Hsa_circ_00011640 inhibits lung adenocarcinoma by targeting miR-942

Hsa_circ_00011640 inhibits lung adenocarcinoma by targeting miR-942 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Hsa_circ_00011640 inhibits lung adenocarcinoma by targeting miR-942 Huize Han, Kandi Xu, Xueqing Du, Van Minh Le, Hongxia Lin, Ocholi Don, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3805181/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objectives: To understand the role of circular RNA (circRNA) hsa_circ_0001640 in lung adenocarcinoma. Methods: We used high-throughput sequencing and qRT-PCR to examine the functional roles of hsa_circ_0001640 in lung adenocarcinoma (LUAD). Expriment in vivo and in vitro was performed. The role of hsa_circ_0001640 in LUAD cells were evaluated by CCK-8 test, cell cycle analysis, clonal formation, transwell assay and wound healing assay. The relative protein levels were measured by western blot and immunofluorescence. Clinical significance of hsa_circ_0001640 was assessed by paired t test, independent sample t test, one-way ANOVA, and COX logistic regression. Results: We observed that hsa_circ_0001640 was downregulated in LUAD and was negatively correlated with clinical stage, lymph node invasion and NSE, and it was a protective factor of OS of LUAD patients after surgery. In experiment in vitro, hsa_circ_0001640 could inhibit proliferation and invasion of H1975 and H1299 cells, and more cells remained in G1 phase with upregulation of hsa_circ_0001640. Hsa_circ_0001640 was proved to be combined with miR-942 as ceRNA, and thus suppressing the promotive effect of miR-942 in LUAD. Hsa_circ_0001640 upregulated e-cadherin and down-regulated fibronectin, indicating an inhibiting effect of hsa_circ_0001640 on EMT. Hsa_circ_0001640 was positively associated with GSK3β and NKIRAS2, suggesting that hsa_circ_0001640 was a potential suppressor in Wnt and NF-κB pathway. Conclusion: Hsa_circ_0001640 was a tumor suppressor in LUAD by targeting miR-942 as a ceRNA, leading to upregulation of GSK3β and NKIRAS2. CircRNA Lung adenocarcinoma Prognosis Molecular biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Lung adenocarcinoma (LUAD) is the most common and aggressive pathological type of lung cancer. Most LUAD deaths are attributed to metastasis. Although enormous efforts have been made to improve therapeutic effect, LUAD patients still suffer an unneglectable mortality.(Chen, Zheng et al. 2016, Siegel, Miller et al. 2020) CircRNAs are a class of widespread non-coding RNAs (ncRNAs) that contain covalently closed loops, discovered by Sanger.(Sanger, Klotz et al. 1976) From then on, circRNAs have been observed in diverse species, and have become one of the largest RNA families.(Hsu and Coca-Prados 1979, Memczak, Jens et al. 2013) According to the competing endogenous RNAs (ceRNAs) hypothesis (all types of RNAs, including coding RNAs, non-coding RNAs and pseudogene, can communicate with each other through miRNA binding sites),(Salmena, Poliseno et al. 2011, Tay, Rinn et al. 2014) the interactions between RNA, DNA, and proteins can be interconverted by the media RNAs, in which circRNAs are critical participants. To date, biological functions of circRNAs have only been investigated in a minor fraction of these important molecules, most of which showed a great regulatory potential to targeted genes as sponges of miRNAs,(Wang, Long et al. 2016) enabled circRNAs to play a vital role in different biological processes. Besides, other circRNAs can act as protein inhibitors, regulating protein function or translation of their parental genes.(Kristensen, Andersen et al. 2019) CircRNAs play an important role in oncogenesis and development of non-small cell lung cancer (NSCLC). CircHIPK3 can significantly enhance cell proliferation, migration, invasion and induced autophagy via the miR124-3p-STAT3-PRKAA/AMPKa axis and indicate a poor survival, especially in advanced-stage NSCLC patients.(Chen, Mao et al. 2019) CircF-circEA-2a derived from EML4-ALK fusion gene promotes NSCLC cell migration and invasion, thus becoming a novel liquid biopsy biomarker.(Tan, Sun et al. 2018) What’s more, ectopically expressing circPTK2 inhibits TGF-β-induced epithelial-mesenchymal transition (EMT) by controlling transcriptional intermediary factor 1 γ.(Wang, Tong et al. 2018) However, few studies have proved integrated down-stream pathways of circRNAs in NSCLC. Here we aimed to explore the expression and potential roles of circRNAs in lung adenocarcinoma and the underlying mechanisms. Methods Clinical samples 90 pairs of LUAD fresh frozen tissues and paracancerous tissues, obtained from 90 primary LUAD patients hospitalized from November 1st, 2013 to May 1st, 2017 in the Department of Thoracic Surgery, Ruijin Hospital (Shanghai, China), were individually diagnosed according to the WHO standardizations. The hospital and the patients both consented to specimen collection following guidelines from the Ruijin Ethics Board. RNA isolation and sequencing of circRNAs and data analysis Total RNA was extracted using the TRIzol reagent (Takara, Kyoto, Japan). RNA purity and quantification were evaluated using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then the libraries were constructed using TruSeq Stranded Total RNA with Ribo-Zero Gold (illumina, Cat.No. RS-122-2301) according to the manufacturer’s instructions. The libraries were sequenced on an Illumina HiSeq X Ten platform, and 150 bp paired-end reads were generated. Raw data (raw reads) of fastq format were firstly processed using the NGS QC Toolkit. CircRNAs were identified using CIRI (v2.0.3) and the expression of circRNAs was calculated using RPM (spliced reads per millon mapping). Then the differential expression analysis was using the DESeq (2012) R package. Differentially expressed circRNAs were screened based on |log2FoldChange > 2| and P < 0.05 (Shanghai OE Biotech Co., Ltd. Shanghai, China). Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted as mentioned above. 1ug total RNA was subjected to reverse transcription and qRT-PCR (both from Takara, Kyoto, Japan) according to the manufacturer’s instructions. ACTB was an internal control. The primers used are as follows: ACTB-F: TTGTTACAGGAAGTCCCTTGCC, ACTB-R: ATGCTATCACCTCCCCTGTGTG; hsa_circ_0001640-F: GTGTAAAGTGACCCTCT, hsa_circ_0001640-R: CTGCTGATTTTCTGCTA; miR-942-F: TCTTCTCTGTTTTGGCCATGTG. Cell lines and culture Human LUAD cell lines H1299 and H1975, human umbilical vein endothelial cells (HUVEC) were obtained from the American Type Culture Collection (VA, USA) and maintained in RPMI1640 or Endothelial Cell Growth Medium with 10% fetal bovine serum, penicillin, streptomycin at 37°C in an incubator with 5% CO 2 . The cells were authenticated by short tandem repeat (STR) DNA profiling and tested for mycoplasma every 3 months. Plasmid construction and transfection The sequence of hsa_circ_0001640 was constructed into pcDNA3.1 (Obio technology, Shanghai, China). The plasmid and control vectors were transfected into cells by Lipofectamine 2000 (Invitrogen, USA). All the siRNA, miRNA mimics, miRNA inhibitors and their control were purchased from GenePharma (Shanghai, China). The transfection efficiency was assessed by qRT-PCR. CCK-8 cell proliferation toxicity test 48h after transfection, cells were seeded into 96-well plates (1×10 4 /well), followed by 24h cultivation. Then, 10ul/well CCK-8 reagent (Maibio, Shanghai, China) was gently added, followed by another 4h incubation. The OD value at 450nm was tested 0h, 24h, 48h, 72h, 96h to plot standard curves. Cell cycle test A cell cycle kit from BioVision (LA, USA) was applied to transfected cell cycle test according to the manufacturer’s instructions. The content of propidium iodide was measured by an analytical flow cytometry (BD FACSCalibur, USA). Cell clone and proliferation experiment The function of has_circ_0001640 was evaluated via cell growth assays. 500 transfected cells were seeded in each well in 6-well plates and hatched a week. Then the cells were fixed with methanol for 15 min, and stained with 0.1% crystal violet for 30 min. Finally, cells were photographed and counted in 3 random 200×fields. Transwell assay Serum-free cell suspensions containing 5 × 10 4 transfected cells or HUVEC treated with supernatant of transfected LUAD cells were seeded in the upper chamber coated with Matrigel (BD, USA). Culture medium supplemented with 10%FBS was added to the bottom chamber. After incubation at 37 °C for 24 h, the migrated cells were fixed, stained and counted as mentioned previously. Wound healing assay Transfected cells or HUVEC treated with supernatant of transfected LUAD cells were cultured in 6-well plates up to 80–90% confluence. A scratch was made in the middle of each well, and cells were incubated in serum-free medium at 37 °C for 48 h. Images of the wounds were captured 24h later. Angiogenesis test 1× 10 5 /well HUVEC treated with supernatant of transfected LUAD cells and 250ul/well Matrigel were added into 24-well plates. After hatched for 6h, images of formation of tubes were captured. Fluorescence in-situ hybridization (FISH) FISH analysis using a Fluorescence In-Situ Hybridization Kit from GenePharma (Shanghai, China) was implemented to estimate the localization of hsa_circ_0001640 and miR-942 in LUAD cells. FITC-labeled hsa_circ_0001640 and Cy3-labeled miR-942 probes were used according to the manufacturer’s instructions. Counterstained with DAPI, images of the cells were obtained with a fluorescence microscope (Leica, Germany). Western blot Transfected cells were lysed in Sodium dodecyl sulfate lysis buffer (Biyotime, Shanghai, China), then the proteins were separated by electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, USA). The membranes were blocked and incubated with primary antibodies against MMP-9, MMP-1, Fibronectin, E-cadherin, NKIRAS2, GSK3β and GAPDH (1:1000, Abcam, UK) overnight, and secondary antibody (1:5000, Thermo, USA) for 1h. Then the protein blots were examined by an enhanced chemiluminescence detection kit (Millipore, USA). Immunofluorescence The cells (4000/well) were plated into 96-well plates. After fixed and blocked, the cells were hatched with primary antibodies of Fibronectin and E-cadherin (1:200) overnight at 4 °C, then labeled with CY3 Red conjugated secondary antibody for 1h at room temperature. After the cells were counterstained with DAPI, images were obtained with a confocal microscope (Nikon, Japan). Immunohistochemistry The tissues were fixed, embedded and then sliced to paraffin sections. The sections were deparaffinized, hydrated, treated with antigen retrieval, then hatched with primary antibodies of MMP-9, MMP-1, Fibronectin, E-cadherin NKIRAS2, GSK3β and β-Catenin (1:100) overnight at 4 °C, then labeled with secondary antibody (MXB, China), stained with DAB peroxidase substrate. The cells were counterstained with hematoxylin, then recorded as photos. Luciferase activity assay After inoculated into 96-well plates (10 4 /well), the cells with hsa_circ_0001640-WT or hsa_circ_0001640-Mut were then transfected with reporting gene expression vectors containing miRNA mimics or NC using Dual-Luciferase Assay System (Promega, USA) and cultured for 48h. Luciferase activities were measured by the Luminoskan Ascent reader system (Thermo, USA). Apoptosis analysis H1975 cells were seeded and incubated in 6-well plates. After incubation, the adherent cells were digested by 0.25% pancreatin, and then harvested and washed by PBS. The cells were centrifuged at 2000 rpm for 5 min and then resuspended in 300 μl of binding buffer. 5 μl of Annexin V-FITC and 5 μl PI was added to the suspension and maintained for 15 min at room temperature in the dark. Finally, 200 μl of binding buffer was added and quantification of cell apoptosis was performed by Guava easyCyte flow cytometer (Millipore, Germany). Animal studies 20 thymic BALB/c nude mice (Bethesda, MD, USA) were randomly divided into 4 groups in both Fig. 2 and Fig. 4 . Transfected cells (5×10 6 ) were subcutaneously injected into the flank. Tumor size was measured by vernier caliper at the end of every week, and tumor volume was calculated following the formula: tumor volume = (length * width 2 ) / 2. 3 weeks later, the mice underwent euthanasia and the tumors were isolated for weighing and photographing. All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals. Statistics All statistical analyses were carried out with SPSS 24.0 (IL, USA). The data are shown as the mean ± SD. Statistical differences were analyzed by two-tailed Student’s t-test, independent sample t test and one-way ANOVA. Kaplan-Meier survival estimate and COX proportional hazards regression model were used to evaluate prognosis of the patients. Correlation regression analysis was used to detect the correlation between hsa_circ_0001640 and miRNA. P value < 0.05 was regarded as significant. Results Hsa_circ_0001640 is downregulated in LUAD We detected more than 18,000 circRNAs in 3 pairs of LUAD and adjacent tissues by high-throughput sequencing. By comparing the data with circBase, a circRNA database (including 92,359 human circRNAs), we found that, more than 8,500 circRNAs were novel besides over 9,800 known circRNAs ( Fig. S1a ). Expression differences of circRNAs were judged by |log2Fold Change| and P value. |log2Fold Change|>2 and P<0.05 was regarded as meaningful ( Fig. 1a ). 37 circRNAs were observed to be differently expressed in all the 3 tissue pairs ( Fig. S 1b ). 24 of them were down-regulated in LUAD tissues and 13 of them were upregulated ( Fig. 1b ). Among these 37 RNAs overlapping with circBase, hsa_circ_0001640 (also called circRNA_07345 in our sequencing result), about which there is no relevant study, was chosen to be verified. Expression of hsa_circ_0001640 was downregulated in LUAD according to the results of high-throughput sequencing. To verify these data, we performed qRT-PCR in 90 pairs of LUAD and adjacent tissues. The result of qRT-PCR demonstrated that there was a significant decrease of hsa_circ_0001640 in LUAD compared with that in adjacent tissues ( Fig. 1c & 1d ), which indicated that low expression of hsa_circ_0001640 could contribute to tumor development. The receiver operating characteristic (ROC) curve suggested that hsa_circ_0001640 had a high sensitivity and specificity in LUAD diagnosis ( Fig. 1e , AUC=0.7802, 95CI: 0.7148 to 0.8457) and might become a tumor marker. Hsa_circ_0001640 is correlated with clinical features of LUAD patients Analytical results in Table 1 clearly indicated that the expression of hsa_circ_0001640 was evidently correlated with clinical stage, lymph node metastasis, neuron-specific enolase (NSE) and 5-year prognosis of 90 LUAD patients, while gender, age, smoking history, T stage, tumor size, carcinoembryonic antigen (CEA), cytokeratin-19-fragment (CYFRA21-1) and recurrence or remote metastasis were not related factors. Hsa_circ_0001640 was observed downregulated in stage III (P=0.002), while it was similar in stage I and II (P=0.438). The data showed a negative correlation between hsa_circ_0001640 and lymph node metastasis (P=0.015). However, this change was not significant between N0 and N1 (P=0.685). In contrast, patients with a positive NSE were accompanied by hardly expressed hsa_circ_0001640. We analyzed prognoses of these patients 5 years after surgery (60 patients in total). Among them, 31 patients survived, 24 patients died, and the other 5 patients were lost. The survivors had a significantly higher expression of hsa_circ_0001640 than the patients who died within 5 years after surgery (P=0.014). Therefore, hsa_circ_0001640 is correlated with 5-year prognosis of LUAD patients. Next, we performed Kaplan-Meier univariate analysis and COX multivariate analysis of the 55 patients who had data of 5-year prognoses after pulmonary surgery ( Table 2 ). We divided these patients into high-expression group and low-expression group by median of hsa_circ_0001640 expression. The results of univariate analysis showed that OS of LUAD patients was related to gender, clinical stage, T stage, N stage, NSE and hsa_circ_0001640 expression level. Age, smoking history, tumor size, and tumor markers such as CEA and CYFRA21-1 were not risk factors. There was a linear positive correlation between OS and level of hsa_circ_0001640 ( Fig. 1f , P = 0.014). OS of high-expression group was far longer than that of low-expression group (P=0.004). 75% patients in high-expression group survived 5 years after surgery, while only 41.9% patients in low-expression group survived that long ( Fig. 1g ). Gender, clinical stage, T stage, N stage, NSE and RNA expression level were selected to perform COX multivariate regression analysis. We observed that clinical stage, NSE and expression level of hsa_circ_0001640 were independent correlation factors (P=0.008, 0.033 and 0.024, respectively). Clinical stage and NSE were risk factors, while hsa_circ_0001640 was a protective factor. Cumulative survival risk of LUAD patients gradually increased with passage of time, but high expression of hsa_circ_0001640 could reduce such risk to a great extent ( Fig. 1h , P=0.016). Hsa_circ_0001640 inhibits LUAD pro liferation and invasion In order to further verify the role of hsa_circ_0001640 in LUAD, two cell lines, H1299 and H1975, were treated by plasmid with high expression of hsa_circ_0001640 (Lenti-hsa_circ_0001640), respectively，and verified by qRT-PCR ( Fig. 2a ). In CCK-8 assay, the proliferation of LUAD cells was significantly delayed by upregulation of hsa_circ_0001640, compared with the negative control ( Fig. 2b, c ). Meanwhile, more cells were captured in phase G1 with upregulation of hsa_circ_0001640 compared with control ( Fig 2d, e ). Afterwards, the results of cell clone and proliferation experiment showed the same proliferation inhibition as above ( Fig. 2f ). The wound healing assay and transwell assay also demonstrated that the migration and invasion abilities of both cell lines were evidently suppressed with upregulation of hsa_circ_0001640 ( Fig. 2g, h, i ). Tumor-derived hsa_circ_0001640 can also suppress the tumor angiogenesis by reducing HUVECs migration, invasion and tube formation ( Fig. S2 ). However, the apoptosis of cells did not show significant differences in diverse expression groups of hsa_circ_0001640 ( Fig. S3 ). To further confirm above observations, tumor cells were subcutaneously injected into mice to observe tumor growth in vivo. 20 mice were randomly divided into 4 groups by upregulating or silencing hsa_circ_0001640 ( Fig. 2j ). The weight and the size of tumors were definitely lower in Lenti-RNA group at the end of 3weeks than those in control, while silencing of hsa_circ_0001640 could significantly promote tumor growth ( Fig. 2k, l ). MiR-942 is a target of hsa_circ_0001640 We further investigated circRNA-miRNA pathway by searching database Circinteractome ( https://circinteractome.nia.nih.gov/ ). Relative expression of 11 predicted miRNAs was evaluated and miR-942, miR-630, miR-582-3p were demonstrated negatively correlated with hsa_circ_0001640 ( Fig. 3a, S4 ). Considering that miR-942 has 2 binding sites with the same sequence on hsa_circ_0001640 and is most relevant to hsa_circ_0001640 (R 2 = 0.7699), among the 3 miRNAs, we focused on miR-942 in our further experiments. Potential binding site of miR-942 with hsa_circ_0001640 was shown in Fig. S5a . The subcellular colocalization between hsa_circ_0001640 and miR-942 in cytoplasm and nucleus was proved by FISH ( Fig. 3b ). And we found a negative linear correlation between the relative expression of hsa_circ_0001640 and miR-942, judging by fluorescence intensity ( Fig. 3c ). Furthermore, the direct bonding of hsa_circ_0001640 with miR-942 was validated by luciferase report assay as there was an indeed reduced fluorescence intensity of miR-942 mimics in hsa_circ_0001640-WT group in contrast to the control ( Fig. 3d ). Hsa_circ_0001640 can suppress the migration and invasion of LUAD cells by inhibiting miR-942 MiR-942 could remarkedly enhance the migration and invasion capability of H1299 cells according to the results of the wound healing assay and transwell assay ( Fig. 4a, b ). Therefore, we hypothesized that miR-942 could contribute to progress of lung carcinogenesis. To further verify this hypothesis, experiments in vivo were performed by injecting H1299 cells transfected with miR-942 mimics or inhibitors into mice. We found that adding miR-942 was accompanied with an augmentation of tumor volume and weight, and tumors shrank in both size and weight with downregulation of miR-942 ( Fig. 4c, d, e ). The functional correlation between hsa_circ_0001640 and miR-942 was evaluated. The reduction of cell invasion induced by miR-942 inhibitors equaled to that induced by upregulation of hsa_circ_0001640 ( Fig. 4f, g ). Conversely, the increase of cells invasion induced by miR-942 mimics was similar to that induced by knockdown of hsa_circ_0001640 ( Fig. 4h, i ). Hsa_circ_0001640 also prevents EMT of LUAD in vivo and in vitro E-cadherin, fibronectin, matrix metalloproteinase-1 (MMP-1) and MMP-9 were detected by immunofluorescence and immunoblotting to evaluate hsa_circ_0001640 function in EMT. Upregulation of hsa_circ_0001640 led to high expression of E-cadherin and low expression of fibronectin, MMP-1, MMP-9 (Fig. 5a, b). By comparison, silencing of hsa_circ_0001640 caused reduced E-cadherin expression and increased fibronectin, MMP-1, MMP-9 expression (Fig. 5b), indicating that hsa_circ_0001640 might suppress EMT progression. MMP-1, MMP-9 and fibronectin showed negative correlations with hsa_circ_0001640, while E-cadherin had an opposite result. Hsa_circ_0001640 can promote NKIRAS2 and GSK3β expressions To explore the downstream pathway of miR-942, we searched TargetScan (www.targetscan.org) and found predicted binding sites of miR-942 on promotors of target genes, such as NKIRAS2 (NF-κB inhibitor interacting RAS-like 2) and GSK3β (Glycogen synthase kinase-3β) ( Fig. S5b, c ). This prediction was verified by western blot ( Fig. 6a, b ). With upregulation of miR-942, NKIRAS2 and GSK3β were suppressed, and inhibition of miR-942 could enhance the expression of NKIRAS2 and GSK3β. However, hsa_circ_0001640 had exactly an opposite result. Discussion Here we aimed to explore the potential antitumor effect of hsa_circ_0001640 on LUAD based on a molecular mechanistic understanding. By screening a comprehensive circRNAs profile of LUAD, we found that Hsa_circ_0001640 differentially expressed in LUAD and adjacent nontumor tissue pairs by high-throughput sequencing technology and certainly correlated with the prognosis of LUAD patients. Second, we studied the interactivity between hsa_circ_0001640 and miR-942, characterized a critical role of hsa_circ_0001640/miR-942 axis in LUAD migration, invasion, angiogenesis and progression. Third, we further revealed that hsa_circ_0001640 may block both Wnt and NF-κB pathways by promoting GSK3β and NKIRAS2, leading to the supression of LUAD development. Hsa_circ_0001640 is derived from gene EPB41L2 and is located in chromosome 6, with a length of 719bp. Increasing circRNAs have been found to be related to a variety of diseases such as cardiovascular diseases, neurological diseases, infectious diseases, and tumors through sequencing or RNA Chip technology. Multiple and diverse circRNAs enriching and separately presenting different profiles in each cancer type, undertake manifold actions.(Vo, Cieslik et al. 2019) Despite the fact that hsa_circ_0001640 is already known in circBase, it’s feature and functional significance have never been reported to date. Compared with linear non-coding RNAs such as miRNAs and lncRNAs, circRNAs are highly conserved and more stable because of their special circular structures. Therefore, circRNAs might become potential biomarkers, as well as new targets for treatment. Recent researches identified circular RNAs as promising biomarkers in tumors of the central nervous system.(Khan, Ullah et al. 2018) Hepatocellular carcinoma (HCC) patients with low hsa_circRNA_0007874 expression had shortened survival. CiRS-7, proposed to be a potential miR-7 sponge, emerged as an independent risk factor for overall survival of colorectal cancer patients.(Weng, Wei et al. 2017) We demonstrated that hsa_circ_0001640 is implicated in clinical stage, lymph node metastasis, NSE and prognoses of LUAD patients. There was no evident change in hsa_circ_0001640 levels in stage I and II of LUAD, but when tumors developed to stage III, hsa_circ_0001640 expression was significantly weakened. Similar phenomenon was also observed in lymph node invasion that hsa_circ_0001640 was more sensitive to LUAD in stage N2. High level of NSE was found to be associated with decrease of hsa_circ_0001640 and high-risk of death, while NSE is generally considered to be elevated in neuroendocrine tumors. The study of Liu et al also confirmed NSE as an independent prognostic factor for LUAD.(Liu, Huang et al. 2019) Therefore, we inferred that NSE might be a sensitive indicator of prognosis. However, the number of patients who survived after the surgery for up to 5 years is limited. Follow-ups and large scale studies in patients are undergoing. MiR-942, of which the role in osteogenesis and vascular regeneration was deeply unearthed,(Ouyang, Tan et al. 2019) has been newly proved to promote EMT by inhibiting BARX2, leading to NSCLC metastasis, invasion and angiogenesis.(Yang, Shao et al. 2019) In addition, Ge et al.'s study found that miR-942 can participate in Wnt/β-catenin signaling pathway to promote colorectal cancer.(Shan, An et al. 2018) As ceRNAs, circRNAs are considered as endogenous "sponge" that can competitively bind to miRNAs to impact the function of miRNAs.(Tay, Rinn et al. 2014, Zheng, Bao et al. 2016) The circRNA-miRNA interaction network is also involved in tumors. Circ-CEP85L is significantly downregulated in gastric cancer and suppresses the proliferation and invasion by regulating NFKBIA expression via miR-942.(Lu, Wang et al. 2020) Our research demonstrated the existence of sponge effect between hsa_circ_0001640 and miR-942 for the first time. The classical Wnt signaling pathway, also named as Wnt/β-catenin signaling pathway, can promote expression of target genes by transferring recruited β-catenin from cytoplasm to the nucleus. GSK3β is the main negative regulator of β-catenin. When the pathway is not activated, adenomatous polyposis coli (APC), Axin, casein kinase (CK) and GSK3β can form a complex and induce ubiquitination and degradation of β-catenin, thus inhibiting the classical Wnt signaling pathway.(Clevers and Nusse 2012) NF-κB signaling pathway is also vital in tumors, which can inhibit cell apoptosis and participate in cell cycle and differentiation. NKIRAS2 can suppress the pathway, thereby inhibiting tumor progression.(Xu, Zhou et al. 2019) Both the pathways are required for EMT, migration and invasion of tumors.(Wu, Deng et al. 2009, Gujral, Chan et al. 2014) EMT-activated cancer cells are in favor of migration, invasion and metastasis.(Caramel, Papadogeorgakis et al. 2013, Wong, Javaid et al. 2014) A variety of circRNAs are regulated during human EMT.(Conn, Pillman et al. 2015) The levels of E-cadherin (a specific biomarker of epithelium), fibronectin (a specific biomarker of mesenchyme), MMP-1 and MMP-9 (vital factors in promoting EMT) changes when EMT occurs. By inducing EMT through sponging miR-30c, circPRMT5 promotes metastasis of urothelial carcinoma.(Chen, Chen et al. 2018) CircPTPRA suppresses EMT and metastasis of NSCLC cells by sponging miR-96.(Zhong, Huang et al. 2017) We found that hsa_circ_0001640 can also inhibit EMT in LUAD by inhibiting the expression of miR-942, and this tumor suppressive effect may be correlated to both Wnt and NF-κB signaling pathways. The effect of tumor-derived circRNAs loaded in exosomes or in the form of extracellular free-RNAs on the vascular formation in tumors has drawn our attention. Studies have proved that circRNAs can take part in angiogenesis of tumors, like bladder cancer (Zhong, Huang et al. 2017) and HCC.(Huang, Huang et al. 2020) Our present investigation is the first report of circRNA/miRNA sponge effect in lung cancer angiogenesis. Conclusion Our data showed that hsa_circ_0001640 has a tumor suppressive effect in LUAD, which is related to clinical stage, lymph node metastasis and prognosis of patients. Hsa_circ_0001640 has a sponge effect on miR-942 to inhibit Wnt and NF-κB signaling pathways, thereby inhibiting migration and invasion of lung cancer, and might be a novel biomarker and therapeutic target. Declarations Acknowledgements We thank Shanghai Institutes for Biological Sciences, Chinese Academy of Science for the support of experiment platform and National Innovative Research Team of High-level Local Universities in Shanghai. Statements of Ethics The study was conducted in accordance with the Declaration of Helsinki, in accordance with the relevant guidelines and regulations. The Regional Ethics Committee at Ruijin Hospital, Shanghai Jiao Tong University School of Medicine approved the study and the hospital and the patients both consented to specimen collection following guidelines from the Ruijin Ethics Board. Conflict of Interest Statement The authors have no conflicts of interest to declare. Funding Sources This study is supported by the National Natural Science Funds of China (81770025, 81970020), the Science and Technology Commission of Shanghai Municipality (17411965000), Shanghai Jiao Tong University Medical cross project (YG2017MS64) , Shanghai Natural Science Foundation (18ZR1424000), Shanghai Municipal Key Clinical Specialty (shslczdzk02202), Shanghai Top-Priority Clinical Key Disciplines Construction Project (2017ZZ02014), Author Contributions H.H., K.X., X.D. designed, performed, and analyzed most experiments, and wrote the article. V.M.L. validated the experimental results, O.D. and H.L. collected the experimental data, G.S., L.N. and L.Z. supervised the entire experimental process and helped revise the manuscript. Data Availability Statement The authors confirm that the data supporting the findings of this study are available within the article and/or its supplementary materials. References Caramel, J., E. Papadogeorgakis, L. Hill, G. J. Browne, G. Richard, A. Wierinckx, G. Saldanha, J. Osborne, P. Hutchinson, G. Tse, J. Lachuer, A. Puisieux, J. H. Pringle, S. Ansieau and E. Tulchinsky (2013). A switch in the expression of embryonic EMT-inducers drives the development of malignant melanoma. Cancer Cell 24(4):466-480. https://doi.org/10.1016/j.ccr.2013.08.018. Chen, W., R. Zheng, P. D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X. Q. Yu and J. He (2016). Cancer statistics in China, 2015. CA Cancer J Clin 66(2):115-132. https://doi.org/10.3322/caac.21338. Chen, X., R. X. Chen, W. S. Wei, Y. H. Li, Z. H. Feng, L. Tan, J. W. Chen, G. J. Yuan, S. L. Chen, S. J. Guo, K. H. Xiao, Z. W. Liu, J. H. Luo, F. J. Zhou and D. Xie (2018). PRMT5 Circular RNA Promotes Metastasis of Urothelial Carcinoma of the Bladder through Sponging miR-30c to Induce Epithelial-Mesenchymal Transition. Clin Cancer Res 24(24):6319-6330. https://doi.org/10.1158/1078-0432.ccr-18-1270. Chen, X., R. Mao, W. Su, X. Yang, Q. Geng, C. Guo, Z. Wang, J. Wang, L. A. Kresty, D. G. Beer, A. C. Chang and G. Chen (2019). Circular RNA circHIPK3 modulates autophagy via MIR124-3p-STAT3-PRKAA/AMPKalpha signaling in STK11 mutant lung cancer. Autophagy1-13. https://doi.org/10.1080/15548627.2019.1634945. Clevers, H. and R. Nusse (2012). Wnt/beta-catenin signaling and disease. Cell 149(6):1192-1205. https://doi.org/10.1016/j.cell.2012.05.012. Conn, S. J., K. A. Pillman, J. Toubia, V. M. Conn, M. Salmanidis, C. A. Phillips, S. Roslan, A. W. Schreiber, P. A. Gregory and G. J. Goodall (2015). The RNA binding protein quaking regulates formation of circRNAs. Cell 160(6):1125-1134. https://doi.org/10.1016/j.cell.2015.02.014. Gujral, T. S., M. Chan, L. Peshkin, P. K. Sorger, M. W. Kirschner and G. MacBeath (2014). A noncanonical Frizzled2 pathway regulates epithelial-mesenchymal transition and metastasis. Cell 159(4):844-856. https://doi.org/10.1016/j.cell.2014.10.032. Hsu, M. T. and M. Coca-Prados (1979). Electron microscopic evidence for the circular form of RNA in the cytoplasm of eukaryotic cells. Nature 280(5720):339-340. https://doi.org/10.1038/280339a0. Huang, X. Y., Z. L. Huang, J. Huang, B. Xu, X. Y. Huang, Y. H. Xu, J. Zhou and Z. Y. Tang (2020). Exosomal circRNA-100338 promotes hepatocellular carcinoma metastasis via enhancing invasiveness and angiogenesis. J Exp Clin Cancer Res 39(1):20. https://doi.org/10.1186/s13046-020-1529-9. Khan, I. N., N. Ullah, D. Hussein and K. S. Saini (2018). Current and emerging biomarkers in tumors of the central nervous system: Possible diagnostic, prognostic and therapeutic applications. Semin Cancer Biol 52(Pt 1):85-102. https://doi.org/10.1016/j.semcancer.2017.07.004. Kristensen, L. S., M. S. Andersen, L. V. W. Stagsted, K. K. Ebbesen, T. B. Hansen and J. Kjems (2019). The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20(11):675-691. https://doi.org/10.1038/s41576-019-0158-7. Liu, C., Q. Huang, W. Ma, L. Qi, Y. Wang, T. Qu, L. Sun, B. Sun, B. Meng and W. Cao (2019). A combination of tumor and molecular markers predicts a poor prognosis in lung adenocarcinoma. Int J Clin Exp Pathol 12(5):1690-1701. Lu, J., Y. H. Wang, X. Y. Huang, J. W. Xie, J. B. Wang, J. X. Lin, Q. Y. Chen, L. L. Cao, C. M. Huang, C. H. Zheng and P. Li (2020). circ-CEP85L suppresses the proliferation and invasion of gastric cancer by regulating NFKBIA expression via miR-942-5p. J Cell Physiolhttps://doi.org/10.1002/jcp.29556. Memczak, S., M. Jens, A. Elefsinioti, F. Torti, J. Krueger, A. Rybak, L. Maier, S. D. Mackowiak, L. H. Gregersen, M. Munschauer, A. Loewer, U. Ziebold, M. Landthaler, C. Kocks, F. le Noble and N. Rajewsky (2013). Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495(7441):333-338. https://doi.org/10.1038/nature11928. Ouyang, Z., T. Tan, X. Zhang, J. Wan, Y. Zhou, G. Jiang, D. Yang, X. Guo and T. Liu (2019). CircRNA hsa_circ_0074834 promotes the osteogenesis-angiogenesis coupling process in bone mesenchymal stem cells (BMSCs) by acting as a ceRNA for miR-942-5p. Cell Death Dis 10(12):932. https://doi.org/10.1038/s41419-019-2161-5. Salmena, L., L. Poliseno, Y. Tay, L. Kats and P. P. Pandolfi (2011). A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146(3):353-358. https://doi.org/10.1016/j.cell.2011.07.014. Sanger, H. L., G. Klotz, D. Riesner, H. J. Gross and A. K. Kleinschmidt (1976). Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci U S A 73(11):3852-3856. https://doi.org/10.1073/pnas.73.11.3852. Shan, Z., N. An, J. Qin, J. Yang, H. Sun and W. Yang (2018). Long non-coding RNA Linc00675 suppresses cell proliferation and metastasis in colorectal cancer via acting on miR-942 and Wnt/beta-catenin signaling. Biomed Pharmacother 101(769-776. https://doi.org/10.1016/j.biopha.2018.02.123. Siegel, R. L., K. D. Miller and A. Jemal (2020). Cancer statistics, 2020. CA Cancer J Clin 70(1):7-30. https://doi.org/10.3322/caac.21590. Tan, S., D. Sun, W. Pu, Q. Gou, C. Guo, Y. Gong, J. Li, Y. Q. Wei, L. Liu, Y. Zhao and Y. Peng (2018). Circular RNA F-circEA-2a derived from EML4-ALK fusion gene promotes cell migration and invasion in non-small cell lung cancer. Mol Cancer 17(1):138. https://doi.org/10.1186/s12943-018-0887-9. Tay, Y., J. Rinn and P. P. Pandolfi (2014). The multilayered complexity of ceRNA crosstalk and competition. Nature 505(7483):344-352. https://doi.org/10.1038/nature12986. Vo, J. N., M. Cieslik, Y. Zhang, S. Shukla, L. Xiao, Y. Zhang, Y. M. Wu, S. M. Dhanasekaran, C. G. Engelke, X. Cao, D. R. Robinson, A. I. Nesvizhskii and A. M. Chinnaiyan (2019). The Landscape of Circular RNA in Cancer. Cell 176(4):869-881.e813. https://doi.org/10.1016/j.cell.2018.12.021. Wang, K., B. Long, F. Liu, J. X. Wang, C. Y. Liu, B. Zhao, L. Y. Zhou, T. Sun, M. Wang, T. Yu, Y. Gong, J. Liu, Y. H. Dong, N. Li and P. F. Li (2016). A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur Heart J 37(33):2602-2611. https://doi.org/10.1093/eurheartj/ehv713. Wang, L., X. Tong, Z. Zhou, S. Wang, Z. Lei, T. Zhang, Z. Liu, Y. Zeng, C. Li, J. Zhao, Z. Su, C. Zhang, X. Liu, G. Xu and H. T. Zhang (2018). Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-beta-induced epithelial-mesenchymal transition and metastasis by controlling TIF1gamma in non-small cell lung cancer. Mol Cancer 17(1):140. https://doi.org/10.1186/s12943-018-0889-7. Weng, W., Q. Wei, S. Toden, K. Yoshida, T. Nagasaka, T. Fujiwara, S. Cai, H. Qin, Y. Ma and A. Goel (2017). Circular RNA ciRS-7-A Promising Prognostic Biomarker and a Potential Therapeutic Target in Colorectal Cancer. Clin Cancer Res 23(14):3918-3928. https://doi.org/10.1158/1078-0432.ccr-16-2541. Wong, I. Y., S. Javaid, E. A. Wong, S. Perk, D. A. Haber, M. Toner and D. Irimia (2014). Collective and individual migration following the epithelial-mesenchymal transition. Nat Mater 13(11):1063-1071. https://doi.org/10.1038/nmat4062. Wu, Y., J. Deng, P. G. Rychahou, S. Qiu, B. M. Evers and B. P. Zhou (2009). Stabilization of snail by NF-kappaB is required for inflammation-induced cell migration and invasion. Cancer Cell 15(5):416-428. https://doi.org/10.1016/j.ccr.2009.03.016. Xu, Y. J., R. Zhou, J. F. Zong, W. S. Lin, S. Tong, Q. J. Guo, C. Lin, S. J. Lin, Y. X. Chen, M. R. Chen, H. L. Chen, Y. B. Ye and J. J. Pan (2019). Epstein-Barr virus-coded miR-BART13 promotes nasopharyngeal carcinoma cell growth and metastasis via targeting of the NKIRAS2/NF-kappaB pathway. Cancer Lett 447(33-40. https://doi.org/10.1016/j.canlet.2019.01.022. Yang, F., C. Shao, K. Wei, X. Jing, Z. Qin, Y. Shi, Y. Shu and H. Shen (2019). miR-942 promotes tumor migration, invasion, and angiogenesis by regulating EMT via BARX2 in non-small-cell lung cancer. J Cell Physiol 234(12):23596-23607. https://doi.org/10.1002/jcp.28928. Zheng, Q., C. Bao, W. Guo, S. Li, J. Chen, B. Chen, Y. Luo, D. Lyu, Y. Li, G. Shi, L. Liang, J. Gu, X. He and S. Huang (2016). Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat Commun 7(11215. https://doi.org/10.1038/ncomms11215. Zhong, Z., M. Huang, M. Lv, Y. He, C. Duan, L. Zhang and J. Chen (2017). Circular RNA MYLK as a competing endogenous RNA promotes bladder cancer progression through modulating VEGFA/VEGFR2 signaling pathway. Cancer Lett 403(305-317. https://doi.org/10.1016/j.canlet.2017.06.027. Tables Table 1 The correlation between expression of hsa_circ_0001640 and clinicopathological characteristics. Groups Numbers RNA expression P value Sex Male 46 0.0006 ± 0.0010 0.110 Female 44 0.0011 ± 0.0016 Age (years) < 65 57 0.0009 ± 0.0015 0.792 ≥ 65 33 0.0008 ± 0.0009 Smoking No 58 0.0010 ± 0.0015 0.055 Yes 32 0.0005 ± 0.0010 Clinical stage I 39 0.0034 ± 0.1000 0.002 II 14 0.0039 ± 0.0096 III 37 0.0004 ± 0.0008 Tumor size (cm) ≤ 3 56 0.0009 ± 0.0012 0.501 > 3 34 0.0007 ± 0.0015 T stage T1 44 0.000900 ± 0.001300 0.400 T2 31 0.000980 ± 0.001600 T3 11 0.000440 ± 0.000630 T4 4 0.000012 ± 0.000008 Lymph node metastasis N0 47 0.0037 ± 0.0110 0.015 N1 10 0.003 ± 0.0019 N2 33 0.0003 ± 0.0006 N3 0 / CEA Negative 55 0.0010 ± 0.0015 0.342 Positive 32 0.0007 ± 0.0011 Unknown 3 / CYFRA21-1 Negative 63 0.0008 ± 0.0012 0.469 Positive 24 0.0010 ± 0.0017 Unknown 3 / NSE Negative 40 0.00085 ± 0.00140 0.005 Positive 14 0.00018 ± 0.00024 Unknown 1 / Prognosis † Survival 31 0.0010 ± 0.0016 0.014 Death 24 0.0003 ± 0.0004 Recurrence or remote metastasis † Negative 15 0.0012 ± 0.0016 0.126 Positive 40 0.0005 ± 0.0010 † 5 years after surgery. Table 2 Kaplan-Meier univariate and COX multivariate analysis. Groups Average survival time (days) Univariate P value Multivariate P value Sex Male 1419.77 ± 145.41 0.042 0.410 Female 1895.75 ± 160.74 Age (years) < 65 1748.81 ± 140.02 0.140 / ≥ 65 1392.88 ± 179.76 Smoking No 1792.53 ± 138.37 0.067 / Yes 1354.64 ± 175.83 Clinical stage I 2147.14 ± 89.65 0.000 0.008 II 1273.50 ± 229.78 III 1122.67 ± 171.64 Tumor size (cm) < 3 1770.81 ± 126.84 0.190 / 3 - 5 1220.62 ± 240.15 5 - 7 1042.00 ± 330.33 ≥ 7 1134.50 ± 558.97 T stage T1 1848.81 ± 134.86 0.011 0.240 T2 1393.07 ± 223.13 T3 768.29 ± 176.36 T4 1608.60 ± 516.30 N stage N0 2040.19 ± 111.94 0.000 0.990 N1 1302.25 ± 275.68 N2 1076.60 ± 179.98 CEA Negative 1690.89 ± 140.25 0.160 / Positive 1371.32 ± 190.92 CYFRA21-1 Negative 1701.84 ± 129.00 0.140 / Positive 1195.38 ± 196.16 NSE Negative 1783.88 ± 123.31 0.001 0.033 Positive 972.71 ± 189.54 RNA High expression 2007.75 ± 104.94 0.004 0.024 Low expression 1263.06 ± 160.98 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFiles.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3805181","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":263281528,"identity":"6db99b9d-c447-4fbf-8cbb-5a776ae1731e","order_by":0,"name":"Huize Han","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Huize","middleName":"","lastName":"Han","suffix":""},{"id":263281530,"identity":"179af39a-d7e1-4949-b38c-f69b383c634f","order_by":1,"name":"Kandi Xu","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kandi","middleName":"","lastName":"Xu","suffix":""},{"id":263281531,"identity":"11270b1a-92d8-4734-a76c-29ee7a625889","order_by":2,"name":"Xueqing Du","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xueqing","middleName":"","lastName":"Du","suffix":""},{"id":263281532,"identity":"8db1fa4e-7e23-4e17-bcc1-3abdf7535bab","order_by":3,"name":"Van Minh Le","email":"","orcid":"","institution":"National Institute of Medicinal Materials","correspondingAuthor":false,"prefix":"","firstName":"Van","middleName":"Minh","lastName":"Le","suffix":""},{"id":263281533,"identity":"6b03ef9a-2297-45bb-83f6-911edf14f975","order_by":4,"name":"Hongxia Lin","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hongxia","middleName":"","lastName":"Lin","suffix":""},{"id":263281534,"identity":"1c1d399a-3976-4998-965c-3e80ccc44be9","order_by":5,"name":"Ocholi Don","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ocholi","middleName":"","lastName":"Don","suffix":""},{"id":263281536,"identity":"43cff1b2-d356-40e2-b849-5170535d3e10","order_by":6,"name":"Lei Ni","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Ni","suffix":""},{"id":263281537,"identity":"f16559fe-8e3d-43b8-a865-10b324235979","order_by":7,"name":"Guochao Shi","email":"","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Guochao","middleName":"","lastName":"Shi","suffix":""},{"id":263281539,"identity":"1d38eed0-250b-410d-b5a6-f33afbfe7537","order_by":8,"name":"Ling Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIie3PMQ6CMBiG4b9pAksT1k5wBYirh8FFJhJHxhISWTwARs+ha0nX6mwCg4mJs264EFsnJyibiX3n/0m/Athsv5iLmHj1vQ8gTQnGuQCHz6YQt9BkwYAYiqBQw1akTY75iUOXHcDbsWGCNKnoPd3zc4w2sgHa8pFdGDFOQpxWIEOM1g2ENB4mzofEOKHGhCgiCBexOaGK1Fu2jPSwWv2F0MsICcry9niyeUCpjK5d1vheNUK+3uPA9VLTe5XHJhzbbDbbX/UGBntF2dqEyDgAAAAASUVORK5CYII=","orcid":"","institution":"Shanghai Jiao Tong University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Ling","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2023-12-25 16:29:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3805181/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3805181/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49078671,"identity":"a11347a6-5853-4eb5-b34c-c309e000f3fc","added_by":"auto","created_at":"2024-01-02 19:23:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":324106,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehsa_circ_0001640 was low-expressed in LUAD and indicated a poor survival.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea. \u003c/strong\u003eExpression of circRNAs in 3 LUAD tissues and paratumoral tissues were normalized and the differences were judged by log\u003csub\u003e2\u003c/sub\u003eFoldChange and P value. |log\u003csub\u003e2\u003c/sub\u003eFoldChange\u0026gt;2| and P\u0026lt;0.05 was regarded as meaningful.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. \u003c/strong\u003e37 differently expressed circRNAs were shown in the heatmap. (T: tumor tissue, N: adjacent non-tumor tissue; Red: overexpressed; Green: low-expressed)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec.\u003c/strong\u003e qRT-PCR verified the low expression of hsa_circ_0001640 in 90 LUAD tissues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed. \u003c/strong\u003eThe differential expression of hsa_circ_0001640 between LUAD and adjacent tissues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee. \u003c/strong\u003eThe ROC curve exhibited the sensitivity and specificity of hsa_circ_0001640 in LUAD diagnosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef. \u003c/strong\u003eThere was a linear positive correlation between OS and level of hsa_circ_0001640 (P = 0.0142).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg. \u003c/strong\u003ePatients with high-expressed hsa_circ_0001640 had a better OS (P=0.0043).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh.\u003c/strong\u003e High expression of hsa_circ_0001640 was linked to a low cumulative survival risk of LUAD patients (P=0.016).\u003c/p\u003e\n\u003cp\u003eData are presented as the means ± SD.\u003c/p\u003e","description":"","filename":"F1.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/29ca3b514a115a340fc95776.png"},{"id":49077493,"identity":"9a02a799-8617-40ec-937c-b0e55457b6ff","added_by":"auto","created_at":"2024-01-02 19:07:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1099970,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehsa_circ_0001640 inhibits LUAD proliferation and invasion.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea. \u003c/strong\u003ehsa_circ_0001640 overexpressed in H1299 (left) and H1275 (right) cells was verified by qRT-PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb, c.\u003c/strong\u003eThe 450nm OD values of hsa_circ_0001640-overexpressing cells and their control were measured at different time points.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed, e.\u003c/strong\u003eThe cell cycles of hsa_circ_0001640-overexpressing cells and their control were examined by flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef.\u003c/strong\u003eThe proliferation of hsa_circ_0001640-overexpressing cells and their control was assessed by cell clone and proliferation experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg.\u003c/strong\u003eThe invasion abilities of hsa_circ_0001640-overexpressing cells and their control were estimated by transwell assay (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh, i.\u003c/strong\u003eThe migration abilities of hsa_circ_0001640-overexpressing cells (\u003cstrong\u003eh.\u003c/strong\u003eH1299, \u003cstrong\u003ei.\u003c/strong\u003e H1275) and their control were evaluated by wound healing assay (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej. \u003c/strong\u003eRepresentative tumor images of mice subcutaneously injected with hsa_circ_0001640-overexpressing cells, hsa_circ_0001640-knockdown cells, and their control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek.\u003c/strong\u003eTumor weight of mice in each group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003el.\u003c/strong\u003eTumor volume of mice in each group was measured at the end of every week.\u003c/p\u003e\n\u003cp\u003eData are presented as the means ± SD. *P\u0026lt;0.05; **P \u0026lt;0.01.\u003c/p\u003e","description":"","filename":"F2.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/d6cfc7d190a9af99380fc632.png"},{"id":49078303,"identity":"dd3b2818-0ead-4b27-acd5-01918a498133","added_by":"auto","created_at":"2024-01-02 19:15:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":334161,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-942 is a target of hsa_circ_0001640.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003eRT-PCR screened the relative expression of 11 predicted miRNAs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb.\u003c/strong\u003eImmunofluorescence proved a colocalization between hsa_circ_0001640 and miR-942 (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec.\u003c/strong\u003eJudging by fluorescence intensity, we found a negative linear correlation between relative expression of hsa_circ_0001640 and miR-942.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed.\u003c/strong\u003eLuciferase report assay revealed a direct combination of hsa_circ_0001640 and miR-942.\u003c/p\u003e\n\u003cp\u003eData are presented as the means ± SD. *P\u0026lt;0.05; **P \u0026lt;0.01. NS: non-significance.\u003c/p\u003e","description":"","filename":"F3.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/7cf6de50a686f84801a75221.png"},{"id":49077492,"identity":"40219239-9dc9-47d9-965d-574869214bae","added_by":"auto","created_at":"2024-01-02 19:07:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":879343,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehsa_circ_0001640 can suppress the migration and invasion of LUAD cells by inhibiting miR-942.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003eWound healing assay of H1299 cells with miR-942 mimics, inhibitors or their control (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb.\u003c/strong\u003eTranswell assay of H1299 cells with miR-942 mimics, inhibitors or their control (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec.\u003c/strong\u003eRepresentative tumor images of mice subcutaneously injected with H1299 cells treated with miR-942 mimic, miR-942 inhibitors or their control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed.\u003c/strong\u003eTumor weight of mice in each group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee.\u003c/strong\u003eTumor volume of mice in each group was measured at the end of every week.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef, g.\u003c/strong\u003eTranswell assay of H1299 cells with Lenti-hsa_circ_0001640, miR-942 inhibitors or their control (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh, i.\u003c/strong\u003eTranswell assay of H1299 cells with siRNA-hsa_circ_0001640, miR-942 mimics or their control (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003eData are presented as the means±SD. *P\u0026lt;0.05; **P \u0026lt;0.01; NS: non-significance.\u003c/p\u003e","description":"","filename":"F4.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/ae70a78f71ac82a564cdeff9.png"},{"id":49077490,"identity":"033db964-0422-400b-9d54-d93ed12d59ca","added_by":"auto","created_at":"2024-01-02 19:07:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":443688,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehsa_circ_0001640 also prevents EMT of LUAD in vivo and in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003eImmunofluorescence showed E-cadherin and fibronectin expression in H1299 cells with Lenti-hsa_circ_0001640 or the control (scale bar: 100um).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb.\u003c/strong\u003eWestern blot reflected MMP-9, MMP-1, fibronectin and E-cadherin expression in H1299 cells with Lenti-hsa_circ_0001640, siRNA-hsa_circ_0001640 or their control.\u003c/p\u003e","description":"","filename":"F5.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/77e88d4604e7c69b6584ef9c.png"},{"id":49077488,"identity":"4bc63399-85ea-4b72-8009-b06e50af85a1","added_by":"auto","created_at":"2024-01-02 19:07:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":112543,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehsa_circ_0001640 can promote NKIRAS2 and GSK3β.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea. \u003c/strong\u003eWestern blot tested the expression of NKIRAS2 and GSK3β in H1299 cells with upregulation of miR-942, inhibition of miR-942 or their control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb.\u003c/strong\u003eWestern blot checked the expression of NKIRAS2 and GSK3β in H1299 cells with upregulation of hsa_circ_0001640, inhibition of hsa_circ_0001640 or their control.\u003c/p\u003e","description":"","filename":"F6.png","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/887e6247f64795d3dfab2623.png"},{"id":49271390,"identity":"6f991f22-814f-485f-bf42-69808e734691","added_by":"auto","created_at":"2024-01-07 06:53:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3824299,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/0e905960-5f47-4943-ad47-6007845664cc.pdf"},{"id":49077495,"identity":"8e64c875-92ca-4f44-bd52-b69d8a5c83a0","added_by":"auto","created_at":"2024-01-02 19:07:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":12815189,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-3805181/v1/30512b31b49a614d66fee2c3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hsa_circ_00011640 inhibits lung adenocarcinoma by targeting miR-942","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLung adenocarcinoma (LUAD) is the most common and aggressive pathological type of lung cancer. Most LUAD deaths are attributed to metastasis. Although enormous efforts have been made to improve therapeutic effect, LUAD patients still suffer an unneglectable mortality.(Chen, Zheng et al. 2016, Siegel, Miller et al. 2020)\u003c/p\u003e\n\u003cp\u003eCircRNAs are a class of widespread non-coding RNAs (ncRNAs) that contain covalently closed loops, discovered by Sanger.(Sanger, Klotz et al. 1976)\u0026nbsp;From then on, circRNAs have been observed in diverse species, and have become one of the largest RNA families.(Hsu and Coca-Prados 1979, Memczak, Jens et al. 2013)\u0026nbsp;According to the competing endogenous RNAs (ceRNAs) hypothesis (all types of RNAs, including coding RNAs, non-coding RNAs and pseudogene, can communicate with each other through miRNA binding sites),(Salmena, Poliseno et al. 2011, Tay, Rinn et al. 2014)\u0026nbsp;the interactions between RNA, DNA, and proteins can be interconverted by the media RNAs, in which circRNAs are critical participants. To date, biological functions of circRNAs have only been investigated in a minor fraction of these important molecules, most of which showed a great regulatory potential to targeted genes as sponges of miRNAs,(Wang, Long et al. 2016)\u0026nbsp;enabled circRNAs to play a vital role in different biological processes. Besides, other circRNAs can act as protein inhibitors, regulating protein function or translation of their parental genes.(Kristensen, Andersen et al. 2019)\u003c/p\u003e\n\u003cp\u003eCircRNAs play an important role in oncogenesis and development of non-small cell lung cancer (NSCLC). CircHIPK3 can significantly enhance cell proliferation, migration, invasion and induced autophagy via the miR124-3p-STAT3-PRKAA/AMPKa axis and indicate a poor survival, especially in advanced-stage NSCLC patients.(Chen, Mao et al. 2019) CircF-circEA-2a derived from EML4-ALK fusion gene promotes NSCLC cell migration and invasion, thus becoming a novel liquid biopsy biomarker.(Tan, Sun et al. 2018) What\u0026rsquo;s more, ectopically expressing circPTK2 inhibits TGF-\u0026beta;-induced epithelial-mesenchymal transition (EMT) by controlling transcriptional intermediary factor 1 \u0026gamma;.(Wang, Tong et al. 2018) However, few studies have proved integrated down-stream pathways of circRNAs in NSCLC. Here we aimed to explore the expression and potential roles of circRNAs in lung adenocarcinoma and the underlying mechanisms.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eClinical samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e90 pairs of LUAD fresh frozen tissues and paracancerous tissues, obtained from 90 primary LUAD patients hospitalized from November 1st, 2013 to May 1st, 2017 in the Department of Thoracic Surgery, Ruijin Hospital (Shanghai, China), were individually diagnosed according to the WHO standardizations. The hospital and the patients both consented to specimen collection following guidelines from the Ruijin Ethics Board.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA isolation and sequencing of circRNAs and data analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted using the TRIzol reagent (Takara, Kyoto, Japan). RNA purity and quantification were evaluated using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then the libraries were constructed using TruSeq Stranded Total RNA with Ribo-Zero Gold (illumina, Cat.No. RS-122-2301) according to the manufacturer\u0026rsquo;s instructions. The libraries were sequenced on an Illumina HiSeq X Ten platform, and 150 bp paired-end reads were generated. Raw data (raw reads) of fastq format were firstly processed using the NGS QC Toolkit. CircRNAs were identified using CIRI (v2.0.3) and the expression of circRNAs was calculated using RPM (spliced reads per millon mapping). Then the differential expression analysis was using the DESeq (2012) R package. Differentially expressed circRNAs were screened based on |log2FoldChange \u0026gt; 2| and P \u0026lt; 0.05 (Shanghai OE Biotech Co., Ltd. Shanghai, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted as mentioned above. 1ug total RNA was subjected to reverse transcription and qRT-PCR (both from Takara, Kyoto, Japan) according to the manufacturer\u0026rsquo;s instructions. ACTB was an internal control. The primers used are as follows: ACTB-F: TTGTTACAGGAAGTCCCTTGCC, ACTB-R: ATGCTATCACCTCCCCTGTGTG; hsa_circ_0001640-F: GTGTAAAGTGACCCTCT, hsa_circ_0001640-R: CTGCTGATTTTCTGCTA; miR-942-F: TCTTCTCTGTTTTGGCCATGTG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell lines and culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman LUAD cell lines H1299 and H1975, human umbilical vein endothelial cells (HUVEC) were obtained from the American Type Culture Collection (VA, USA) and maintained in RPMI1640 or Endothelial Cell Growth Medium with 10% fetal bovine serum, penicillin, streptomycin at 37\u0026deg;C in an incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. The cells were authenticated by short tandem repeat (STR) DNA profiling and tested for mycoplasma every 3 months.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlasmid construction and transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence of hsa_circ_0001640 was constructed into pcDNA3.1 (Obio technology, Shanghai, China). The plasmid and control vectors were transfected into cells by Lipofectamine 2000 (Invitrogen, USA). All the siRNA, miRNA mimics, miRNA inhibitors and their control were purchased from GenePharma (Shanghai, China). The transfection efficiency was assessed by qRT-PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCK-8 cell proliferation toxicity test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e48h after transfection, cells were seeded into 96-well plates (1\u0026times;10\u003csup\u003e4\u003c/sup\u003e/well), followed by 24h cultivation. Then, 10ul/well CCK-8 reagent (Maibio, Shanghai, China) was gently added, followed by another 4h incubation. The OD value at 450nm was tested 0h, 24h, 48h, 72h, 96h to plot standard curves.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell cycle test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA cell cycle kit from BioVision (LA, USA) was applied to transfected cell cycle test according to the manufacturer\u0026rsquo;s instructions. The content of propidium iodide was measured by an analytical flow cytometry (BD FACSCalibur, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell clone and proliferation experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe function of has_circ_0001640 was evaluated via cell growth assays. 500 transfected cells were seeded in each well in 6-well plates and hatched a week. Then the cells were fixed with methanol for 15 min, and stained with 0.1% crystal violet for 30 min. Finally, cells were photographed and counted in 3 random 200\u0026times;fields.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranswell assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum-free cell suspensions containing 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e transfected cells or HUVEC treated with supernatant of transfected LUAD cells were seeded in the upper chamber coated with Matrigel (BD, USA). Culture medium supplemented with 10%FBS was added to the bottom chamber. After incubation at 37 \u0026deg;C for 24 h, the migrated cells were fixed, stained and counted as mentioned previously.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWound healing assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransfected cells or HUVEC treated with supernatant of transfected LUAD cells were cultured in 6-well plates up to 80\u0026ndash;90% confluence. A scratch was made in the middle of each well, and cells were incubated in serum-free medium at 37 \u0026deg;C for 48 h. Images of the wounds were captured 24h later.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAngiogenesis test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1\u0026times; 10\u003csup\u003e5\u003c/sup\u003e /well HUVEC treated with supernatant of transfected LUAD cells and 250ul/well Matrigel were added into 24-well plates. After hatched for 6h, images of formation of tubes were captured.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFluorescence in-situ hybridization (FISH)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFISH analysis using a Fluorescence In-Situ Hybridization Kit from GenePharma (Shanghai, China) was implemented to estimate the localization of hsa_circ_0001640 and miR-942 in LUAD cells. FITC-labeled hsa_circ_0001640 and Cy3-labeled miR-942 probes were used according to the manufacturer\u0026rsquo;s instructions. Counterstained with DAPI, images of the cells were obtained with a fluorescence microscope (Leica, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransfected cells were lysed in Sodium dodecyl sulfate lysis buffer (Biyotime, Shanghai, China), then the proteins were separated by electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, USA). The membranes were blocked and incubated with primary antibodies against MMP-9, MMP-1, Fibronectin, E-cadherin, NKIRAS2, GSK3\u0026beta; and GAPDH (1:1000, Abcam, UK) overnight, and secondary antibody (1:5000, Thermo, USA) for 1h. Then the protein blots were examined by an enhanced chemiluminescence detection kit (Millipore, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells (4000/well) were plated into 96-well plates. After fixed and blocked, the cells were hatched with primary antibodies of Fibronectin and E-cadherin (1:200) overnight at 4 \u0026deg;C, then labeled with CY3 Red conjugated secondary antibody for 1h at room temperature. After the cells were counterstained with DAPI, images were obtained with a confocal microscope (Nikon, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe tissues were fixed, embedded and then sliced to paraffin sections. The sections were deparaffinized, hydrated, treated with antigen retrieval, then hatched with primary antibodies of MMP-9, MMP-1, Fibronectin, E-cadherin NKIRAS2, GSK3\u0026beta; and \u0026beta;-Catenin (1:100) overnight at 4 \u0026deg;C, then labeled with secondary antibody (MXB, China), stained with DAB peroxidase substrate. The cells were counterstained with hematoxylin, then recorded as photos.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase activity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter inoculated into 96-well plates (10\u003csup\u003e4\u003c/sup\u003e/well), the cells with hsa_circ_0001640-WT or hsa_circ_0001640-Mut were then transfected with reporting gene expression vectors containing miRNA mimics or NC using Dual-Luciferase Assay System (Promega, USA) and cultured for 48h. Luciferase activities were measured by the Luminoskan Ascent reader system (Thermo, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApoptosis analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH1975 cells were seeded and incubated in 6-well plates. After incubation, the adherent cells were digested by 0.25% pancreatin, and then harvested and washed by PBS. The cells were centrifuged at 2000 rpm for 5 min and then resuspended in 300 \u0026mu;l of binding buffer. 5 \u0026mu;l of Annexin V-FITC and 5 \u0026mu;l PI was added to the suspension and maintained for 15 min at room temperature in the dark. Finally, 200 \u0026mu;l of binding buffer was added and quantification of cell apoptosis was performed by Guava easyCyte flow cytometer (Millipore, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal studies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e20 thymic BALB/c nude mice (Bethesda, MD, USA) were randomly divided into 4 groups in both \u003cstrong\u003eFig. 2\u003c/strong\u003e and \u003cstrong\u003eFig. 4\u003c/strong\u003e. Transfected cells (5\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were subcutaneously injected into the flank. Tumor size was measured by vernier caliper at the end of every week, and tumor volume was calculated following the formula: tumor volume = (length * width\u003csup\u003e2\u003c/sup\u003e) / 2. 3 weeks later, the mice underwent euthanasia and the tumors were isolated for weighing and photographing. All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll statistical analyses were carried out with SPSS 24.0 (IL, USA). The data are shown as the mean \u0026plusmn; SD. Statistical differences were analyzed by two-tailed Student\u0026rsquo;s t-test, independent sample t test and one-way ANOVA. Kaplan-Meier survival estimate and COX proportional hazards regression model were used to evaluate prognosis of the patients. Correlation regression analysis was used to detect the correlation between hsa_circ_0001640 and miRNA. P value \u0026lt; 0.05 was regarded as significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHsa_circ_0001640\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;is downregulated in LUAD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe detected more than 18,000 circRNAs in 3 pairs of LUAD and adjacent tissues by high-throughput sequencing. By comparing the data with circBase, a circRNA database (including 92,359 human circRNAs), we found that, more than 8,500 circRNAs were novel besides over 9,800 known circRNAs (\u003cstrong\u003eFig. S1a\u003c/strong\u003e). Expression differences of circRNAs were judged by |log2Fold Change| and P value. |log2Fold Change|\u0026gt;2 and P\u0026lt;0.05 was regarded as meaningful (\u003cstrong\u003eFig. 1a\u003c/strong\u003e). 37 circRNAs were observed to be differently expressed in all the 3 tissue pairs (\u003cstrong\u003eFig. S\u003c/strong\u003e\u003cstrong\u003e1b\u003c/strong\u003e). 24 of them were down-regulated in LUAD tissues and 13 of them were upregulated (\u003cstrong\u003eFig. 1b\u003c/strong\u003e). Among these 37 RNAs overlapping with circBase, hsa_circ_0001640 (also called circRNA_07345 in our sequencing result), about which there is no relevant study, was chosen to be verified.\u003c/p\u003e\n\u003cp\u003eExpression of hsa_circ_0001640\u0026nbsp;was downregulated in LUAD according to the results of high-throughput sequencing. To verify these data, we performed qRT-PCR in 90 pairs of LUAD and adjacent tissues. The result of qRT-PCR demonstrated that there was a significant decrease of hsa_circ_0001640 in LUAD compared with that in adjacent tissues (\u003cstrong\u003eFig. 1c \u0026amp; 1d\u003c/strong\u003e), which indicated that low expression of hsa_circ_0001640 could contribute to tumor development. The receiver operating characteristic (ROC) curve suggested that hsa_circ_0001640 had a high sensitivity and specificity in LUAD diagnosis (\u003cstrong\u003eFig. 1e\u003c/strong\u003e,\u0026nbsp;AUC=0.7802, 95CI: 0.7148 to 0.8457) and might become a tumor marker.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHsa_circ_0001640 is correlated with clinical features of LUAD patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnalytical results in \u003cstrong\u003eTable 1\u003c/strong\u003e clearly indicated that the expression of hsa_circ_0001640 was evidently correlated with clinical stage, lymph node metastasis, neuron-specific enolase\u0026nbsp;(NSE) and 5-year prognosis of 90 LUAD patients, while gender, age, smoking history, T stage, tumor size, carcinoembryonic antigen (CEA), cytokeratin-19-fragment (CYFRA21-1) and recurrence or remote metastasis were not related factors. Hsa_circ_0001640 was observed downregulated in stage III (P=0.002), while it was similar in stage I and II (P=0.438). The data showed a negative correlation between hsa_circ_0001640 and lymph node metastasis (P=0.015). However, this change was not significant between N0 and N1 (P=0.685). In contrast, patients with a positive NSE were accompanied by hardly expressed hsa_circ_0001640. We analyzed prognoses\u0026nbsp;of these patients 5 years after surgery (60 patients in total). Among them, 31 patients survived, 24 patients died, and the other 5 patients were lost. The survivors had a significantly higher expression of hsa_circ_0001640 than the patients who died within 5 years after surgery (P=0.014). Therefore, hsa_circ_0001640 is correlated with 5-year prognosis of LUAD patients.\u003c/p\u003e\n\u003cp\u003eNext, we performed Kaplan-Meier univariate analysis and COX multivariate analysis of the 55 patients who had data of 5-year prognoses after pulmonary surgery (\u003cstrong\u003eTable 2\u003c/strong\u003e). We divided these patients into high-expression group and low-expression group by median of hsa_circ_0001640 expression. The results of univariate analysis showed that OS of LUAD patients was related to gender, clinical stage, T stage, N stage, NSE and hsa_circ_0001640 expression level. Age, smoking history, tumor size, and tumor markers such as CEA and CYFRA21-1 were not risk factors. There was a linear positive correlation between OS and level of hsa_circ_0001640 (\u003cstrong\u003eFig. 1f\u003c/strong\u003e, P = 0.014). OS of high-expression group was far longer than that of low-expression group (P=0.004). 75% patients in high-expression group survived 5 years after surgery, while only 41.9% patients in low-expression group survived that long (\u003cstrong\u003eFig. 1g\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGender, clinical stage, T stage, N stage, NSE and RNA expression level were selected to perform COX multivariate regression analysis. We observed that clinical stage, NSE and expression level of hsa_circ_0001640 were independent correlation factors (P=0.008, 0.033 and 0.024, respectively). Clinical stage and NSE were risk factors, while hsa_circ_0001640 was a protective factor. Cumulative survival risk of LUAD patients gradually increased with passage of time, but high expression of hsa_circ_0001640 could reduce such risk to a great extent (\u003cstrong\u003eFig. 1h\u003c/strong\u003e, P=0.016).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHsa_circ_0001640\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;inhibits LUAD pro\u003c/strong\u003e\u003cstrong\u003eliferation and invasion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to further verify the role of hsa_circ_0001640 in LUAD,\u0026nbsp;two cell lines,\u0026nbsp;H1299 and H1975,\u0026nbsp;were treated by\u0026nbsp;plasmid with high expression of hsa_circ_0001640 (Lenti-hsa_circ_0001640), \u0026nbsp;respectively，and verified by qRT-PCR (\u003cstrong\u003eFig. 2a\u003c/strong\u003e). In CCK-8 assay,\u0026nbsp;the proliferation of LUAD cells was significantly delayed by upregulation of hsa_circ_0001640, compared with the negative control\u0026nbsp;(\u003cstrong\u003eFig. 2b, c\u003c/strong\u003e).\u0026nbsp;Meanwhile, more cells were captured in phase G1 with upregulation of\u0026nbsp;hsa_circ_0001640\u0026nbsp;compared with control (\u003cstrong\u003eFig 2d, e\u003c/strong\u003e). Afterwards, the results of cell clone and proliferation experiment showed the same proliferation inhibition as above (\u003cstrong\u003eFig. 2f\u003c/strong\u003e). The wound healing assay and transwell assay also demonstrated that the migration and invasion abilities of both cell lines were evidently suppressed with upregulation of hsa_circ_0001640 (\u003cstrong\u003eFig. 2g, h, i\u003c/strong\u003e). Tumor-derived hsa_circ_0001640 can also suppress the tumor angiogenesis by reducing HUVECs migration, invasion and tube formation (\u003cstrong\u003eFig. S2\u003c/strong\u003e). However, the apoptosis of cells did not show significant differences in diverse expression groups of hsa_circ_0001640 (\u003cstrong\u003eFig. S3\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eTo further confirm above observations, tumor cells were\u0026nbsp;subcutaneously\u0026nbsp;injected into mice to observe tumor growth in vivo. 20 mice were randomly divided into 4 groups by upregulating or silencing\u0026nbsp;hsa_circ_0001640 (\u003cstrong\u003eFig. 2j\u003c/strong\u003e).\u0026nbsp;The weight and the size of tumors were definitely lower in Lenti-RNA group at the end of 3weeks than those in control, while silencing of hsa_circ_0001640 could significantly promote tumor growth (\u003cstrong\u003eFig. 2k, l\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMiR-942 is a target of hsa_circ_0001640\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe further investigated circRNA-miRNA pathway by searching database Circinteractome (\u003ca href=\"https://circinteractome.nia.nih.gov/\"\u003ehttps://circinteractome.nia.nih.gov/\u003c/a\u003e). Relative expression of 11 predicted miRNAs was evaluated and miR-942, miR-630, miR-582-3p were demonstrated negatively correlated with hsa_circ_0001640 (\u003cstrong\u003eFig. 3a, S4\u003c/strong\u003e). Considering that miR-942 has 2 binding sites with the same sequence on hsa_circ_0001640 and is most relevant to hsa_circ_0001640 (R\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e= 0.7699), among the 3 miRNAs, we focused on miR-942 in our further experiments. Potential binding site of miR-942 with hsa_circ_0001640 was shown in \u003cstrong\u003eFig. S5a\u003c/strong\u003e. The subcellular colocalization between hsa_circ_0001640\u0026nbsp;and miR-942 in cytoplasm and nucleus was proved by\u0026nbsp;FISH (\u003cstrong\u003eFig. 3b\u003c/strong\u003e). And we found a negative linear correlation between the relative expression of hsa_circ_0001640 and miR-942, judging by fluorescence intensity (\u003cstrong\u003eFig. 3c\u003c/strong\u003e). Furthermore, the direct bonding of hsa_circ_0001640 with miR-942 was validated by luciferase report assay as there was an indeed reduced fluorescence intensity of miR-942 mimics in hsa_circ_0001640-WT group in contrast to the control (\u003cstrong\u003eFig. 3d\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHsa_circ_0001640\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;can suppress the migration and invasion of LUAD cells by inhibiting miR-942\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMiR-942 could remarkedly enhance the migration\u0026nbsp;and invasion capability of H1299 cells according to the results of the wound healing assay and transwell assay (\u003cstrong\u003eFig. 4a, b\u003c/strong\u003e). Therefore, we hypothesized that miR-942 could contribute to progress of lung carcinogenesis. To further verify this hypothesis, experiments in vivo were performed by injecting H1299 cells transfected with miR-942 mimics or inhibitors into mice. We found that adding miR-942 was accompanied with an augmentation of tumor volume and weight, and tumors shrank in both size and weight with downregulation of miR-942 (\u003cstrong\u003eFig. 4c, d, e\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe functional correlation between hsa_circ_0001640 and miR-942 was evaluated. The reduction of cell invasion induced by miR-942 inhibitors equaled to that induced by upregulation of hsa_circ_0001640\u0026nbsp;(\u003cstrong\u003eFig. 4f, g\u003c/strong\u003e). Conversely, the increase of cells invasion induced by miR-942 mimics was similar to that induced by knockdown of hsa_circ_0001640 (\u003cstrong\u003eFig. 4h, i\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHsa_circ_0001640 also prevents EMT of LUAD in vivo and in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eE-cadherin, fibronectin, matrix metalloproteinase-1 (MMP-1) and MMP-9 were detected by immunofluorescence and immunoblotting to evaluate hsa_circ_0001640 function in EMT. Upregulation of hsa_circ_0001640 led to high expression of E-cadherin and low expression of fibronectin, MMP-1, MMP-9 (Fig. 5a, b). By comparison, silencing of hsa_circ_0001640 caused reduced E-cadherin expression and increased fibronectin, MMP-1, MMP-9 expression (Fig. 5b), indicating that\u0026nbsp;hsa_circ_0001640 might suppress EMT progression. MMP-1, MMP-9 and fibronectin showed negative correlations with hsa_circ_0001640, while E-cadherin had an opposite result.\u003c/p\u003e\n\u003cp\u003eHsa_circ_0001640 can promote NKIRAS2 and GSK3\u0026beta; expressions\u003c/p\u003e\n\u003cp\u003eTo explore the downstream pathway of miR-942, we searched TargetScan (www.targetscan.org) and found predicted binding sites of miR-942 on promotors of target genes, such as NKIRAS2 (NF-\u0026kappa;B inhibitor interacting RAS-like 2) and GSK3\u0026beta; (Glycogen synthase kinase-3\u0026beta;) (\u003cstrong\u003eFig. S5b, c\u003c/strong\u003e). This prediction was verified by western blot (\u003cstrong\u003eFig. 6a, b\u003c/strong\u003e). With upregulation of miR-942, NKIRAS2 and GSK3\u0026beta; were suppressed, and inhibition of miR-942 could enhance the expression of NKIRAS2 and GSK3\u0026beta;. However, hsa_circ_0001640 had exactly an opposite result.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHere we aimed to explore the potential antitumor effect of hsa_circ_0001640 on LUAD based on a molecular mechanistic understanding. By screening a comprehensive circRNAs profile of LUAD, we found that Hsa_circ_0001640 differentially expressed in LUAD and adjacent nontumor tissue pairs\u0026nbsp;by high-throughput sequencing technology and certainly correlated with the prognosis of LUAD patients. Second, we studied the interactivity between hsa_circ_0001640\u0026nbsp;and miR-942, characterized a critical role of\u0026nbsp;hsa_circ_0001640/miR-942 axis in LUAD migration, invasion, angiogenesis and progression. Third, we further revealed that\u0026nbsp;hsa_circ_0001640 may block both Wnt and\u0026nbsp;NF-\u0026kappa;B\u0026nbsp;pathways by promoting GSK3\u0026beta; and NKIRAS2, leading to the supression of LUAD development.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHsa_circ_0001640 is derived from gene EPB41L2 and is located in chromosome 6, with a length of 719bp.\u0026nbsp;Increasing circRNAs\u0026nbsp;have been found to be related to a variety of diseases such as cardiovascular diseases, neurological diseases, infectious diseases, and tumors through sequencing or RNA Chip technology. Multiple and diverse circRNAs enriching and separately presenting different profiles in each cancer type, undertake manifold actions.(Vo, Cieslik et al. 2019)\u0026nbsp;Despite the fact that hsa_circ_0001640 is\u0026nbsp;already known in circBase, it\u0026rsquo;s feature and functional significance\u0026nbsp;have never been reported to date.\u003c/p\u003e\n\u003cp\u003eCompared with linear non-coding RNAs such as miRNAs and lncRNAs, circRNAs are highly conserved and more stable because of their special circular structures. Therefore, circRNAs might become potential biomarkers, as well as new targets for treatment. Recent researches identified circular RNAs as promising biomarkers in tumors of the central nervous system.(Khan, Ullah et al. 2018)\u0026nbsp;Hepatocellular carcinoma (HCC) patients with low hsa_circRNA_0007874 expression had shortened survival. CiRS-7, proposed to be a potential miR-7 sponge, emerged as an independent risk factor for overall survival of colorectal cancer patients.(Weng, Wei et al. 2017)\u0026nbsp;We demonstrated that hsa_circ_0001640 is implicated in\u0026nbsp;clinical stage, lymph node metastasis, NSE and prognoses of LUAD patients. There was no evident change in hsa_circ_0001640 levels in stage I and II of LUAD, but when tumors developed to stage III, hsa_circ_0001640 expression was significantly weakened. Similar phenomenon was also observed in lymph node invasion that hsa_circ_0001640 was more sensitive to LUAD in stage N2. High level of NSE was found to be associated with decrease of hsa_circ_0001640 and high-risk of death, while NSE is generally considered to be elevated in neuroendocrine tumors. The study of Liu et al also confirmed NSE as an independent prognostic factor for LUAD.(Liu, Huang et al. 2019)\u0026nbsp;Therefore, we inferred that NSE might be a sensitive indicator of prognosis. However, the number of patients who survived after the surgery for up to 5 years is limited. Follow-ups and large scale studies in patients are undergoing.\u003c/p\u003e\n\u003cp\u003eMiR-942, of which the role in\u0026nbsp;osteogenesis and vascular regeneration\u0026nbsp;was deeply unearthed,(Ouyang, Tan et al. 2019)\u0026nbsp;has been newly proved to\u0026nbsp;promote EMT by inhibiting BARX2, leading to NSCLC metastasis, invasion and angiogenesis.(Yang, Shao et al. 2019)\u0026nbsp;In addition, Ge et al.\u0026apos;s study found that miR-942 can participate in Wnt/\u0026beta;-catenin signaling pathway to promote\u0026nbsp;colorectal\u0026nbsp;cancer.(Shan, An et al. 2018)\u0026nbsp;As ceRNAs, circRNAs\u0026nbsp;are considered as endogenous \u0026quot;sponge\u0026quot; that can competitively bind to miRNAs to impact the function of miRNAs.(Tay, Rinn et al. 2014, Zheng, Bao et al. 2016)\u0026nbsp;The\u0026nbsp;circRNA-miRNA interaction network\u0026nbsp;is also involved in tumors.\u0026nbsp;Circ-CEP85L\u0026nbsp;is significantly downregulated in gastric cancer and suppresses the proliferation and invasion by regulating NFKBIA expression via miR-942.(Lu, Wang et al. 2020)\u0026nbsp;Our research demonstrated the existence of sponge effect between hsa_circ_0001640 and miR-942 for the first time.\u003c/p\u003e\n\u003cp\u003eThe classical Wnt signaling pathway, also named as Wnt/\u0026beta;-catenin signaling pathway, can promote expression of target genes by transferring recruited \u0026beta;-catenin from cytoplasm to the nucleus. GSK3\u0026beta; is the main negative regulator of \u0026beta;-catenin. When the pathway is not activated,\u0026nbsp;adenomatous polyposis coli (APC), Axin,\u0026nbsp;casein kinase (CK)\u0026nbsp;and GSK3\u0026beta; can form a complex and induce ubiquitination and degradation of \u0026beta;-catenin, thus inhibiting the classical Wnt signaling pathway.(Clevers and Nusse 2012)\u0026nbsp;NF-\u0026kappa;B signaling pathway is also vital in tumors, which can inhibit cell apoptosis and participate in cell cycle and differentiation. NKIRAS2 can suppress the pathway, thereby inhibiting tumor progression.(Xu, Zhou et al. 2019)\u0026nbsp;Both the pathways are required for EMT, migration and invasion of tumors.(Wu, Deng et al. 2009, Gujral, Chan et al. 2014)\u0026nbsp;EMT-activated cancer cells are in favor of migration, invasion and metastasis.(Caramel, Papadogeorgakis et al. 2013, Wong, Javaid et al. 2014)\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eA variety of circRNAs are regulated during human EMT.(Conn, Pillman et al. 2015)\u0026nbsp;The levels of E-cadherin (a specific biomarker of epithelium), fibronectin (a specific biomarker of mesenchyme), MMP-1 and MMP-9 (vital factors in promoting EMT) changes when EMT occurs.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eBy inducing EMT through sponging miR-30c,\u0026nbsp;circPRMT5 promotes metastasis of urothelial carcinoma.(Chen, Chen et al. 2018)\u0026nbsp;CircPTPRA suppresses EMT and metastasis of NSCLC cells by sponging miR-96.(Zhong, Huang et al. 2017)\u0026nbsp;We found that hsa_circ_0001640 can also inhibit EMT in LUAD by inhibiting the expression of miR-942, and this tumor suppressive effect may be correlated to both Wnt and NF-\u0026kappa;B signaling pathways.\u003c/p\u003e\n\u003cp\u003eThe effect of tumor-derived circRNAs loaded in exosomes or in the form of extracellular free-RNAs on the vascular formation in tumors has drawn our attention.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStudies have proved that circRNAs can take part in angiogenesis of tumors, like bladder cancer (Zhong, Huang et al. 2017) and HCC.(Huang, Huang et al. 2020) Our present investigation is the first report of circRNA/miRNA sponge effect in lung cancer angiogenesis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur data showed that hsa_circ_0001640 has a tumor suppressive effect in LUAD, which is related to clinical stage, lymph node metastasis and prognosis of patients. Hsa_circ_0001640 has a sponge effect on miR-942 to inhibit Wnt and NF-\u0026kappa;B signaling pathways, thereby inhibiting migration and invasion of lung cancer, and might be a novel biomarker and therapeutic target.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Shanghai Institutes for Biological Sciences, Chinese Academy of Science for the support of experiment platform and National Innovative Research Team of High-level Local Universities in Shanghai.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatements of Ethics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted in accordance with the Declaration of Helsinki, in accordance with the relevant guidelines and regulations. The Regional Ethics Committee at Ruijin Hospital, Shanghai Jiao Tong University School of Medicine approved the study and the hospital and the patients both consented to specimen collection following guidelines from the Ruijin Ethics Board.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is supported by the National Natural Science Funds of China (81770025, 81970020), the Science and Technology Commission of Shanghai Municipality (17411965000), Shanghai Jiao Tong University Medical cross project (YG2017MS64) , Shanghai Natural Science Foundation (18ZR1424000), Shanghai Municipal Key Clinical Specialty (shslczdzk02202), Shanghai Top-Priority Clinical Key Disciplines Construction Project (2017ZZ02014),\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.H., K.X., X.D. designed, performed, and analyzed most experiments, and wrote the article. V.M.L. validated the experimental results, O.D. and H.L. collected the experimental data, G.S., L.N. and L.Z. supervised the entire experimental process and helped revise the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that the data supporting the findings of this study are available within the article and/or its supplementary materials.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCaramel, J., E. Papadogeorgakis, L. Hill, G. J. Browne, G. Richard, A. Wierinckx, G. Saldanha, J. Osborne, P. Hutchinson, G. Tse, J. Lachuer, A. Puisieux, J. H. Pringle, S. Ansieau and E. Tulchinsky (2013). A switch in the expression of embryonic EMT-inducers drives the development of malignant melanoma. Cancer Cell 24(4):466-480. https://doi.org/10.1016/j.ccr.2013.08.018.\u003c/li\u003e\n\u003cli\u003eChen, W., R. Zheng, P. D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X. Q. Yu and J. He (2016). Cancer statistics in China, 2015. CA Cancer J Clin 66(2):115-132. https://doi.org/10.3322/caac.21338.\u003c/li\u003e\n\u003cli\u003eChen, X., R. X. Chen, W. S. Wei, Y. H. Li, Z. H. Feng, L. Tan, J. W. Chen, G. J. Yuan, S. L. Chen, S. J. Guo, K. H. Xiao, Z. W. Liu, J. H. Luo, F. J. Zhou and D. Xie (2018). PRMT5 Circular RNA Promotes Metastasis of Urothelial Carcinoma of the Bladder through Sponging miR-30c to Induce Epithelial-Mesenchymal Transition. Clin Cancer Res 24(24):6319-6330. https://doi.org/10.1158/1078-0432.ccr-18-1270.\u003c/li\u003e\n\u003cli\u003eChen, X., R. Mao, W. Su, X. Yang, Q. Geng, C. Guo, Z. Wang, J. Wang, L. A. Kresty, D. G. Beer, A. C. Chang and G. Chen (2019). Circular RNA circHIPK3 modulates autophagy via MIR124-3p-STAT3-PRKAA/AMPKalpha signaling in STK11 mutant lung cancer. Autophagy1-13. https://doi.org/10.1080/15548627.2019.1634945.\u003c/li\u003e\n\u003cli\u003eClevers, H. and R. Nusse (2012). Wnt/beta-catenin signaling and disease. Cell 149(6):1192-1205. https://doi.org/10.1016/j.cell.2012.05.012.\u003c/li\u003e\n\u003cli\u003eConn, S. J., K. A. Pillman, J. Toubia, V. M. Conn, M. Salmanidis, C. A. Phillips, S. Roslan, A. W. Schreiber, P. A. Gregory and G. J. Goodall (2015). The RNA binding protein quaking regulates formation of circRNAs. Cell 160(6):1125-1134. https://doi.org/10.1016/j.cell.2015.02.014.\u003c/li\u003e\n\u003cli\u003eGujral, T. S., M. Chan, L. Peshkin, P. K. Sorger, M. W. Kirschner and G. MacBeath (2014). A noncanonical Frizzled2 pathway regulates epithelial-mesenchymal transition and metastasis. Cell 159(4):844-856. https://doi.org/10.1016/j.cell.2014.10.032.\u003c/li\u003e\n\u003cli\u003eHsu, M. T. and M. Coca-Prados (1979). Electron microscopic evidence for the circular form of RNA in the cytoplasm of eukaryotic cells. Nature 280(5720):339-340. https://doi.org/10.1038/280339a0.\u003c/li\u003e\n\u003cli\u003eHuang, X. Y., Z. L. Huang, J. Huang, B. Xu, X. Y. Huang, Y. H. Xu, J. Zhou and Z. Y. Tang (2020). Exosomal circRNA-100338 promotes hepatocellular carcinoma metastasis via enhancing invasiveness and angiogenesis. J Exp Clin Cancer Res 39(1):20. https://doi.org/10.1186/s13046-020-1529-9.\u003c/li\u003e\n\u003cli\u003eKhan, I. N., N. Ullah, D. Hussein and K. S. Saini (2018). Current and emerging biomarkers in tumors of the central nervous system: Possible diagnostic, prognostic and therapeutic applications. Semin Cancer Biol 52(Pt 1):85-102. https://doi.org/10.1016/j.semcancer.2017.07.004.\u003c/li\u003e\n\u003cli\u003eKristensen, L. S., M. S. Andersen, L. V. W. Stagsted, K. K. Ebbesen, T. B. Hansen and J. Kjems (2019). The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20(11):675-691. https://doi.org/10.1038/s41576-019-0158-7.\u003c/li\u003e\n\u003cli\u003eLiu, C., Q. Huang, W. Ma, L. Qi, Y. Wang, T. Qu, L. Sun, B. Sun, B. Meng and W. Cao (2019). A combination of tumor and molecular markers predicts a poor prognosis in lung adenocarcinoma. Int J Clin Exp Pathol 12(5):1690-1701.\u003c/li\u003e\n\u003cli\u003eLu, J., Y. H. Wang, X. Y. Huang, J. W. Xie, J. B. Wang, J. X. Lin, Q. Y. Chen, L. L. Cao, C. M. Huang, C. H. Zheng and P. Li (2020). circ-CEP85L suppresses the proliferation and invasion of gastric cancer by regulating NFKBIA expression via miR-942-5p. J Cell Physiolhttps://doi.org/10.1002/jcp.29556.\u003c/li\u003e\n\u003cli\u003eMemczak, S., M. Jens, A. Elefsinioti, F. Torti, J. Krueger, A. Rybak, L. Maier, S. D. Mackowiak, L. H. Gregersen, M. Munschauer, A. Loewer, U. Ziebold, M. Landthaler, C. Kocks, F. le Noble and N. Rajewsky (2013). Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495(7441):333-338. https://doi.org/10.1038/nature11928.\u003c/li\u003e\n\u003cli\u003eOuyang, Z., T. Tan, X. Zhang, J. Wan, Y. Zhou, G. Jiang, D. Yang, X. Guo and T. Liu (2019). CircRNA hsa_circ_0074834 promotes the osteogenesis-angiogenesis coupling process in bone mesenchymal stem cells (BMSCs) by acting as a ceRNA for miR-942-5p. Cell Death Dis 10(12):932. https://doi.org/10.1038/s41419-019-2161-5.\u003c/li\u003e\n\u003cli\u003eSalmena, L., L. Poliseno, Y. Tay, L. Kats and P. P. Pandolfi (2011). A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146(3):353-358. https://doi.org/10.1016/j.cell.2011.07.014.\u003c/li\u003e\n\u003cli\u003eSanger, H. L., G. Klotz, D. Riesner, H. J. Gross and A. K. Kleinschmidt (1976). Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci U S A 73(11):3852-3856. https://doi.org/10.1073/pnas.73.11.3852.\u003c/li\u003e\n\u003cli\u003eShan, Z., N. An, J. Qin, J. Yang, H. Sun and W. Yang (2018). Long non-coding RNA Linc00675 suppresses cell proliferation and metastasis in colorectal cancer via acting on miR-942 and Wnt/beta-catenin signaling. Biomed Pharmacother 101(769-776. https://doi.org/10.1016/j.biopha.2018.02.123.\u003c/li\u003e\n\u003cli\u003eSiegel, R. L., K. D. Miller and A. Jemal (2020). Cancer statistics, 2020. CA Cancer J Clin 70(1):7-30. https://doi.org/10.3322/caac.21590.\u003c/li\u003e\n\u003cli\u003eTan, S., D. Sun, W. Pu, Q. Gou, C. Guo, Y. Gong, J. Li, Y. Q. Wei, L. Liu, Y. Zhao and Y. Peng (2018). Circular RNA F-circEA-2a derived from EML4-ALK fusion gene promotes cell migration and invasion in non-small cell lung cancer. Mol Cancer 17(1):138. https://doi.org/10.1186/s12943-018-0887-9.\u003c/li\u003e\n\u003cli\u003eTay, Y., J. Rinn and P. P. Pandolfi (2014). The multilayered complexity of ceRNA crosstalk and competition. Nature 505(7483):344-352. https://doi.org/10.1038/nature12986.\u003c/li\u003e\n\u003cli\u003eVo, J. N., M. Cieslik, Y. Zhang, S. Shukla, L. Xiao, Y. Zhang, Y. M. Wu, S. M. Dhanasekaran, C. G. Engelke, X. Cao, D. R. Robinson, A. I. Nesvizhskii and A. M. Chinnaiyan (2019). The Landscape of Circular RNA in Cancer. Cell 176(4):869-881.e813. https://doi.org/10.1016/j.cell.2018.12.021.\u003c/li\u003e\n\u003cli\u003eWang, K., B. Long, F. Liu, J. X. Wang, C. Y. Liu, B. Zhao, L. Y. Zhou, T. Sun, M. Wang, T. Yu, Y. Gong, J. Liu, Y. H. Dong, N. Li and P. F. Li (2016). A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur Heart J 37(33):2602-2611. https://doi.org/10.1093/eurheartj/ehv713.\u003c/li\u003e\n\u003cli\u003eWang, L., X. Tong, Z. Zhou, S. Wang, Z. Lei, T. Zhang, Z. Liu, Y. Zeng, C. Li, J. Zhao, Z. Su, C. Zhang, X. Liu, G. Xu and H. T. Zhang (2018). Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-beta-induced epithelial-mesenchymal transition and metastasis by controlling TIF1gamma in non-small cell lung cancer. Mol Cancer 17(1):140. https://doi.org/10.1186/s12943-018-0889-7.\u003c/li\u003e\n\u003cli\u003eWeng, W., Q. Wei, S. Toden, K. Yoshida, T. Nagasaka, T. Fujiwara, S. Cai, H. Qin, Y. Ma and A. Goel (2017). Circular RNA ciRS-7-A Promising Prognostic Biomarker and a Potential Therapeutic Target in Colorectal Cancer. Clin Cancer Res 23(14):3918-3928. https://doi.org/10.1158/1078-0432.ccr-16-2541.\u003c/li\u003e\n\u003cli\u003eWong, I. Y., S. Javaid, E. A. Wong, S. Perk, D. A. Haber, M. Toner and D. Irimia (2014). Collective and individual migration following the epithelial-mesenchymal transition. Nat Mater 13(11):1063-1071. https://doi.org/10.1038/nmat4062.\u003c/li\u003e\n\u003cli\u003eWu, Y., J. Deng, P. G. Rychahou, S. Qiu, B. M. Evers and B. P. Zhou (2009). Stabilization of snail by NF-kappaB is required for inflammation-induced cell migration and invasion. Cancer Cell 15(5):416-428. https://doi.org/10.1016/j.ccr.2009.03.016.\u003c/li\u003e\n\u003cli\u003eXu, Y. J., R. Zhou, J. F. Zong, W. S. Lin, S. Tong, Q. J. Guo, C. Lin, S. J. Lin, Y. X. Chen, M. R. Chen, H. L. Chen, Y. B. Ye and J. J. Pan (2019). Epstein-Barr virus-coded miR-BART13 promotes nasopharyngeal carcinoma cell growth and metastasis via targeting of the NKIRAS2/NF-kappaB pathway. Cancer Lett 447(33-40. https://doi.org/10.1016/j.canlet.2019.01.022.\u003c/li\u003e\n\u003cli\u003eYang, F., C. Shao, K. Wei, X. Jing, Z. Qin, Y. Shi, Y. Shu and H. Shen (2019). miR-942 promotes tumor migration, invasion, and angiogenesis by regulating EMT via BARX2 in non-small-cell lung cancer. J Cell Physiol 234(12):23596-23607. https://doi.org/10.1002/jcp.28928.\u003c/li\u003e\n\u003cli\u003eZheng, Q., C. Bao, W. Guo, S. Li, J. Chen, B. Chen, Y. Luo, D. Lyu, Y. Li, G. Shi, L. Liang, J. Gu, X. He and S. Huang (2016). Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat Commun 7(11215. https://doi.org/10.1038/ncomms11215.\u003c/li\u003e\n\u003cli\u003eZhong, Z., M. Huang, M. Lv, Y. He, C. Duan, L. Zhang and J. Chen (2017). Circular RNA MYLK as a competing endogenous RNA promotes bladder cancer progression through modulating VEGFA/VEGFR2 signaling pathway. Cancer Lett 403(305-317. https://doi.org/10.1016/j.canlet.2017.06.027.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 The correlation between expression of hsa_circ_0001640 and clinicopathological characteristics.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"560\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumbers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRNA expression\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\"\u003e\n \u003cp\u003e\u003cstrong\u003eP value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSex\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0006 \u0026plusmn; 0.0010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.110\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0011 \u0026plusmn; 0.0016\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge (years)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003e\u0026lt; 65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0009 \u0026plusmn; 0.0015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.792\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003e\u0026ge; 65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0008 \u0026plusmn; 0.0009\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSmoking\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0010 \u0026plusmn; 0.0015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.055\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0005 \u0026plusmn; 0.0010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0034 \u0026plusmn; 0.1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0039 \u0026plusmn; 0.0096\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eIII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0004 \u0026plusmn; 0.0008\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor size\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(cm)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003e\u0026le; 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0009 \u0026plusmn; 0.0012\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.501\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003e\u0026gt; 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0007 \u0026plusmn; 0.0015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eT stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.000900 \u0026plusmn; 0.001300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"4\"\u003e\n \u003cp\u003e0.400\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.000980 \u0026plusmn; 0.001600\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.000440 \u0026plusmn; 0.000630\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.000012 \u0026plusmn; 0.000008\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eLymph node\u0026nbsp;\u003cbr\u003e\u0026nbsp;metastasis\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eN0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0037 \u0026plusmn; 0.0110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"4\"\u003e\n \u003cp\u003e0.015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eN1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.003 \u0026plusmn; 0.0019\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eN2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0003 \u0026plusmn; 0.0006\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eN3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eCEA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0010 \u0026plusmn; 0.0015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.342\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0007 \u0026plusmn; 0.0011\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eUnknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eCYFRA21-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0008 \u0026plusmn; 0.0012\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.469\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0010 \u0026plusmn; 0.0017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eUnknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eNSE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.00085 \u0026plusmn; 0.00140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.00018 \u0026plusmn; 0.00024\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eUnknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrognosis\u003c/strong\u003e\u0026dagger;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eSurvival\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0010 \u0026plusmn; 0.0016\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003eDeath\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0003 \u0026plusmn; 0.0004\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.357142857142858%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eRecurrence or\u0026nbsp;\u003cbr\u003e\u0026nbsp;remote metastasis\u003c/strong\u003e\u0026dagger;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.714285714285714%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.142857142857142%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.464285714285715%\"\u003e\n \u003cp\u003e0.0012 \u0026plusmn; 0.0016\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.321428571428571%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.126\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.214899713467048%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.507163323782233%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.277936962750715%\"\u003e\n \u003cp\u003e0.0005 \u0026plusmn; 0.0010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026dagger; 5 years after surgery.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2 Kaplan-Meier univariate and COX multivariate analysis.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"610\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\"\u003e\n \u003cp\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage survival\u0026nbsp;\u003cbr\u003e\u0026nbsp;time (days)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\"\u003e\n \u003cp\u003e\u003cstrong\u003eUnivariate\u0026nbsp;\u003cbr\u003e\u0026nbsp;P value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultivariate\u0026nbsp;\u003cbr\u003e\u0026nbsp;P value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSex\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1419.77 \u0026plusmn; 145.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.042\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.410\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1895.75 \u0026plusmn; 160.74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge (years)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003e\u0026lt; 65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1748.81 \u0026plusmn; 140.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003e\u0026ge; 65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1392.88 \u0026plusmn; 179.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSmoking\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1792.53 \u0026plusmn; 138.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.067\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1354.64 \u0026plusmn; 175.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e2147.14 \u0026plusmn; 89.65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1273.50 \u0026plusmn; 229.78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eIII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1122.67 \u0026plusmn; 171.64\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor size\u0026nbsp;\u003cbr\u003e\u0026nbsp;(cm)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003e\u0026lt; 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1770.81 \u0026plusmn; 126.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"4\"\u003e\n \u003cp\u003e0.190\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"4\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003e3 - 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1220.62 \u0026plusmn; 240.15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003e5 - 7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1042.00 \u0026plusmn; 330.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003e\u0026ge; 7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1134.50 \u0026plusmn; 558.97\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eT stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1848.81 \u0026plusmn; 134.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"4\"\u003e\n \u003cp\u003e0.011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"4\"\u003e\n \u003cp\u003e0.240\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1393.07 \u0026plusmn; 223.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e768.29 \u0026plusmn; 176.36\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1608.60 \u0026plusmn; 516.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eN stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eN0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e2040.19 \u0026plusmn; 111.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.990\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eN1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1302.25 \u0026plusmn; 275.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eN2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1076.60 \u0026plusmn; 179.98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eCEA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1690.89 \u0026plusmn; 140.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.160\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1371.32 \u0026plusmn; 190.92\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eCYFRA21-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1701.84 \u0026plusmn; 129.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1195.38 \u0026plusmn; 196.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eNSE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e1783.88 \u0026plusmn; 123.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.033\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e972.71 \u0026plusmn; 189.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.868852459016395%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eRNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.672131147540984%\"\u003e\n \u003cp\u003eHigh expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.737704918032787%\"\u003e\n \u003cp\u003e2007.75 \u0026plusmn; 104.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.524590163934427%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.19672131147541%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.024\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.32129963898917%\"\u003e\n \u003cp\u003eLow expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.67870036101083%\"\u003e\n \u003cp\u003e1263.06 \u0026plusmn; 160.98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CircRNA, Lung adenocarcinoma, Prognosis, Molecular biology","lastPublishedDoi":"10.21203/rs.3.rs-3805181/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3805181/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjectives:\u003c/strong\u003e To understand the role of circular RNA (circRNA) hsa_circ_0001640 in lung adenocarcinoma.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e We used high-throughput sequencing and qRT-PCR to examine the functional roles of hsa_circ_0001640 in lung adenocarcinoma (LUAD). Expriment in vivo and in vitro was performed. The role of hsa_circ_0001640 in LUAD cells were evaluated by CCK-8 test, cell cycle analysis, clonal formation, transwell assay and wound healing assay. The relative protein levels were measured by western blot and immunofluorescence. Clinical significance of hsa_circ_0001640 was assessed by paired t test, independent sample t test, one-way ANOVA, and COX logistic regression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e We observed that hsa_circ_0001640 was downregulated in LUAD and was negatively correlated with clinical stage, lymph node invasion and NSE, and it was a protective factor of OS of LUAD patients after surgery. In experiment in vitro, hsa_circ_0001640 could inhibit proliferation and invasion of H1975 and H1299 cells, and more cells remained in G1 phase with upregulation of hsa_circ_0001640. Hsa_circ_0001640 was proved to be combined with miR-942 as ceRNA, and thus suppressing the promotive effect of miR-942 in LUAD. Hsa_circ_0001640 upregulated e-cadherin and down-regulated fibronectin, indicating an inhibiting effect of hsa_circ_0001640 on EMT. Hsa_circ_0001640 was positively associated with GSK3β and NKIRAS2, suggesting that hsa_circ_0001640 was a potential suppressor in Wnt and NF-κB pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eHsa_circ_0001640 was a tumor suppressor in LUAD by targeting miR-942 as a ceRNA, leading to upregulation of GSK3β and NKIRAS2.\u003c/p\u003e","manuscriptTitle":"Hsa_circ_00011640 inhibits lung adenocarcinoma by targeting miR-942","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-02 19:07:25","doi":"10.21203/rs.3.rs-3805181/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"89b56b15-c039-4c87-be2e-aefbe0b7bc2c","owner":[],"postedDate":"January 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-07T06:45:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-02 19:07:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3805181","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3805181","identity":"rs-3805181","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}