Genome-wide Analysis of Core Histone Genes and Expression Dynamics of the H3 subfamily in Brassica napus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome-wide Analysis of Core Histone Genes and Expression Dynamics of the H3 subfamily in Brassica napus Fengwu Xie, Chunjun He, Ying Huang, Shuxiang Mao, Mingli Yan, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8114797/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 Mar, 2026 Read the published version in Plant Molecular Biology Reporter → Version 1 posted 13 You are reading this latest preprint version Abstract This study performed a comprehensive genome-wide identification and phylogenetic analysis of the core histone family (CHF) in Arabidopsis thaliana , Brassica napus , and its two diploid progenitor species, Brassica rapa and Brassica oleracea . Using bioinformatics approaches, a total of 86 core histone genes were identified in B. napus , classified into four subfamilies—H2A, H2B, H3, and H4. Comparative analyses revealed that histone H4 is highly conserved across the five studied species, whereas the H2A and H2B subfamilies exhibit substantial sequence divergence. In B. napus , genes derived from the C genome (originating from B. oleracea ) show a higher retention rate compared to those originating from the A genome (from B. rapa ). Promoter regions of the core histone genes are enriched with 21 distinct functional cis-regulatory elements, many of which are associated with a "light–hormone–stress" regulatory network. Furthermore, the centromere-specific histone variant CENH3 was found to localize to the nucleus and forms a distinct clade in the phylogenetic tree, indicating its divergent evolutionary trajectory. These findings provide a solid theoretical foundation for understanding the evolutionary dynamics of histone gene families within the Brassicaceae family. Brassica napus Core histones family Phylogenetic analysis CENH3 Haploid induction Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Key massage 1. Annotated 86 CHF genes in B. napus and clarified the "core conservation and variant differentiation" feature. 2. Revealed that CHF has undergone polyploidization, and B. napus preferentially retains CHF genes from the C-genome of B. oleracea . 3. Discovered that CENH3 forms a distinct evolutionary clade, localizes to chromosomes, and is indispensable for cell division. 4. Identified that CHF contain 21 types of cis-acting elements and clarified their involvement in the "light-hormone-stress" regulatory network. Introduction Core histone family (CHF, including H2A, H2B, H3, and H4) is the core constituents of eukaryotic chromatin, playing critical roles in gene expression modulation, chromatin homeostasis, DNA repair, and cell cycle regulation (Kamakaka and Biggins 2005 ). These proteins assemble into an octamer structure and interact with DNA to form the fundamental chromatin unit — the nucleosome — around which ~ 147 bp of DNA is wrapped, a structure highly conserved across evolution, exhibiting striking sequence homology among core histones from yeast to humans (Strahl and Allis 2000 ). Beyond their primary DNA packaging function, core histones exhibit significant functional diversification through variants. These histones achieve functional diversification in processes such as DNA repair, transcription, and cell differentiation via structural polymorphisms, post-translational modifications, and spatiotemporal deposition patterns (Talbert and Henikoff 2021 ). While core histone structures were elucidated early, the complexity arising from numerous variants has historically directed research efforts towards individual types, leaving inter-variant structural and functional relationships less explored. Studies in Arabidopsis thaliana ( A. thaliana ) characterized specific H2B variants (snH2Bs) that are pivotal for growth, reproduction, and histone modification crosstalk (Yao et al. 2024 ), revealed the structural-functional interrelationships between H2A and its variants H2A.Z/H2A.W (Wang et al. 2025 ), and disclosed synergistic roles of H2A.Z and non-classical H3K4me3 (ncH3K4me3) in mouse oocytes (Mei et al. 2025 ). Double haploid (DH) technology, a linchpin of contemporary plant breeding, expedites the establishment of fully homozygous lines. This approach entails the induction of haploids (individuals with gametic chromosome complement) followed by chromosome set duplication, thereby yielding 100% homozygous diploids within a single generation. This bypasses the need for prolonged inbreeding, proving especially valuable for species with self-incompatibility or complex genetics (Zargar et al. 2022 ). The principle of DH technology hinges on two cardinal steps. First, haploid induction (HI), which entails generating haploids from diploid plants via specialized methodologies including anther culture, microspore culture, gynogenesis, radiation-induced mutagenesis, and interspecific hybridization (Devaux 2021 ; Lantos et al. 2022 ; Marin-Montes et al. 2022 ; Mangal et al. 2023 ; Wang et al. 2023 ). Second, chromosome doubling, involving the use of chemical agents such as colchicine or physical approaches like low-temperature treatment to duplicate the chromosome number of haploid cells, thereby restoring diploidy. Significantly, the resultant diploids are homozygous as they develop directly from haploid progenitors (Prem et al. 2012 ; Sharma et al. 2019 ). DH technology has exhibited substantial potential in crop breeding, yet its implementation across diverse crops confronts notable challenges. For instance, marked disparities in HI efficiency exist among species and genotypes, while cost-effective generation of DH plants remains suboptimal for certain crops (Ferrie and Caswell 2011 ). Moreover, the molecular mechanisms underlying HI remain incompletely elucidated, imposing constraints on the technology's extrapolation to a broader range of crops. (Gilles et al. 2017 ). The advent of CRISPR/Cas9 gene editing offers promising avenues for overcoming these limitations by enabling targeted in vivo HI (Wang et al. 2022 ). Centromeric histone H3 ( CENH3 ), a branch of core histone H3, is responsible for maintaining the structural stability of chromosome centromeres (Kingston et al. 2011 ; Fu et al. 2024 ). Centromeres play a critical role in cell mitosis by binding to spindle fibers and being drawn to opposite poles, thereby facilitating chromosome segregation and cell division (Talbert and Henikoff 2020 ). The CENH3 protein is composed of a highly conserved C-terminal histone fold domain (HFD) and a divergent N-terminal tail (Lv et al. 2020 ). The latter mediates species-specific centromere-kinetochore interactions, conferring functional roles in kinetochore assembly — a protein complex mediating microtubule-centromere attachment that is critical for accurate chromosome segregation (Foley and Kapoor 2013 ). Meanwhile, interactions between CENH3 and other kinetochore proteins (e.g., CENP-C and KNL2 ) are crucial for its proper localization and functional execution at centromeres (Shono et al. 2015 ; Sandmann et al. 2017 ). These interactions are highly conserved in plants, underscoring the fundamental role of CENH3 in eukaryotic cell division and thereby making CENH3 a pivotal gene in both basic research and agricultural applications due to such interspecific conservation. CENH3 mutations lead to abnormal chromosome segregation and generate haploids, a phenomenon first discovered in A. thaliana (Ravi and Chan 2010 ). Subsequently, researchers have successfully induced haploids in various species including wheat, maize, and rice through editing CENH3 (Lv et al. 2020 ; Meng et al. 2022 ; Kalinowska et al. 2019 ). In crops like maize and wheat, the creation of haploid and double haploid (DH) lines not only accelerates the breeding process but also facilitates the introgression of novel traits — including disease resistance, drought tolerance, and increased yield — into elite breeding lines. Although HI has been successfully applied in diploids, a paucity of application cases exists in polyploids — take Brassica napus ( B. napus , AACC genome, 2 n = 4 X = 38), the world’s second-largest oilseed crop, as an example. This species represents a classic allopolyploid formed through natural interspecific hybridization and genome doubling between its diploid progenitors, Brassica rapa ( B. rapa , AA genome, 2 n = 2 X = 20) and Brassica oleracea ( B. oleracea , CC genome, 2 n = 2 X = 18) (Chalhoub et al. 2014 ; Borges et al. 2023 ; Tan et al. 2024 ). The allopolyploid genome retains ancestral features, offering unique insights into gene family evolution and functional diversification post-polyploidization. Although CHF is well-characterized in the model plant A. thaliana , systematic comparative analyses in the Brassica genus, particularly concerning the dynamic evolutionary relationships of CHF between tetraploid species and their diploid ancestors, are still insufficient (Stroud et al. 2012 ; Yu et al. 2023 ; Yao et al. 2024 ). This study aims to bridge that gap by comprehensively identifying CHF members in B. napus , B. rapa , B. oleracea , and A. thaliana at the whole-genome level. Through integrated gene analyses of structure, phylogeny, collinearity, and selection pressure, it seeks to elucidate the evolutionary trajectory of CHF in Brassica, investigate the potential of B. napus CENH3 ( BnCENH3 ) genes for HI, and establish a foundation for developing efficient DH technology to accelerate genetic improvement and breeding in this vital crop. Future research will integrate transgenic technologies and bioinformatics approaches to clarify the precise mechanisms of CENH3 in B. napus HI. Material and Methods Identification of CHF Members The protein dataset of B. napus (ZS11.v0) was downloaded from BnIR (Yang et al. 2023 ; The website links are shown in Table 1 , identical hereinafter). The CHF Hidden Markov Model (HMM, PF00125) was acquired from the InterPro database to identify 184 candidate members via HMMSEARCH against the B. napus proteome (Blum et al. 2025 ). Concurrently, protein sequences of A. thaliana H2A (SM00414), H2B (SM00428), H3 (SM00427), and H4 (SM00417) were retrieved from the SMART database, followed by local BLAST searches (Letunic et al. 2021 ). Extraction of the intersection between BLAST results and HMMSEARCH outputs yielded 86 CHF genes, with identical protocols applied to identify family members in the other three species (Online Resource 1). Physicochemical Property Analysis and Chromosomal Localization The physicochemical properties of proteins—encompassing amino acid (AA) count, molecular weight (MW), pI, instability index, aliphatic index, Grand Average of Hydropathicity (GRAVY), and hydrophilicity index—were batch-analysed using the ProteinParamterCalc (ProtParam-based) function in TBtools (Chen et al. 2023 ). Chromosomal localization of genes were visualized via the "gene location visualize from GTF/GFF" function in the same software. Phylogenetic Analysis of CHF Members identified above were analysed using MEGA11 (Tamura et al. 2021 ). Sequence alignment was performed with the Muscle program, and a phylogenetic tree was constructed via the Neighbor-Joining method (bootstrap set to 1000 replicates). The NWK file of the constructed tree was saved and subjected to visual refinement using the online platform Chiplot (Xie et al. 2023 ). Analysis of Conserved Motifs, Protein Domains, and Gene Structures A total of 86 target proteins were screened from the B. napus proteome, and motif analysis was performed using the MEME program with the number of predicted motifs set to 10 and other parameters at default settings (Bailey et al. 2015 ). Subsequently, the type and location of conserved domains were determined via the Conserved Domain Database (CDD) on the NCBI website. Finally, an integrated visualization combining the phylogenetic tree, motif distribution, domain prediction, and gene structure was generated using TBtools to intuitively illustrate the evolutionary relationships among different family members. Cis-Acting Regulatory Elements Prediction The 2000 bp upstream sequences of the promoters of all CHF members were extracted using TBtools and submitted to the PlantCARE online tool for cis-acting regulatory elements (CAREs) prediction (Lescot et al. 2002 ). The results were visualized using TBtools for further analysis. Collinearity and Selection Pressure Analysis The syntenic relationships among core histone genes across A . thaliana, B. rapa, B. oleracea , and B. napus were analyzed using the OneStepMCScanX-SuperFast plugin in TBtools, with visualization using the Comparative Genomics module. Concurrently, Advanced Circos in TBtools was employed to analyze and visualize intragenomic collinear relationships of CHF in B. napus. Additionally, TBtools was used to calculate the Ka/Ks (non-synonymous substitution rate/synonymous substitution rate) values of B. napus CHF. Subcellular Localization Prediction and Experimental Validation Subcellular localization of the identified B. napus genes was predicted via the online platform WoLFPSORT, while validation experiments utilized B. napus (cultivar 20B) and Nicotiana benthamiana , provided by the Hunan Institute of Crop Science. Transformed tobacco samples were observed under a laser confocal microscope borrowed from the Hunan Hybrid Rice Research Center. Table 1 The online website utilized in this article Website name Website link Website name Website link BnIR https://yanglab.hzau.edu.cn/BnIR MEME https://meme-suite.org/meme/ InterPro https://www.ebi.ac.uk/interpro/ CDD https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi SMART https://smart.embl.de/ PlantCARE https://bioinformatics.psb.ugent.be/webtools/plantcare/html/ Chiplot https://www.chiplot.online/ WoLFPSORT https://wolfpsort.hgc.jp/ RESULTS and ANALYSIS Physicochemical Property Analysis of CHF Genes Analysis of physicochemical properties revealed the AA counts of the CHF ranged from 103 to 319 residues, with MW of 11.41–35.38 kDa, additional data are given in Online Resource 1. Histone H4 consistently exhibited the smallest size (103 residues) across all examined species. Notably, the AA count, pI, and hydropathy index of H4 are perfectly conserved across the five species, indicating exceptional structural and functional constraints in Brassica species. This evolutionary stasis suggests that H4 performs indispensable cellular roles under intense negative selection pressure, where mutations altering its biophysical properties are likely deleterious. The H2B subfamily displayed the greatest variation in AA number: for example, the AA counts of H2B members in B. napus ranged from 132 (BnH2B-12) to 319 (BnH2B-02). The pI value of these proteins ranged from 8.2 to 11.57 (average ~ 10), except for BnH2B-01 in B. napus (pI = 6.95). Sequence alignment indicated that this member’s longer sequence potentially affects its spatial structure, alters overall charge properties, and decreases pI. All CHF members had negative hydropathy indices, classifying them as hydrophilic, and most were predicted to be labile — possibly linked to their roles in maintaining chromatin structure and regulating chromatin loosening. B. napus harbored two CENH3 gene copies (BnH3-01, BnH3-02), whereas other species had only a single copy (AtH3-01, BoH3-01, BrH3-01). The AA counts and MW displayed minimal variation, averaging 181 AAs and 19.84 kDa, respectively. Notably, the mean pI value of BnCENH3 proteins reached as high as 11.5, the highest among the CHF, with instability in-dices higher than those of most H3 members and aliphatic indices lower than those of most H3 members. The high pI endows it with a substantial net positive charge under physiological conditions, facilitating its electrostatic association with the negatively charged DNA phosphate backbone and thereby promoting the formation of a more compact nucleosmal structure. At the molecular level, the high positive charge increases electrostatic interactions within chromatin fibers, compressing the distance between DNA strands and promoting the formation of a highly condensed structure in the centromere region (Grau et al. 2011 ). Furthermore, the positively charged region of CENH3 might form a specialized structure to suppress acetylation modifications, thereby sustaining the transcriptionally repressed state of the centromere region and ensuring the precise assembly and function of kinetochore complexes (Zhu et al. 2018 ). Chromosomal Distribution and Phylogenetic Analysis of CHF A total of 34 CHF genes were mapped to 10 A chromosomes, with distributions ranging from a single gene on ChrA04 to six genes on ChrA09 (Fig. 1 A). Conversely, 53 CHF genes were distributed across all eight C chromosomes, exhibiting near-uniform density except for ChrC07 which contained only one gene (Fig. 1 B). These findings demonstrate that B. napus retains a higher number of histone genes from B. oleracea than from B. rapa , implying that B. oleracea -derived genes exhibit a greater tendency to be preserved in B. napus . According to the subfamily classification criteria of the A. thaliana CHF in prior investigations, histone genes of five species were categorized into four subfamilies — H2A, H2B, H3, and H4 (Fig. 2 ) (Wang Y et al. 2023 ). The H2A and H2B subfamilies comprised 96 and 54 members, respectively, emerging as the most diversified subfamilies. Although the four subfamilies displayed relatively independent evolutionary trajectories, pronounced differentiation occurred within the three non-H4 subfamilies, giving rise to multiple variants with distinct functional profiles. This functional variation predominantly stemmed from gene duplication events, whereby duplicated genes acquired novel functions under selective pressure through mutational accumulation during long-term evolution, thereby driving functional diversification (Tang et al. 2018 ). For instance, the H2A.Z variant exerts a critical function in remodeling chromatin and regulating gene expression, particularly in mediating responses to environmental fluctuations and developmental processes (Miao et al. 2024 ). Conversely, the H2A.X variant is involved in DNA damage repair, with its phosphorylated form γ-H2A.X serving as a marker for DNA double-strand breaks (Fragkos et al. 2009 ). The H2B.W variant is expressed during spermatogenesis, participating in chromatin structure remodeling and gene expression regulation (Ding et al. 2024 ). The H3 subfamily encompasses multiple variants, including H3.1/H3.2, H3.3, CENP-A, and other specialized variants (Talbert and Henikoff 2021 ; Sokolova et al. 2022 ). H3.1 and H3.2 are predominantly integrated into chromatin during DNA replication, thereby facilitating nucleosome assembly and chromatin stabilization. H3.3 functions as a replication-independent variant enriched in transcriptionally active and open chromatin domains, contributing to dynamic gene expression regulation, chromatin state maintenance, and cellular differentiation programs (Stroud et al. 2012 ; Zhao et al. 2021 ; Zhao et al. 2022 ). Phylogenetic analysis demonstrates that CENH3 is the most distinct among these variants, having diverged from other H3 genes at an early evolutionary stage. It localizes specifically to the centromeric region of chromosomes, where it orchestrates centromere formation and chromosome segregation. Given that centromeres are critical for chromosome segregation during cell division, the early divergence of CENH3 indicates that centromeric functions were established and highly conserved early in eukaryotic evolution (Burrack and Berman 2012 ). This implies that accurate centromere assembly and function are vital for cell viability, exerting strong selective pressure on the structural evolution of CENH3 and highlighting its functional distinctions from other H3 variants. Whereas CENH3 is classified as a histone H3 subtype, its exceptional specificity in centromeric localization and function enables it to replace classical H3 in centromeric regions and function as a platform for kinetochore assembly, recruiting other centromeric proteins to form kinetochores and supervise chromosome segregation during cell division (Foltz et al. 2006 ; Watanabe et al. 2019 ; Ariyoshi et al. 2021 ). The functional diversification of these variants indicates that the CHF has evolved increased complexity through gene duplication and adaptive functional mutation. Moreover, these variants engage in complex epigenetic regulatory networks through post-translational modifications, exert crosstalk effects on other histones modifications, and dynamically modulate gene expression and chromatin architecture, thereby facilitating plant adaptability to environmental fluctuations (Nunez-Vazquez et al. 2022 ). The phylogenetic analyses revealed that B. oleracea -derived genes exhibited closer relationships with B. napus , suggesting a predominant genetic contribution of B. oleracea to the B. napus genome. This genetic bias may culminate in preferential regulation of B. oleracea -derived genes, a phenomenon that mirrors the expansion of B. oleracea -originated genes during post-hybridization genome remodeling. This expansionary trend is potentially attributable to either the elevated adaptability of B. oleracea alleles under environmental selection pressures or epigenetic inheritance patterns influenced by maternal effects. Analysis of Conserved Motifs, Protein Domains, and Gene Structures Analysis of CHF genes revealed that CHF encompasses Motif 1 and Motif 2, whereas H4 lacks Motif 4, and other motifs display high specificity among CHF members (Fig. 3 ). This indicates that these motifs may play critical roles in preserving the fundamental structure and function of the CHF. Notably, BnCENH3 exhibits marked structural disparities from other H3 histones. Motif 2, typically highly conserved in the CHF, is implying its importance in maintaining CHF functions. Nevertheless, BnCENH3 loses Motif 2 during evolution, potentially resulting in substantial structural and functional divergences from conventional H3 histones. Additionally, while H3 generally contains 0–2 introns, BnCENH3 harbors four introns, further supporting the notion that BnCENH3 has undergone a distinct evolutionary trajectory. The increase in intron number might affect the gene expression, RNA splicing, and protein structure/function. These findings indicate that BnCENH3 has experienced accelerated evolution, exhibiting a distinct evolutionary pattern from canonical H3 histones, which underlies the structural and functional divergence from other H3 genes. This evolutionary divergence is likely associated with the specialized functions of CENH3 in centromeric regions. As a centromere-specific H3 variant, CENH3 plays indispensable roles in centromere establishment and maintenance, kinetochore assembly, and accurate chromosome segregation (Lipikhina et al. 2017 ). Thus, structural variations in BnCENH3 might reflect its specialized adaptation to centromeric functions in B. napus . Future investigations could further delineate how structural variations in BnCENH3 affect its binding affinity to centromeric DNA, its interaction with kinetochore proteins, and its regulation of chromosome segregation, to deepen our understanding of rapeseed centromere structure and function. Additionally, investigating the evolutionary forces shaping BnCENH3 , such as natural selection and genetic drift, will illuminate the contributions of centromeric proteins to species evolution. Collinearity and Selection Pressure Analysis Multi-species collinearity analysis of B. napus , B. oleracea , and B. rapa uncovered extensive collinear regions across their genomes, demonstrating a high level of structural homology among these species (Fig. 4 ). The widespread distribution of these collinear blocks supports the hypothesis that B. oleracea and B. rapa diverged from the same ancestral genome, which subsequently evolved into the current genomic structures via mechanisms including whole-genome triplication (WGT), chromosomal rearrangements, and local sequence variations. Notwithstanding prolonged independent evolution, the genomic architecture of pivotal gene clusters and CAREs exhibits remarkable conservation, putatively linked to the maintenance of core biological processes critical for species viability. This finding furnishes crucial evidence for deciphering the evolutionary trajectory of Brassica species, illuminating the consequences of genome doubling events, and cross-species comparative mapping of genes underlying key agronomic phenotypes. Follow-up studies can excavate functional genes within collinear regions and integrate breakpoint analysis to decipher the dynamic processes of genome remodeling. Intra-specific collinearity analysis of CHF genes in B. napus (Fig. 5 ) revealed extensive segmental duplication events, presumably driven by re-breaking and error repair of partial chromosomal regions after WGT, thereby driving the genomic repositioning and amplification of CHF loci. Observations of the tandem duplication events indicated that some genes in the CHF underwent continuous replication in local genomic regions. Tandem duplications might be caused by DNA replication slippage, transposon insertion, or other mechanisms. Evolutionary analysis based on Ka/Ks ratio metrics revealed that the CHF exhibited Ka/Ks values significantly below 1.00, indicating that the CHF has been under strong purifying selection during its evolutionary history, with additional data provided in Online Resource 2. Cis-acting Regulatory Elements Prediction Besides the abundant core transcriptional elements (TATA-box and CAAT-box), we identified 21 major CAREs in the CHF, involving regulatory modules for plant growth and development, hormone signaling, and abiotic stress responses (Additional data are given in Online Resource 3). Growth- /development- associated elements included light response (2866 elements), cell cycle regulation (77 elements), endosperm expression (59 elements), meristem expression (102 elements), and circadian rhythm regulation (63 elements), which mainly modulate spatiotemporal growth processes (e.g., cell cycle organogenesis, metabolic homeostasis) to ensure optimal plant development under permissive conditions. Significantly, the abundant light-responsive elements enable plants to rapidly activate photosynthesis for growth. Hormone-responsive elements include those responsive to abscisic acid (709 elements), gibberellin (177 elements), auxin (244 elements), methyl jasmonate (MeJA; 1218 elements), salicylic acid (183 elements), etc. These elements modulate various plant growth and developmental processes via hormone-responsive gene regulation and play pivotal roles in stress responses. Numerous abiotic stress-responsive elements were identified for drought (179 elements), low temperature (236 elements), anaerobic condition (27 elements), hypoxia (660 elements), defense and stress (116 elements), enhancing plant stress resistance and adaptability to environmental changes. CAREs with high abundance (>100) were tallied and plotted in a stacked bar chart, providing an intuitive overview of their distribution pattern (Fig. 2 ). In B. napus , 15 major CAREs were identified (Fig. 6 ), with their relative abundance following a similar trend to other species, predominantly comprising elements governing plant growth and development, and hormone signaling. Collectively, these results demonstrate that CHF plays a prominent role in plant growth and development, assisting plants in adapting to the environment and reproducing. Tissue-Specific Expression Analysis of H3 Genes in B. napus Select Heatmap from the Tools of BnIR. Input the IDs of the 86 histone genes that have been identified in Brassica napus. For the value, select log 10 (TPM + 1), and leave the remaining parameters at their default values. After submission, a set of transcriptome data were obtained and are provided in Online Resource 4. H3 gene-related data were then screened to construct a spatiotemporal expression heatmap (Fig. 7 ). In terms of expression levels, BnaA09T0694800ZS (BnH3-01) and BnaA09T0716200ZS (BnH3-02) exhibited significantly reduced expression in planta compared to other H3 genes, whereas BnaC01T0011300ZS (BnH3-05) presented the highest expression level in the H3 subfamily. Focusing on spatiotemporal expression patterns, BnH3-01/02 exhibited elevated expression in tissues characterized by high cell division capacity, including 2-mm flower buds, seeds at ≤ 28 days after flowering (DAF), and ≤ 8-DAF siliques. Cell division represents a fundamental and indispensable process in plant growth and development, necessitating the coordinated regulation of numerous genes to ensure accurate chromosome replication and segregation (Jing et al. 2022 ). The elevated expression profile of BnH3-01/02 in these tissues strongly indicates their distinctive and indispensable role in cytokinesis. In tissues characterized by robust mitotic activity, a substantial cohort of cells undergo chromosomal replication and disjunction, rendering the upregulated expression of BnH3-01/02 inherently essential for maintaining centromeric integrity and orchestrating chromosomal dynamics. To dissect the regulatory mechanisms underlying these expression divergences, a comprehensive analysis of their promoter landscapes was performed. The findings revealed that the promoters of BnH3-01 and BnH3-02 harbored abundant anaerobic response elements (AREs). The presence of AREs indicates that these two genes may be intricately involved in the anaerobic response mechanism of plants, potentially linked to their elevated expression in vigorously dividing tissues. Active cell proliferation triggers the upregulation of cellular metabolism, thereby eliciting heightened oxygen consumption and the establishment of microenvironmental hypoxia, which might induce the expression activation of these genes. Conversely, the promoter of BnH3-05 harbors an abundance of MeJA and auxin elements, along with defense-related regulatory elements. These regulatory elements may coordinate with other defense signaling cascades to orchestrate the spatiotemporal expression of BnH3-05, enabling plants to respond rapidly and effectively to diverse environmental stresses. Subcellular Localization Prediction and Experimental Validation of BnCENH3 Genes The specificity of CENH3 within the CHF necessitates comprehensive investigation of this histone variant. Subcellular localization prediction of the H3 subfamily in B. napus by WoLFPSORT reveals that most proteins localize to the nucleus, whereas BnCENH3 proteins exhibit tripartite localization in the nucleus, mitochondria, and chloroplasts, underscoring that these proteins are essential important for chromatin dynamics (Online Resource 1). Table 2 cDNA sequences of primers for subcellular localization of the CENH3 gene Gene ID Forward primer Reverse primer BnapChr18G00829680.1 TGCAGGGGCCCGGGGTCGACA TGGCGAGAACCAAACATTTC GCCCTTGCTCACCATGGTACC CAATGGTCTGCCTTTTCCTC BnapChr9G00266290.1 TGCAGGGGCCCGGGGTCGACA TGGCGAGAACGAAACATTTC GCCCTTGCTCACCATGGTA CCCAATGGCCTGCCTTTTCC We conducted subcellular localization assays for CENH3 genes ( BnapChr18G00829680.1 , BnapChr9G00266290.1 ) in the 20B line and entrusted primer synthesis to Changsha Qingke Biotechnology Co., Ltd. (Table 2 ). The transient expression of GFP fusion proteins was performed by introducing the constructed CENH3 ::GFP expression vector into Nicotiana benthamiana mesophyll cells through Agrobacterium-mediated transformation (Fig. 8 ). Cellular visualization via confocal laser scanning microscopy (CLSM), at 72 h post-infiltration, detected dis- tinct green fluorescent signaling within the nuclear, validating the in silico predictions from the WoLFPSORT algorithm and functionally confirming the nuclear localization of BnCENH3 (Fig. 9 ). Given that the nucleus serves as the primary locus of chromatin, these findings indicate that BnCENH3 orchestrates centromeric chromatin dynamics within this subcellular. Subcellular localization assays provide intuitive cellular-level evidence to facilitate mechanistic insight into BnCENH3 function, thereby enabling further exploration of its specific mechanism of action in cellular contexts and establishing a more robust foundation for haploid breeding. Discussion U's triangle hypothesis postulates that B. napus is an allotetraploid arising from interspecific hybridization between B. rapa and B. oleracea followed by a whole-genome duplication event, endowing B. napus with numerous adaptive traits inherited from both progenitor species (Song et al. 2021 ). The whole-genome resequencing and phylogenetic analysis on multiple materials reveal that 7,000 years ago the European turnip (a variant of B. rapa ) in the Mediterranean region hybridized with the extinct progenitor of B. oleracea to form the initial winter-type B. napus , which subsequently diverged into spring-type and semi-winter-type B. napus varieties (Lu et al. 2019 ). CHF genes, serving as the basic building blocks for chromatin structure formation and maintenance, are indispensable cellular structures that exhibit remarkable evolutionary conservation and have been subjected to strong purifying selection (Woo and Li 2012 ; Truong and Boeke 2017; Corcoran et al. 2022 ). Using CHF as molecular markers to study the phylogenetic relationships between B. napus and its progenitor species offers distinct advantages, notably minimizing mutation noise interference. Collinearity analysis revealed extensive syntenic blocks among B. napus , B. rapa , and B. oleracea , indicating that B. napus inherited CHF genes from both B. rapa and B. oleracea through segmental and tandem duplications. Following allopolyploidization, these CHF genes retained a high level of sequence conservation, yet B. oleracea -derived orthologs exhibited genomic enrichment in B. napus. This phenomenon implies that the C genome conferred adaptive traits upon B. napus during evolution (e.g., stress resistance, nutrient utilization efficiency), thereby driving preferential retention through positive selection. Further characterization of CHF in B. napus revealed these genes were classified into four distinct subfamilies. The H4 subfamily exhibited near-identical AA sequences and conserved physicochemical characteristics across all five species analysed, underscoring its indispensability in nucleosome assembly and chromatin homeostasis. This extreme conservation stems from intense purifying selection pressure—any mutation event affecting H4 structure would disrupt nucleosome integrity, leading to dysregulation in essential functions such as DNA repair and gene expression (Piontkivska et al. 2002 ). H3 exhibited relatively lower conservation than H4, engaging in chromatin epigenetic modifications, including H3K4, H3K27, H3K36 methylation and H3S10 phosphorylation. These modifications regulate gene transcription activation or silencing by modulating chromatin accessibility or recruiting regulatory factors (Luger et al. 1997 ; Cheung et al. 2000 ; Li et al. 2023 ). H3 also exerts critical roles in DNA replication, repair, and cell cycle progression. For instance, H3 phosphorylation modifications triggered by DNA damage are involved in repair signaling transduction pathways (Zhang et al. 2016 ). Conversely, H2A and H2B exhibit elevated sequence divergence. For example, BnH2B-01 has a pI of 6.95—substantially lower than any other H2B member. This difference indicates that structural modifications have equipped it with novel roles in chromatin remodeling or transcriptional control. This paradigm of "conserved core with divergent variants" not only maintains the stability of fundamental chromatin functions but also affords a molecular foundation for the evolution of complex regulatory networks. Promoter analysis revealed that CHF was involved in complex regulatory networks of plant growth, development, and stress response. The presence of numerous light-responsive elements (2,866 elements) indicates that CHF may integrate light signaling via epigenetic mechanisms to modulate the expression of photosynthesis-related genes. Meanwhile, the enrichment of hormone-responsive elements (e.g., MeJA and auxin) and abiotic stress elements (e.g., drought and low temperature) highlight that CHF not only maintain chromatin architecture but also mediate plant environmental adaptation by modulating downstream target gene networks. For instance, the upregulated expression of BnH3-05 observed in this study is potentially induced by jasmonic acid signaling, which may coordinate chromatin remodeling and stress-responsive gene expression during defense responses (Long et al. 2024 ). H4 mitigates drought-triggered bolting by promoting H4 acetylation, enabling direct chromatin association with floral repressor gene promoters, and repressing their transcriptional competence (Xin et al. 2021 ). H3K4me3 modification accumulates in the promoter region of the rice dehydrin gene cluster (such as OsDhn1 ), enhancing the DNA binding affinity of transcription factor OsbZIP23 to establish a positive feedback loop of "modification-transcription factor" and recruiting the chromatin remodeling complex SWI/SNF to diminish nucleosome density, thereby making OsbZIP23 more accessible to target genes, ultimately activating drought-responsive gene expression (Zong et al. 2020 ). H3 occupies a prominent position in the CHF, participating in diverse regulations through modifications and functional transitions via structural changes. Spatiotemporal-specific expression profiling of H3 proteins reveals significantly distinct expression levels from other H3 proteins. BnH3-05, the most highly expressed H3 protein, is an H3 variant (H3.3) primarily involved in regulating chromatin dynamics, implicated in transcription, DNA damage repair, and mitosis (Sakai et al. 2009 ; Shi et al. 2017 ). Phylogenetic analysis revealed that BnH3-01/02 formed a distinct clade with the lowest expression levels, exhibiting drastic gene structural divergence and unique expression profiles compared to other H3 variants. Specifically, CENH3 genes underwent the deletion of evolutionary motif 2 and intron gain, potentially fine-tuning their binding affinity to centromeric DNA via conformational changes in protein interaction interfaces or alternative splicing regulation. CENH3 -mediated HI technology has been well-established in diploids including A. thaliana , rice, and maize. Researchers recently used HI-Edit technology to edit the BoCENH3 gene and rapidly generated transgene-free B. oleracea HI lines with the desired anthocyanin content (Li et al. 2025 ). The allopolyploid nature of B. napus imposes a substantially more complex genomic architecture than diploid species, posing significant challenges for generating HI lines via BnCENH3 editing. It is foreseeable that even if HI is achieved, efficiency will remain dramatically low. Thus, experimental designs must adopt a multivariate approach rather than single-factor optimization to attain desired outcomes. The two BnCENH3 paralogs exhibit functional redundancy, thereby enabling plants to sustain essential biological processes when a single copy is mutated and mitigating the phenotypic impact of deleterious mutations. Additionally, studies have shown that retaining a single functional CENH3 allele significantly restores fertility and enhances recombination efficiency in edited lines (Chu et al. 2024 ). Future research could implement monoallelic ( BnCENH3 +/− ) and biallelic ( BnCENH3 −/− ) editing strategies to dissect the trade-off between chromosome elimination efficiency and plant fertility, with the aim of generating optimal B. napus DH lines. A recent investigation has revealed thermosensitive traits in A. thaliana haploid lines, demonstrating that temperature modulation can potentiate CENH3 -mediated HI efficiency and presenting a promising avenue to alleviate the inefficiency associated with monoallelic editing for HI in polyploid crops (Wang Z et al. 2023 ). Loss-of-function mutation in ZmPLD3 , a maize phospholipase D ( PLD ) homolog, elicits maternal HI at rates comparable to those of canonical HI gene MATRILINEAL ( MTL ), and ZmPLD3/MTL double mutants displays a 4-fold increased HI efficiency, with the triple mutant ZmPLD3 +/− - MTL - ZmDMP (DUF679-containing membrane protein) exhibits a 6–7 fold enhancement, collectively highlighting synergistic effects among phospholipid signaling pathways in genome elimination (Li et al. 2021 ). Regrettably, MTL is uniquely present in monocots, rendering this strategy inapplicable to B. napus . However, given that PLD and DMP possess orthologous genes in B. napus , their synergistic interplay with CENH3 could be harnessed to enhance HI efficiency (Lu et al. 2013 ; Zhao et al. 2022 ). Conclusion This study conducts a genome-wide identification and analysis of the CHF in B. napus and its diploid progenitors ( B. rapa and B. oleracea ), annotating 86 CHF genes belonging to H2A, H2B, H3, and H4 subfamilies via HMMSEARCH, BLAST, and other methods. The research reveals that H4 exhibits high sequence conservation across species, while H2A and H2B display significant variation. Phylogenetic and collinearity analyses reveal that CHF genes have undergone polyploidization events with preferential retention of C-genome loci from B. oleracea . CENH3 , a centromere-specific variant of H3, constitutes an independent evolutionary clade, featuring structural variations that correlate with its elevated expression in meristematic tissues. Promoter analysis uncovers that CHF is embedded in a "light-hormone-stress" regulatory network, harboring 21 classes of CAREs. Additionally, the spatiotemporal expression profile of the H3 subfamily demonstrates that BnH3-05 exhibits the highest expression level, whereas BnCENH3 displays specific expression in meiotically active tissues. Subcellular localization experiments validate that BnCENH3 localized to the nucleus, and its functional redundancy provides a theoretical framework for HI in B. napus . This study furnishes critical insights into the evolution of CHF in Brassica and the utilization of CENH3 for B. napus breeding improvement. Declarations Conflict of interest The authors declare that they have no conflict of interest. Ethical approval Not Applicable. Funding This study was funded by the National Natural Science Foundation of China (32071965); the National Key Research and Development Program of China (2023YFD1201403); Hunan Provincial Science and Technology talent Promotion Project (2023TJ-Z09). Author Contribution Fengwu Xie: Data Collection, Analysis & Interpretation, Experimentation, Writing.Chunjun He: Experimentation.Ying Huang: Review and editing.Shuxiang Mao: Conceptualization, advice.Mingli Yan: Conceptualization, Supervision, Resources & Support.Lili Liu: Revision, Resources & Support, Supervision. Acknowledgement The successful completion of this research was made possible by generous funding from the National Natural Science Foundation of China and the National Key Research and Development Program of China. We express our sincere gratitude to our mentors and colleagues for their invaluable guidance, and we thank all members of our institutes for their continued support and assistance. Data availability The datasets used during the current study are available from the corresponding author on reasonable request. References Ariyoshi M, Makino F, Watanabe R, Nakagawa R, Kato T, Namba K, Arimura Y, Fujita R, Kurumizaka H, Okumura EI, Hara M, & Fukagawa T (2021). Cryo-EM structure of the CENP-A nucleosome in complex with phosphorylated CENP-C. The EMBO journal, 40(5), e105671. https://doi.org/10.15252/embj.2020105671 Bailey TL, Johnson J, Grant CE, & Noble, W S (2015). The MEME Suite. Nucleic acids research, 43(W1), W39–W49. https://doi.org/10.1093/nar/gkv416 Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto B L, Orr A, Paysan-Lafoss, T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-López F, Marchler-Bauer A, … Bateman A (2025). InterPro: the protein sequence classification resource in 2025. Nucleic acids research , 53 (D1), D444–D456. https://doi.org/10.1093/nar/gkae1082 Borges CE, Von dos Santos Veloso R, da Conceição CA et al. (2023). Forecasting Brassica napus production under climate change with a mechanistic species distribution model. Sci Rep 13, 12656. https://doi.org/10.1038/s41598-023-38910-3 Burrack LS, & Berman J (2012). Flexibility of centromere and kinetochore structures. Trends in genetics: TIG, 28(5), 204–212. https://doi.org/10.1016/j.tig.2012.02.003 Chalhoub B, Denoeud F, Liu S, Parkin IA, Tang H, Wang X, Chiquet J, Belcram H, Tong C, Samans B, Corréa M, Da Silva C, Just J, Falentin C, Koh CS, Le Clainche I, Bernard M, Bento P, Noel B, Labadie K, … Wincker P (2014). Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science (New York, N.Y.), 345(6199), 950–953. https://doi.org/10.1126/science.1253435 Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, & Xia R (2023). TBtools-II: A "one for all, all for one" bioinformatics platform for biological big-data mining. Molecular plant , 16 (11), 1733–1742. https://doi.org/10.1016/j.molp.2023.09.010 Cheung P, Tanner KG, Cheung WL, Sassone-Corsi P, Denu JM, & Allis C D (2000). Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Molecular cell, 5(6), 905-915. https://doi.org/10.1016/s1097-2765(00)80256-7 Chu L, Zhuang J, Geng M, Zhang Y, Zhu J, Zhang C, Schnittger A, Yi B, & Yang C (2024). ASYNAPSIS3 has diverse dosage-dependent effects on meiotic crossover formation in Brassica napus . The Plant cell, 36(9), 3838–3856. https://doi.org/10.1093/plcell/koae207 Corcoran ET, LeBlanc C, Huang YC, Arias Tsang M, Sarkiss A, Hu Y, Pedmale UV, & Jacob Y (2022). Systematic histone H4 replacement in Arabidopsis thaliana reveals a role for H4R17 in regulating flowering time. The Plant cell, 34(10), 3611–3631. https://doi.org/10.1093/plcell/koac211 Devaux P. (2021). Production of Wheat Doubled Haploids Through Intergeneric Hybridization with Maize. Methods in molecular biology (Clifton, N.J.), 2287,267–279. https://doi.org/10.1007/978-1-0716-1315-314 Ding D, Pang MYH, Deng M, Nguyen TT, Liu Y, Sun X, Xu Z, Zhang Y, Zhai Y, Yan Y, & Ishibashi T (2024). Testis-specific H2B.W1 disrupts nucleosome integrity by reducing DNA-histone interactions. Nucleic acids research, 52(19), 11612–11625. https://doi.org/10.1093/nar/gkae825 Ferrie AMR, Caswell KL (2011). Isolated microspore culture techniques and recent progress for haploid and doubled haploid plant production. Plant Cell Tiss Organ Cult 104, 301–309. https://doi.org/10.1007/s11240-010-9800-y Foley E, Kapoor T (2013). Microtubule attachment and spindle assembly checkpoint signalling at the kinetochore. Nat Rev Mol Cell Biol 14, 25–37. https://doi.org/10.1038/nrm3494 Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR, 3rd, & Cleveland DW (2006). The human CENP-A centromeric nucleosome-associated complex. Nature cell biology, 8(5), 458–469. https://doi.org/10.1038/ncb1397 Fragkos M, Jurvansuu J, & Beard P (2009). H2AX is required for cell cycle arrest via the p53/p21 pathway. Molecular and cellular biology, 29(10), 2828–2840. https://doi.org/10.1128/MCB.01830-08 Fu H, Zhong J, Zhao J, Huo L, Wang C, Ma D, Pan W, Sun L, Ren Z, Fan T, Wang Z, Wang W, Lei X, Yu G, Li J, Zhu Y, Geelen D and Liu B (2024), Ultraviolet attenuates centromere-mediated meiotic genome stability and alters gametophytic ploidy consistency in flowering plants. New Phytol, 243: 2214-2234. https://doi.org/10.1111/nph.19978 Gilles LM, Khaled A, Laffaire JB, Chaignon S, Gendrot G, Laplaige J, Bergès H, Beydon G, Bayle V, Barret P, Comadran J, Martinant JP, Rogowsky PM, & Widiez T (2017). Loss of pollen-specific phospholipase NOT LIKE DAD triggers gynogenesis in maize. The EMBO journal, 36(6), 707–717. https://doi.org/10.15252/embj.201796603 Grau DJ, Chapman BA, Garlick JD, Borowsky M, Francis NJ, & Kingston RE (2011). Compaction of chromatin by diverse Polycomb group proteins requires localized regions of high charge. Genes & development, 25(20), 2210–2221. https://doi.org/10.1101/gad.17288211 Jing J, Wu N, Xu W, Wang Y, Pawlowski WP, & He Y (2022). An F-box protein ACOZ1 functions in crossover formation by ensuring proper chromosome compaction during maize meiosis. The New phytologist, 235(1), 157–172. https://doi.org/10.1111/nph.18116 Kalinowska K, Chamas S, Unkel K et al. (2019). State-of-the-art and novel developments of in vivo haploid technologies. Theor Appl Genet 132, 593–605.https://doi.org/10.1007/s00122-018-3261-9 Kamakaka RT, & Biggins S (2005). Histone variants: deviants? Genes & development, 19(3), 295–310. https://doi.org/10.1101/gad.1272805 Kingston IJ, Yung JS, & Singleton MR (2011). Biophysical characterization of the centromere-specific nucleosome from budding yeast. The Journal of biological chemistry , 286 (5), 4021–4026. https://doi.org/10.1074/jbc.M110.189340 Lantos C; Jancsó M; Székely Á; Nagy É; Szalóki T; Pauk J (2022). Improvement of Anther Culture to integrate Doubled Haploid Technology in Temperate Rice (Oryza sativa L.) Breeding. Plants, 11, 3446. https://doi.org/10.3390/plants11243446 Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, & Rombauts S (2002). PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.Nucleic acids research, 30(1),325–327. https://doi.org/10.1093/nar/30.1.325 Letunic I, Khedkar S, & Bork P (2021). SMART: recent updates, new developments and status in 2020. Nucleic acids research , 49 (D1), D458–D460. https://doi.org/10.1093/nar/gkaa937 Li H, Shen J, Zhao X, Ji J, Wang Y, Yang L, Zhuang M, Liu L, Zhang Y and Lv H (2025). Rapid design of transgene-free cabbage with desired anthocyanin contents via HI-Edit. J. Integr. Plant Biol. https://doi.org/10.1111/jipb.13943 Li Y, Chen M, Khan AH, Ma Y, He X, Yang J, Zhang R, Ma H, Zuo C, Li Y, Kong J, Wang M, Zhu L, Zhang X, & Min L (2023). Histone H3 lysine 27 trimethylation suppresses jasmonate biosynthesis and signaling to affect male fertility under high temperature in cotton. Plant communications, 4(6), 100660. https://doi.org/10.1016/j.xplc.2023.100660 Li Y, Lin Z, Yue Y.et al. (2021) Loss-of-function alleles of ZmPLD3 cause haploid induction in maize. Nat. Plants 7, 1579–1588. https://doi.org/10.1038/s41477-021-01037-2 Lipikhina YA, Evtushenko EV, Elisafenko EA, & Vershinin AV (2017). Chromosomal assignment of centromere-specific histone CENH3 genes in rye (Secale cereale L.) and their phylogeny. Comparative cytogenetics, 11(4), 821–832. https://doi.org/10.3897/CompCytogen.v11i4.19953 Long X, Yang W, Lv Y, Zhong X, Chen L, Li Q, Lv Z, Li Y, Cai Y, & Yang H (2024). The Histone Variant H3.3 Is Required for Plant Growth and Fertility in Arabidopsis. International journal of molecular sciences, 25(5), 2549. https://doi.org/10.3390/ijms25052549 Lu K, Wei L, Li X et al. (2019). Whole-genome resequencing reveals Brassica napus origin and genetic loci involved in its improvement. Nat Commun 10, 1154. https://doi.org/10.3897/CompCytogen.v11i4.19953 Lu S, Bahn SC, Qu G, Qin H, Hong Y, Xu Q, Zhou Y, Hong Y, & Wang X (2013). Increased expression of phospholipase Dα1 in guard cells decreases water loss with improved seed production under drought in Brassica napus . Plant biotechnology journal, 11(3), 380–389. https://doi.org/10.1111/pbi.12028 Luger K, Mäder AW, Richmond RK, Sargent DF, & Richmond TJ (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389(6648), 251–260. https://doi.org/10.1038/38444 Lv J, Yu K, Wei J et al. (2020). Generation of paternal haploids in wheat by genome editing of the centromeric histone CENH3 . Nat Biotechnol 38, 1397–1401. https://doi.org/10.1038/s41587-020-0728-4 Mangal M, Sahana KP, Srivastava A et al. (2023). Haploid induction through microspore embryogenesis in Bell pepper genotypes (PREPRINT Version 1). Research Square. https://doi.org/10.21203/rs.3.rs-2571870/v1 Marin-Montes IM, Rodríguez-Pérez JE, Robledo-Paz A, de la Cruz-Torres E, Peña-Lomelí A, & Sahagún-Castellanos J (2022). Haploid Induction in Tomato (Solanum lycopersicum L.) via Gynogenesis. Plants (Basel, Switzerland), 11(12), 1595. https://doi.org/10.3390/plants11121595 Mei H, Hayashi R, Kozuka C, Kumon M, Koseki H, & Inoue A (2025). H2A.Z reinforces maternal H3K4me3 formation and is essential for meiotic progression in mouse oocytes. Nature structural & molecular biology, 10.1038/s41594-025-01573-x. Advance online publication.https://doi.org/10.1038/s41594-025-01573-x Meng D, Luo H, Dong Z, Huang W, Liu F, Li F, Chen S, Yu H, & Jin W (2022). Overexpression of Modified CENH3 in Maize Stock6-Derived Inducer Lines Can Effectively Improve Maternal Haploid Induction Rates. Frontiers in plant science , 13 , 892055. https://doi.org/10.3389/fpls.2022.892055 Miao R, Zhang Y, Liu X, Yuan Y, Zang W, Li Z et al. (2024) Histone variant H2A.Z is required for plant salt response by regulating gene transcription. Plant, Cell & Environment, 47, 2691–2707. https://doi.org/10.1111/pce.14908 Nunez-Vazquez R, Desvoyes B, & Gutierrez C (2022). Histone variants and modifications during abiotic stress response. Frontiers in plant science, 13, 984702. https://doi.org/10.3389/fpls.2022.984702 Piontkivska H, Rooney AP, & Nei M (2002). Purifying selection and birth-and-death evolution in the histone H4 gene family. Molecular biology and evolution, 19(5), 689-697. https://doi.org/10.1093/oxfordjournals.molbev.a004127 Prem D, Solís MT, Bárány I et al. (2012). A new microspore embryogenesis system under low temperature which mimics zygotic embryogenesis initials, expresses auxin and efficiently regenerates doubled-haploid plants in Brassica napus. BMC Plant Biol 12, 127. https://doi.org/10.1186/1471-2229-12-127 Ravi M, Chan S (2010). Haploid plants produced by centromere-mediated genome elimination. Nature 464, 615–618. https://doi.org/10.1038/nature08842 Sakai A, Schwartz BE, Goldstein S, & Ahmad K (2009). Transcriptional and developmental functions of the H3.3 histone variant in Drosophila. Current biology: CB, 19(21), 1816–1820. https://doi.org/10.1016/j.cub.2009.09.021 Sandmann M, Talbert P, Demidov D, Kuhlmann M, Rutten T, Conrad U, & Lermontova I (2017). Targeting of Arabidopsis KNL2 to Centromeres Depends on the Conserved CENPC-k Motif in Its C Terminus. The Plant cell , 29 (1), 144–155. https://doi.org/10.1105/tpc.16.00720 Sharma P, Chaudhary HK, Manoj NV et al. (2019). New Protocol for Colchicine Induced Efficient Doubled Haploidy in Haploid Regenerants of Tetraploid and Hexaploid Wheats at In vitro Level. CEREAL RESEARCH COMMUNICATIONS 47, 356–368. https://doi.org/10.1556/0806.47.2019.09 Shi L, Wen H, & Shi X (2017). The Histone Variant H3.3 in Transcriptional Regulation and Human Disease. Journal of molecular biology, 429(13), 1934–1945. https://doi.org/10.1016/j.jmb.2016.11.019 Shono N, Ohzeki J, Otake K, Martins NM, Nagase T, Kimura H, Larionov V, Earnshaw WC, & Masumoto H (2015). CENP-C and CENP-I are key connecting factors for kinetochore and CENP-A assembly. Journal of cell science, 128(24), 4572–4587. https://doi.org/10.1242/jcs.180786 Sokolova V, Sarkar S, & Tan D (2022). Histone variants and chromatin structure, update of advances. Computational and structural biotechnology journal, 21, 299–311. https://doi.org/10.1016/j.csbj.2022.12.002 Song X, Wei,Y, Xiao D, Gong K, Sun P, Ren Y, Yuan J, Wu T, Yang Q, Li X, Nie F, Li N, Feng S, Pei Q, Yu T, Zhang C, Liu T, Wang X, & Yang J (2021). Brassica carinata genome characterization clarifies U's triangle model of evolution and polyploidy in Brassica. Plant physiology, 186(1), 388–406. https://doi.org/10.1093/plphys/kiab048 Strahl B, Allis C (2000). The language of covalent histone modifications. Nature 403, 41–45. https://doi.org/10.1038/47412 Stroud H, Otero S, Desvoyes B, Ramírez-Parra E, Jacobsen SE, & Gutierrez C (2012). Genome-wide analysis of histone H3.1 and H3.3 variants in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 109(14), 5370–5375. https://doi.org/10.1073/pnas.1203145109 Talbert PB, & Henikoff S (2020). What makes a centromere? Experimental cell research, 389(2), 11189 5.https://doi.org/10.1016/j.yexcr.2020.111895 Talbert PB, & Henikoff S (2021). Histone variants at a glance. Journal of cell science, 134(6), jcs24474 9. https://doi.org/10.1242/jcs.244749 Tamura K, Stecher G, & Kumar S (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular biology and evolution , 38 (7), 3022–3027. https://doi.org/10.1093/molbev/msab120 Tan Z, Han X, Dai C, Lu S, He H, Yao X, Chen P, Yang C, Zhao L, Yang Q Y, Zou J, Wen J, Hong D, Liu C, Ge X, Fan C, Yi B, Zhang C, Ma C, Liu K, … Zhao H (2024). Functional genomics of Brassica napus : Progresses, challenges, and perspectives. Journal of integrative plant biology, 66(3), 484–509. https://doi.org/10.1111/jipb.13635 Tang H, Zhang X, Tong C, Chalhoub B, Liu S, Lyons E (2018). From Alpha-Duplication to Triplication and Sextuplication. In: Liu S, Snowdon R, Chalhoub B (eds) The Brassica napus Genome. Compendium of Plant Genomes. Springer, Cham. https://doi.org/10.1007/978-3-319-43694-4_5 Truon, DM, & Boeke JD (2017). Resetting the Yeast Epigenome with Human Nucleosomes. Cell, 171(7), 1508–1519.e13. https://doi.org/10.1016/j.cell.2017.10.043 Wang H, Hou H, Jan CC, & Chao WS (2023). Irradiated Pollen-Induced Parthenogenesis for Doubled Haploid Production in Sunflowers (Helianthus spp.). Plants (Basel, Switzerland), 12(13), 2430. https://doi.org/10.3390/plants12132430 Wang N, Xia X, Jiang T, Li L, Zhang P, Niu L, Cheng H, Wang K, &Lin H (2022). Inplanta haploid induction by genome editing of DMP in the model legume Medicago truncatula. Plant biotechnology journal, 20(1), 22–24. https://doi.org/10.1111/pbi.13740 Wang Y, Li Y, Zhou F, Zhang L, Gong J, Cheng C, Chen J, & Lou Q (2023). Genome-wide characterization, phylogenetic and expression analysis of Histone gene family in cucumber (Cucumis sativus L.). International journal of biological macromolecules, 230, 123401. https://doi.org/10.1016/j.ijbiomac.2023.123401 Wang Y, Wu J, Yang S, Li X, Wang J, Lv Q, Zhu X, Lu G, Zhang J, Shen W H, Liu B, Lin J, & Dong A (2025). Structural and functional interrelationships of histone H2A with its variants H2A.Z and H2A.W in Arabidopsis. Structure (London, England: 1993), S0969-2126(25)00149-2. Advance online publication. https://doi.org/10.1016/j.str.2025.04.015 Wang Z, Chen M, Yang H et al. (2023). A simple and highly efficient strategy to induce both paternal and maternal haploids through temperature manipulation. Nat. Plants 9,699-705.https://doi.org/10.1038/s41477-023-01389-x Watanabe R, Hara M, Okumura EI, Hervé S, Fachinetti D, Ariyoshi M, & Fukagawa T (2019). CDK1-mediated CENP-C phosphorylation modulates CENP-A binding and mitotic kinetochore localization. The Journal of cell biology, 218(12), 4042–4062. https://doi.org/10.1083/jcb.201907006 Woo YH, & Li WH (2012). Evolutionary conservation of histone modifications in mammals. Molecular biology and evolution , 29 (7), 1757–1767. https://doi.org/10.1093/molbev/mss022 Xie J, Chen Y, Cai G, Cai R, Hu Z, Wang H (2023). Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees. Nucleic acids research, 51(W1), W587–W592. https://doi.org/10.1093/nar/gkad359 Xin X, Su T, Li P, Wang W, Zhao X, Yu Y, Zhang D, Yu S, & Zhang F (2021). A histone H4 gene prevents drought-induced bolting in Chinese cabbage by attenuating the expression of flowering genes. Journal of experimental botany , 72 (2), 623–635. https://doi.org/10.1093/jxb/eraa452 Yao P, He Q, Wang Y, Sun D, Chen X, & Lu L (2024). Genome-wide profiling and functional study of short N-terminal H2B variants in Arabidopsis. Journal of advanced research , S2090-1232(24)00557-5. Advance online publication. https://doi.org/10.1016/j.jare.2024.12.001 Yang Z, Wang S, Wei L, Huang Y, Liu D, Jia Y, Luo C, Lin Y, Liang C, Hu Y, Dai C, Guo L, Zhou Y, & Yang Q Y (2023). BnIR: A multi-omics database with various tools for Brassica napus research and breeding. Molecular plant, 16(4), 775–789. https://doi.org/10.1016/j.molp.2023.03.007 Yu Y, Wang S, Wang Z, Gao R, & Lee J (2023). Arabidopsis thaliana : a powerful model organism to explore histone modifications and their upstream regulations. Epigenetics , 18 (1). https://doi.org/10.1080/15592294.2023.2211362 Zargar M, Zavarykina T, Voronov S, Pronina I, & Bayat M (2022). The Recent Development in Technologies for Attaining Doubled Haploid Plants In Vivo. Agriculture , 12 (10), 1595. https://doi.org/10.3390/agriculture12101595 Zhang H, Wang P, Hou H, Wen H, Zhou H, Gao F, Wu J, Qiu Z, & Li L (2016). Histone Modification Is Involved in Okadaic Acid (OA) Induced DNA Damage Response and G2-M Transition Arrest in Maize. PloS one , 11 (5), e0155852. https://doi.org/10.1371/journal.pone.0155852 Zhao F, Zhang H, Zhao T, Li Z, & Jiang D (2021). The histone variant H3.3 promotes the active chromatin state to repress flowering in Arabidopsis. Plant physiology , 186 (4), 2051–2063. https://doi.org/10.1093/plphys/kiab224 Zhao T, Lu J, Zhang H et al. (2022). Histone H3.3 deposition in seed is essential for the post-embryonic developmental competence in Arabidopsis . Nat Commun 13 , 7728. https://doi.org/10.1038/s41467-022-35509-6 Zhao X, Yuan K, Liu Y, Zhang N, Yang L, Zhang Y, Wang Y, Ji J, Fang Z, Han F, & Lv H (2022). In vivo maternal haploid induction based on genome editing of DMP in Brassica oleracea. Plant biotechnology journal , 20 (12), 2242–2244. https://doi.org/10.1111/pbi.13934 Zhu J, Cheng KCL & Yuen KWY (2018). Histone H3K9 and H4 Acetylations and Transcription Facilitate the Initial CENP-A HCP−3 Deposition and De Novo Centromere Establishment in Caenorhabditis elegans Artificial Chromosomes. Epigenetics &Chromatin 11 , 16. https://doi.org/10.1186/s13072-018-0185-1 Zong W, Yang J, Fu J, & Xiong L (2020). Synergistic regulation of drought-responsive genes by transcription factor OsbZIP23 and histone modification in rice. Journal of integrative plant biology , 62 (6), 723–729. https://doi.org/10.1111/jipb.12850 Additional Declarations No competing interests reported. Supplementary Files ESM1.xlsx ESM2.xlsx ESM3.docx ESM4.xlsx Cite Share Download PDF Status: Published Journal Publication published 23 Mar, 2026 Read the published version in Plant Molecular Biology Reporter → Version 1 posted Editorial decision: Revision requested 04 Jan, 2026 Reviews received at journal 15 Dec, 2025 Reviews received at journal 11 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers agreed at journal 07 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers agreed at journal 03 Dec, 2025 Reviewers invited by journal 03 Dec, 2025 Editor assigned by journal 18 Nov, 2025 Submission checks completed at journal 18 Nov, 2025 First submitted to journal 14 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8114797","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":555117768,"identity":"cd0271df-9293-4782-ab32-f837f7172e4a","order_by":0,"name":"Fengwu Xie","email":"","orcid":"","institution":"Hunan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Fengwu","middleName":"","lastName":"Xie","suffix":""},{"id":555117769,"identity":"d637bc17-ce9a-43cc-9a5d-ab5bd9f25465","order_by":1,"name":"Chunjun He","email":"","orcid":"","institution":"Hunan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Chunjun","middleName":"","lastName":"He","suffix":""},{"id":555117770,"identity":"f1280f56-d4c6-4702-91d4-132a64d2145e","order_by":2,"name":"Ying Huang","email":"","orcid":"","institution":"Hunan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Huang","suffix":""},{"id":555117771,"identity":"1f26c05f-98a2-4922-8bd2-565e5008c4be","order_by":3,"name":"Shuxiang Mao","email":"","orcid":"","institution":"Hunan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shuxiang","middleName":"","lastName":"Mao","suffix":""},{"id":555117772,"identity":"b0368a60-7d66-49d6-bc95-b0ac48039e13","order_by":4,"name":"Mingli Yan","email":"","orcid":"","institution":"Hunan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mingli","middleName":"","lastName":"Yan","suffix":""},{"id":555117773,"identity":"bd4e86f3-6638-4c8c-b1d4-c1a9046287f5","order_by":5,"name":"Lili Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBACPmYGxgMJBRJy9sebDxz48IMILWzMDAwHEgwkjBnOHEs8OLOHGC1AfIDBgCGx4YaP8WEONmK0sPMYHHhgYMHYOIPnw2EGHgZ5frEDhBwG1AJ0GDOzdO+GwwUWDIYzZycQp4WNTebshsMzeBgSDG4TqYWHRyLnwWEeNhK0AEEOA7Fa2ApAWgwMeI4ZAANZgrBf+PkPb3z4o6KufgN78+MPH37YyPNLE9CCDiRIUz4KRsEoGAWjADsAAIThP+dEXFB2AAAAAElFTkSuQmCC","orcid":"","institution":"Hunan University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Lili","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-11-14 12:55:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8114797/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8114797/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11105-026-01698-3","type":"published","date":"2026-03-23T16:10:21+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":97669847,"identity":"91af4595-1af8-4750-b12d-42c413e6947f","added_by":"auto","created_at":"2025-12-08 09:29:05","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13119821,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/e8cbe9f28c4b07e339ab2c5c.tif"},{"id":97506189,"identity":"f7ddc7dc-db03-470e-ae4c-20d9b2c2873b","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"tiff","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4909052,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/dc724335df6fc4144820dbaf.tiff"},{"id":97506209,"identity":"0f107dd4-ec5f-4e3a-be99-060d94262bef","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92759023,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/46ca6ca377135f830607bcfc.docx"},{"id":97506191,"identity":"9c1bdfc0-7d13-44b2-afab-746917d2144a","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23058620,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0d2ae9cbf0e5adc69c7a4b00.tif"},{"id":97506225,"identity":"dfe3ca6f-e147-483f-a7a8-e50ad78d6c6b","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"tiff","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":787809,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/1d19054faf28b9aed26c61a9.tiff"},{"id":97506220,"identity":"430bd48b-aebe-4be6-8b11-d55eb7eb1229","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12131,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f84a6f64db8572e790479df9.xlsx"},{"id":97506174,"identity":"e97a4465-843a-4854-8a43-66762bcc5d3a","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":522156,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5A.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/e5a510c6f7feb5ae618926c8.png"},{"id":97670452,"identity":"9a29fdb1-1831-4144-b291-c4d9eaaade1c","added_by":"auto","created_at":"2025-12-08 09:30:42","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9707,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/028596a15e5f7b9d1006d0a8.xlsx"},{"id":97671722,"identity":"8a9860ee-34f8-4b17-98cb-87b8e4a3521c","added_by":"auto","created_at":"2025-12-08 09:32:59","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12066476,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5B.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0be0321af23cd69c9e64dcf3.tif"},{"id":97670497,"identity":"cd9ddea8-de59-42b4-ab75-ea78a07df222","added_by":"auto","created_at":"2025-12-08 09:30:48","extension":"tiff","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":633049,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0d49c1fd0ccd18686bc7b591.tiff"},{"id":97669441,"identity":"7108cd0b-4bee-4e52-be4f-5ac4f2a9eccf","added_by":"auto","created_at":"2025-12-08 09:28:00","extension":"tiff","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1843285,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/41b675d6bded5867ec6fedf9.tiff"},{"id":97669920,"identity":"64de4f4b-aace-4013-97f3-bb35c2b21f1a","added_by":"auto","created_at":"2025-12-08 09:29:24","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13014116,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.8.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/d5d173e3e4bf997fa3279a46.tif"},{"id":97669353,"identity":"6c75a6fc-1597-4007-a235-99c9689adff4","added_by":"auto","created_at":"2025-12-08 09:27:50","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22724560,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.9.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/5d5783a576c943943c7d8977.tif"},{"id":97893292,"identity":"26394e32-4717-4b7d-aad1-13a081d55069","added_by":"auto","created_at":"2025-12-10 15:29:46","extension":"json","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7336,"visible":true,"origin":"","legend":"","description":"","filename":"4309d2297e8446cf91bf9d7c6bf80c92.json","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/dd62941802a86fb0368732cf.json"},{"id":97671814,"identity":"69dc47ab-f643-42b5-b3f0-44511bc05a36","added_by":"auto","created_at":"2025-12-08 09:33:08","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25793,"visible":true,"origin":"","legend":"","description":"","filename":"ESM1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/af0ace8b3538f2889b0010b4.xlsx"},{"id":97506201,"identity":"ceef0ff6-0723-4e2d-95bb-cc6448e851fa","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"xlsx","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24504,"visible":true,"origin":"","legend":"","description":"","filename":"ESM2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/fbe8db93cdcc5987f2c5c6b6.xlsx"},{"id":97671968,"identity":"70bd612a-2bf5-419a-88ea-49912c9f4a01","added_by":"auto","created_at":"2025-12-08 09:33:33","extension":"docx","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3386391,"visible":true,"origin":"","legend":"","description":"","filename":"ESM3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/a7efea56bba87f21f80084a4.docx"},{"id":97506200,"identity":"3544bdc6-656e-4ade-aa0f-351a2cc6b57c","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"xlsx","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33811,"visible":true,"origin":"","legend":"","description":"","filename":"ESM4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/008bc93ea40567f0d40c8400.xlsx"},{"id":97506190,"identity":"8a29ba5e-3638-4a9f-811a-71edb5cb3bec","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":210692,"visible":true,"origin":"","legend":"","description":"","filename":"4309d2297e8446cf91bf9d7c6bf80c921enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/b6e1f0df5e3b51a477c3dd4c.xml"},{"id":97669578,"identity":"c0bca0d3-7da4-4165-a5c9-630381a6e3fa","added_by":"auto","created_at":"2025-12-08 09:28:16","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13119821,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f0567026c91e8cf67a0aa6c7.tif"},{"id":97506184,"identity":"5a04961b-c836-441d-a449-4189e7d91cf4","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"tiff","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4909052,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/30c958067fb6b292f3e3f9b1.tiff"},{"id":97506183,"identity":"bed1a4e1-e364-47e3-a3ff-54e806294095","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23058620,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/84445b5f2a27f48542931e7e.tif"},{"id":97506211,"identity":"82427b0b-bf7a-4fde-b2ae-f5851a7c9b2b","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"tiff","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":787809,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/1486da96f13c67d3bbd6211f.tiff"},{"id":97506186,"identity":"787ea537-dc4a-4174-a702-f8a35db4b1d6","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":522156,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5A.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/10fa2d1fab5f8922205585be.png"},{"id":97506216,"identity":"15e88314-ed16-413e-bf72-78e52831794b","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"tif","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12066476,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5B.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/3bf1abe3aea7373b149bb5ab.tif"},{"id":97670416,"identity":"6c9766c9-a4eb-4646-9111-3afdd6721e22","added_by":"auto","created_at":"2025-12-08 09:30:36","extension":"tiff","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":633049,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/a1cbc8f89e6ace809eb9ab57.tiff"},{"id":97506197,"identity":"f54c1321-3882-49ae-bd69-6be292d90360","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"tiff","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1843285,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tiff","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/e26466bea2153ecfc5f919f6.tiff"},{"id":97671055,"identity":"91aa1a6d-218b-4645-8c34-99583556d0cc","added_by":"auto","created_at":"2025-12-08 09:31:48","extension":"tif","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13014116,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.8.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/edc7ac1c3e73412b6a05e1ea.tif"},{"id":97506228,"identity":"9871c2fd-023a-4dd1-aa3f-9bd3e94728c4","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"tif","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22724560,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.9.tif","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f254f9e0649af45d42c6ab07.tif"},{"id":97671829,"identity":"8db03b61-1309-4ae4-b607-005a01944bfa","added_by":"auto","created_at":"2025-12-08 09:33:09","extension":"jpeg","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23058620,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/50f25b0c016afabc53569b1d.jpeg"},{"id":97893048,"identity":"d077e1c1-e380-4413-b11d-664f1687dc6b","added_by":"auto","created_at":"2025-12-10 15:26:17","extension":"jpeg","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13119821,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/49005fa1926caa4f27eddd40.jpeg"},{"id":97671355,"identity":"2a4d2855-aa67-4197-9eac-c2aed569d04f","added_by":"auto","created_at":"2025-12-08 09:32:31","extension":"jpeg","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":787809,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/4f2d32f87530171c87d8cab1.jpeg"},{"id":97506192,"identity":"6c0b4fbd-b01d-464b-baeb-f84ed3754ca6","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"jpeg","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4909052,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/1e3a6429bef947be224f6669.jpeg"},{"id":97506227,"identity":"f00857d0-a19d-46d3-9ebe-29beacc899f9","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"jpeg","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1048271,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0f236bdb439bf1e002974dd1.jpeg"},{"id":97506202,"identity":"72c76475-1082-4933-8207-8bbcfa213efc","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"jpeg","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":633049,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/059f22080fd0c1ec4fe7c7dc.jpeg"},{"id":97506226,"identity":"f2b0287c-c281-4817-88b3-3f8481cb48eb","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"jpeg","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1843285,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/403629e44e3c8a3df837e9a5.jpeg"},{"id":97669944,"identity":"1bc73d9e-02d1-4df7-84de-8924ed263078","added_by":"auto","created_at":"2025-12-08 09:29:25","extension":"jpeg","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13014116,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/9fbcba6c9e16fd7b00bf82cd.jpeg"},{"id":97506223,"identity":"afbfbcec-f893-4019-8c94-873d1d5bd9e4","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"jpeg","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22724560,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/d745031c245dad7de7a0a359.jpeg"},{"id":97670513,"identity":"0504cad1-5c65-4d9f-89ae-68ba18f8b036","added_by":"auto","created_at":"2025-12-08 09:30:50","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1951058,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/4a583952bb6d06c92d49ec9e.png"},{"id":97506238,"identity":"9cfd3bb6-3ffd-486a-b6d9-7d53e4d414c9","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":729872,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/e8a878e9e6dfc46d36949bfb.png"},{"id":97506194,"identity":"42d7c7a7-71c6-4201-a6ca-e8d4389a8985","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1082860,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/c80661e399c2da4bfe62cdeb.png"},{"id":97506235,"identity":"020ee2ce-1666-497b-adbf-a6a34ca6fd74","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":188281,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/fe0964ecc72f73b7581c4eee.png"},{"id":97506214,"identity":"3ad2f4a7-2505-42df-aaf9-d952021e4779","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":96055,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5A.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/00169c1efd61860b1199ff4b.png"},{"id":97506205,"identity":"972e0f1b-c583-4903-be6f-0b4b6e01eda2","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1389303,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5B.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/620c5a7d3d282a9b10c39116.png"},{"id":97506255,"identity":"a8ae8e95-8ae0-425c-bab0-05740f84cd63","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122577,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/a1d3dcb3f02f6497736ce886.png"},{"id":97506198,"identity":"9ad82042-ed59-46d2-bd5a-b805d42b37b3","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":268433,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/35920f45cd8052fa2da93bba.png"},{"id":97670430,"identity":"1e74c3de-a24c-4d56-aabb-a3936899ae79","added_by":"auto","created_at":"2025-12-08 09:30:39","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":950826,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/fd0516e163c99bf801e7ddfc.png"},{"id":97671938,"identity":"d596870e-b8e2-4e4a-b227-5eb399c603e1","added_by":"auto","created_at":"2025-12-08 09:33:24","extension":"png","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1778549,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.9.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/6d88d7fd07bc7ef069c8b361.png"},{"id":97670159,"identity":"c72fd510-a3e7-4ec0-ab29-0ee77310f5e8","added_by":"auto","created_at":"2025-12-08 09:29:46","extension":"png","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1082860,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/340985034fa6f67a11152e03.png"},{"id":97506243,"identity":"d7720a92-adf7-4c5a-b750-303f67a740b2","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":49,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1951058,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0bbd9c9851f970c90e442098.png"},{"id":97670526,"identity":"acdfa1e9-84fd-4511-aa14-f9d554ac3c0b","added_by":"auto","created_at":"2025-12-08 09:30:51","extension":"png","order_by":50,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":188281,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/a2f932b0ec3b6ff4c3443962.png"},{"id":97506233,"identity":"72a6f722-45e1-42ae-9446-19e3eb483863","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":51,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":729872,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/b17847075281f76c5b78b02f.png"},{"id":97506222,"identity":"7cc45cae-a82a-4a63-a1c6-1b9389a71113","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":52,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":262474,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/4dfa26b622be26e5f9445240.png"},{"id":97506230,"identity":"06dece6d-26b1-4819-a2d0-11985526511c","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"png","order_by":53,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122577,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/362389f30802c234bde67b5c.png"},{"id":97506218,"identity":"569c0cd4-cfa6-460c-8780-e7c405cfcd43","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"png","order_by":54,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":268433,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/d5d6d6a3b370f3516d39fc8d.png"},{"id":97671564,"identity":"73a5fe11-08cc-4a1c-b1d1-a44ad51bb1a1","added_by":"auto","created_at":"2025-12-08 09:32:45","extension":"png","order_by":55,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":950826,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/4c6f035dffda33b28dcb5bbd.png"},{"id":97670155,"identity":"2b2f5ddd-024c-4802-9753-1ead443eaf4f","added_by":"auto","created_at":"2025-12-08 09:29:46","extension":"png","order_by":56,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1778549,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f5720ce83f09e6ac892e826e.png"},{"id":97506215,"identity":"af363d35-0fbd-4d45-a374-bfe8d622ac65","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"xml","order_by":57,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":210029,"visible":true,"origin":"","legend":"","description":"","filename":"4309d2297e8446cf91bf9d7c6bf80c921structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/71aa13a7b733d8361ae273cb.xml"},{"id":97506254,"identity":"39a2b0ea-de16-4540-8b91-73dc3b568d27","added_by":"auto","created_at":"2025-12-05 08:18:36","extension":"html","order_by":58,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224713,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/ac323440c8b7f1cd2a3a743d.html"},{"id":97506171,"identity":"07fe1a4a-6164-4d94-baef-6b8df33e661c","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1361439,"visible":true,"origin":"","legend":"\u003cp\u003eThe location of genes on chromosomes.\u003cstrong\u003e \u003c/strong\u003eA: There are 32 histone genes among the 10 A chromosomes. B: There are 53 histone genes in the 9 C chromosomes. The chromosome colors in the figure represent the gene density at that position. Blue indicates a low density, while yellow and orange gradually increase in density, and red indicates a high density\u003c/p\u003e","description":"","filename":"Fig.1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/51be6b2f079c09232c74ad18.jpg"},{"id":97506178,"identity":"c5067923-3060-4642-8662-f071fcf3abfa","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7359412,"visible":true,"origin":"","legend":"\u003cp\u003eSpecies evolutionary tree of \u003cem\u003eB. napus\u003c/em\u003e, \u003cem\u003eB. rapa\u003c/em\u003e, \u003cem\u003eB. oleracea\u003c/em\u003e, and \u003cem\u003eA. thaliana\u003c/em\u003e, and stacked bar graph of the number of cis-acting regulatory elements (CAREs) contained in each gene. The CHF was divided into four subfamilies: H2A, H2B, H3, and H4. Some CAREs with a large quantity (number \u0026gt; 100) were selected for display. The length of the bars represents the quantity, and the colors are used to distinguish different CAREs\u003c/p\u003e","description":"","filename":"Fig.2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/dac01dc6f9880a8dac3eccd6.jpg"},{"id":97506180,"identity":"533eff6d-a5fd-4b7b-8243-83f6a1243153","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2618706,"visible":true,"origin":"","legend":"\u003cp\u003eComprehensive display diagram of phylogenetic tree, motifs, predicted domains, and gene structures for 86 core histone genes in \u003cem\u003eB. napus\u003c/em\u003e. A: Phylogenetic tree of the core histone family; B: Motifs of core histones and their positions, where each small box represents a motif and the position of the box indicates its relative location in the protein; C: Predicted domains of core histones via NCBI; D: Gene structure diagram of core histones, with numbers indicating the number of introns at each site\u003c/p\u003e","description":"","filename":"Fig.3.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/6f5b878a5b16eb31912f79ed.jpg"},{"id":97670106,"identity":"6c4c7a43-19fb-4972-9156-af841682c46c","added_by":"auto","created_at":"2025-12-08 09:29:41","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4054325,"visible":true,"origin":"","legend":"\u003cp\u003eInterspecific collinearity analysis among \u003cem\u003eB. napus\u003c/em\u003e and its diploid ancestors \u003cem\u003eB. oleracea\u003c/em\u003e and \u003cem\u003eB. rapa\u003c/em\u003e. Lines denote homologous gene pairs between species, with the junctions of lines and species chromosomes indicating the relative positions of genes on chromosomes. Line colors represent their subfamilies: green for H2B, purple for H3, yellow for H4, and blue for H2A\u003c/p\u003e","description":"","filename":"Fig.4.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/207141313da4d4f952bad244.jpg"},{"id":97669430,"identity":"80a5bd77-b518-42a0-9549-22837619ba1b","added_by":"auto","created_at":"2025-12-08 09:27:56","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":263719,"visible":true,"origin":"","legend":"\u003cp\u003eIntraspecific collinearity analysis in \u003cem\u003eB. napus\u003c/em\u003e. A: Chromosomal visualization of collinear gene arrangements in linear format. Green straight lines denote segmental duplications, while green curves indicate tandem duplications. B: Chromosomal representation of collinear gene pairs in circular format. Color coding: green for H2B, purple for H3, yellow for H4, and blue for H2A\u003c/p\u003e","description":"","filename":"Fig.5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f1dea7fec10f252cd78c5907.jpg"},{"id":97670400,"identity":"e6c218b3-2cfd-4c08-becb-5238f6ec0480","added_by":"auto","created_at":"2025-12-08 09:30:32","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1686997,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution map of CAREs in 86 members of the core histone family in \u003cem\u003eB. napus\u003c/em\u003e.\u003cstrong\u003e \u003c/strong\u003eThe positions of colored blocks in the figure indicate the C-terminal 20 bp regions of these CAREs. CCRE: cell cycle regulatory element; ABRE: abscisic acid regulatory element; ARE: auxin regulatory element; LRE: light regulatory element; MeJA: MeJA-responsiveness elements; SARE: salicylic acid regulatory element; MBS: MYB binding site; DSRE: defense and stress regulatory element; LTR: low temperature responsiveness\u003c/p\u003e","description":"","filename":"Fig.6.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/5f2799ba44830744a8a7daf0.jpg"},{"id":97506203,"identity":"1c32344f-90e6-45bb-a4b3-747914416b9e","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2882637,"visible":true,"origin":"","legend":"\u003cp\u003eSpatiotemporal expression heat map of transcriptome for H3 subfamily members in\u0026nbsp;\u003cem\u003eB. napus\u003c/em\u003e Data in the figure are log\u003csub\u003e10 \u003c/sub\u003e(raw data + 1). Color gradient from blue to red indicates increasing expression levels. DAF: days after flowering. Leaf_1 to leaf_10 represent the number of leaves at different stages of plant growth\u003c/p\u003e","description":"","filename":"Fig.7.tiff.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/74b5afd642f9f0519fc422b9.jpg"},{"id":97670505,"identity":"ebcc2ab6-0301-4f89-a290-40383422dc9c","added_by":"auto","created_at":"2025-12-08 09:30:49","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":837775,"visible":true,"origin":"","legend":"\u003cp\u003eVectors used for subcellular localization. Left: p1300-eGFP-6290 represents the vector map of the gene BnapChr9G00266290.1. Right: p1300-eGFP-9680 represents the vector map attached to the gene BnapChr18G00829680.1\u003c/p\u003e","description":"","filename":"Fig.8.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/675e2f194301ea32a0799469.jpg"},{"id":97506193,"identity":"c444c7ef-1e87-4e6a-bc0c-34995e351ea9","added_by":"auto","created_at":"2025-12-05 08:18:35","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":6991628,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of the two CENH3 genes in 20b.\u003cstrong\u003e \u003c/strong\u003eGFP::20B-80 indicates that the GFP vector is connected to BnapChr18G00829680.1. GFP::20B-90 indicates that the GFP vector is connected to BnapChr9G00266290.1; Empty vector (GFP) indicates that the GFP is empty and not connected to other genes, existing as a control\u003c/p\u003e","description":"","filename":"Fig.9.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/581d65f445cd8843216b7f31.jpg"},{"id":105754968,"identity":"1e35da8d-e0d1-45fd-bbbd-84c0f97083c3","added_by":"auto","created_at":"2026-03-30 16:23:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":29067387,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/3be1be28-7abd-4a1c-9c18-baacfe273e5a.pdf"},{"id":97506177,"identity":"4ffbf6c2-ab8c-4901-ae38-083963384374","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":25793,"visible":true,"origin":"","legend":"","description":"","filename":"ESM1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/6bea8e28c52c3956af61ef84.xlsx"},{"id":97506173,"identity":"ccface3d-9309-4c0e-a2ef-88512f6c59c8","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":24504,"visible":true,"origin":"","legend":"","description":"","filename":"ESM2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/0f7067395cf8167c003635ba.xlsx"},{"id":97669436,"identity":"4a3f0b4d-66ab-47a9-88b9-c08696495e81","added_by":"auto","created_at":"2025-12-08 09:27:59","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":3386391,"visible":true,"origin":"","legend":"","description":"","filename":"ESM3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/bb722efc2eb758bac7542c7b.docx"},{"id":97506181,"identity":"686cc8f5-8072-4979-b3f5-605e87cf4f71","added_by":"auto","created_at":"2025-12-05 08:18:34","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":33811,"visible":true,"origin":"","legend":"","description":"","filename":"ESM4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8114797/v1/f83b92f9d0a78afd22db39c9.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome-wide Analysis of Core Histone Genes and Expression Dynamics of the H3 subfamily in Brassica napus","fulltext":[{"header":"Key massage\t","content":"\u003cp\u003e1. Annotated 86 CHF genes in \u003cem\u003eB. napus\u003c/em\u003e and clarified the \u0026quot;core conservation and variant differentiation\u0026quot; feature.\u003c/p\u003e\n\u003cp\u003e2. Revealed that CHF has undergone polyploidization, and \u003cem\u003eB. napus\u003c/em\u003e preferentially retains CHF genes from the C-genome of \u003cem\u003eB. oleracea\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e3. Discovered that \u003cem\u003eCENH3\u003c/em\u003e forms a distinct evolutionary clade, localizes to chromosomes, and is indispensable for cell division.\u003c/p\u003e\n\u003cp\u003e4. Identified that CHF contain 21 types of cis-acting elements and clarified their involvement in the \u0026quot;light-hormone-stress\u0026quot; regulatory network.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eCore histone family (CHF, including H2A, H2B, H3, and H4) is the core constituents of eukaryotic chromatin, playing critical roles in gene expression modulation, chromatin homeostasis, DNA repair, and cell cycle regulation (Kamakaka and Biggins \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). These proteins assemble into an octamer structure and interact with DNA to form the fundamental chromatin unit \u0026mdash; the nucleosome \u0026mdash; around which\u0026thinsp;~\u0026thinsp;147 bp of DNA is wrapped, a structure highly conserved across evolution, exhibiting striking sequence homology among core histones from yeast to humans (Strahl and Allis \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Beyond their primary DNA packaging function, core histones exhibit significant functional diversification through variants. These histones achieve functional diversification in processes such as DNA repair, transcription, and cell differentiation via structural polymorphisms, post-translational modifications, and spatiotemporal deposition patterns (Talbert and Henikoff \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). While core histone structures were elucidated early, the complexity arising from numerous variants has historically directed research efforts towards individual types, leaving inter-variant structural and functional relationships less explored. Studies in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (\u003cem\u003eA. thaliana\u003c/em\u003e) characterized specific H2B variants (snH2Bs) that are pivotal for growth, reproduction, and histone modification crosstalk (Yao et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), revealed the structural-functional interrelationships between H2A and its variants H2A.Z/H2A.W (Wang et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), and disclosed synergistic roles of H2A.Z and non-classical H3K4me3 (ncH3K4me3) in mouse oocytes (Mei et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDouble haploid (DH) technology, a linchpin of contemporary plant breeding, expedites the establishment of fully homozygous lines. This approach entails the induction of haploids (individuals with gametic chromosome complement) followed by chromosome set duplication, thereby yielding 100% homozygous diploids within a single generation. This bypasses the need for prolonged inbreeding, proving especially valuable for species with self-incompatibility or complex genetics (Zargar et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The principle of DH technology hinges on two cardinal steps. First, haploid induction (HI), which entails generating haploids from diploid plants via specialized methodologies including anther culture, microspore culture, gynogenesis, radiation-induced mutagenesis, and interspecific hybridization (Devaux \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Lantos et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Marin-Montes et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Mangal et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Second, chromosome doubling, involving the use of chemical agents such as colchicine or physical approaches like low-temperature treatment to duplicate the chromosome number of haploid cells, thereby restoring diploidy. Significantly, the resultant diploids are homozygous as they develop directly from haploid progenitors (Prem et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Sharma et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). DH technology has exhibited substantial potential in crop breeding, yet its implementation across diverse crops confronts notable challenges. For instance, marked disparities in HI efficiency exist among species and genotypes, while cost-effective generation of DH plants remains suboptimal for certain crops (Ferrie and Caswell \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Moreover, the molecular mechanisms underlying HI remain incompletely elucidated, imposing constraints on the technology's extrapolation to a broader range of crops. (Gilles et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The advent of CRISPR/Cas9 gene editing offers promising avenues for overcoming these limitations by enabling targeted in vivo HI (Wang et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Centromeric histone H3 (\u003cem\u003eCENH3\u003c/em\u003e), a branch of core histone H3, is responsible for maintaining the structural stability of chromosome centromeres (Kingston et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Fu et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Centromeres play a critical role in cell mitosis by binding to spindle fibers and being drawn to opposite poles, thereby facilitating chromosome segregation and cell division (Talbert and Henikoff \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The \u003cem\u003eCENH3\u003c/em\u003e protein is composed of a highly conserved C-terminal histone fold domain (HFD) and a divergent N-terminal tail (Lv et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The latter mediates species-specific centromere-kinetochore interactions, conferring functional roles in kinetochore assembly \u0026mdash; a protein complex mediating microtubule-centromere attachment that is critical for accurate chromosome segregation (Foley and Kapoor \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Meanwhile, interactions between \u003cem\u003eCENH3\u003c/em\u003e and other kinetochore proteins (e.g., \u003cem\u003eCENP-C\u003c/em\u003e and \u003cem\u003eKNL2\u003c/em\u003e) are crucial for its proper localization and functional execution at centromeres (Shono et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Sandmann et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These interactions are highly conserved in plants, underscoring the fundamental role of \u003cem\u003eCENH3\u003c/em\u003e in eukaryotic cell division and thereby making \u003cem\u003eCENH3\u003c/em\u003e a pivotal gene in both basic research and agricultural applications due to such interspecific conservation. \u003cem\u003eCENH3\u003c/em\u003e mutations lead to abnormal chromosome segregation and generate haploids, a phenomenon first discovered in \u003cem\u003eA. thaliana\u003c/em\u003e (Ravi and Chan \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Subsequently, researchers have successfully induced haploids in various species including wheat, maize, and rice through editing \u003cem\u003eCENH3\u003c/em\u003e (Lv et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Meng et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kalinowska et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In crops like maize and wheat, the creation of haploid and double haploid (DH) lines not only accelerates the breeding process but also facilitates the introgression of novel traits \u0026mdash; including disease resistance, drought tolerance, and increased yield \u0026mdash; into elite breeding lines.\u003c/p\u003e\u003cp\u003eAlthough HI has been successfully applied in diploids, a paucity of application cases exists in polyploids \u0026mdash; take \u003cem\u003eBrassica napus\u003c/em\u003e (\u003cem\u003eB. napus\u003c/em\u003e, AACC genome, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;4\u003cem\u003eX\u003c/em\u003e\u0026thinsp;=\u0026thinsp;38), the world\u0026rsquo;s second-largest oilseed crop, as an example. This species represents a classic allopolyploid formed through natural interspecific hybridization and genome doubling between its diploid progenitors, \u003cem\u003eBrassica rapa\u003c/em\u003e (\u003cem\u003eB. rapa\u003c/em\u003e, AA genome, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003eX\u003c/em\u003e\u0026thinsp;=\u0026thinsp;20) and \u003cem\u003eBrassica oleracea\u003c/em\u003e (\u003cem\u003eB. oleracea\u003c/em\u003e, CC genome, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003eX\u003c/em\u003e\u0026thinsp;=\u0026thinsp;18) (Chalhoub et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Borges et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Tan et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The allopolyploid genome retains ancestral features, offering unique insights into gene family evolution and functional diversification post-polyploidization. Although CHF is well-characterized in the model plant \u003cem\u003eA. thaliana\u003c/em\u003e, systematic comparative analyses in the \u003cem\u003eBrassica\u003c/em\u003e genus, particularly concerning the dynamic evolutionary relationships of CHF between tetraploid species and their diploid ancestors, are still insufficient (Stroud et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yao et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This study aims to bridge that gap by comprehensively identifying CHF members in \u003cem\u003eB. napus\u003c/em\u003e, \u003cem\u003eB. rapa\u003c/em\u003e, \u003cem\u003eB. oleracea\u003c/em\u003e, and \u003cem\u003eA. thaliana\u003c/em\u003e at the whole-genome level. Through integrated gene analyses of structure, phylogeny, collinearity, and selection pressure, it seeks to elucidate the evolutionary trajectory of CHF in Brassica, investigate the potential of \u003cem\u003eB. napus CENH3\u003c/em\u003e (\u003cem\u003eBnCENH3\u003c/em\u003e) genes for HI, and establish a foundation for developing efficient DH technology to accelerate genetic improvement and breeding in this vital crop. Future research will integrate transgenic technologies and bioinformatics approaches to clarify the precise mechanisms of \u003cem\u003eCENH3\u003c/em\u003e in \u003cem\u003eB. napus\u003c/em\u003e HI.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eIdentification of CHF Members\u003c/h2\u003e\u003cp\u003eThe protein dataset of \u003cem\u003eB. napus\u003c/em\u003e (ZS11.v0) was downloaded from BnIR (Yang et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; The website links are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, identical hereinafter). The CHF Hidden Markov Model (HMM, PF00125) was acquired from the InterPro database to identify 184 candidate members via HMMSEARCH against the \u003cem\u003eB. napus\u003c/em\u003e proteome (Blum et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Concurrently, protein sequences of \u003cem\u003eA. thaliana\u003c/em\u003e H2A (SM00414), H2B (SM00428), H3 (SM00427), and H4 (SM00417) were retrieved from the SMART database, followed by local BLAST searches (Letunic et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Extraction of the intersection between BLAST results and HMMSEARCH outputs yielded 86 CHF genes, with identical protocols applied to identify family members in the other three species (Online Resource 1).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePhysicochemical Property Analysis and Chromosomal Localization\u003c/h3\u003e\n\u003cp\u003eThe physicochemical properties of proteins\u0026mdash;encompassing amino acid (AA) count, molecular weight (MW), pI, instability index, aliphatic index, Grand Average of Hydropathicity (GRAVY), and hydrophilicity index\u0026mdash;were batch-analysed using the ProteinParamterCalc (ProtParam-based) function in TBtools (Chen et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Chromosomal localization of genes were visualized via the \"gene location visualize from GTF/GFF\" function in the same software.\u003c/p\u003e\n\u003ch3\u003ePhylogenetic Analysis of CHF\u003c/h3\u003e\n\u003cp\u003eMembers identified above were analysed using MEGA11 (Tamura et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Sequence alignment was performed with the Muscle program, and a phylogenetic tree was constructed via the Neighbor-Joining method (bootstrap set to 1000 replicates). The NWK file of the constructed tree was saved and subjected to visual refinement using the online platform Chiplot (Xie et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eAnalysis of Conserved Motifs, Protein Domains, and Gene Structures\u003c/h3\u003e\n\u003cp\u003eA total of 86 target proteins were screened from the \u003cem\u003eB. napus\u003c/em\u003e proteome, and motif analysis was performed using the MEME program with the number of predicted motifs set to 10 and other parameters at default settings (Bailey et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Subsequently, the type and location of conserved domains were determined via the Conserved Domain Database (CDD) on the NCBI website. Finally, an integrated visualization combining the phylogenetic tree, motif distribution, domain prediction, and gene structure was generated using TBtools to intuitively illustrate the evolutionary relationships among different family members.\u003c/p\u003e\n\u003ch3\u003eCis-Acting Regulatory Elements Prediction\u003c/h3\u003e\n\u003cp\u003eThe 2000 bp upstream sequences of the promoters of all CHF members were extracted using TBtools and submitted to the PlantCARE online tool for cis-acting regulatory elements (CAREs) prediction (Lescot et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The results were visualized using TBtools for further analysis.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eCollinearity and Selection Pressure Analysis\u003c/h2\u003e\u003cp\u003eThe syntenic relationships among core histone genes across \u003cem\u003eA\u003c/em\u003e. thaliana, B. rapa, \u003cem\u003eB. oleracea\u003c/em\u003e, and \u003cem\u003eB. napus\u003c/em\u003e were analyzed using the OneStepMCScanX-SuperFast plugin in TBtools, with visualization using the Comparative Genomics module. Concurrently, Advanced Circos in TBtools was employed to analyze and visualize intragenomic collinear relationships of CHF in B. napus. Additionally, TBtools was used to calculate the Ka/Ks (non-synonymous substitution rate/synonymous substitution rate) values of \u003cem\u003eB. napus\u003c/em\u003e CHF.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSubcellular Localization Prediction and Experimental Validation\u003c/h3\u003e\n\u003cp\u003eSubcellular localization of the identified \u003cem\u003eB. napus\u003c/em\u003e genes was predicted via the online platform WoLFPSORT, while validation experiments utilized \u003cem\u003eB. napus\u003c/em\u003e (cultivar 20B) and \u003cem\u003eNicotiana benthamiana\u003c/em\u003e, provided by the Hunan Institute of Crop Science. Transformed tobacco samples were observed under a laser confocal microscope borrowed from the Hunan Hybrid Rice Research Center.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe online website utilized in this article\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWebsite name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWebsite link\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWebsite name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWebsite link\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBnIR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://yanglab.hzau.edu.cn/BnIR\u003c/span\u003e\u003cspan address=\"https://yanglab.hzau.edu.cn/BnIR\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMEME\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://meme-suite.org/meme/\u003c/span\u003e\u003cspan address=\"https://meme-suite.org/meme/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInterPro\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/interpro/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/interpro/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCDD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSMART\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://smart.embl.de/\u003c/span\u003e\u003cspan address=\"https://smart.embl.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePlantCARE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinformatics.psb.ugent.be/webtools/plantcare/html/\u003c/span\u003e\u003cspan address=\"https://bioinformatics.psb.ugent.be/webtools/plantcare/html/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChiplot\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.chiplot.online/\u003c/span\u003e\u003cspan address=\"https://www.chiplot.online/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWoLFPSORT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://wolfpsort.hgc.jp/\u003c/span\u003e\u003cspan address=\"https://wolfpsort.hgc.jp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"RESULTS and ANALYSIS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003ePhysicochemical Property Analysis of CHF Genes\u003c/h2\u003e\u003cp\u003eAnalysis of physicochemical properties revealed the AA counts of the CHF ranged from 103 to 319 residues, with MW of 11.41\u0026ndash;35.38 kDa, additional data are given in Online Resource 1. Histone H4 consistently exhibited the smallest size (103 residues) across all examined species. Notably, the AA count, pI, and hydropathy index of H4 are perfectly conserved across the five species, indicating exceptional structural and functional constraints in Brassica species. This evolutionary stasis suggests that H4 performs indispensable cellular roles under intense negative selection pressure, where mutations altering its biophysical properties are likely deleterious. The H2B subfamily displayed the greatest variation in AA number: for example, the AA counts of H2B members in \u003cem\u003eB. napus\u003c/em\u003e ranged from 132 (BnH2B-12) to 319 (BnH2B-02). The pI value of these proteins ranged from 8.2 to 11.57 (average\u0026thinsp;~\u0026thinsp;10), except for BnH2B-01 in \u003cem\u003eB. napus\u003c/em\u003e (pI\u0026thinsp;=\u0026thinsp;6.95). Sequence alignment indicated that this member\u0026rsquo;s longer sequence potentially affects its spatial structure, alters overall charge properties, and decreases pI. All CHF members had negative hydropathy indices, classifying them as hydrophilic, and most were predicted to be labile \u0026mdash; possibly linked to their roles in maintaining chromatin structure and regulating chromatin loosening.\u003c/p\u003e\u003cp\u003e\u003cem\u003eB. napus\u003c/em\u003e harbored two CENH3 gene copies (BnH3-01, BnH3-02), whereas other species had only a single copy (AtH3-01, BoH3-01, BrH3-01). The AA counts and MW displayed minimal variation, averaging 181 AAs and 19.84 kDa, respectively. Notably, the mean pI value of BnCENH3 proteins reached as high as 11.5, the highest among the CHF, with instability in-dices higher than those of most H3 members and aliphatic indices lower than those of most H3 members. The high pI endows it with a substantial net positive charge under physiological conditions, facilitating its electrostatic association with the negatively charged DNA phosphate backbone and thereby promoting the formation of a more compact nucleosmal structure. At the molecular level, the high positive charge increases electrostatic interactions within chromatin fibers, compressing the distance between DNA strands and promoting the formation of a highly condensed structure in the centromere region (Grau et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Furthermore, the positively charged region of CENH3 might form a specialized structure to suppress acetylation modifications, thereby sustaining the transcriptionally repressed state of the centromere region and ensuring the precise assembly and function of kinetochore complexes (Zhu et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eChromosomal Distribution and Phylogenetic Analysis of CHF\u003c/h2\u003e\u003cp\u003eA total of 34 CHF genes were mapped to 10 A chromosomes, with distributions ranging from a single gene on ChrA04 to six genes on ChrA09 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Conversely, 53 CHF genes were distributed across all eight C chromosomes, exhibiting near-uniform density except for ChrC07 which contained only one gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). These findings demonstrate that \u003cem\u003eB. napus\u003c/em\u003e retains a higher number of histone genes from \u003cem\u003eB. oleracea\u003c/em\u003e than from \u003cem\u003eB. rapa\u003c/em\u003e, implying that \u003cem\u003eB. oleracea\u003c/em\u003e-derived genes exhibit a greater tendency to be preserved in \u003cem\u003eB. napus\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAccording to the subfamily classification criteria of the \u003cem\u003eA. thaliana\u003c/em\u003e CHF in prior investigations, histone genes of five species were categorized into four subfamilies \u0026mdash; H2A, H2B, H3, and H4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) (Wang Y et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The H2A and H2B subfamilies comprised 96 and 54 members, respectively, emerging as the most diversified subfamilies. Although the four subfamilies displayed relatively independent evolutionary trajectories, pronounced differentiation occurred within the three non-H4 subfamilies, giving rise to multiple variants with distinct functional profiles. This functional variation predominantly stemmed from gene duplication events, whereby duplicated genes acquired novel functions under selective pressure through mutational accumulation during long-term evolution, thereby driving functional diversification (Tang et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For instance, the H2A.Z variant exerts a critical function in remodeling chromatin and regulating gene expression, particularly in mediating responses to environmental fluctuations and developmental processes (Miao et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Conversely, the H2A.X variant is involved in DNA damage repair, with its phosphorylated form γ-H2A.X serving as a marker for DNA double-strand breaks (Fragkos et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The H2B.W variant is expressed during spermatogenesis, participating in chromatin structure remodeling and gene expression regulation (Ding et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The H3 subfamily encompasses multiple variants, including H3.1/H3.2, H3.3, CENP-A, and other specialized variants (Talbert and Henikoff \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sokolova et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). H3.1 and H3.2 are predominantly integrated into chromatin during DNA replication, thereby facilitating nucleosome assembly and chromatin stabilization. H3.3 functions as a replication-independent variant enriched in transcriptionally active and open chromatin domains, contributing to dynamic gene expression regulation, chromatin state maintenance, and cellular differentiation programs (Stroud et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePhylogenetic analysis demonstrates that \u003cem\u003eCENH3\u003c/em\u003e is the most distinct among these variants, having diverged from other H3 genes at an early evolutionary stage. It localizes specifically to the centromeric region of chromosomes, where it orchestrates centromere formation and chromosome segregation. Given that centromeres are critical for chromosome segregation during cell division, the early divergence of \u003cem\u003eCENH3\u003c/em\u003e indicates that centromeric functions were established and highly conserved early in eukaryotic evolution (Burrack and Berman \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThis implies that accurate centromere assembly and function are vital for cell viability, exerting strong selective pressure on the structural evolution of \u003cem\u003eCENH3\u003c/em\u003e and highlighting its functional distinctions from other H3 variants. Whereas \u003cem\u003eCENH3\u003c/em\u003e is classified as a histone H3 subtype, its exceptional specificity in centromeric localization and function enables it to replace classical H3 in centromeric regions and function as a platform for kinetochore assembly, recruiting other centromeric proteins to form kinetochores and supervise chromosome segregation during cell division (Foltz et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Watanabe et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ariyoshi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The functional diversification of these variants indicates that the CHF has evolved increased complexity through gene duplication and adaptive functional mutation. Moreover, these variants engage in complex epigenetic regulatory networks through post-translational modifications, exert crosstalk effects on other histones modifications, and dynamically modulate gene expression and chromatin architecture, thereby facilitating plant adaptability to environmental fluctuations (Nunez-Vazquez et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The phylogenetic analyses revealed that \u003cem\u003eB. oleracea\u003c/em\u003e-derived genes exhibited closer relationships with \u003cem\u003eB. napus\u003c/em\u003e, suggesting a predominant genetic contribution of \u003cem\u003eB. oleracea\u003c/em\u003e to the \u003cem\u003eB. napus\u003c/em\u003e genome. This genetic bias may culminate in preferential regulation of \u003cem\u003eB. oleracea\u003c/em\u003e-derived genes, a phenomenon that mirrors the expansion of \u003cem\u003eB. oleracea\u003c/em\u003e-originated genes during post-hybridization genome remodeling. This expansionary trend is potentially attributable to either the elevated adaptability of \u003cem\u003eB. oleracea\u003c/em\u003e alleles under environmental selection pressures or epigenetic inheritance patterns influenced by maternal effects.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eAnalysis of Conserved Motifs, Protein Domains, and Gene Structures\u003c/h2\u003e\u003cp\u003eAnalysis of CHF genes revealed that CHF encompasses Motif 1 and Motif 2, whereas H4 lacks Motif 4, and other motifs display high specificity among CHF members (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This indicates that these motifs may play critical roles in preserving the fundamental structure and function of the CHF. Notably, \u003cem\u003eBnCENH3\u003c/em\u003e exhibits marked structural disparities from other H3 histones. Motif 2, typically highly conserved in the CHF, is implying its importance in maintaining CHF functions. Nevertheless, \u003cem\u003eBnCENH3\u003c/em\u003e loses Motif 2 during evolution, potentially resulting in substantial structural and functional divergences from conventional H3 histones. Additionally, while H3 generally contains 0\u0026ndash;2 introns, \u003cem\u003eBnCENH3\u003c/em\u003e harbors four introns, further supporting the notion that \u003cem\u003eBnCENH3\u003c/em\u003e has undergone a distinct evolutionary trajectory. The increase in intron number might affect the gene expression, RNA splicing, and protein structure/function.\u003c/p\u003e\u003cp\u003eThese findings indicate that \u003cem\u003eBnCENH3\u003c/em\u003e has experienced accelerated evolution, exhibiting a distinct evolutionary pattern from canonical H3 histones, which underlies the structural and functional divergence from other H3 genes. This evolutionary divergence is likely associated with the specialized functions of \u003cem\u003eCENH3\u003c/em\u003e in centromeric regions. As a centromere-specific H3 variant, \u003cem\u003eCENH3\u003c/em\u003e plays indispensable roles in centromere establishment and maintenance, kinetochore assembly, and accurate chromosome segregation (Lipikhina et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Thus, structural variations in \u003cem\u003eBnCENH3\u003c/em\u003e might reflect its specialized adaptation to centromeric functions in \u003cem\u003eB. napus\u003c/em\u003e. Future investigations could further delineate how structural variations in \u003cem\u003eBnCENH3\u003c/em\u003e affect its binding affinity to centromeric DNA, its interaction with kinetochore proteins, and its regulation of chromosome segregation, to deepen our understanding of rapeseed centromere structure and function. Additionally, investigating the evolutionary forces shaping \u003cem\u003eBnCENH3\u003c/em\u003e, such as natural selection and genetic drift, will illuminate the contributions of centromeric proteins to species evolution.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCollinearity and Selection Pressure Analysis\u003c/h2\u003e\u003cp\u003eMulti-species collinearity analysis of \u003cem\u003eB. napus\u003c/em\u003e, \u003cem\u003eB. oleracea\u003c/em\u003e, and \u003cem\u003eB. rapa\u003c/em\u003e uncovered extensive collinear regions across their genomes, demonstrating a high level of structural homology among these species (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The widespread distribution of these collinear blocks supports the hypothesis that \u003cem\u003eB. oleracea\u003c/em\u003e and \u003cem\u003eB. rapa\u003c/em\u003e diverged from the same ancestral genome, which subsequently evolved into the current genomic structures via mechanisms including whole-genome triplication (WGT), chromosomal rearrangements, and local sequence variations. Notwithstanding prolonged independent evolution, the genomic architecture of pivotal gene clusters and CAREs exhibits remarkable conservation, putatively linked to the maintenance of core biological processes critical for species viability. This finding furnishes crucial evidence for deciphering the evolutionary trajectory of \u003cem\u003eBrassica\u003c/em\u003e species, illuminating the consequences of genome doubling events, and cross-species comparative mapping of genes underlying key agronomic phenotypes. Follow-up studies can excavate functional genes within collinear regions and integrate breakpoint analysis to decipher the dynamic processes of genome remodeling. Intra-specific collinearity analysis of CHF genes in \u003cem\u003eB. napus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) revealed extensive segmental duplication events, presumably driven by re-breaking and error repair of partial chromosomal regions after WGT, thereby driving the genomic repositioning and amplification of CHF loci. Observations of the tandem duplication events indicated that some genes in the CHF underwent continuous replication in local genomic regions. Tandem duplications might be caused by DNA replication slippage, transposon insertion, or other mechanisms. Evolutionary analysis based on Ka/Ks ratio metrics revealed that the CHF exhibited Ka/Ks values significantly below 1.00, indicating that the CHF has been under strong purifying selection during its evolutionary history, with additional data provided in Online Resource 2.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eCis-acting Regulatory Elements Prediction\u003c/h2\u003e\u003cp\u003eBesides the abundant core transcriptional elements (TATA-box and CAAT-box), we identified 21 major CAREs in the CHF, involving regulatory modules for plant growth and development, hormone signaling, and abiotic stress responses (Additional data are given in Online Resource 3). Growth- /development- associated elements included light response (2866 elements), cell cycle regulation (77 elements), endosperm expression (59 elements), meristem expression (102 elements), and circadian rhythm regulation (63 elements), which mainly modulate spatiotemporal growth processes (e.g., cell cycle organogenesis, metabolic homeostasis) to ensure optimal plant development under permissive conditions. Significantly, the abundant light-responsive elements enable plants to rapidly activate photosynthesis for growth.\u003c/p\u003e\u003cp\u003eHormone-responsive elements include those responsive to abscisic acid (709 elements), gibberellin (177 elements), auxin (244 elements), methyl jasmonate (MeJA; 1218 elements), salicylic acid (183 elements), etc. These elements modulate various plant growth and developmental processes via hormone-responsive gene regulation and play pivotal roles in stress responses. Numerous abiotic stress-responsive elements were identified for drought (179 elements), low temperature (236 elements), anaerobic condition (27 elements), hypoxia (660 elements), defense and stress (116 elements), enhancing plant stress resistance and adaptability to environmental changes. CAREs with high abundance (\u0026gt;100) were tallied and plotted in a stacked bar chart, providing an intuitive overview of their distribution pattern (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In \u003cem\u003eB. napus\u003c/em\u003e, 15 major CAREs were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), with their relative abundance following a similar trend to other species, predominantly comprising elements governing plant growth and development, and hormone signaling. Collectively, these results demonstrate that CHF plays a prominent role in plant growth and development, assisting plants in adapting to the environment and reproducing.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTissue-Specific Expression Analysis of H3 Genes in\u003c/b\u003e \u003cb\u003eB. napus\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSelect Heatmap from the Tools of BnIR. Input the IDs of the 86 histone genes that have been identified in Brassica napus. For the value, select log\u003csub\u003e10\u003c/sub\u003e(TPM\u0026thinsp;+\u0026thinsp;1), and leave the remaining parameters at their default values. After submission, a set of transcriptome data were obtained and are provided in Online Resource 4. H3 gene-related data were then screened to construct a spatiotemporal expression heatmap (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). In terms of expression levels, BnaA09T0694800ZS (BnH3-01) and BnaA09T0716200ZS (BnH3-02) exhibited significantly reduced expression \u003cem\u003ein planta\u003c/em\u003e compared to other H3 genes, whereas BnaC01T0011300ZS (BnH3-05) presented the highest expression level in the H3 subfamily. Focusing on spatiotemporal expression patterns, BnH3-01/02 exhibited elevated expression in tissues characterized by high cell division capacity, including 2-mm flower buds, seeds at \u0026le;\u0026thinsp;28 days after flowering (DAF), and \u0026le;\u0026thinsp;8-DAF siliques. Cell division represents a fundamental and indispensable process in plant growth and development, necessitating the coordinated regulation of numerous genes to ensure accurate chromosome replication and segregation (Jing et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The elevated expression profile of BnH3-01/02 in these tissues strongly indicates their distinctive and indispensable role in cytokinesis. In tissues characterized by robust mitotic activity, a substantial cohort of cells undergo chromosomal replication and disjunction, rendering the upregulated expression of BnH3-01/02 inherently essential for maintaining centromeric integrity and orchestrating chromosomal dynamics. To dissect the regulatory mechanisms underlying these expression divergences, a comprehensive analysis of their promoter landscapes was performed.\u003c/p\u003e\u003cp\u003eThe findings revealed that the promoters of BnH3-01 and BnH3-02 harbored abundant anaerobic response elements (AREs). The presence of AREs indicates that these two genes may be intricately involved in the anaerobic response mechanism of plants, potentially linked to their elevated expression in vigorously dividing tissues. Active cell proliferation triggers the upregulation of cellular metabolism, thereby eliciting heightened oxygen consumption and the establishment of microenvironmental hypoxia, which might induce the expression activation of these genes. Conversely, the promoter of BnH3-05 harbors an abundance of MeJA and auxin elements, along with defense-related regulatory elements. These regulatory elements may coordinate with other defense signaling cascades to orchestrate the spatiotemporal expression of BnH3-05, enabling plants to respond rapidly and effectively to diverse environmental stresses.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSubcellular Localization Prediction and Experimental Validation of\u003c/b\u003e \u003cb\u003eBnCENH3\u003c/b\u003e \u003cb\u003eGenes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe specificity of \u003cem\u003eCENH3\u003c/em\u003e within the CHF necessitates comprehensive investigation of this histone variant. Subcellular localization prediction of the H3 subfamily in \u003cem\u003eB. napus\u003c/em\u003e by WoLFPSORT reveals that most proteins localize to the nucleus, whereas \u003cem\u003eBnCENH3\u003c/em\u003e proteins exhibit tripartite localization in the nucleus, mitochondria, and chloroplasts, underscoring that these proteins are essential important for chromatin dynamics (Online Resource 1).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ecDNA sequences of primers for subcellular localization of the CENH3 gene\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene ID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBnapChr18G00829680.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCAGGGGCCCGGGGTCGACA\u003c/p\u003e\u003cp\u003eTGGCGAGAACCAAACATTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCCTTGCTCACCATGGTACC\u003c/p\u003e\u003cp\u003eCAATGGTCTGCCTTTTCCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBnapChr9G00266290.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCAGGGGCCCGGGGTCGACA\u003c/p\u003e\u003cp\u003eTGGCGAGAACGAAACATTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCCTTGCTCACCATGGTA\u003c/p\u003e\u003cp\u003eCCCAATGGCCTGCCTTTTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe conducted subcellular localization assays for \u003cem\u003eCENH3\u003c/em\u003e genes (\u003cem\u003eBnapChr18G00829680.1\u003c/em\u003e, \u003cem\u003eBnapChr9G00266290.1\u003c/em\u003e) in the 20B line and entrusted primer synthesis to Changsha Qingke Biotechnology Co., Ltd. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The transient expression of GFP fusion proteins was performed by introducing the constructed \u003cem\u003eCENH3\u003c/em\u003e::GFP expression vector into \u003cem\u003eNicotiana benthamiana\u003c/em\u003e mesophyll cells through Agrobacterium-mediated transformation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Cellular visualization via confocal laser scanning microscopy (CLSM), at 72 h post-infiltration, detected dis- tinct green fluorescent signaling within the nuclear, validating the \u003cem\u003ein silico\u003c/em\u003e predictions from the WoLFPSORT algorithm and functionally confirming the nuclear localization of \u003cem\u003eBnCENH3\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Given that the nucleus serves as the primary locus of chromatin, these findings indicate that \u003cem\u003eBnCENH3\u003c/em\u003e orchestrates centromeric chromatin dynamics within this subcellular. Subcellular localization assays provide intuitive cellular-level evidence to facilitate mechanistic insight into \u003cem\u003eBnCENH3\u003c/em\u003e function, thereby enabling further exploration of its specific mechanism of action in cellular contexts and establishing a more robust foundation for haploid breeding.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eU's triangle hypothesis postulates that \u003cem\u003eB. napus\u003c/em\u003e is an allotetraploid arising from interspecific hybridization between \u003cem\u003eB. rapa\u003c/em\u003e and \u003cem\u003eB. oleracea\u003c/em\u003e followed by a whole-genome duplication event, endowing \u003cem\u003eB. napus\u003c/em\u003e with numerous adaptive traits inherited from both progenitor species (Song et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The whole-genome resequencing and phylogenetic analysis on multiple materials reveal that 7,000 years ago the European turnip (a variant of \u003cem\u003eB. rapa\u003c/em\u003e) in the Mediterranean region hybridized with the extinct progenitor of \u003cem\u003eB. oleracea\u003c/em\u003e to form the initial winter-type \u003cem\u003eB. napus\u003c/em\u003e, which subsequently diverged into spring-type and semi-winter-type \u003cem\u003eB. napus\u003c/em\u003e varieties (Lu et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). CHF genes, serving as the basic building blocks for chromatin structure formation and maintenance, are indispensable cellular structures that exhibit remarkable evolutionary conservation and have been subjected to strong purifying selection (Woo and Li \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Truong and Boeke 2017; Corcoran et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Using CHF as molecular markers to study the phylogenetic relationships between \u003cem\u003eB. napus\u003c/em\u003e and its progenitor species offers distinct advantages, notably minimizing mutation noise interference. Collinearity analysis revealed extensive syntenic blocks among \u003cem\u003eB. napus\u003c/em\u003e, \u003cem\u003eB. rapa\u003c/em\u003e, and \u003cem\u003eB. oleracea\u003c/em\u003e, indicating that \u003cem\u003eB. napus\u003c/em\u003e inherited CHF genes from both \u003cem\u003eB. rapa\u003c/em\u003e and \u003cem\u003eB. oleracea\u003c/em\u003e through segmental and tandem duplications. Following allopolyploidization, these CHF genes retained a high level of sequence conservation, yet \u003cem\u003eB. oleracea\u003c/em\u003e-derived orthologs exhibited genomic enrichment in \u003cem\u003eB. napus.\u003c/em\u003e This phenomenon implies that the C genome conferred adaptive traits upon \u003cem\u003eB. napus\u003c/em\u003e during evolution (e.g., stress resistance, nutrient utilization efficiency), thereby driving preferential retention through positive selection. Further characterization of CHF in \u003cem\u003eB. napus\u003c/em\u003e revealed these genes were classified into four distinct subfamilies. The H4 subfamily exhibited near-identical AA sequences and conserved physicochemical characteristics across all five species analysed, underscoring its indispensability in nucleosome assembly and chromatin homeostasis. This extreme conservation stems from intense purifying selection pressure\u0026mdash;any mutation event affecting H4 structure would disrupt nucleosome integrity, leading to dysregulation in essential functions such as DNA repair and gene expression (Piontkivska et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). H3 exhibited relatively lower conservation than H4, engaging in chromatin epigenetic modifications, including H3K4, H3K27, H3K36 methylation and H3S10 phosphorylation. These modifications regulate gene transcription activation or silencing by modulating chromatin accessibility or recruiting regulatory factors (Luger et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Cheung et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). H3 also exerts critical roles in DNA replication, repair, and cell cycle progression. For instance, H3 phosphorylation modifications triggered by DNA damage are involved in repair signaling transduction pathways (Zhang et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Conversely, H2A and H2B exhibit elevated sequence divergence. For example, BnH2B-01 has a pI of 6.95\u0026mdash;substantially lower than any other H2B member. This difference indicates that structural modifications have equipped it with novel roles in chromatin remodeling or transcriptional control. This paradigm of \"conserved core with divergent variants\" not only maintains the stability of fundamental chromatin functions but also affords a molecular foundation for the evolution of complex regulatory networks.\u003c/p\u003e\u003cp\u003ePromoter analysis revealed that CHF was involved in complex regulatory networks of plant growth, development, and stress response. The presence of numerous light-responsive elements (2,866 elements) indicates that CHF may integrate light signaling via epigenetic mechanisms to modulate the expression of photosynthesis-related genes. Meanwhile, the enrichment of hormone-responsive elements (e.g., MeJA and auxin) and abiotic stress elements (e.g., drought and low temperature) highlight that CHF not only maintain chromatin architecture but also mediate plant environmental adaptation by modulating downstream target gene networks. For instance, the upregulated expression of BnH3-05 observed in this study is potentially induced by jasmonic acid signaling, which may coordinate chromatin remodeling and stress-responsive gene expression during defense responses (Long et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). H4 mitigates drought-triggered bolting by promoting H4 acetylation, enabling direct chromatin association with floral repressor gene promoters, and repressing their transcriptional competence (Xin et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). H3K4me3 modification accumulates in the promoter region of the rice dehydrin gene cluster (such as \u003cem\u003eOsDhn1\u003c/em\u003e), enhancing the DNA binding affinity of transcription factor \u003cem\u003eOsbZIP23\u003c/em\u003e to establish a positive feedback loop of \"modification-transcription factor\" and recruiting the chromatin remodeling complex \u003cem\u003eSWI/SNF\u003c/em\u003e to diminish nucleosome density, thereby making \u003cem\u003eOsbZIP23\u003c/em\u003e more accessible to target genes, ultimately activating drought-responsive gene expression (Zong et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eH3 occupies a prominent position in the CHF, participating in diverse regulations through modifications and functional transitions via structural changes. Spatiotemporal-specific expression profiling of H3 proteins reveals significantly distinct expression levels from other H3 proteins. BnH3-05, the most highly expressed H3 protein, is an H3 variant (H3.3) primarily involved in regulating chromatin dynamics, implicated in transcription, DNA damage repair, and mitosis (Sakai et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Shi et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Phylogenetic analysis revealed that BnH3-01/02 formed a distinct clade with the lowest expression levels, exhibiting drastic gene structural divergence and unique expression profiles compared to other H3 variants. Specifically, \u003cem\u003eCENH3\u003c/em\u003e genes underwent the deletion of evolutionary motif 2 and intron gain, potentially fine-tuning their binding affinity to centromeric DNA via conformational changes in protein interaction interfaces or alternative splicing regulation. \u003cem\u003eCENH3\u003c/em\u003e-mediated HI technology has been well-established in diploids including \u003cem\u003eA. thaliana\u003c/em\u003e, rice, and maize. Researchers recently used HI-Edit technology to edit the BoCENH3 gene and rapidly generated transgene-free \u003cem\u003eB. oleracea\u003c/em\u003e HI lines with the desired anthocyanin content (Li et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The allopolyploid nature of \u003cem\u003eB. napus\u003c/em\u003e imposes a substantially more complex genomic architecture than diploid species, posing significant challenges for generating HI lines via \u003cem\u003eBnCENH3\u003c/em\u003e editing. It is foreseeable that even if HI is achieved, efficiency will remain dramatically low. Thus, experimental designs must adopt a multivariate approach rather than single-factor optimization to attain desired outcomes. The two BnCENH3 paralogs exhibit functional redundancy, thereby enabling plants to sustain essential biological processes when a single copy is mutated and mitigating the phenotypic impact of deleterious mutations. Additionally, studies have shown that retaining a single functional \u003cem\u003eCENH3\u003c/em\u003e allele significantly restores fertility and enhances recombination efficiency in edited lines (Chu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Future research could implement monoallelic (\u003cem\u003eBnCENH3\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) and biallelic (\u003cem\u003eBnCENH3\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) editing strategies to dissect the trade-off between chromosome elimination efficiency and plant fertility, with the aim of generating optimal \u003cem\u003eB. napus\u003c/em\u003e DH lines. A recent investigation has revealed thermosensitive traits in \u003cem\u003eA. thaliana\u003c/em\u003e haploid lines, demonstrating that temperature modulation can potentiate \u003cem\u003eCENH3\u003c/em\u003e-mediated HI efficiency and presenting a promising avenue to alleviate the inefficiency associated with monoallelic editing for HI in polyploid crops (Wang Z et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Loss-of-function mutation in \u003cem\u003eZmPLD3\u003c/em\u003e, a maize \u003cem\u003ephospholipase D\u003c/em\u003e (\u003cem\u003ePLD\u003c/em\u003e) homolog, elicits maternal HI at rates comparable to those of canonical HI gene \u003cem\u003eMATRILINEAL\u003c/em\u003e(\u003cem\u003eMTL\u003c/em\u003e), and \u003cem\u003eZmPLD3/MTL\u003c/em\u003e double mutants displays a 4-fold increased HI efficiency, with the triple mutant \u003cem\u003eZmPLD3\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e-\u003cem\u003eMTL\u003c/em\u003e-\u003cem\u003eZmDMP\u003c/em\u003e (DUF679-containing membrane protein) exhibits a 6\u0026ndash;7 fold enhancement, collectively highlighting synergistic effects among phospholipid signaling pathways in genome elimination (Li et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Regrettably, \u003cem\u003eMTL\u003c/em\u003e is uniquely present in monocots, rendering this strategy inapplicable to \u003cem\u003eB. napus\u003c/em\u003e. However, given that \u003cem\u003ePLD\u003c/em\u003e and \u003cem\u003eDMP\u003c/em\u003e possess orthologous genes in \u003cem\u003eB. napus\u003c/em\u003e, their synergistic interplay with \u003cem\u003eCENH3\u003c/em\u003e could be harnessed to enhance HI efficiency (Lu et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study conducts a genome-wide identification and analysis of the CHF in \u003cem\u003eB. napus\u003c/em\u003e and its diploid progenitors (\u003cem\u003eB. rapa\u003c/em\u003e and \u003cem\u003eB. oleracea\u003c/em\u003e), annotating 86 CHF genes belonging to H2A, H2B, H3, and H4 subfamilies via HMMSEARCH, BLAST, and other methods. The research reveals that H4 exhibits high sequence conservation across species, while H2A and H2B display significant variation. Phylogenetic and collinearity analyses reveal that CHF genes have undergone polyploidization events with preferential retention of C-genome loci from \u003cem\u003eB. oleracea\u003c/em\u003e. \u003cem\u003eCENH3\u003c/em\u003e, a centromere-specific variant of H3, constitutes an independent evolutionary clade, featuring structural variations that correlate with its elevated expression in meristematic tissues. Promoter analysis uncovers that CHF is embedded in a \"light-hormone-stress\" regulatory network, harboring 21 classes of CAREs. Additionally, the spatiotemporal expression profile of the H3 subfamily demonstrates that BnH3-05 exhibits the highest expression level, whereas BnCENH3 displays specific expression in meiotically active tissues. Subcellular localization experiments validate that BnCENH3 localized to the nucleus, and its functional redundancy provides a theoretical framework for HI in \u003cem\u003eB. napus\u003c/em\u003e. This study furnishes critical insights into the evolution of CHF in Brassica and the utilization of CENH3 for \u003cem\u003eB. napus\u003c/em\u003e breeding improvement.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003cp\u003eNot Applicable.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis study was funded by the National Natural Science Foundation of China (32071965); the National Key Research and Development Program of China (2023YFD1201403); Hunan Provincial Science and Technology talent Promotion Project (2023TJ-Z09).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eFengwu Xie: Data Collection, Analysis \u0026amp; Interpretation, Experimentation, Writing.Chunjun He: Experimentation.Ying Huang: Review and editing.Shuxiang Mao: Conceptualization, advice.Mingli Yan: Conceptualization, Supervision, Resources \u0026amp; Support.Lili Liu: Revision, Resources \u0026amp; Support, Supervision.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe successful completion of this research was made possible by generous funding from the National Natural Science Foundation of China and the National Key Research and Development Program of China. We express our sincere gratitude to our mentors and colleagues for their invaluable guidance, and we thank all members of our institutes for their continued support and assistance.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e\u003cp\u003eThe datasets used during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003eAriyoshi M, Makino F, Watanabe R, Nakagawa R, Kato T, Namba K, Arimura Y, Fujita R, Kurumizaka H, Okumura EI, Hara M, \u0026amp; Fukagawa T (2021). Cryo-EM structure of the CENP-A nucleosome in complex with phosphorylated CENP-C. The EMBO journal, 40(5), e105671. https://doi.org/10.15252/embj.2020105671\u003c/p\u003e\n\u003cp\u003eBailey TL, Johnson J, Grant CE, \u0026amp; Noble, W S (2015). The MEME Suite. \u003cem\u003eNucleic acids \u003c/em\u003eresearch, 43(W1), W39\u0026ndash;W49. https://doi.org/10.1093/nar/gkv416 \u003c/p\u003e\n\u003cp\u003eBlum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto B L, Orr A, Paysan-Lafoss, T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-L\u0026oacute;pez F, Marchler-Bauer A, \u0026hellip; Bateman A (2025). InterPro: the protein sequence classification resource in 2025. \u003cem\u003eNucleic acids research\u003c/em\u003e, \u003cem\u003e53\u003c/em\u003e(D1), D444\u0026ndash;D456. https://doi.org/10.1093/nar/gkae1082 \u003c/p\u003e\n\u003cp\u003eBorges CE, Von dos Santos Veloso R, da Concei\u0026ccedil;\u0026atilde;o CA et al. (2023). Forecasting \u003cem\u003eBrassica napus\u003c/em\u003e production under climate change with a mechanistic species distribution model. Sci Rep 13, 12656. https://doi.org/10.1038/s41598-023-38910-3\u003c/p\u003e\n\u003cp\u003eBurrack LS, \u0026amp; Berman J (2012). Flexibility of centromere and kinetochore structures. Trends in genetics: TIG, 28(5), 204\u0026ndash;212. https://doi.org/10.1016/j.tig.2012.02.003\u003c/p\u003e\n\u003cp\u003eChalhoub B, Denoeud F, Liu S, Parkin IA, Tang H, Wang X, Chiquet J, Belcram H, Tong C, Samans B, Corr\u0026eacute;a M, Da Silva C, Just J, Falentin C, Koh CS, Le Clainche I, Bernard M, Bento P, Noel B, Labadie K, \u0026hellip; Wincker P (2014). Plant genetics. Early allopolyploid evolution in the post-Neolithic \u003cem\u003eBrassica napus\u003c/em\u003e oilseed genome. Science (New York, N.Y.), 345(6199), 950\u0026ndash;953. https://doi.org/10.1126/science.1253435\u003c/p\u003e\n\u003cp\u003eChen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, \u0026amp; Xia R (2023). TBtools-II: A \u0026quot;one for all, all for one\u0026quot; bioinformatics platform for biological big-data mining. \u003cem\u003eMolecular plant\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(11), 1733\u0026ndash;1742. https://doi.org/10.1016/j.molp.2023.09.010 \u003c/p\u003e\n\u003cp\u003eCheung P, Tanner KG, Cheung WL, Sassone-Corsi P, Denu JM, \u0026amp; Allis C D (2000). Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Molecular cell, 5(6), 905-915. https://doi.org/10.1016/s1097-2765(00)80256-7 \u003c/p\u003e\n\u003cp\u003eChu L, Zhuang J, Geng M, Zhang Y, Zhu J, Zhang C, Schnittger A, Yi B, \u0026amp; Yang C (2024). ASYNAPSIS3 has diverse dosage-dependent effects on meiotic crossover formation in \u003cem\u003eBrassica napus\u003c/em\u003e. The Plant cell, 36(9), 3838\u0026ndash;3856. https://doi.org/10.1093/plcell/koae207\u003c/p\u003e\n\u003cp\u003eCorcoran ET, LeBlanc C, Huang YC, Arias Tsang M, Sarkiss A, Hu Y, Pedmale UV, \u0026amp; Jacob Y (2022). Systematic histone H4 replacement in Arabidopsis thaliana reveals a role for H4R17 in regulating flowering time. The Plant cell, 34(10), 3611\u0026ndash;3631. https://doi.org/10.1093/plcell/koac211\u003c/p\u003e\n\u003cp\u003eDevaux P. (2021). Production of Wheat Doubled Haploids Through Intergeneric Hybridization with Maize. Methods in molecular biology (Clifton, N.J.), 2287,267\u0026ndash;279. https://doi.org/10.1007/978-1-0716-1315-314\u003c/p\u003e\n\u003cp\u003eDing D, Pang MYH, Deng M, Nguyen TT, Liu Y, Sun X, Xu Z, Zhang Y, Zhai Y, Yan Y, \u0026amp; Ishibashi T (2024). Testis-specific H2B.W1 disrupts nucleosome integrity by reducing DNA-histone interactions. Nucleic acids research, 52(19), 11612\u0026ndash;11625. https://doi.org/10.1093/nar/gkae825\u003c/p\u003e\n\u003cp\u003eFerrie AMR, Caswell KL (2011). Isolated microspore culture techniques and recent progress for haploid and doubled haploid plant production. Plant Cell Tiss Organ Cult 104, 301\u0026ndash;309. https://doi.org/10.1007/s11240-010-9800-y\u003c/p\u003e\n\u003cp\u003eFoley E, Kapoor T (2013). Microtubule attachment and spindle assembly checkpoint signalling at the kinetochore. Nat Rev Mol Cell Biol 14, 25\u0026ndash;37. https://doi.org/10.1038/nrm3494\u003c/p\u003e\n\u003cp\u003eFoltz DR, Jansen LE, Black BE, Bailey AO, Yates JR, 3rd, \u0026amp; Cleveland DW (2006). The human CENP-A centromeric nucleosome-associated complex. Nature cell biology, 8(5), 458\u0026ndash;469. https://doi.org/10.1038/ncb1397\u003c/p\u003e\n\u003cp\u003eFragkos M, Jurvansuu J, \u0026amp; Beard P (2009). H2AX is required for cell cycle arrest via the p53/p21 pathway. Molecular and cellular biology, 29(10), 2828\u0026ndash;2840. https://doi.org/10.1128/MCB.01830-08\u003c/p\u003e\n\u003cp\u003eFu H, Zhong J, Zhao J, Huo L, Wang C, Ma D, Pan W, Sun L, Ren Z, Fan T, Wang Z, Wang W, Lei X, Yu G, Li J, Zhu Y, Geelen D and Liu B (2024), Ultraviolet attenuates centromere-mediated meiotic genome stability and alters gametophytic ploidy consistency in flowering plants. New Phytol, 243: 2214-2234. https://doi.org/10.1111/nph.19978 \u003c/p\u003e\n\u003cp\u003eGilles LM, Khaled A, Laffaire JB, Chaignon S, Gendrot G, Laplaige J, Berg\u0026egrave;s H, Beydon G, Bayle V, Barret P, Comadran J, Martinant JP, Rogowsky PM, \u0026amp; Widiez T (2017). Loss of pollen-specific phospholipase NOT LIKE DAD triggers gynogenesis in maize. The EMBO journal, 36(6), 707\u0026ndash;717. https://doi.org/10.15252/embj.201796603 \u003c/p\u003e\n\u003cp\u003eGrau DJ, Chapman BA, Garlick JD, Borowsky M, Francis NJ, \u0026amp; Kingston RE (2011). Compaction of chromatin by diverse Polycomb group proteins requires localized regions of high charge. Genes \u0026amp; development, 25(20), 2210\u0026ndash;2221. https://doi.org/10.1101/gad.17288211\u003c/p\u003e\n\u003cp\u003eJing J, Wu N, Xu W, Wang Y, Pawlowski WP, \u0026amp; He Y (2022). An F-box protein ACOZ1 functions in crossover formation by ensuring proper chromosome compaction during maize meiosis. The New phytologist, 235(1), 157\u0026ndash;172. https://doi.org/10.1111/nph.18116\u003c/p\u003e\n\u003cp\u003eKalinowska K, Chamas S, Unkel K et al. (2019). State-of-the-art and novel developments of in vivo haploid technologies. Theor Appl Genet 132, 593\u0026ndash;605.https://doi.org/10.1007/s00122-018-3261-9\u003c/p\u003e\n\u003cp\u003eKamakaka RT, \u0026amp; Biggins S (2005). Histone variants: deviants? Genes \u0026amp; development, 19(3), 295\u0026ndash;310. https://doi.org/10.1101/gad.1272805\u003c/p\u003e\n\u003cp\u003eKingston IJ, Yung JS, \u0026amp; Singleton MR (2011). Biophysical characterization of the centromere-specific nucleosome from budding yeast. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e, \u003cem\u003e286\u003c/em\u003e(5), 4021\u0026ndash;4026. https://doi.org/10.1074/jbc.M110.189340 \u003c/p\u003e\n\u003cp\u003eLantos C; Jancs\u0026oacute; M; Sz\u0026eacute;kely \u0026Aacute;; Nagy \u0026Eacute;; Szal\u0026oacute;ki T; Pauk J (2022). Improvement of Anther Culture to integrate Doubled Haploid Technology in Temperate Rice (Oryza sativa L.) Breeding. Plants, 11, 3446. https://doi.org/10.3390/plants11243446\u003c/p\u003e\n\u003cp\u003eLescot M, D\u0026eacute;hais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouz\u0026eacute; P, \u0026amp; Rombauts S (2002). PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.Nucleic acids research, 30(1),325\u0026ndash;327. https://doi.org/10.1093/nar/30.1.325 \u003c/p\u003e\n\u003cp\u003eLetunic I, Khedkar S, \u0026amp; Bork P (2021). SMART: recent updates, new developments and status in 2020. \u003cem\u003eNucleic acids research\u003c/em\u003e, \u003cem\u003e49\u003c/em\u003e(D1), D458\u0026ndash;D460. https://doi.org/10.1093/nar/gkaa937 \u003c/p\u003e\n\u003cp\u003eLi H, Shen J, Zhao X, Ji J, Wang Y, Yang L, Zhuang M, Liu L, Zhang Y and Lv H (2025). Rapid design of transgene-free cabbage with desired anthocyanin contents via HI-Edit. J. Integr. Plant Biol. https://doi.org/10.1111/jipb.13943\u003c/p\u003e\n\u003cp\u003eLi Y, Chen M, Khan AH, Ma Y, He X, Yang J, Zhang R, Ma H, Zuo C, Li Y, Kong J, Wang M, Zhu L, Zhang X, \u0026amp; Min L (2023). Histone H3 lysine 27 trimethylation suppresses jasmonate biosynthesis and signaling to affect male fertility under high temperature in cotton. Plant communications, 4(6), 100660. https://doi.org/10.1016/j.xplc.2023.100660\u003c/p\u003e\n\u003cp\u003eLi Y, Lin Z, Yue Y.et al. (2021) Loss-of-function alleles of ZmPLD3 cause haploid induction in maize. Nat. Plants 7, 1579\u0026ndash;1588. https://doi.org/10.1038/s41477-021-01037-2\u003c/p\u003e\n\u003cp\u003eLipikhina YA, Evtushenko EV, Elisafenko EA, \u0026amp; Vershinin AV (2017). Chromosomal assignment of centromere-specific histone \u003cem\u003eCENH3\u003c/em\u003e genes in rye (Secale cereale L.) and their phylogeny. Comparative cytogenetics, 11(4), 821\u0026ndash;832. https://doi.org/10.3897/CompCytogen.v11i4.19953\u003c/p\u003e\n\u003cp\u003eLong X, Yang W, Lv Y, Zhong X, Chen L, Li Q, Lv Z, Li Y, Cai Y, \u0026amp; Yang H (2024). The Histone Variant H3.3 Is Required for Plant Growth and Fertility in Arabidopsis. International journal of molecular sciences, 25(5), 2549. https://doi.org/10.3390/ijms25052549\u003c/p\u003e\n\u003cp\u003eLu K, Wei L, Li X et al. (2019). Whole-genome resequencing reveals \u003cem\u003eBrassica napus\u003c/em\u003e origin and genetic loci involved in its improvement. Nat Commun 10, 1154. https://doi.org/10.3897/CompCytogen.v11i4.19953\u003c/p\u003e\n\u003cp\u003eLu S, Bahn SC, Qu G, Qin H, Hong Y, Xu Q, Zhou Y, Hong Y, \u0026amp; Wang X (2013). Increased expression of phospholipase D\u0026alpha;1 in guard cells decreases water loss with improved seed production under drought in \u003cem\u003eBrassica napus\u003c/em\u003e. Plant biotechnology journal, 11(3), 380\u0026ndash;389. https://doi.org/10.1111/pbi.12028\u003c/p\u003e\n\u003cp\u003eLuger K, M\u0026auml;der AW, Richmond RK, Sargent DF, \u0026amp; Richmond TJ (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389(6648), 251\u0026ndash;260. https://doi.org/10.1038/38444\u003c/p\u003e\n\u003cp\u003eLv J, Yu K, Wei J et al. (2020). Generation of paternal haploids in wheat by genome editing of the centromeric histone \u003cem\u003eCENH3\u003c/em\u003e. Nat Biotechnol 38, 1397\u0026ndash;1401. https://doi.org/10.1038/s41587-020-0728-4\u003c/p\u003e\n\u003cp\u003eMangal M, Sahana KP, Srivastava A et al. (2023). Haploid induction through microspore embryogenesis in Bell pepper genotypes (PREPRINT Version 1). Research Square. https://doi.org/10.21203/rs.3.rs-2571870/v1\u003c/p\u003e\n\u003cp\u003eMarin-Montes IM, Rodr\u0026iacute;guez-P\u0026eacute;rez JE, Robledo-Paz A, de la Cruz-Torres E, Pe\u0026ntilde;a-Lomel\u0026iacute; A, \u0026amp; Sahag\u0026uacute;n-Castellanos J (2022). Haploid Induction in Tomato (Solanum lycopersicum L.) via Gynogenesis. Plants (Basel, Switzerland), 11(12), 1595. https://doi.org/10.3390/plants11121595\u003c/p\u003e\n\u003cp\u003eMei H, Hayashi R, Kozuka C, Kumon M, Koseki H, \u0026amp; Inoue A (2025). H2A.Z reinforces maternal H3K4me3 formation and is essential for meiotic progression in mouse oocytes. Nature structural \u0026amp; molecular biology, 10.1038/s41594-025-01573-x. Advance online publication.https://doi.org/10.1038/s41594-025-01573-x\u003c/p\u003e\n\u003cp\u003eMeng D, Luo H, Dong Z, Huang W, Liu F, Li F, Chen S, Yu H, \u0026amp; Jin W (2022). Overexpression of Modified \u003cem\u003eCENH3\u003c/em\u003e in Maize Stock6-Derived Inducer Lines Can Effectively Improve Maternal Haploid Induction Rates. \u003cem\u003eFrontiers in plant science\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 892055. https://doi.org/10.3389/fpls.2022.892055 \u003c/p\u003e\n\u003cp\u003eMiao R, Zhang Y, Liu X, Yuan Y, Zang W, Li Z et al. (2024) Histone variant H2A.Z is required for plant salt response by regulating gene transcription. Plant, Cell \u0026amp; Environment, 47, 2691\u0026ndash;2707. https://doi.org/10.1111/pce.14908\u003c/p\u003e\n\u003cp\u003eNunez-Vazquez R, Desvoyes B, \u0026amp; Gutierrez C (2022). Histone variants and modifications during abiotic stress response. Frontiers in plant science, 13, 984702. https://doi.org/10.3389/fpls.2022.984702\u003c/p\u003e\n\u003cp\u003ePiontkivska H, Rooney AP, \u0026amp; Nei M (2002). Purifying selection and birth-and-death evolution in the histone H4 gene family. Molecular biology and evolution, 19(5), 689-697. https://doi.org/10.1093/oxfordjournals.molbev.a004127\u003c/p\u003e\n\u003cp\u003ePrem D, Sol\u0026iacute;s MT, B\u0026aacute;r\u0026aacute;ny I et al. (2012). A new microspore embryogenesis system under low temperature which mimics zygotic embryogenesis initials, expresses auxin and efficiently regenerates doubled-haploid plants in Brassica napus. BMC Plant Biol 12, 127. https://doi.org/10.1186/1471-2229-12-127\u003c/p\u003e\n\u003cp\u003eRavi M, Chan S (2010). Haploid plants produced by centromere-mediated genome elimination. Nature 464, 615\u0026ndash;618. https://doi.org/10.1038/nature08842\u003c/p\u003e\n\u003cp\u003eSakai A, Schwartz BE, Goldstein S, \u0026amp; Ahmad K (2009). Transcriptional and developmental functions of the H3.3 histone variant in Drosophila. Current biology: CB, 19(21), 1816\u0026ndash;1820. https://doi.org/10.1016/j.cub.2009.09.021\u003c/p\u003e\n\u003cp\u003eSandmann M, Talbert P, Demidov D, Kuhlmann M, Rutten T, Conrad U, \u0026amp; Lermontova I (2017). Targeting of Arabidopsis KNL2 to Centromeres Depends on the Conserved CENPC-k Motif in Its C Terminus. \u003cem\u003eThe Plant cell\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e(1), 144\u0026ndash;155. https://doi.org/10.1105/tpc.16.00720 \u003c/p\u003e\n\u003cp\u003eSharma P, Chaudhary HK, Manoj NV et al. (2019). New Protocol for Colchicine Induced Efficient Doubled Haploidy in Haploid Regenerants of Tetraploid and Hexaploid Wheats at In vitro Level. CEREAL RESEARCH COMMUNICATIONS 47, 356\u0026ndash;368. https://doi.org/10.1556/0806.47.2019.09\u003c/p\u003e\n\u003cp\u003eShi L, Wen H, \u0026amp; Shi X (2017). The Histone Variant H3.3 in Transcriptional Regulation and Human Disease. Journal of molecular biology, 429(13), 1934\u0026ndash;1945. https://doi.org/10.1016/j.jmb.2016.11.019\u003c/p\u003e\n\u003cp\u003eShono N, Ohzeki J, Otake K, Martins NM, Nagase T, Kimura H, Larionov V, Earnshaw WC, \u0026amp; Masumoto H (2015). CENP-C and CENP-I are key connecting factors for kinetochore and CENP-A assembly. Journal of cell science, 128(24), 4572\u0026ndash;4587. https://doi.org/10.1242/jcs.180786\u003c/p\u003e\n\u003cp\u003eSokolova V, Sarkar S, \u0026amp; Tan D (2022). Histone variants and chromatin structure, update of advances. Computational and structural biotechnology journal, 21, 299\u0026ndash;311. https://doi.org/10.1016/j.csbj.2022.12.002\u003c/p\u003e\n\u003cp\u003eSong X, Wei,Y, Xiao D, Gong K, Sun P, Ren Y, Yuan J, Wu T, Yang Q, Li X, Nie F, Li N, Feng S, Pei Q, Yu T, Zhang C, Liu T, Wang X, \u0026amp; Yang J (2021). Brassica carinata genome characterization clarifies U\u0026apos;s triangle model of evolution and polyploidy in Brassica. Plant physiology, 186(1), 388\u0026ndash;406. https://doi.org/10.1093/plphys/kiab048\u003c/p\u003e\n\u003cp\u003eStrahl B, Allis C (2000). The language of covalent histone modifications. Nature 403, 41\u0026ndash;45. https://doi.org/10.1038/47412\u003c/p\u003e\n\u003cp\u003eStroud H, Otero S, Desvoyes B, Ram\u0026iacute;rez-Parra E, Jacobsen SE, \u0026amp; Gutierrez C (2012). Genome-wide analysis of histone H3.1 and H3.3 variants in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 109(14), 5370\u0026ndash;5375. https://doi.org/10.1073/pnas.1203145109 \u003c/p\u003e\n\u003cp\u003eTalbert PB, \u0026amp; Henikoff S (2020). What makes a centromere? Experimental cell research, 389(2), 11189 5.https://doi.org/10.1016/j.yexcr.2020.111895\u003c/p\u003e\n\u003cp\u003eTalbert PB, \u0026amp; Henikoff S (2021). Histone variants at a glance. Journal of cell science, 134(6), jcs24474 9. https://doi.org/10.1242/jcs.244749\u003c/p\u003e\n\u003cp\u003eTamura K, Stecher G, \u0026amp; Kumar S (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. \u003cem\u003eMolecular biology and evolution\u003c/em\u003e, \u003cem\u003e38\u003c/em\u003e(7), 3022\u0026ndash;3027. https://doi.org/10.1093/molbev/msab120\u003c/p\u003e\n\u003cp\u003eTan Z, Han X, Dai C, Lu S, He H, Yao X, Chen P, Yang C, Zhao L, Yang Q Y, Zou J, Wen J, Hong D, Liu C, Ge X, Fan C, Yi B, Zhang C, Ma C, Liu K, \u0026hellip; Zhao H (2024). Functional genomics of \u003cem\u003eBrassica napus\u003c/em\u003e: Progresses, challenges, and perspectives. Journal of integrative plant biology, 66(3), 484\u0026ndash;509. https://doi.org/10.1111/jipb.13635\u003c/p\u003e\n\u003cp\u003eTang H, Zhang X, Tong C, Chalhoub B, Liu S, Lyons E (2018). From Alpha-Duplication to Triplication and Sextuplication. In: Liu S, Snowdon R, Chalhoub B (eds) The Brassica napus Genome. Compendium of Plant Genomes. Springer, Cham. https://doi.org/10.1007/978-3-319-43694-4_5\u003c/p\u003e\n\u003cp\u003eTruon, DM, \u0026amp; Boeke JD (2017). Resetting the Yeast Epigenome with Human Nucleosomes. Cell, 171(7), 1508\u0026ndash;1519.e13. https://doi.org/10.1016/j.cell.2017.10.043\u003c/p\u003e\n\u003cp\u003eWang H, Hou H, Jan CC, \u0026amp; Chao WS (2023). Irradiated Pollen-Induced Parthenogenesis for Doubled Haploid Production in Sunflowers (Helianthus spp.). Plants (Basel, Switzerland), 12(13), 2430. https://doi.org/10.3390/plants12132430 \u003c/p\u003e\n\u003cp\u003eWang N, Xia X, Jiang T, Li L, Zhang P, Niu L, Cheng H, Wang K, \u0026amp;Lin H (2022). Inplanta haploid induction by genome editing of DMP in the model legume Medicago truncatula. Plant biotechnology journal, 20(1), 22\u0026ndash;24. https://doi.org/10.1111/pbi.13740 \u003c/p\u003e\n\u003cp\u003eWang Y, Li Y, Zhou F, Zhang L, Gong J, Cheng C, Chen J, \u0026amp; Lou Q (2023). Genome-wide characterization, phylogenetic and expression analysis of Histone gene family in cucumber (Cucumis sativus L.). International journal of biological macromolecules, 230, 123401. https://doi.org/10.1016/j.ijbiomac.2023.123401 \u003c/p\u003e\n\u003cp\u003eWang Y, Wu J, Yang S, Li X, Wang J, Lv Q, Zhu X, Lu G, Zhang J, Shen W H, Liu B, Lin J, \u0026amp; Dong A (2025). Structural and functional interrelationships of histone H2A with its variants H2A.Z and H2A.W in Arabidopsis. Structure (London, England: 1993), S0969-2126(25)00149-2. Advance online publication. https://doi.org/10.1016/j.str.2025.04.015\u003c/p\u003e\n\u003cp\u003eWang Z, Chen M, Yang H et al. (2023). A simple and highly efficient strategy to induce both paternal and maternal haploids through temperature manipulation. Nat. Plants 9,699-705.https://doi.org/10.1038/s41477-023-01389-x\u003c/p\u003e\n\u003cp\u003eWatanabe R, Hara M, Okumura EI, Herv\u0026eacute; S, Fachinetti D, Ariyoshi M, \u0026amp; Fukagawa T (2019). CDK1-mediated CENP-C phosphorylation modulates CENP-A binding and mitotic kinetochore localization. The Journal of cell biology, 218(12), 4042\u0026ndash;4062. https://doi.org/10.1083/jcb.201907006\u003c/p\u003e\n\u003cp\u003eWoo YH, \u0026amp; Li WH (2012). Evolutionary conservation of histone modifications in mammals. \u003cem\u003eMolecular biology and evolution\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e(7), 1757\u0026ndash;1767. https://doi.org/10.1093/molbev/mss022\u003c/p\u003e\n\u003cp\u003eXie J, Chen Y, Cai G, Cai R, Hu Z, Wang H (2023). Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees. Nucleic acids research, 51(W1), W587\u0026ndash;W592. https://doi.org/10.1093/nar/gkad359 \u003c/p\u003e\n\u003cp\u003eXin X, Su T, Li P, Wang W, Zhao X, Yu Y, Zhang D, Yu S, \u0026amp; Zhang F (2021). A histone H4 gene prevents drought-induced bolting in Chinese cabbage by attenuating the expression of flowering genes. \u003cem\u003eJournal of experimental botany\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e(2), 623\u0026ndash;635. https://doi.org/10.1093/jxb/eraa452\u003c/p\u003e\n\u003cp\u003eYao P, He Q, Wang Y, Sun D, Chen X, \u0026amp; Lu L (2024). Genome-wide profiling and functional study of short N-terminal H2B variants in Arabidopsis. \u003cem\u003eJournal of advanced research\u003c/em\u003e, S2090-1232(24)00557-5. Advance online publication. https://doi.org/10.1016/j.jare.2024.12.001\u003c/p\u003e\n\u003cp\u003eYang Z, Wang S, Wei L, Huang Y, Liu D, Jia Y, Luo C, Lin Y, Liang C, Hu Y, Dai C, Guo L, Zhou Y, \u0026amp; Yang Q Y (2023). BnIR: A multi-omics database with various tools for Brassica napus research and breeding. Molecular plant, 16(4), 775\u0026ndash;789. https://doi.org/10.1016/j.molp.2023.03.007 \u003c/p\u003e\n\u003cp\u003eYu Y, Wang S, Wang Z, Gao R, \u0026amp; Lee J (2023). \u003cem\u003eArabidopsis thaliana\u003c/em\u003e: a powerful model organism to explore histone modifications and their upstream regulations. \u003cem\u003eEpigenetics\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(1). https://doi.org/10.1080/15592294.2023.2211362\u003c/p\u003e\n\u003cp\u003eZargar M, Zavarykina T, Voronov S, Pronina I, \u0026amp; Bayat M (2022). The Recent Development in Technologies for Attaining Doubled Haploid Plants In Vivo. \u003cem\u003eAgriculture\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(10), 1595. https://doi.org/10.3390/agriculture12101595\u003c/p\u003e\n\u003cp\u003eZhang H, Wang P, Hou H, Wen H, Zhou H, Gao F, Wu J, Qiu Z, \u0026amp; Li L (2016). Histone Modification Is Involved in Okadaic Acid (OA) Induced DNA Damage Response and G2-M Transition Arrest in Maize. \u003cem\u003ePloS one\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(5), e0155852. https://doi.org/10.1371/journal.pone.0155852 \u003c/p\u003e\n\u003cp\u003eZhao F, Zhang H, Zhao T, Li Z, \u0026amp; Jiang D (2021). The histone variant H3.3 promotes the active chromatin state to repress flowering in Arabidopsis. \u003cem\u003ePlant physiology\u003c/em\u003e, \u003cem\u003e186\u003c/em\u003e(4), 2051\u0026ndash;2063. https://doi.org/10.1093/plphys/kiab224\u003c/p\u003e\n\u003cp\u003eZhao T, Lu J, Zhang H et al. (2022). Histone H3.3 deposition in seed is essential for the post-embryonic developmental competence in \u003cem\u003eArabidopsis\u003c/em\u003e. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 7728. https://doi.org/10.1038/s41467-022-35509-6\u003c/p\u003e\n\u003cp\u003eZhao X, Yuan K, Liu Y, Zhang N, Yang L, Zhang Y, Wang Y, Ji J, Fang Z, Han F, \u0026amp; Lv H (2022). In vivo maternal haploid induction based on genome editing of DMP in Brassica oleracea. \u003cem\u003ePlant biotechnology journal\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(12), 2242\u0026ndash;2244. https://doi.org/10.1111/pbi.13934\u003c/p\u003e\n\u003cp\u003eZhu J, Cheng KCL \u0026amp; Yuen KWY (2018). Histone H3K9 and H4 Acetylations and Transcription Facilitate the Initial CENP-A\u003csup\u003eHCP\u0026minus;3\u003c/sup\u003e Deposition and De Novo Centromere Establishment in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e Artificial Chromosomes. \u003cem\u003eEpigenetics \u0026amp;Chromatin\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 16. https://doi.org/10.1186/s13072-018-0185-1\u003c/p\u003e\n\u003cp\u003eZong W, Yang J, Fu J, \u0026amp; Xiong L (2020). Synergistic regulation of drought-responsive genes by transcription factor OsbZIP23 and histone modification in rice. \u003cem\u003eJournal of integrative plant biology\u003c/em\u003e, \u003cem\u003e62\u003c/em\u003e(6), 723\u0026ndash;729. https://doi.org/10.1111/jipb.12850\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"plant-molecular-biology-reporter","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pmbr","sideBox":"Learn more about [Plant Molecular Biology Reporter](http://link.springer.com/journal/11105)","snPcode":"11105","submissionUrl":"https://submission.nature.com/new-submission/11105/3","title":"Plant Molecular Biology Reporter","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Brassica napus, Core histones family, Phylogenetic analysis, CENH3, Haploid induction","lastPublishedDoi":"10.21203/rs.3.rs-8114797/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8114797/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study performed a comprehensive genome-wide identification and phylogenetic analysis of the core histone family (CHF) in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, \u003cem\u003eBrassica napus\u003c/em\u003e, and its two diploid progenitor species, \u003cem\u003eBrassica rapa\u003c/em\u003e and \u003cem\u003eBrassica oleracea\u003c/em\u003e. Using bioinformatics approaches, a total of 86 core histone genes were identified in \u003cem\u003eB. napus\u003c/em\u003e, classified into four subfamilies\u0026mdash;H2A, H2B, H3, and H4. Comparative analyses revealed that histone H4 is highly conserved across the five studied species, whereas the H2A and H2B subfamilies exhibit substantial sequence divergence. In \u003cem\u003eB. napus\u003c/em\u003e, genes derived from the C genome (originating from \u003cem\u003eB. oleracea\u003c/em\u003e) show a higher retention rate compared to those originating from the A genome (from \u003cem\u003eB. rapa\u003c/em\u003e). Promoter regions of the core histone genes are enriched with 21 distinct functional cis-regulatory elements, many of which are associated with a \"light\u0026ndash;hormone\u0026ndash;stress\" regulatory network. Furthermore, the centromere-specific histone variant CENH3 was found to localize to the nucleus and forms a distinct clade in the phylogenetic tree, indicating its divergent evolutionary trajectory. These findings provide a solid theoretical foundation for understanding the evolutionary dynamics of histone gene families within the Brassicaceae family.\u003c/p\u003e","manuscriptTitle":"Genome-wide Analysis of Core Histone Genes and Expression Dynamics of the H3 subfamily in Brassica napus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-05 08:18:28","doi":"10.21203/rs.3.rs-8114797/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-05T04:16:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-15T13:17:39+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-11T09:46:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257571000197910894800881933595057748927","date":"2025-12-08T22:06:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"267127321875494036330057821537594998438","date":"2025-12-07T06:14:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"46073784663558509554014490958466675226","date":"2025-12-05T10:15:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"309528777469343291065213507940550164177","date":"2025-12-05T08:44:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"84386798304875335137646375478778091661","date":"2025-12-04T08:47:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"329577390558655290934148656182128048650","date":"2025-12-03T11:50:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-03T08:21:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-18T13:07:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-18T13:04:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Molecular Biology Reporter","date":"2025-11-14T12:43:48+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"plant-molecular-biology-reporter","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pmbr","sideBox":"Learn more about [Plant Molecular Biology Reporter](http://link.springer.com/journal/11105)","snPcode":"11105","submissionUrl":"https://submission.nature.com/new-submission/11105/3","title":"Plant Molecular Biology Reporter","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"780c85ea-7b1a-4887-abf7-0606fd0cbe3e","owner":[],"postedDate":"December 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-30T16:18:07+00:00","versionOfRecord":{"articleIdentity":"rs-8114797","link":"https://doi.org/10.1007/s11105-026-01698-3","journal":{"identity":"plant-molecular-biology-reporter","isVorOnly":false,"title":"Plant Molecular Biology Reporter"},"publishedOn":"2026-03-23 16:10:21","publishedOnDateReadable":"March 23rd, 2026"},"versionCreatedAt":"2025-12-05 08:18:28","video":"","vorDoi":"10.1007/s11105-026-01698-3","vorDoiUrl":"https://doi.org/10.1007/s11105-026-01698-3","workflowStages":[]},"version":"v1","identity":"rs-8114797","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8114797","identity":"rs-8114797","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.