003e\u003cem\u003eInt Immunopharmacol \u003c/em\u003e2019, \u003cstrong\u003e75:\u003c/strong\u003e105741.\u003c/li\u003e\n\u003cli\u003eGreen TP, Johnson DE, Marchessault RP, Gatto CW: \u003cstrong\u003eTransvascular flux and tissue accrual of Evans blue: effects of endotoxin and histamine.\u003c/strong\u003e\u003cem\u003eJ Lab Clin Med \u003c/em\u003e1988, \u003cstrong\u003e111:\u003c/strong\u003e173-183.\u003c/li\u003e\n\u003cli\u003eSyeda R, Xu J, Dubin AE, Coste B, Mathur J, Huynh T, Matzen J, Lao J, Tully DC, Engels IH, et al: \u003cstrong\u003eChemical activation of the mechanotransduction channel Piezo1.\u003c/strong\u003e\u003cem\u003eElife \u003c/em\u003e2015, \u003cstrong\u003e4\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eCoste B, Xiao B, Santos JS, Syeda R, Grandl J, Spencer KS, Kim SE, Schmidt M, Mathur J, Dubin AE, et al: \u003cstrong\u003ePiezo proteins are pore-forming subunits of mechanically activated channels.\u003c/strong\u003e\u003cem\u003eNature \u003c/em\u003e2012, \u003cstrong\u003e483:\u003c/strong\u003e176-181.\u003c/li\u003e\n\u003cli\u003eNonomura K, Lukacs V, Sweet DT, Goddard LM, Kanie A, Whitwam T, Ranade SS, Fujimori T, Kahn ML, Patapoutian A: \u003cstrong\u003eMechanically activated ion channel PIEZO1 is required for lymphatic valve formation.\u003c/strong\u003e\u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2018, \u003cstrong\u003e115:\u003c/strong\u003e12817-12822.\u003c/li\u003e\n\u003cli\u003eYoung CC, Harris EM, Vacchiano C, Bodnar S, Bukowy B, Elliott RRD, Migliarese J, Ragains C, Trethewey B, Woodward A, et al: \u003cstrong\u003eLung-protective ventilation for the surgical patient: international expert panel-based consensus recommendations.\u003c/strong\u003e\u003cem\u003eBr J Anaesth \u003c/em\u003e2019, \u003cstrong\u003e123:\u003c/strong\u003e898-913.\u003c/li\u003e\n\u003cli\u003eZhou XL, Wei XJ, Li SP, Ma HL, Zhao Y: \u003cstrong\u003eLung-protective ventilation worsens ventilator-induced diaphragm atrophy and weakness.\u003c/strong\u003e\u003cem\u003eRespir Res \u003c/em\u003e2020, \u003cstrong\u003e21:\u003c/strong\u003e16.\u003c/li\u003e\n\u003cli\u003eTana M, Polglase GR, Cota F, Tirone C, Aurilia C, Lio A, Ricci C, Romagnoli C, Vento G: \u003cstrong\u003eDetermination of Lung Volume and Hemodynamic Changes During High-Frequency Ventilation Recruitment in Preterm Neonates With Respiratory Distress Syndrome.\u003c/strong\u003e\u003cem\u003eCrit Care Med \u003c/em\u003e2015, \u003cstrong\u003e43:\u003c/strong\u003e1685-1691.\u003c/li\u003e\n\u003cli\u003eLiang GP, Xu J, Cao LL, Zeng YH, Chen BX, Yang J, Zhang ZW, Kang Y: \u003cstrong\u003ePiezo1 induced apoptosis of type II pneumocytes during ARDS.\u003c/strong\u003e\u003cem\u003eRespir Res \u003c/em\u003e2019, \u003cstrong\u003e20:\u003c/strong\u003e118.\u003c/li\u003e\n\u003cli\u003eFriedrich EE, Hong Z, Xiong S, Zhong M, Di A, Rehman J, Komarova YA, Malik AB: \u003cstrong\u003eEndothelial cell Piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions.\u003c/strong\u003e\u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2019, \u003cstrong\u003e116:\u003c/strong\u003e12980-12985.\u003c/li\u003e\n\u003cli\u003eGawlak G, Son S, Tian Y, O'Donnell JJ, 3rd, Birukov KG, Birukova AA: \u003cstrong\u003eChronic high-magnitude cyclic stretch stimulates EC inflammatory response via VEGF receptor 2-dependent mechanism.\u003c/strong\u003e\u003cem\u003eAm J Physiol Lung Cell Mol Physiol \u003c/em\u003e2016, \u003cstrong\u003e310:\u003c/strong\u003eL1062-1070.\u003c/li\u003e\n\u003cli\u003eGottlieb PA, Sachs F: \u003cstrong\u003ePiezo1: properties of a cation selective mechanical channel.\u003c/strong\u003e\u003cem\u003eChannels (Austin) \u003c/em\u003e2012, \u003cstrong\u003e6:\u003c/strong\u003e214-219.\u003c/li\u003e\n\u003cli\u003ePairet N, Mang S, Fois G, Keck M, Kuhnbach M, Gindele J, Frick M, Dietl P, Lamb DJ: \u003cstrong\u003eTRPV4 inhibition attenuates stretch-induced inflammatory cellular responses and lung barrier dysfunction during mechanical ventilation.\u003c/strong\u003e\u003cem\u003ePLoS One \u003c/em\u003e2018, \u003cstrong\u003e13:\u003c/strong\u003ee0196055.\u003c/li\u003e\n\u003cli\u003eHamanaka K, Jian MY, Townsley MI, King JA, Liedtke W, Weber DS, Eyal FG, Clapp MM, Parker JC: \u003cstrong\u003eTRPV4 channels augment macrophage activation and ventilator-induced lung injury.\u003c/strong\u003e\u003cem\u003eAm J Physiol Lung Cell Mol Physiol \u003c/em\u003e2010, \u003cstrong\u003e299:\u003c/strong\u003eL353-362.\u003c/li\u003e\n\u003cli\u003eBogatcheva NV, Zemskova MA, Kovalenkov Y, Poirier C, Verin AD: \u003cstrong\u003eMolecular mechanisms mediating protective effect of cAMP on lipopolysaccharide (LPS)-induced human lung microvascular endothelial cells (HLMVEC) hyperpermeability.\u003c/strong\u003e\u003cem\u003eJ Cell Physiol \u003c/em\u003e2009, \u003cstrong\u003e221:\u003c/strong\u003e750-759.\u003c/li\u003e\n\u003cli\u003eTasaka S, Koh H, Yamada W, Shimizu M, Ogawa Y, Hasegawa N, Yamaguchi K, Ishii Y, Richer SE, Doerschuk CM, Ishizaka A: \u003cstrong\u003eAttenuation of endotoxin-induced acute lung injury by the Rho-associated kinase inhibitor, Y-27632.\u003c/strong\u003e\u003cem\u003eAm J Respir Cell Mol Biol \u003c/em\u003e2005, \u003cstrong\u003e32:\u003c/strong\u003e504-510.\u003c/li\u003e\n\u003cli\u003eLi Y, Wu Y, Wang Z, Zhang XH, Wu WK: \u003cstrong\u003eFasudil attenuates lipopolysaccharide-induced acute lung injury in mice through the Rho/Rho kinase pathway.\u003c/strong\u003e\u003cem\u003eMed Sci Monit \u003c/em\u003e2010, \u003cstrong\u003e16:\u003c/strong\u003eBR112-118.\u003c/li\u003e\n\u003cli\u003eBirukova AA, Chatchavalvanich S, Rios A, Kawkitinarong K, Garcia JG, Birukov KG: \u003cstrong\u003eDifferential regulation of pulmonary endothelial monolayer integrity by varying degrees of cyclic stretch.\u003c/strong\u003e\u003cem\u003eAm J Pathol \u003c/em\u003e2006, \u003cstrong\u003e168:\u003c/strong\u003e1749-1761.\u003c/li\u003e\n\u003cli\u003eShikata Y, Rios A, Kawkitinarong K, DePaola N, Garcia JG, Birukov KG: \u003cstrong\u003eDifferential effects of shear stress and cyclic stretch on focal adhesion remodeling, site-specific FAK phosphorylation, and small GTPases in human lung endothelial cells.\u003c/strong\u003e\u003cem\u003eExp Cell Res \u003c/em\u003e2005, \u003cstrong\u003e304:\u003c/strong\u003e40-49.\u003c/li\u003e\n\u003cli\u003eBowman CL, Gottlieb PA, Suchyna TM, Murphy YK, Sachs F: \u003cstrong\u003eMechanosensitive ion channels and the peptide inhibitor GsMTx-4: history, properties, mechanisms and pharmacology.\u003c/strong\u003e\u003cem\u003eToxicon \u003c/em\u003e2007, \u003cstrong\u003e49:\u003c/strong\u003e249-270.\u003c/li\u003e\n\u003cli\u003eHamano T, Shirafuji N, Yen SH, Yoshida H, Kanaan NM, Hayashi K, Ikawa M, Yamamura O, Fujita Y, Kuriyama M, Nakamoto Y: \u003cstrong\u003eRho-kinase ROCK inhibitors reduce oligomeric tau protein.\u003c/strong\u003e\u003cem\u003eNeurobiol Aging \u003c/em\u003e2020, \u003cstrong\u003e89:\u003c/strong\u003e41-54.\u003c/li\u003e\n\u003cli\u003eSpindler V, Schlegel N, Waschke J: \u003cstrong\u003eRole of GTPases in control of microvascular permeability.\u003c/strong\u003e\u003cem\u003eCardiovasc Res \u003c/em\u003e2010, \u003cstrong\u003e87:\u003c/strong\u003e243-253.\u003c/li\u003e\n\u003cli\u003eKandasamy K, Bezavada L, Escue RB, Parthasarathi K: \u003cstrong\u003eLipopolysaccharide induces endoplasmic store Ca2+-dependent inflammatory responses in lung microvessels.\u003c/strong\u003e\u003cem\u003ePLoS One \u003c/em\u003e2013, \u003cstrong\u003e8:\u003c/strong\u003ee63465.\u003c/li\u003e\n\u003cli\u003eLimanjaya I, Hsu TI, Chuang JY, Kao TJ: \u003cstrong\u003eL-selectin activation regulates Rho GTPase activity via Ca(+2) influx in Sertoli cell line, ASC-17D cells.\u003c/strong\u003e\u003cem\u003eBiochem Biophys Res Commun \u003c/em\u003e2020, \u003cstrong\u003e525:\u003c/strong\u003e1011-1017.\u003c/li\u003e\n\u003cli\u003eCoste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, Patapoutian A: \u003cstrong\u003ePiezo1 and Piezo2 are essential components of distinct mechanically activated cation channels.\u003c/strong\u003e\u003cem\u003eScience \u003c/em\u003e2010, \u003cstrong\u003e330:\u003c/strong\u003e55-60.\u003c/li\u003e\n\u003cli\u003eNourse JL, Pathak MM: \u003cstrong\u003eHow cells channel their stress: Interplay between Piezo1 and the cytoskeleton.\u003c/strong\u003e\u003cem\u003eSemin Cell Dev Biol \u003c/em\u003e2017, \u003cstrong\u003e71:\u003c/strong\u003e3-12.\u003c/li\u003e\n\u003cli\u003eZhao Q, Wu K, Geng J, Chi S, Wang Y, Zhi P, Zhang M, Xiao B: \u003cstrong\u003eIon Permeation and Mechanotransduction Mechanisms of Mechanosensitive Piezo Channels.\u003c/strong\u003e\u003cem\u003eNeuron \u003c/em\u003e2016, \u003cstrong\u003e89:\u003c/strong\u003e1248-1263.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"respiratory-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rere","sideBox":"Learn more about [Respiratory Research](http://respiratory-research.biomedcentral.com/)","snPcode":"12931","submissionUrl":"https://submission.nature.com/new-submission/12931/3","title":"Respiratory Research","twitterHandle":"@RespiratoryBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Piezo1, ventilator-induced lung injury, RhoA/ROCK1, Acute lung injury ","lastPublishedDoi":"10.21203/rs.3.rs-555235/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-555235/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eMechanical ventilation can induce or aggravate lung injury, which is termed ventilator‑induced lung injury. Piezo1 is a key element of the mechanotransduction process and can transduce mechanical signals into biological signals by mediating Ca2+ influx, which in turn regulates cytoskeletal remodeling and stress alterations. We hypothesized that it plays an important role in the occurrence of ventilator‑induced lung injury, and we investigated the underlying mechanisms. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eHigh tidal volume mechanical ventilation and high magnitude cyclic stretch were performed on Sprague Dawley rats, and A549 and human pulmonary microvascular endothelial cells, respectively, to establish ventilator‑induced lung injury models. Immunohistochemical staining, flow cytometry, histological examination, enzyme-linked immunosorbent assay, western blotting, quantitative real-time reverse transcription-PCR and survival curves were used to assess the effect of Piezo1 on induction of lung injury, as well as the signaling pathways involved.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e We observed that Piezo1 expression increased in the lungs after high tidal volume mechanical ventilation and in cyclic stretch-treated cells. Mechanistically, we observed the enhanced expression of RhoA/ROCK1 in both cyclic stretch and Yoda1-treated cells, while the deficiency or inhibition of Piezo1 dramatically antagonized RhoA/ROCK1 expression. Furthermore, blockade of RhoA/ROCK1 signaling using an inhibitor did not affect Piezo1 expression. GSMTx4 was used to inhibit Piezo1, which alleviated ventilator‑induced lung injury-induced pathologic changes, water content and protein leakage in the lungs, and the induction of systemic inflammatory mediators, and improved the 7-day mortality rate in the model rats. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e These findings indicate that Piezo1 affects the development and progression of ventilator‑induced lung injury through promotion of RhoA/ROCK1 signaling.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Mechanosensitive Cation Channel Piezo1 Contributes To Ventilator-Induced Lung Injury By Activating RhoA/ROCK1 In Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-06-09 20:46:04","doi":"10.21203/rs.3.rs-555235/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-06-29T06:56:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-06-29T00:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2021-06-23T00:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-06-08T00:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorInvitedReview","content":"","date":"2021-06-07T03:00:00+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-06-07T02:58:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2021-06-07T00:00:00+00:00","index":1,"fulltext":""},{"type":"editorInvited","content":"Respiratory Research","date":"2021-05-29T06:52:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-05-24T00:54:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-05-23T23:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Respiratory Research","date":"2021-05-23T13:32:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"respiratory-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rere","sideBox":"Learn more about [Respiratory Research](http://respiratory-research.biomedcentral.com/)","snPcode":"12931","submissionUrl":"https://submission.nature.com/new-submission/12931/3","title":"Respiratory Research","twitterHandle":"@RespiratoryBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"691fda9c-714d-4879-8731-2719651d64fc","owner":[],"postedDate":"June 9th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":4904484,"name":"Pulmonology"}],"tags":[],"updatedAt":"2021-09-14T18:00:11+00:00","versionOfRecord":[],"versionCreatedAt":"2021-06-09 20:46:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-555235","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-555235","identity":"rs-555235","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}