Development of diagnostic markers for the disease susceptibility gene Tsn1 in wheat reveals novel resistance alleles and a new locus required for ToxA sensitivity

Development of diagnostic markers for the disease susceptibility gene Tsn1 in wheat reveals novel resistance alleles and a new locus required for ToxA sensitivity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of diagnostic markers for the disease susceptibility gene Tsn1 in wheat reveals novel resistance alleles and a new locus required for ToxA sensitivity Katherine L.D. Running, Krishna Acharya, Tiana M. Roth, Gurminder Singh, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5953910/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Jun, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted 5 You are reading this latest preprint version Abstract The wheat Tsn1 gene recognizes the necrotrophic effector ToxA, which is produced by three different necrotrophic fungal pathogens. A compatible Tsn1 -ToxA interaction leads to host-induced responses that result in the development of disease. Therefore, marker-assisted elimination of functional Tsn1 alleles is an effective strategy for the development of disease resistant varieties. To develop such markers, available wheat genome assemblies were used to compare gene and transposable element content in lines with and without Tsn1 ( Tsn1 - and Tsn1 +), revealing two conserved haplotypes. Because Tsn1 is almost always absent in insensitive lines, Kompetitive Allele Specific PCR (KASP) markers were designed in flanking syntenic regions of Tsn1 - and Tsn1 + assemblies. The KASP markers were validated in more than 1,500 diverse lines. The markers correctly predicted a ToxA-insensitive phenotype in 99.33–100% of the lines, but they were less effective at predicting a ToxA-sensitive phenotype (89.50-94.55%) due to 60 insensitive lines with sensitive marker alleles. Sequence analysis of Tsn1 from these lines revealed that some were not transcribed and others contained point mutations. However, some carried and expressed the dominant Tsn1 allele, and subsequent analysis of two such lines revealed a second locus controlling ToxA sensitivity on chromosome 2B, termed Tsn1-B2 . Genetic mapping of Tsn1-B2 in a biparental durum population define the locus to a 4.8 cM region corresponding to 8.6 Mb in Svevo Rel 2.0. The markers presented here could be used for reliable and robust marker-assisted elimination of Tsn1 in a high-throughput manner, furthering the development of wheat genetically resistant to multiple pathogens. Tsn1 wheat ToxA disease resistance susceptibility marker-assisted selection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Key Message The wheat gene Tsn1 confers susceptibility to tan spot, septoria nodorum blotch, and spot blotch. The markers developed here may be immediately deployed in breeding programs to eliminate Tsn1 . Introduction Hexaploid common wheat ( Triticum aestivum L. ssp. aestivum , 2 n = 6 x = 42, AABBDD genomes) and tetraploid durum wheat ( T. turgidum L. ssp. durum (Desf.) van Slageren, 2 n = 4 x = 28, AABB genomes) are two important food crops grown globally. Compatible interactions between wheat and several necrotrophic fungal pathogens rely on the recognition of pathogen-produced molecules known as necrotrophic effectors (NEs) by specific dominant host genes (Faris and Friesen 2020 ; Friesen and Faris 2021 ; Kariyawasam et al. 2023 for reviews). These inverse gene-for-gene interactions lead to programmed cell death in the host, which allows the fungi to obtain nutrients and complete their life cycles, leading to susceptibility. The necrotic lesions ultimately reduce the photosynthetic area of leaves and lower yields (Shabeer and Bockus 1988 ). One of these interactions involves the recognition of the NE ToxA by the wheat gene Tsn1 , which exists in both common and durum wheat. The Tsn1 -ToxA interaction is unique in that ToxA has been identified in three economically important pathogens, Pyrenophora tritici-repentis (Tomas and Bockus 1987 ; Ballance et al. 1989 ), Parastagonospora nodorum (Friesen et al. 2006 ), and Bipolaris sorokiniana (McDonald et al. 2018 ) thereby making the Tsn1 gene an important susceptibility factor for the diseases tan spot, septoria nodorum blotch (SNB), and spot blotch. In 2019, these pathogens were estimated to cause global yield losses of 0.9%, 1.64%, and 1.67% (Savary et al. 2019 ). These relatively small percentages translate to massive yield losses when applied to global wheat production. In the 2023/2024 marketing year, tan spot, SNB, and spot blotch infections caused estimated yield losses of 16.4, 9.0, and 16.7 million tons, which is enough wheat to bake 58.9 billion loaves of bread (Shahbandeh 2024 , Wulff and Krattinger 2022 ). ToxA was first identified in P. tritici-repentis where it was found to play a role in the development of the disease tan spot (Tomas and Bockus 1987 ; Ballance et al. 1989 ). PtrToxA has been reported to exist in 83–100% of isolates, depending on the region where the isolates were collected (Lamari et al. 1998; Antoni et al. 2010 ; Moreno et al. 2015 ; Abdullah et al. 2017 ; Wei et al. 2021 ). A ToxA homolog was later identified in P. nodorum , the causal agent of SNB in wheat, with 99.7% similarity to PtrToxA (Friesen et al. 2006 ). SnToxA was present in 40% of P. nodorum isolates in a global panel, ranging from 6% in isolates collected in China to 97% in isolates collected in Australia (McDonald et al. 2013 ). Ptr ToxA and SnToxA were found to be functionally identical in terms of conferring sensitivity in wheat plants containing Tsn1 (Liu et al. 2006 ). The ToxA gene has also been identified in isolates of B. sorokinina , the causal agent of spot blotch, collected in Australia (McDonald et al. 2018 ), the Unites States (Friesen et al. 2018 , Manan et al. 2023 ), India (Navanthe et al. 2020), and most recently, Mexico (Wu et al. 2021 ) where BsToxA was present in 10.2–86.6% of isolates. ToxA resides in a ~ 14 kb class II transposon called ToxhAT (McDonald et al. 2019), which has been horizontally transferred between P. nodorum , P. tritici-repentis , and B. sorokiniana . Sequence analysis revealed that ToxhAT resides in a larger Starship transposon (143 kb) named “ Horizon ” in Ptr (Gourlie et al. 2022 ). ToxhAT is also present in Horizon in P. nodorum , but in a degraded form (Megan McDonald, personal communication). Recently, ToxhAT was found in the distantly related Starship transposon (170–196 kb) Sanctuary , which independently captured ToxhAT (Bucknell and McDonald 2024). ToxhAT remains an active transposon in B. sorokiniana . It is possible that the Starship transposons have or will transfer to additional fungal species. ToxA confers a fitness advantage to the fungal pathogens when infecting wheat lines that carry Tsn1 (McDonald et al. 2018 ; Friesen et al. 2018 ). Tsn1 contains nucleotide binding (NB), leucine - rich repeat (LRR), and protein kinase (PK) domains (Faris et al. 2010 ). Amplification of the Tsn1- specific marker fcp623 from 386 Triticum accessions revealed that the gene was only present in ToxA-sensitive cultivars, and nearly all the ToxA-insensitive cultivars were lacking a Tsn1 allele. The presence/absence variation of Tsn1 rendered all gene-specific markers dominant. Flanking codominant markers that delineated Tsn1 to 351 kb were designed based on the sequenced bacterial artificial chromosome contig developed in the durum cultivar Langdon (Faris et al. 2010 ). The Tsn1 region has been identified as a recombination hot spot (Faris et al. 2000 ), which may result in a high rate of linkage disequilibrium decay and reduce marker-trait associations in natural populations. Additionally, these codominant markers targeted microsatellites and were therefore not as amenable to high throughput genotyping (HTG) platforms as digital single nucleotide polymorphism (SNP) assays, such as Kompetitive Allele Specific PCR (KASP) markers. Given that Tsn1 confers susceptibility to multiple wheat pathogens, it is imperative Tsn1 be selectively eliminated from wheat breeding lines. Here, we conducted a thorough structural analysis of the Tsn1 genomic region, characterizing gene and transposable element (TE) content, and identified syntenic regions in lines with and without Tsn1 . We designed high throughput diagnostic SNP markers and validated them on hard red spring wheat, durum, and winter wheat panels, demonstrating their usefulness in marker-assisted elimination of Tsn1 . We also discovered novel ToxA-insensitive tsn1b haplotypes and identified and mapped a new genomic region associated with ToxA-sensitivity. Given the presence of multiple ToxA-sensitivity genes in the B subgenome, we propose the first locus mapped, Tsn1 , be renamed Tsn1-B1 and the second locus, mapped here, be termed Tsn1-B2 . For clarity, the proposed names Tsn1-B1 and Tsn1-B2 will be used henceforth. Materials and methods Plant materials Fifteen sequenced hexaploid and three sequenced tetraploid wheat lines were evaluated for ToxA sensitivity (Supplementary Table 1) and used for synteny analysis and/or marker development. Three panels, including the Global Durum Panel (GDP), a winter wheat panel (WWP), and a hard red spring wheat panel (HRSWP), were evaluated for ToxA sensitivity and genotyped with the designed markers to assess their diagnostic capability (Supplementary Table 2). The GDP, WWP, and HRSWP consist of 513, 263, and 812 lines, respectively, and were originally described and phenotyped by Szabo-Hever et al. (2023, 2024) and Peters Haugrud et al. (2023). Here, the GDP has three additional lines, DWRC-801, DWRC-1319, and DWRC-1505, which are described in Supplementary Table 2. One line, Ankar II, was dropped from the WWP due to heterogeneity. Line PI 532255 (HRSW-717) was recently reported to be a durum wheat, and as such, was dropped from the HRSWP (https://npgsweb.ars-grin.gov/). Two lines from the GDP, DWRC-0110 and DWRC-1007, were selected for further genetic analysis of ToxA sensitivity. Both durum lines were crossed to the North Dakota durum cultivar Lebsock and to each other. F 1 plants from the following crosses were evaluated for ToxA sensitivity: DWRC-0110 × Lebsock, DWRC-1007 × Lebsock, and DWRC-0110 × DWRC-1007. F 2 plants from the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock populations were evaluated for ToxA-sensitivity and DNA was collected from individual plants for use in bulked segregant analysis (BSA), and in the case of DWRC-1007 × Lebsock, low resolution mapping. ToxA production and infiltration HRSWP, GDP, and WWP phenotypic data were originally published in Szabo-Hever et al. (2023, 2024), and Peters Haugrud et al. (2023). Preparation of cultures and infiltration methods for the sequenced wheat lines in Supplementary Table 1 and the re-evaluation of several others were conducted as described by Szabo-Hever et al. (2023). Plants were scored on a 0-3 scale at 5 days after infiltration, according to Seneviratne et al. (2024). A minimum of four plants were evaluated per line. The same growing conditions were used for evaluation of the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock plants as described by Szabo-Hever et al. (2023), except one plant was planted per cone. ToxA-insensitive F 2 plants were infiltrated a second time to confirm insensitivity. DNA extraction and gene sequencing DNA from the three panels, DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F 2 plants, and lines with apparent double crossover was extracted, quantified, and normalized as described in Supplementary M1. Tsn1-B1 gene sequences were amplified via PCR in seven fragments using the primers reported in Faris et al. (2010) from lines that were insensitive to ToxA, despite carrying a Tsn1-B1 allele. Sequencing was completed over all coding sequence and splice-sites, but not all introns were sequenced due to the size of intron 4 (~3.4 kb). All PCR reactions were 25 µL and consisted of 20 ng/μL of template DNA, 1× NH 4 Reaction Buffer (Meridian Bioscience, Cincinnati, OH) (,2.0 mM MgCl 2 , 0.2 mM dNTPs, 0.4 µM of each primer, and 0.1U/μL of BioTaq DNA polymerase (Meridian Bioscience, Cincinnati, OH) . All reactions had an initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, a 30s annealing step starting at 65°C that decreased by 0.2°C each cycle, and a 72°C extension for 2.5 min, followed by a final extension at 72°C for 7 min. To confirm amplification, 7 µL of each PCR product was electrophoresed on a 1% agarose gel. The remaining PCR product was purified with ExoSAP IT (Thermo Fisher Scientific, Waltham, Massachusetts, USA). PCR products were sequenced with amplification primers reported in Faris et al. (2010) and with internal primers reported in Supplementary Table 3 via Sanger sequencing (Eurofins Genomics, Louisville, KY, USA). Gene sequences were assembled for each line in CodonCode Aligner 9.0.2 (CodonCode Corporation, Centerville, Massachusetts, USA), and point mutations were identified by comparative sequence analysis with the reported functional Tsn1-B1 allele in Langdon (Genbank ID: GU259618.1, Faris et al. 2010). RNA extraction and sequencing Total RNA was extracted from ToxA-insensitive lines with wildtype Tsn1-B1 alleles and Langdon (Supplementary Table 4) using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with on-column DNase digestion for 20 minutes. cDNA was synthesized from 3 µg RNA using the SuperScript IV First-Strand Synthesis system (Thermo Fisher Scientific, Waltham, MA). First, cDNA samples were tested for DNA contamination via PCR with primers GAPDH.F152 and GAPDH.R338 (Shi et al. 2016). PCR primers used to amplify Tsn1-B1 cDNA were reported in Faris et al. (2010) (Supplementary Table 5). To confirm Tsn1-B1 expression, cDNA fragment 4 was amplified via PCR with 2 µL template cDNA per 10 µL reaction using the PCR reaction components and conditions described above with a modified annealing temperature of 62°C and an extension time of 1.5 min. In lines that had no amplification of fragment 4 and two durum lines (DWRC-1007 and DWRC-0110), PCR was completed with all amplification primers using 3.8 µL of template cDNA per 30 µL reaction. PCR cycling conditions were as described above, but with optimized annealing temperatures as reported in Supplementary Table 5. Amplification of PCR products was confirmed and cleaned-up as described above. Samples were diluted to 1 µL PCR product per 12 µL sequencing reaction and sequenced via Sanger sequencing with the amplification primers (Eurofins Genomics, Louisville, KY, USA). Synteny analysis Synteny analysis focused on the area between the previously reported flanking markers fcp620 and fcp394 (Faris et al. 2010). Ten hexaploid lines with complete pseudomolecule assemblies were used for the analysis (Supplementary Table 1) (IWGSC 2018; Walkowiak et al. 2020). Pseudomolecule assemblies were acquired from the Leibniz Institute of Plant Genetics and Crop Plant Research (https://wheat.ipk-gatersleben.de/), but the assemblies are now available on GrainGenes (https://wheat.pw.usda.gov/GG3/). The positions of fcp620 and fcp394 were identified by conducting BLASTn searches of the amplified marker sequences in the Chinese Spring RefSeq v1.0 (IWGSC 2018) against the hexaploid assemblies. The region between fcp620 and fcp394 was extracted from chromosome 5B of each assembly using samtools (Li et al. 2009). Lines SY Mattis and ArinaLrFor have a 5B:7B chromosomal translocation (Walkowiak et al. 2020), therefore the Tsn1-B1 region was extracted from chromosome 7B of these two lines. Synteny within the extracted genomic region of ToxA-sensitive and ToxA-insensitive lines was identified with Smash ++ (Hosseini et al. 2020) to determine the plausibility of constructing consensus ToxA-sensitive and -insensitive sequences. The parameters used were k -mer size = 14, number of substitutions in substitution-tolerant Markov model (STMM) = 5, and a minimum segment size of 300 bp. Multiple sequence alignments of the ToxA-sensitive and ToxA-insensitive sequences were generated using K-align 3 (Lassmann 2020), and consensus sensitive and insensitive sequences ( Tsn1-B1 +Cons and Tsn1-B1 -Cons) were generated using Emboss Cons 6.6.0.0 (Rice et al. 2000). Release 19 of the nonredundant Transposable Element Platform (TREP) nucleotide sequence database was used to mask the consensus sequences with RepeatMasker v 4.1.0 (Wicker et al. 2002; Smit et al. 2013-2015). Transposable element (TE) content and distribution was assessed in the consensus sequences by TE class as defined by Wicker et al. (2007), with the percentage of each class being the ratio of the length of the sequences that matched to a TE class and the total length of the consensus sequence (Table 1). Synteny between the masked consensus sequences was identified with Smash ++ using the same parameters as were used for initial synteny analysis. GFF files were constructed for genes, markers, TE, and syntenic regions in Tsn1-B1 +Cons and Tsn1-B1 -Cons and visualized in Geneious Prime 2021.0.3 (https://www.geneious.com) to identify syntenic low-copy DNA regions that could be targeted for marker development. Gene-based haplotype analysis Because the genomic region between markers fcp620 and fcp394 was too large (351 kb) to reasonably conduct a nucleotide-based haplotype analysis, a gene-based comparison was conducted to assess structural haplotypes in the Tsn1-B1 region in the sequenced hexaploid lines with pseudomolecule assemblies. Given the level of sequence conservation in the Tsn1-B1 region in hexaploid Tsn1-B1+ and Tsn1-B1- lines (see results), genes were identified in a representative insensitive sequenced line (Chinese Spring) and a sensitive sequenced line (CDC Landmark). Because Chinese Spring does not have Tsn1-B1 and may be missing additional genes in the Tsn1-B1 region, genes were annotated in the Tsn1-B1 region of the ToxA-sensitive line CDC Landmark using the TriAnott pipeline (Leroy et al. 2012). Protein domains were identified using Pfam (http://pfam.xfam.org/, accessed April 20 th , 2020). Genes smaller than 500 bp or without Pfam matches with an e-value of at least 1×10 -5 were considered pseudogenes. Predicted open reading frames with homology to the polypeptide of LTR copia-type domain were considered TEs. The annotated genes in the Tsn1-B1 region of the durum reference genome Svevo Rel. 1.0 and the wild emmer ( T. turgidum ssp. dicoccoides (Körn. ex Asch. & Graebn.) Thell., (2 n = 4 x = 28, AABB genomes) reference genome Zavitan WEWSeq v1.0 were identified on Ensembl Plants (https://plants.ensembl.org) in case there were tetraploid-specific genes that did not show up in the Chinese Spring or CDC Landmark annotations (Maccaferri et al 2019; Avni et al. 2017; IWGSC 2018; Walkowiak et al. 2020). In December 2021, a de novo annotation of CDC Landmark by Plant Genomes and System Biology and the Earlham Institute was published on Ensembl plants (release 52). The genes annotated in CDC Landmark using the TriAnnott pipeline were compared to those in the de novo annotation (PGSBv2.1). The presence and position of the annotated genes were identified in the genome assemblies of eight ToxA-sensitive and four ToxA-insensitive wheat lines by conducting BLASTn searches of all the identified annotations against the pseudomolecule level assemblies (Supplementary Table 6). While the presence of these genes could be confirmed in scaffold-level assemblies, the presence of other potential genes not identified in the set of annotated genes could not be ruled out. Therefore, lines with scaffold-level assemblies were excluded from gene-based haplotype analysis. Tsn1-B1 marker development To identify diagnostic markers for Tsn1-B1 , the alignment of the repeat-masked Tsn1-B1 +Cons and Tsn1-B1 -Cons sequences was used to identify SNPs that could be targeted for marker development. Contextual SNP sequences were used in BLASTn searches against additional hexaploid scaffold level assemblies and T. turgidum assemblies to determine their SNP alleles (Supplementary Table 1). SNPs that did not consistently differentiate ToxA-sensitive from ToxA-insensitive lines were eliminated from consideration. Nine semi-thermal asymmetric reverse PCR (STARP) markers were designed according to the recommended parameters reported in Long et al. (2017), with six targeting the distal side of Tsn1-B1 and three targeting the proximal side. The STARP markers were first amplified via PCR from sequenced lines with known Tsn1-B1 alleles as described in Long et al. (2017) and electrophoresed on 6% nondenaturing polyacrylamide gels. Gels were stained with Gelred™ nucleic acid stain (Biotium Corporate, Hayward, CA) and scanned with a Typhoon 9500 variable mode imager (GE healthcare Biosciences, Waukesha, WI). This procedure was also used to evaluate the STARP markers on the WWP and GDP. Two selected STARP markers flanking Tsn1 were converted to KASP by dropping the induced mutation in the STARP forward primer and replacing the STARP tails with KASP fluorescent tails. No adjustments were made to the reverse primer. STARP and KASP markers were evaluated as digital assays by the USDA-ARS small grains genotyping Lab in Fargo, ND. Only the digital KASP assays were evaluated on the HRSWP due to its size. Primer sequences for all four markers are reported in Table 2. For each marker, the accuracy of the phenotypic prediction was calculated using all lines with homozygous alleles for that marker. Prediction accuracies were calculated separately for each marker in the three panels (Table 3). Assessing recombination events Apparent crossovers were identified in the panels using lines with homozygous alleles for markers fcp991 and fcp992 . To identify apparent double crossovers, the reaction to ToxA was used to infer the allelic state of Tsn1-B1 in each line, i.e. sensitive to ToxA = dominant Tsn1-B1 allele; insensitive to ToxA = recessive or absent tsn1-B1 allele. Lines that were ToxA-insensitive but had marker genotypes that would indicate a ToxA-sensitive phenotype were selected for further analysis. First, additional replicates of each line were planted. Each plant was infiltrated with ToxA and scored independently. If the phenotype segregated, indicating seed mixture, the line was excluded from further analysis. DNA was extracted from apparent double crossover lines and a Tsn1-B1 gene fragment was amplified to further confirm the presence or absence of a Tsn1-B1 DNA sequence. Genetic evaluation of ToxA-insensitivity in Tsn1-B1 + lines A two-tailed Chi-squared test was used to determine if the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F 2 phenotypic data fit the expected 3:1 ratio. BSA was conducted using four bulks from each F 2 population, two sensitive and insensitive bulks, each consisting of eight F 2 plants.. The bulks and parents were genotyped with the 90K iSelect SNP genotyping array (Wang et al. 2014) at the USDA-ARS small grains genotyping lab in Fargo, ND, USA. Clustering of SNPs was analyzed using GenomeStudio 2.0.5 (Illumina, San Diego, CA). Initial BSA of SNPs was conducted by calculating the absolute value of the difference between the theta values of the sensitive and insensitive bulks for each SNP. SNPs were then filtered based on the calculated values being greater than 0.5 to ensure that only SNPs with clear cluster differentiation were being evaluated. Each SNP was visually inspected to ensure that the sensitive and insensitive parents had alternate alleles, the insensitive parent was clustering with the insensitive bulks, and the sensitive bulks were either heterozygous or clustering with the sensitive parents. The probe sequences of SNPs associated with ToxA-sensitivity identified by BSA were used in a BLASTn search of the Svevo Rel. 2.0 assembly (https://wheat.pw.usda.gov/blast/) to determine their genomic position. Low-resolution mapping was conducted using 121 DWRC-1007 × Lebsock F 2 plants. KASP were designed for the SNPs identified in BSA using PolyMarker (Ramirez-Gonzalez et al. 2015) and the Svevo Rel. 1.0 assembly (Maccaferri et al. 2019). Primer3 was used to check the annealing temperature, self-complementarity, and self 3’ complementarity of primer sequences. Sequences were used in BLASTn searches of the Svevo Rel. 1.0 assembly (Maccaferri et al. 2019) to ensure target specificity. Primer sequences that were not specific or did not meet the desired conditions were manually redesigned using the probe sequences and Svevo Rel. 1.0 assembly. Primer sequences are available in Supplementary Table 7. KASP markers were amplified and scanned on the CFX384 Real-Time System (Bio-Rad, Hercules, CA). Bio-Rad CFX Manager (Bio-Rad, Hercules, CA) was used to analyze KASP amplification and define alleles. The linkage map was assembled using MapDisto v2.1.8.7 (Lorieux 2012) as described by Acharya et al. (2024) and anchored to a physical map constructed based on the physical locations of the SNPs in Svevo Rel. 2.0. Results Development and comparison of Tsn1-B1 + and Tsn1-B1 - consensus sequences Wheat lines carrying Tsn1-B1 exhibit strong necrotic reactions when infiltrated with ToxA, while lines with no Tsn1-B1 allele or with a non-functional tsn1-B1 allele show an insensitive reaction (Figure 1). Among the 18 sequenced wheat lines, six (33%) were sensitive and 12 (66%) were insensitive to ToxA. The ToxA-insensitive lines included the hexaploids ArinaLrFor, CDC Stanley, Chinese Spring, Julius, Mace, SY Mattis, Claire, Robigus, and Weebil, and the tetraploids Kronos, Svevo, and Zavitan (Supplementary Table 1). The Tsn1-B1 region was defined as the sequence flanked by markers fcp620 and fcp394 . Within the ToxA-insensitive hexaploid lines, the length of the Tsn1-B1 region ranged from 281.7 to 298.4 kb with an average length of 288.4 kb. The size of the Tsn1-B1 region in the ToxA-insensitive durum cultivar Svevo was 290.8 kb, which was within the range identified in the ToxA-insensitive hexaploid lines. The length of the Tsn1-B1 region in the ToxA-insensitive wild emmer Zavitan genome was slightly smaller at 275.7 kb. The Tsn1-B1 region was larger in the ToxA-sensitive lines (CDC Landmark, Jagger, LongReach Lancer, Norin61, Cadenza, and Paragon), which were all hexaploid, where it ranged from 328.6 to 448.4 kb . Among these, Jagger had the smallest Tsn1-B1 region at 328.6 kb with the others ranging from 444.9 to 448.4 kb, varying by just 3.5 kb. The smaller Tsn1-B1 region in Jagger reduced the average Tsn1-B1 region to 416.8 kb for the ToxA-sensitive lines. Overall, there was a substantial difference in the size of the Tsn1-B1 region between sensitive and insensitive lines with the Tsn1-B1 region being on average 128 kb larger in the ToxA-sensitive lines, i.e. lines that contained Tsn1-B1 . A single syntenic block between the sequences of ToxA-insensitive lines was identified. Similarly, a single syntenic block between the sequences of ToxA-sensitive lines was also identified. No structural rearrangements were identified within either the sensitive or insensitive groups. Given this finding, consensus sequences were created for each of the two sensitivity classes, and they are hereafter referred to as Tsn1-B1 +Cons and Tsn1-B1 -Cons. Ten syntenic regions ranging in length from approximately 2.5-15.5 kb were identified in Tsn1-B1 +Cons and Tsn1-B1 -Cons, representing low-copy DNA that did not display presence/absence variation between sequences. STARP ( fcp993 and fcp994 ) and KASP ( fcp991 and fcp992 ) markers were designed flanking Tsn1-B1 in the syntenic regions nearest the gene (Figure 2). The region between fcp991 and fcp992 was 40.4 kb and 41.5 kb in the Chinese Spring RefSeq v1.0 assembly (IWGSC 2018) and Tsn1-B1 -Cons, respectively. In Tsn1-B1 +Cons, fcp991 and fcp992 were 134.8 kb apart and 77.2 kb and 57.5 kb on either side of Tsn1-B1. The Tsn1-B1 -Cons segment (between markers fcp620 and fcp394 ) was 305.5 kb, and 45.44% was identified as repetitive elements. Tsn1-B1 +Cons was larger with a length of 332.7 kb and contained 46.30% repetitive elements. In both Tsn1-B1 +Cons and Tsn1-B1 -Cons, gypsy retrotransposons were the largest TE superfamily, representing 30.72% and 25.38% of the total length, respectively (Table 1). There were fewer Copia elements in the Tsn1-B1 -Cons compared to the Tsn1-B1 +Cons. However, in general, the TE makeup between fcp620 and fcp394 was relatively similar in Tsn1-B1 +Cons and Tsn1-B1 -Cons. Only two gene-based haplotypes were identified in the hexaploid pseudomolecule-level assemblies. Haplotype 1 was common among ToxA-insensitive lines and Haplotype 2 was common among ToxA-sensitive lines (Supplementary Table 6). Therefore, the consensus sequences Tsn1-B1 -Cons and Tsn1-B1 +Cons represent the two gene-based haplotypes, and the positions of the genes in the consensus sequences are displayed in Figure 2. No tetraploid-specific genes were identified. Four genes were common among the sensitive and insensitive pseudomolecule-level assemblies (Supplementary Table 6). One of these was a wall-associated kinase ( TraesCS5B02G368200 , WAK), which contained the sequence for marker fcp620 and resided at the very proximal end of genomic region under investigation. The other three genes common to both haplotypes were in the distal region of the segment between fcp992 and fcp394 and consisted of genes that encode an RNA recognition motif domain ( TraesCS5B02G368400 , RNP), a potassium transporter ( TraesCS5B02G368500 , PT), and a palmitoyltransferase ( TraesCS5B02G368600 , PLTF). Within Haplotype 1, a gene encoding cathepsin propeptide inhibitor and peptidase domains ( TraesCS5B02G368300 , CPI-Peptidase) was identified between fcp620 and fcp991 . Two unique genes were identified in Haplotype 2. The first unique gene in Haplotype 2 encoded proteins with endonuclease/exonuclease/phosphatase family, DUF4283, and zinc knuckle protein domains according to the TriAnnot gene prediction. However, the PGSBv2.1 annotation of this gene ( TraesLDM5B03G02955820 ) indicated that the sequence containing the endonuclease/exonuclease/phosphatase family protein domains was not part of the open reading frame that coded for the DUF4283 and zinc knuckle domains (DUF-ZK). The second unique gene to Haplotype 2 was Tsn1-B1 . Marker validation The HRSWP, GDP, and WWP, which were infiltrated with ToxA in Szabo-Hever et al. (2023, 2024), and Peters Haugrud et al. (2023), were used to validate markers fcp991, fcp992 , fcp993 , and fcp994 . For the HRSWP, GDP, and WWP, 52.1%, 29.0%, and 38.4% of the lines were sensitive to ToxA, respectively (Figure 3, Supplementary Table 2). The distribution of phenotypic scores was bimodal in both the panels and the sequenced lines, with most of the lines having a score of 0-0.49 or 2.5-3.0. KASP markers fcp991 and fcp992 were used to genotype the WWP, GDP, and HRSWP (Figure 4). In all panels, clear clusters formed, representing the Tsn1-B1 + and Tsn1-B1 - alleles. When the KASP markers fcp991 and fcp992 predicted a line would be insensitive, it was true in 99.32-100% of cases in all three panels (Table 4). Each panel contained a few lines where the marker alleles predicted the line to be sensitive to ToxA, but the line was experimentally found to be insensitive. Because of this, the accuracy predicting when a line would be sensitive to ToxA was lower (89.47-95.55%). STARP markers fcp993 and fcp994 were used to genotype the GDP and WWP and produced strong bands that were easy to discriminate (Supplementary Figure 1). They were 99.41-100% accurate when predicting the insensitive phenotype and 89.10-95.19% accurate when predicting the sensitive phenotype, similar to the accuracies found using the KASP markers (Table 4). As the KASP markers were run on all three panels, further analysis focused on the alleles determined by the KASP markers. In total, 1,531 lines had homozygous alleles for both fcp991 and fcp992 . When ToxA sensitivity was treated as a marker for Tsn1-B1 , there was no recombination detected between the markers and Tsn1-B1 for 94.97% of those lines. Of the remaining lines, six had a single crossover between fcp991 and Tsn1-B1 , nine had single crossovers between fcp992 and Tsn1-B1 , and 62 had apparent double crossover events, with a crossover occurring between Tsn1-B1 and both flanking markers. Given the preponderance of apparent double crossovers and that 96.77% of the apparent double crossovers were insensitive to ToxA, a Tsn1-B1 internal marker ( fcp623 or Tsn1-B1 sequencing primer pair) was used to confirm double crossover events. A true double crossover event between fcp991 and fcp992 resulting in marker alleles predictive of sensitivity, but showing an insensitive phenotype, would mean that the line would not have a Tsn1-B1 allele, and therefore fcp623 and/or Tsn1-B1 sequencing reactions would fail to amplify any fragment. In sixty-two lines with apparent double crossovers, only two were true double crossovers. The two lines with true double crossover events were both sensitive, with flanking markers predicting that the line should be insensitive. The remaining sixty lines were all insensitive with flanking markers predicting they should be sensitive, but analysis with marker fcp623 ora Tsn1-B1 sequencing primer pair showed that all 60 lines possessed an allele of Tsn1-B1 , or at least a fragment of the gene, which suggested they were not true crossovers and that further analysis of the alleles present in these lines was necessary. Identification of novel tsn1-B1b haplotypes To further investigate the cause for ToxA insensitivity in Tsn1-B1+ lines, Tsn1-B1 was sequenced from the 60 lines that were insensitive to ToxA despite having a Tsn1-B1 amplicon. Mutations that altered the coding sequence were found in 63.33% of lines, explaining their insensitivity (Figure 5, Supplementary Table 4). Ten insensitive haplotypes of the insensitive Tsn1-B1 allele, tsn1-B1b , were identified and designated tsn1-B1b_h1 through tsn1-B1b_h10 . Previously, four naturally occurring mutations in Tsn1-B1 were reported (Faris et al. 2010), and three of them were observed in this study. The frameshift mutations at 4,616 bp ( tsn1 -B1 b_h2 ) and 6,634 ( tsn1-B1b_h4 ) reported in lines TA2601 and Ching Feng, respectively, were observed here in both the HRSWP and WWP. The nonsense mutation at 9,767 bp ( tsn1-B1b_h9 ) reported in the hexaploid wheat lines Huo Mai, Novo, and Puseas was only identified in the HRSWP. The frameshift at 8,145 bp previously reported in Siu Mak ( tsn1-B1b_h6) was not identified in any of the lines sequenced in this study. Six novel tsn1-B1b haplotypes were identified here with four being missense mutations ( tsn1-B1b_h1, tsn1-B1b_h5, tsn1-B1b_h7, and tsn1-B1b_h8 )and two being frameshift mutations ( tsn1-B1b_h3 and tsn1-B1b_h10 ). Haplotype tsn1-B1b_h3 was specific to tetraploid wheat, whereas the other nine mutation haplotypes were specific to hexaploids. Interestingly, 22 of the 60 lines that were insensitive to ToxA and carried a Tsn1-B1 allele had the same gene sequence as ToxA-sensitive lines ( Tsn1-B1a_h1 , Figure 5, Supplementary Table 4). Amplification of Tsn1-B1 cDNA was confirmed in 18 of the 22 lines indicating that Tsn1-B1 was not expressed in four of the lines, which were all from the HRSWP. The remaining 18 lines appeared to have a functional Tsn1-B1 gene, and we hypothesized that these lines had a mutation in a different gene required in the disease response pathway rendering them insensitive to ToxA. Genetic analysis of ToxA-insensitive lines carrying a functional Tsn1-B1 gene Several crosses were made to test the hypothesis that the ToxA-insensitive lines expressing haplotype Tsn1-B1a_h1 carried a mutation at a second locus necessary for expression of a ToxA-sensitive phenotype. Two ToxA-insensitive lines, DWRC-0110 and DWRC-1007 (Figure 1), were found to express Tsn1-B1a_h1 with no mutations or alterations in splicing. DWRC-0110 and DWRC-1007 were crossed to each other for an allelism test and to the ToxA-sensitive durum cultivar Lebsock (Figure 1) for mapping and evaluation of inheritance of ToxA-sensitivity. All F 1 plants from the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock crosses were sensitive to ToxA, indicating that sensitivity was a dominant trait. All F 1 plants from the DWRC-0110 × DWRC-1007 cross were insensitive to ToxA, indicating that they likely shared the same insensitivity locus. Sensitivity in the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F 2 populations fit the expected genetic ratio of 3 sensitive: 1 insensitive, indicating sensitivity was inherited as a dominant monogenic trait in these populations. Because both parents of the populations carried and expressed Tsn1-B1a_h1 , but differed in ToxA sensitivity (Figure 1), we expected ToxA sensitivity to map to another locus. BSA using insensitive and sensitive bulks from the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F 2 populations identified 12 SNPs associated with ToxA sensitivity in each population (Supplementary Tables 7 and 8). A BLASTn search using the SNP probe sequences revealed that all SNPs resided on the short arm of chromosome 2B in the Svevo Rel. 2.0 assembly, confirming the hypothesis that an additional locus, which we designated Tsn1-B2 , was conferring ToxA-sensitivity. In DWRC-0110 × Lebsock, the SNPs were between position 11.36 Mb and 30.5 Mb, and in DWRC-1007 × Lebsock the SNPs were at positions 9.15-30.5 Mb. Low resolution mapping of Tsn1-B2 was conducted using 120 DWRC-1007 × Lebsock F 2 plants. Nine of twelve KASP ( fcp1013-1021 , Supplementary Table 6) designed from SNPs identified via BSA produced clear cluster differentiation and thus were used for mapping (Figure 6). The low-resolution map was 20.7 cM long and spanned a physical distance of 21.3 Mb in Svevo Rel. 2.0. The Tsn1-B1 locus was delineated to a 4.8 cM region, flanked by markers fcp1016 and fcp1019 , corresponding to a 8.6 Mb region in Svevo Rel. 2.0 (14.2-22.8 Mb). Discussion The primary goal of this research was to develop highly robust and effective markers for high-throughput marker-assisted elimination of functional Tsn1-B1 alleles. We found that, among the cultivated and breeding lines in the WWP and HRSWP, 22.0 and 50.88% of the lines were sensitive to ToxA, respectively, indicating that ToxA sensitivity, and therefore susceptibility to SNB, tan spot, and spot blotch, is relatively common in cultivated bread wheats. A similar trend was observed in the durum panel, where 24.0% of the modern lines were sensitive to ToxA. While phenotypic testing of breeding lines for sensitivity to ToxA is possible, performing infiltrations is quite laborious and requires growing yeast cultures to produce ToxA. Additionally, because Tsn1-B1 confers dominant sensitivity to ToxA, homozygous ToxA-sensitive lines cannot be distinguished from heterozygous lines, thus limiting the amount of genetic information that can be obtained. For efficient low-cost high throughput selection of lines insensitive to ToxA, marker-assisted selection is more user-friendly and preferred by most wheat breeding programs because it is easy to incorporate additional markers into their already-established marker-assisted selection programs. The codominant KASP and STARP (gel-based assay) markers developed here, fcp991 - fcp994 , tightly flank Tsn1-B1 and correctly identify ToxA-insensitive plants with greater than 99% accuracy. While it is possible that additional markers could be developed to select for other insensitive tsn1-B1b haplotypes, it would not be efficient to use them given the relative rarity of these haplotypes (0.8%-0.07%). Tsn1-B1 arose when separate PK and NB-LRR genes went through a gene fusion event, likely in the diploid B-progenitor of polyploid wheat (Faris et al. 2010 ). Tetraploid wild emmer wheat ( T. turgidum ssp. dicoccoides ) either obtained Tsn1-B1 through the hybridization event between the diploid B-progenitor, closely related to Aegilops speltoides Tausch. (2 n = 2 x = 14, SS genome), and T. urartu Tumanian ex Gandilyan (2 n = 2 x = 14, AA genome) that formed wild emmer wheat, or through subsequent outcrossing with a wild diploid B-genome species. During a second amphiploidization event, a T. turgidum ssp. and the diploid wild goat grass Ae. tauschii Coss. (2 n = 2 x = 14, DD) hybridized to form hexaploid wheat T. aestivum (AABBDD genomes). Tsn1-B1 was introduced into hexaploid wheat either through this event, or through gene flow via subsequent outcrossing event(s). These hybridization events act as significant bottlenecks for genetic diversity. In line with that trend, Faris et al. ( 2010 ) observed greater sequence diversity in Ae. speltoides , T. turgidum ssp. dicoccum , and T. turgidum ssp. dicoccoides accessions than in spring wheats. In all three diversity panels evaluated in this study, greater haplotype diversity was found among the landraces than cultivated lines. However, only two haplotypes were identified in the GDP, whereas four and eight haplotypes were identified in the WWP and HRSWP, respectively. In the GDP, only one intragenic mutation was identified ( tsn1-B1b_h3 ) and it was exclusive to durum landraces. The Tsn1-B1 + ToxA-insensitive cultivated durum lines all expressed Tsn1-B1a_h1 , and it is likely they were insensitive to ToxA because they carried a mutation in a different gene necessary for ToxA sensitivity, possibly Tsn1-B2 . Of the four ToxA-insensitive lines that had, but did not express, Tsn1-B1a_h1 , three of them were landraces. One was a Finnish cultivar, Kimmo, released in 1941. It appears that the variant inhibiting the expression of Tsn1-B1 has not been selected for in modern cultivars. Based on the greater haplotype diversity of the insensitive tsn1-B1b allele in hexaploid wheats relative to durum wheat, it appears that more of the mutations in Tsn1-B1 occurred after the formation of hexaploid wheat. However, the rarity of these mutations suggests that the mutations occurred relatively recently. Two highly conserved gene-based haplotypes for the Tsn1-B1 region were identified among sequenced wheat lines where one haplotype was conserved among lines having Tsn1-B1 and the other among lines lacking Tsn1-B1 . There were two major differences between the two haplotypes. First, the region between the 6th and 7th syntenic low-copy DNA blocks identified between Tsn1-B1 + and Tsn1-B1 - consensus sequences was expanded in Tsn1-B1 -Cons. The expanded region contained a greater number of TEs and a gene unique to the Tsn1-B1 - lines (CPI-peptidase). This likely resulted from an insertion/deletion event that led to the deletion of the DUF-ZK gene in Tsn1-B1 + lines and the introduction of CPI-peptidase in Tsn1-B1 - lines. Second, the region between the 7th and 8th syntenic blocks is expanded in Tsn1-B1 + Cons, again containing a greater number of TE and a unique gene, Tsn1-B1 . This was also likely the result of an insertion/deletion event leading to the acquisition of Tsn1-B1 in the Tsn1-B1 + lines. These insertion/deletion events would have most likely occurred in a wheat progenitor before the formation of cultivated durum or common wheat, and the cultivated lines likely acquired the segment extending from the 6th syntenic block to the location of fcp992 through a recombination event. Further genomic analysis of this region in the wheat progenitors, including the diploid ancestors, would likely shed more light on the evolutionary events that shaped this region. The evaluation of the efficacy of markers for Tsn1-B1 led to the identification of a second locus on chromosome 2B ( Tsn1-B2 ) in durum wheat associated with ToxA-sensitivity. The Tsc2 gene, which is a susceptibility gene that recognizes the necrotrophic effector Ptr ToxB produced by Pyrenophora tritici-repentis is also located on wheat chromosome arm 2BS (reviewed by Faris et al. 2013 ), but comparisons of the physical locations of the two genes indicated that Tsn1-2B was located at least 7 Mb distal to Tsc2 . No markers on chromosome 5B were identified by BSA, confirming that both DWRC-0110 and DWRC-1007 have functional Tsn1-B1 alleles, despite being insensitive to ToxA. Based on the F 1 and F 2 phenotypes in the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock populations, sensitivity to ToxA was dominant, and the dominant allele at Tsn1-B2 was required to express sensitivity. It is likely that the recessive tsn1-B2 allele is relatively rare, and that is why it has not been detected before. A gene required in the ToxA-sensitivity pathway may underlie the Tsn1-B2 locus. It is interesting to note that among dozens of studies involving the genetic evaluation and mapping of ToxA sensitivity (Friesen and Faris 2010 , 2021 ; Faris et al. 2013 ; Peters Haugrud et al. 2022 for reviews) and the development of chemically-induced ToxA-insensitive mutants (Faris et al. 2010 ) in wheat, no locus other than Tsn1 on chromosome 5B has been implicated in governing ToxA sensitivity. Fine mapping and cloning are underway using the DWRC-1007 × Lebsock population to better define the Tsn1-B2 locus and ultimately uncover the mechanism that makes Tsn1-B2 necessary for ToxA sensitivity, which should extend our knowledge of the compatible Tsn1 -ToxA interaction and wheat-pathogen interactions in general. Dozens of studies have demonstrated the role of Tsn1 as a susceptibility factor in the development of tan spot, SNB, and spot blotch (Friesen and Faris 2010 , 2021 ; Faris et al. 2013 ; Peters Haugrud et al. 2022 for reviews). The markers developed here can be used to reliably and efficiently select lines with absent alleles for Tsn1-B1 using either high-throughput platforms (both KASP and STARP markers) or using relatively low-throughput, low-cost gel-based assays (STARP markers). Including these markers in marker-assisted selection arrays would allow the efficient selection of lines insensitive to ToxA, and therefore less susceptible to P. nodorum , P. tritici-repentis , and B. sorokiniana . Declarations Acknowledgements The authors would like to thank Danielle Holmes, Mary Osenga, Stephanie McCoy, and Heaven James for technical assistance. Figures 3 and 5 were created in BioRender. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer. Funding This research was supported by USDA-ARS CRIS Project: 3060-21000-046-000D. Competing interests The authors have no relevant financial or non-financial interests to disclose. Author contribution Statement KLDR and JD Faris designed the experiments; KLDR, KA, TMP, GS, ARPH, AS-H, and JD Fiedler conducted the experiments and collected the data; KLDR, KA, TMP, and JD Faris analyzed and interpreted the data; and KLDR and JD Faris wrote the paper. All the authors read and approved the final version of the manuscript. Data availability The datasets generated during and/or analyzed during the current study are available as supplementary materials and/or from the corresponding author on reasonable request. Tsn1-B1 sequences generated here have been deposited in GenBank under accession numbers XXX-XXX Ethics approval NA Consent to participate NA Consent to publish NA References Abdullah S, Sehgal SK, Ali S, Liatukas Z, Ittu M, Kaur N (2017) Characterization of Pyrenophora tritici-repentis (tan spot of wheat) races in Baltic states and Romania. Plant Pathol J 33:133–139 Acharya K, Liu Z, Schachterle J, Kumari P, Manan F, Xu SS, Green AJ, Faris JD (2024) Genetic mapping of QTLs for resistance to bacterial leaf streak in hexaploid wheat. Theor Appl Genet 137:265. https://doi.org/10.1007/s00122-024-04767-x Antoni EA, Rybak K, Tucker MP, Hane JK, Solomon PS, Drenth A, Shankar M, Oliver RP (2010) Ubiquity of ToxA and absence of ToxB in Australian populations of Pyrenophora tritici - repentis . Austral Plant Pathol 39:63–68 Avni R, Nave M, Barad O et al (2017) Wild emmer genome architecture and diversity elucidate wheat evolution and domestication. Science 357:93–97 Ballance GM, Lamari L, Bernier CC (1989) Purification and characterization of a host-selective necrosis toxin from Pyrenophora tritici-repentis . Physiol Mol Plant Pathol 35:203–213 Bucknell AH, McDonald MC (2023) That’s no moon, it’s a Starship: Giant transposons driving fungal horizontal gene transfer. Mol Microbiol 120:555–563. https://doi.org/10.1111/mmi.15118 Bulli P, Zhang J, Chao S, Chen X, Pumphrey M (2016) Genetic architecture of resistance to stripe rust in a global winter wheat germplasm collection. G3-Genes Genom Genet. 6:2237–2253. 10.1534/g3.116.028407 Ciuffetti LM, Manning VA, Pandelova I, Betts MF, Martinez JP (2010) Host-selective toxins, Ptr ToxA and Ptr ToxB, as necrotrophic effectors in the Pyrenophora tritici - repentis -wheat interaction. New Phytol 187:911–919 Faris JD, Abeysekara NS, McClean PE, Xu SS, Friesen TL (2012) Tan spot susceptibility governed by the Tsn1 locus and race-nonspecific resistance quantitative trait loci in a population derived from the wheat lines Salamouni and Katepwa. Mol Breed 30:1669–1678 Faris JD, Friesen TL (2009) Reevaluation of a tetraploid wheat population indicates that the Tsn1 -ToxA interaction is the only factor governing Stagonospora nodorum blotch susceptibility. Phytopathology 99:906–912 Faris JD, Friesen TL (2020) Plant genes hijacked by necrotrophic fungal pathogens. Curr Opin Plant Biol 56:74–80. https://doi.org/10.1016/j.pbi.2020.04.003 Faris JD, Haen KM, Gill BS (2000) Saturation mapping of a gene-rich recombination hot spot region in wheat. Genetics 154:823–835 Faris JD, Liu Z, Xu SS (2013) Genetics of tan spot resistance in wheat. Theor Appl Genet 126:2197–2217. https://doi.org/10.1007/s00122-013-2157-y Faris JD, Zhang Z, Lu H, Lu Z, Reddy L, Cloutier S, Fellers JP, Meinhardt SW, Rasmussen JB, Xu SS, Oliver RP, Simons KJ, Friesen TL (2010) A unique wheat disease resistance-like gene governs effector-triggered susceptibility to necrotrophic pathogens. Proc Natl Acad Sci USA 107:13544–13549 Friesen TL, Faris JD (2010) Characterization of the wheat- Stagonospora nodorum disease system - what is the molecular basis of this quantitative necrotrophic disease interaction? Can J Plant Pathol 32:20–28 Friesen TL, Faris JD (2021) Characterization of effector–target interactions in necrotrophic pathosystems reveals trends and variation in host manipulation. Annu Rev Phytopathol 59:77–98. https://doi.org/10.1146/annurev-phyto-120320-012807 Friesen TL, Stukenbrock EH, Liu Z, Meinhardt S, Ling H, Faris JD, Rasmussen JB, Solomon PS, McDonald BA, Oliver RP (2006) Emergence of a new disease as a result of interspecific virulence gene transfer. Nat Genet 38:953–956 Friesen TL, Holmes DJ, Bowden RL, Faris JD (2018) ToxA is present in U.S. Bipolaris sorokiniana population and is a significant virulence factor on wheat harboring Tsn1 . Plant Dis 102:2446–2452 Gourlie R, McDonald M, Hafez M, Ortega-Polo R, Low KE, Abbott DW, Strelkov SE, Daayf F, Aboukhaddour R (2022) The pangenome of the wheat pathogen Pyrenophora tritici-repentis reveals novel transposons associated with necrotrophic effectors ToxA and ToxB. BMC Biol 20:239. https://doi.org/10.1186/s12915-022-01433-w Hosseini M, Pratas D, Morgenstern B, Pinho AJ (2020) Smash++: an alignment-free and memory-efficient tool to find genomic rearrangements. GigaScience 9:giaa048. https://doi.org/10.1093/gigascience/giaa048 :, International Wheat Genome Sequencing Consortium (IWGSC), IWGSC RefSeq principal investigators, Appels R et al (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 361:eaar7191 Kariyawasam GK, Nelson AC, Williams SJ, Solomon PS, Faris JD, Friesen TL (2023) The necrotrophic pathogen Parastagonospora nodorum is a master manipulator of wheat defense. MPMI 36:764–773. https://doi.org/10.1094/MPMI-05-23-0067-IRW Lamari L, Bernier CC (1989) Evaluations of wheat lines and cultivars to tan spot [ Pyrenophora tritici-repentis ] based on lesion type. Can J Plant Pathol 11:49–56 Lassmann T (2019) Kalign 3: multiple sequence alignment of large datasets. https://doi.org/10.1093/bioinformatics/btz795 . Bioinformatics btz795 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078–2079 Liu Z, Friesen TL, Ling H, Meinhardt SW, Oliver RP, Rasmussen JB, Faris JD (2006) The Tsn1 -ToxA interaction in the wheat- Stagonospora nodorum pathosystem parallels that of the wheat-tan spot system. Genome 49:1265–1273 Long YM, Chao WS, Ma GJ, Xu SS, Qi LL (2017) An innovative SNP genotyping method adapting to multiple platforms and throughputs. Theor Appl Genet 130:597–607 Lorieux M (2012) MapDisto: fast and efficient computation of genetic linkage maps. Mol Breed 30:1231–1235 Maccaferri M, Harris NS, Twardziok SO et al (2019) Durum wheat genome highlights past domestication signatures and future improvement targets. Nat Genet 51:885–895 Maccaferri M, Zhang J, Bulli P, Abate Z, Chao S, Cantu D, Bossolini E, Chen X, Pumphrey M, Dubcovsky J (2015) A genome-wide association study of resistance to stripe rust ( Puccinia striiformis f. sp. tritici ) in a worldwide collection of hexaploid spring wheat ( Triticum aestivum L.). G3-Genes. Genom Genet 5:449–465 Manan F, Shi G, Gong H, Hou H, Khan H, Leng Y, Castell-Miller C, Ali S, Faris JD, Zhong S, Steffenson BJ, Liu Z (2023) Prevalence and importance of the necrotrophic effector gene ToxA in Bipolaris sorokiniana populations collected from spring wheat and barley. Plant Dis 107:2424–2430. https://doi.org/10.1094/PDIS-08-22-2011-RE Mazzucotelli E, Sciara G, Mastrangelo AM et al (2020) The Global Durum Wheat Panel (GDP): An international platform to identify and exchange beneficial alleles. Front Plant Sci 11:569905 McDonald MC, Ahren D, Simpfendorfer S, Milgate A, Solomon PS (2018) The discovery of the virulence gene ToxA in the wheat and barley pathogen Bipolaris sorokiniana . Mol Plant Pathol 19:432–439 McDonald MC, Oliver RP, Friesen TL, Brunner PC, McDonald BA (2013) Global diversity and distribution of three necrotrophic effectors in Phaeosphaeria nodorum and related species. New Phytol 199:241–251 Mihalyov PD, Nichols VA, Bulli P, Rouse MN, Pumphrey MO (2017) Multi-locus mixed model analysis of stem rust resistance in winter wheat. Plant Genome. https://doi.org/10.3835/plantgenome2017.01.0001 Moreno MV, Stenglein S, Perelló AE (2015) Distribution of races and Tox genes in Pyrenophora tritici-repentis isolates from wheat in Argentina. Trop Plant Pathol 40:141–146 Muleta KT, Chen X, Pumphrey M (2020) Genome-wide mapping of resistance to stripe rust caused by Puccinia striiformis f. sp. tritici in hexaploid wheat. Crop Sci 60:115–131 Navathe S, Yadav PS, Chand R, Mishra VK, Vasistha NK, Meher PK, Joshi AK, Gupta PK (2020) ToxA - Tsn1 Interaction for spot blotch susceptibility in Indian wheat: An example of inverse gene-for-gene relationship. Plant Dis 104:71–81 Pallotta MA, Warner P, Fox RL, Kuchel H, Jefferies SJ, Langridge P (2003) Marker assisted wheat breeding in the southern region of Australia. Proceedings of the Tenth International Wheat Genetics Symposium (1–6 September 2003, Paestum, Italy) pp. 789–791 Peters Haugrud AR, Shi G, Seneviratne S, Running KLD, Zhang Z, Singh G, Szabo-Hever A, Acharya K, Friesen TL, Liu Z, Faris JD (2023) Genome-wide association mapping of resistance to the foliar diseases septoria nodorum blotch and tan spot in a global winter wheat collection. Mol Breed 43:54. https://doi.org/10.1007/s11032-023-01400-5 Peters Haugrud AR, Zhang Z, Friesen TL, Faris JD (2022) Genetics of resistance to septoria nodorum blotch in wheat. Theor Appl Genet 135:3685–3707. https://doi.org/10.1007/s00122-022-04036-9 Ramirez-Gonzalez RH, Uauy C, Caccamo M (2015) PolyMarker: A fast polyploid primer design pipeline. Bioinformatics 31:2038–2039. https://doi.org/10.1093/bioinformatics/btv069 Savary S, Willocquet L, Pethybridge SJ et al (2019) The global burden of pathogens and pests on major food crops. Nat Ecol Evol 3:430–439. https://doi.org/10.1038/s41559-018-0793-y Seneviratne S, Shi G, Szabo-Hever A, Zhang Z, Peters Haugrud AR, Running KLD, Singh G, Nandety RS, Fiedler JD, McClean PE, Xu SS, Friesen TL, Faris JD (2024) Evolution, diversity, and function of the disease susceptibility gene Snn1 in wheat. Plant J 119:1720–1736. https://doi.org/10.1111/tpj.16879 Shabeer A, Bockus WW (1988) Tan spot effects on yield and yield components relative to growth stage in winter wheat. Plant Dis 72:599–602 Shaw DE (1957) Studies on Leptosphaeria avenaria . f. sp. triticea on cereals and grasses. Can J Bot 35:113–118 Shi G, Zhang Z, Friesen TL, Raats D, Fahima T, Brueggeman RS, Lu S, Trick HN, Liu Z, Chao W, Frenkel Z, Xu SS, Rasmussen JB, Faris JD (2016) The hijacking of a receptor kinase-driven pathway by a wheat fungal pathogen leads to disease. Sci Adv 2:e1600822. https://doi.org/10.1126/sciadv.1600822 Smit AFA, Hubley R, Green P (2013–2015) RepeatMasker Open-4.0 http://www.repeatmasker.org Shahbandeh M (2024) Global wheat production from 1990/1991 to 2023/2024 (in million metric tons). Statista. https://www.statista.com/statistics/267268/production-of-wheat-worldwide-since-1990/#:~:text=Wheat%3A%20production%20volume%20worldwide1990%2F1991% 2D2023%2F2024&text=In%20the%20marketing%20year%20of,almost%20785%20 million%20metric%20tons . Accessed 7 July 2024 Szabo-Hever A, Running KLD, Seneviratne S, Singh G, Zhang Z, Peters Haugrud AR, Maccaferri M, Tuberosa R, Xu SS, Friesen TL, Faris JD (2024) Evaluation of durum and hard red spring wheat panels for sensitivity to necrotrophic effectors produced by Parastagonospora nodorum . Plant Dis PDIS. https://doi.org/10.1094/PDIS-05-24-0990-RE . -05-24-0990-RE Szabo-Hever A, Singh G, Peters Haugrud AR, Running KLD, Seneviratne S, Zhang Z, Shi G, Bassi FM, Maccaferri M, Cattivelli L, Tuberosa R, Friesen TL, Liu Z, Xu SS, Faris JD (2023) Association mapping of resistance to tan spot in the Global Durum Panel. https://doi.org/10.1094/PHYTO-02-23-0043-R . Phytopathology PHYTO-02-23-0043-R Tomas A, Bockus WW (1987) Cultivar-specific toxicity of culture filtrate of Pyrenophora tritici-repentis . Phytopathology 77:1337–1340 Virdi SK, Liu Z, Overlander ME, Zhang Z, Xu SS, Friesen TL, Faris JD (2016) New insights into the roles of host gene-necrotrophic effector interactions in governing susceptibility of durum wheat to tan spot and spetoria nodorum blotch. G3-Genes. Genom Genet 6:4139–4150 Walkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D (2020) Multiple wheat genomes reveal global variation in modern breeding. Nature 588:277–283 Wicker T, Matthews DE, Keller B (2002) TREP: a database for Triticeae repetitive elements. Trends Plant Sci 7:561–562 Wicker T, Sabot F, Hua-Van A et al (2007) A unified classification system for eukaryotic transposable elements. Nat Rev Genet 8:973–982 Wu L, He X, Lozano N, Zhang X, Singh PK (2021) ToxA, a significant virulence factor involved in wheat spot blotch disease, exists in the Mexican population of Bipolaris sorokiniana . Trop Plant Pathol 46:201–206 Zhang Z, Friesen TL, Xu SS, Shi G, Liu Z, Rasmussen JB, Faris JD (2011) Two putatively homoeologous wheat genes mediate recognition of SnTox3 to confer effector-triggered susceptibility to Stagnonospora nodorum . Plant J 65:27–38 Wei B, Despins T, Fernandez MR, Strelkov SE, Ruan Y, Graf R, Aboukhaddour R (2021) Race distribution of Pyrenophora tritici-repentis in relation to ploidy level and susceptibility of durum and winter bread wheat. Can J Plant Pathol 43:582–598. https://doi.org/10.1080/07060661.2020.1870002 Wulff BB, Krattinger SG (2022) The long road to engineering durable disease resistance in wheat. Curr Opin Biotechnol 73:270–275. https://doi.org/10.1016/j.copbio.2021.09.002 Tables Table 1. TE content and distribution in the Tsn1 region defined by markers fcp620 and fcp494 Classification Tsn1-B1 +Cons Tsn1-B1 -Cons Order Superfamily Length (bp) % Length (bp) % Class I elements (Retrotransposons) LTR Copia (RLC) 51,970 15.62 28,937 9.47 Gypsy (RLG) 102,193 30.72 77,540 25.38 Unknown (RLX) 24,026 7.22 26,702 8.74 LINE Unknown (RIX) 14,252 4.28 8,616 2.82 SINE Unknown (RSX) 1,370 0.41 1,003 0.33 Class II elements (DNA Transposons) Unknown (DXX) 119 0.04 0 0.00 Subclass 1 TIR Tc1- Mariner (DTT) 982 0.30 1,653 0.54 hAT (DTA) 159 0.05 0 0.00 Mutator (DTM) 436 0.13 3,271 1.07 PIF-Harbinger (DTH) 1,110 0.33 3,681 1.20 CACTA (DTC) 69,162 20.79 66,043 21.62 Unknown (DTX) 46 0.01 0 0.00 Subclass 2 Helitron (DHH) 1,890 0.57 945 0.31 Others Unknown (XXX) 333 0.10 60 0.02 SSRs 2,210 0.66 2,542 0.83 Table 2. Tsn1 marker primers Marker type Marker name Primer name Primer Sequence a Position of SNP b KASP fcp991 Tsn1-B1_1Ka-FAM Tsn1-B1_1Ka-HEX Tsn1-B1_1Ka-Com GAAGGTGACCAAGTTCATGCTTCTTGTATGGAGCAGCGACTAGG T GAAGGTCGGAGTCAACGGATTTCTTGTATGGAGCAGCGACTAGGG ACTTCCTACTGGTTATGGAATGGTTC 546,766,568 KASP fcp992 Tsn1-B1_2Ka-FAM Tsn1-B1_2Ka-HEX Tsn1-B1_2Ka-Com GAAGGTGACCAAGTTCATGCTCTAGTGCCATCTACCAATCCC C GAAGGTCGGAGTCAACGGATTCTAGTGCCATCTACCAATCCCT TACAGATGTCCAGAACCTTTGAC 546,806,925 STARP fcp993 Tsn1-B1_1St-Tail2 Tsn1-B1_1St-Tail1 Tsn1-B1_1St-Com GACGCAAGTGAGCAGTATGACTCTTGTATGGAGCAGCGACTAAG T GCAACAGGAACCAGCTATGACTCTTGTATGGAGCAGCGACTCGGG ACTTCCTACTGGTTATGGAATGGTTC 546,766,568 STARP fcp994 Tsn1-B1_2St-Tail1 Tsn1-B1_2St-Tail2 Tsn1-B1_2St-Com GCAACAGGAACCAGCTATGACCTAGTGCCATCTACCAATTCC C GACGCAAGTGAGCAGTATGACCTAGTGCCATCTACCAATCTCT TACAGATGTCCAGAACCTTTGAC 546,806,925 a For each marker, the primer targeting the insensitive allele is listed first and the SNP associated with the insensitive allele is underlined. b SNP positions (in bp) are based on the IWGSC RefSeq v1.0 assembly Table 3. Accuracies of correct phenotypic prediction given the marker prediction for KASP markers fcp991 and fcp992 and STARP markers fcp993 and fcp994 in three panels Accuracy predicting insensitive phenotype (%) Accuracy predicting sensitive phenotype (%) panel fcp991 fcp992 fcp993 fcp994 fcp991 fcp992 fcp993 fcp994 HRSW 99.40 99.42 - - 89.77 89.47 - - GDP 100.00 99.71 100.00 99.41 89.7 89.74 90.26 89.10 WW 100.00 99.33 100.00 100.00 94.55 94.50 95.19 95.10 Table 4. Inheritance of ToxA-sensitivity population generation number of sensitive plants number of insensitive plants genetic ratio χ 2 p-value DWRC-0110 × Lebsock F 1 5 0 - - - F 2 55 22 3:1 0.524 0.469 DWRC-1007 × Lebsock F 1 5 0 - - - F 2 93 27 3:1 0.400 0.527 DWRC-0110 × DWRC-1007 F 1 0 6 - - - Supplementary Files Tsn1Runningetal.SupplementaryFigure.docx Tsn1Runningetal.SupplementaryMethods.docx Tsn1Runningetal.SupplementaryTables.xlsx Cite Share Download PDF Status: Published Journal Publication published 28 Jun, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted Editorial decision: Accept 01 May, 2025 Reviewers agreed at journal 16 Apr, 2025 Reviewers invited by journal 16 Apr, 2025 Editor assigned by journal 15 Apr, 2025 First submitted to journal 15 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5953910","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":443739321,"identity":"e0c2378b-fae8-4416-b2de-9d56cfae1e15","order_by":0,"name":"Katherine L.D. Running","email":"","orcid":"","institution":"North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Katherine","middleName":"L.D.","lastName":"Running","suffix":""},{"id":443739322,"identity":"f7c2c32d-ffce-4253-9238-bd09c909d207","order_by":1,"name":"Krishna Acharya","email":"","orcid":"","institution":"North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Krishna","middleName":"","lastName":"Acharya","suffix":""},{"id":443739323,"identity":"89bd9130-ef58-4dcd-a60d-354dd13ec485","order_by":2,"name":"Tiana M. Roth","email":"","orcid":"","institution":"North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Tiana","middleName":"M.","lastName":"Roth","suffix":""},{"id":443739324,"identity":"431c80b6-c31a-4339-b131-95cbf712fd5e","order_by":3,"name":"Gurminder Singh","email":"","orcid":"","institution":"North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Gurminder","middleName":"","lastName":"Singh","suffix":""},{"id":443739325,"identity":"3db55cc3-fe78-468e-94c8-f2af5dab5222","order_by":4,"name":"Agnes Szabo-Hever","email":"","orcid":"","institution":"North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Agnes","middleName":"","lastName":"Szabo-Hever","suffix":""},{"id":443739326,"identity":"c9d106df-93d4-4c48-8002-bc638b0fddde","order_by":5,"name":"Amanda R. Peters Haugrud","email":"","orcid":"","institution":"USDA-ARS Plains Area","correspondingAuthor":false,"prefix":"","firstName":"Amanda","middleName":"R. Peters","lastName":"Haugrud","suffix":""},{"id":443739327,"identity":"e123e780-f25b-49c8-a1d9-3e7d392a11f2","order_by":6,"name":"Jason D. Fiedler","email":"","orcid":"","institution":"USDA-ARS Plains Area","correspondingAuthor":false,"prefix":"","firstName":"Jason","middleName":"D.","lastName":"Fiedler","suffix":""},{"id":443739328,"identity":"01adbf8c-1492-4405-b5e4-30844b7e1057","order_by":7,"name":"Timothy L. Friesen","email":"","orcid":"","institution":"USDA-ARS Plains Area","correspondingAuthor":false,"prefix":"","firstName":"Timothy","middleName":"L.","lastName":"Friesen","suffix":""},{"id":443739329,"identity":"b9b88170-f5fb-4235-bb28-478b17699a3b","order_by":8,"name":"Justin Faris","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBACxgYgkcDAwA9mfoAKENLC2ADUIgmiGWcQowVmkSSIYOYhRgvzjPTnDx7uYJDgn324+bNtW51sfwP7xcc8+KyYkWPYkHiGQULiXGKbdG7bYeMZB3iKjQloYWxIbGOoYzjD2Mac23YgseEAT5rkDLxa0h+CtEjIn2Fs/mzZVpc4n7CWBEOwFoMzjA3SQIsSNxxgPybxAZ+WnjeGMxLbJCQMgQ6T7Dl32HjjYR5mA3xaDNvTH3z82WYjIXeG/fGHH2V1svOOtz98kIBPSwOYkkASYuYxwKOBgUEeixj7A7xaRsEoGAWjYMQBADlCUTXBkljHAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-9653-3287","institution":"USDA-ARS Plains Area","correspondingAuthor":true,"prefix":"","firstName":"Justin","middleName":"","lastName":"Faris","suffix":""}],"badges":[],"createdAt":"2025-02-03 22:25:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5953910/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5953910/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00122-025-04952-6","type":"published","date":"2025-06-28T15:57:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80854137,"identity":"c59bc927-9d61-410f-95b9-f243c1d2a6c7","added_by":"auto","created_at":"2025-04-17 20:13:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":300382,"visible":true,"origin":"","legend":"\u003cp\u003eLeaves of ToxA differential lines and population parents infiltrated with ToxA.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/fb36bf74c392bb3d960096bb.png"},{"id":80853573,"identity":"0771c131-e684-4994-85cb-1a3f85fafb12","added_by":"auto","created_at":"2025-04-17 20:05:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":283822,"visible":true,"origin":"","legend":"\u003cp\u003eStructural comparison of \u003cem\u003eTsn1\u003c/em\u003e region in ToxA-sensitive (\u003cem\u003eTsn1-B1+Cons\u003c/em\u003e) and ToxA-insensitive (\u003cem\u003eTsn1-B1-Cons\u003c/em\u003e) sequences.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/2459d4b7fc873fea2bb7d395.png"},{"id":80853577,"identity":"556ee54b-04b6-4b24-af1a-f7baf2c24c31","added_by":"auto","created_at":"2025-04-17 20:05:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":166431,"visible":true,"origin":"","legend":"\u003cp\u003eToxA sensitivity distributions in the panels.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/44f406cdc8250064952f890c.png"},{"id":80854138,"identity":"6d6e4ba8-5d89-4da7-91f8-230259088a51","added_by":"auto","created_at":"2025-04-17 20:13:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":478834,"visible":true,"origin":"","legend":"\u003cp\u003eEndpoint fluorescence scatter plots for KASP markers \u003cem\u003efcp991 \u003c/em\u003eand \u003cem\u003efcp992 \u003c/em\u003eon the WWP, GDP, and HRSWP.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/bb7d3bb4eb01f53d4f0efe9a.png"},{"id":80854141,"identity":"01c3118f-c107-4019-b8e0-333eeaed7a9d","added_by":"auto","created_at":"2025-04-17 20:13:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":380344,"visible":true,"origin":"","legend":"\u003cp\u003eGene structures of\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eTsn1-B1\u003c/em\u003e haplotypes in ToxA-insensitive lines.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/51e7fe22fa6e4feda7c13011.png"},{"id":80853583,"identity":"433aa1a3-514d-47da-8420-6627622bf4e8","added_by":"auto","created_at":"2025-04-17 20:05:04","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":226861,"visible":true,"origin":"","legend":"\u003cp\u003ePhysical and genetic map of the \u003cem\u003eTsn1-B2\u003c/em\u003e locus.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/c8416d04ed708a34740d05fb.png"},{"id":85686155,"identity":"059d284a-5bdc-4529-b54b-7dab5da4f79c","added_by":"auto","created_at":"2025-06-30 16:03:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2730283,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/1c7c2f88-0257-4540-8056-aa3e5aa8e8bd.pdf"},{"id":80853580,"identity":"7a27dc56-99c4-48d1-9f1b-1807eed553c3","added_by":"auto","created_at":"2025-04-17 20:05:04","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":219825,"visible":true,"origin":"","legend":"","description":"","filename":"Tsn1Runningetal.SupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/de4d968f605d01499126b936.docx"},{"id":80853587,"identity":"5092d656-f8f8-4d4e-aea3-f8da017f5de5","added_by":"auto","created_at":"2025-04-17 20:05:04","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":22994,"visible":true,"origin":"","legend":"","description":"","filename":"Tsn1Runningetal.SupplementaryMethods.docx","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/b38f2fdeb522d0bc7885ef0d.docx"},{"id":80854144,"identity":"73e22c84-069e-4729-a059-e25765ddc599","added_by":"auto","created_at":"2025-04-17 20:13:04","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":169324,"visible":true,"origin":"","legend":"","description":"","filename":"Tsn1Runningetal.SupplementaryTables.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5953910/v1/399df8a8aa597fa1a25751b6.xlsx"}],"financialInterests":"","formattedTitle":"Development of diagnostic markers for the disease susceptibility gene Tsn1 in wheat reveals novel resistance alleles and a new locus required for ToxA sensitivity","fulltext":[{"header":"Key Message","content":"\u003cp\u003eThe wheat gene \u003cem\u003eTsn1\u003c/em\u003e confers susceptibility to tan spot, septoria nodorum blotch, and spot blotch. The markers developed here may be immediately deployed in breeding programs to eliminate \u003cem\u003eTsn1\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eHexaploid common wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L. ssp. \u003cem\u003eaestivum\u003c/em\u003e, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;42, AABBDD genomes) and tetraploid durum wheat (\u003cem\u003eT. turgidum\u003c/em\u003e L. ssp. \u003cem\u003edurum\u003c/em\u003e (Desf.) van Slageren, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;4\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;28, AABB genomes) are two important food crops grown globally. Compatible interactions between wheat and several necrotrophic fungal pathogens rely on the recognition of pathogen-produced molecules known as necrotrophic effectors (NEs) by specific dominant host genes (Faris and Friesen \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Friesen and Faris \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kariyawasam et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e for reviews). These inverse gene-for-gene interactions lead to programmed cell death in the host, which allows the fungi to obtain nutrients and complete their life cycles, leading to susceptibility. The necrotic lesions ultimately reduce the photosynthetic area of leaves and lower yields (Shabeer and Bockus \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). One of these interactions involves the recognition of the NE ToxA by the wheat gene \u003cem\u003eTsn1\u003c/em\u003e, which exists in both common and durum wheat. The \u003cem\u003eTsn1\u003c/em\u003e-ToxA interaction is unique in that \u003cem\u003eToxA\u003c/em\u003e has been identified in three economically important pathogens, \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e (Tomas and Bockus \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Ballance et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1989\u003c/span\u003e), \u003cem\u003eParastagonospora nodorum\u003c/em\u003e (Friesen et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), and \u003cem\u003eBipolaris sorokiniana\u003c/em\u003e (McDonald et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) thereby making the \u003cem\u003eTsn1\u003c/em\u003e gene an important susceptibility factor for the diseases tan spot, septoria nodorum blotch (SNB), and spot blotch. In 2019, these pathogens were estimated to cause global yield losses of 0.9%, 1.64%, and 1.67% (Savary et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These relatively small percentages translate to massive yield losses when applied to global wheat production. In the 2023/2024 marketing year, tan spot, SNB, and spot blotch infections caused estimated yield losses of 16.4, 9.0, and 16.7\u0026nbsp;million tons, which is enough wheat to bake 58.9\u0026nbsp;billion loaves of bread (Shahbandeh \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Wulff and Krattinger \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eToxA was first identified in \u003cem\u003eP. tritici-repentis\u003c/em\u003e where it was found to play a role in the development of the disease tan spot (Tomas and Bockus \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Ballance et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). \u003cem\u003ePtrToxA\u003c/em\u003e has been reported to exist in 83\u0026ndash;100% of isolates, depending on the region where the isolates were collected (Lamari et al. 1998; Antoni et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Moreno et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Abdullah et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wei et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). A \u003cem\u003eToxA\u003c/em\u003e homolog was later identified in \u003cem\u003eP. nodorum\u003c/em\u003e, the causal agent of SNB in wheat, with 99.7% similarity to \u003cem\u003ePtrToxA\u003c/em\u003e (Friesen et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). \u003cem\u003eSnToxA\u003c/em\u003e was present in 40% of \u003cem\u003eP. nodorum\u003c/em\u003e isolates in a global panel, ranging from 6% in isolates collected in China to 97% in isolates collected in Australia (McDonald et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Ptr ToxA and SnToxA were found to be functionally identical in terms of conferring sensitivity in wheat plants containing \u003cem\u003eTsn1\u003c/em\u003e (Liu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The \u003cem\u003eToxA\u003c/em\u003e gene has also been identified in isolates of \u003cem\u003eB. sorokinina\u003c/em\u003e, the causal agent of spot blotch, collected in Australia (McDonald et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), the Unites States (Friesen et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Manan et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), India (Navanthe et al. 2020), and most recently, Mexico (Wu et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) where \u003cem\u003eBsToxA\u003c/em\u003e was present in 10.2\u0026ndash;86.6% of isolates.\u003c/p\u003e \u003cp\u003e \u003cem\u003eToxA\u003c/em\u003e resides in a\u0026thinsp;~\u0026thinsp;14 kb class II transposon called ToxhAT (McDonald et al. 2019), which has been horizontally transferred between \u003cem\u003eP. nodorum\u003c/em\u003e, \u003cem\u003eP. tritici-repentis\u003c/em\u003e, and \u003cem\u003eB. sorokiniana\u003c/em\u003e. Sequence analysis revealed that ToxhAT resides in a larger \u003cem\u003eStarship\u003c/em\u003e transposon (143 kb) named \u0026ldquo;\u003cem\u003eHorizon\u003c/em\u003e\u0026rdquo; in \u003cem\u003ePtr\u003c/em\u003e (Gourlie et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). ToxhAT is also present in \u003cem\u003eHorizon\u003c/em\u003e in \u003cem\u003eP. nodorum\u003c/em\u003e, but in a degraded form (Megan McDonald, personal communication). Recently, ToxhAT was found in the distantly related \u003cem\u003eStarship\u003c/em\u003e transposon (170\u0026ndash;196 kb) \u003cem\u003eSanctuary\u003c/em\u003e, which independently captured ToxhAT (Bucknell and McDonald 2024). ToxhAT remains an active transposon in \u003cem\u003eB. sorokiniana\u003c/em\u003e. It is possible that the \u003cem\u003eStarship\u003c/em\u003e transposons have or will transfer to additional fungal species. ToxA confers a fitness advantage to the fungal pathogens when infecting wheat lines that carry \u003cem\u003eTsn1\u003c/em\u003e (McDonald et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Friesen et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eTsn1\u003c/em\u003e contains nucleotide binding (NB), leucine\u003cem\u003e-\u003c/em\u003erich repeat (LRR), and protein kinase (PK) domains (Faris et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Amplification of the \u003cem\u003eTsn1-\u003c/em\u003especific marker \u003cem\u003efcp623\u003c/em\u003e from 386 \u003cem\u003eTriticum\u003c/em\u003e accessions revealed that the gene was only present in ToxA-sensitive cultivars, and nearly all the ToxA-insensitive cultivars were lacking a \u003cem\u003eTsn1\u003c/em\u003e allele. The presence/absence variation of \u003cem\u003eTsn1\u003c/em\u003e rendered all gene-specific markers dominant. Flanking codominant markers that delineated \u003cem\u003eTsn1\u003c/em\u003e to 351 kb were designed based on the sequenced bacterial artificial chromosome contig developed in the durum cultivar Langdon (Faris et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The \u003cem\u003eTsn1\u003c/em\u003e region has been identified as a recombination hot spot (Faris et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), which may result in a high rate of linkage disequilibrium decay and reduce marker-trait associations in natural populations. Additionally, these codominant markers targeted microsatellites and were therefore not as amenable to high throughput genotyping (HTG) platforms as digital single nucleotide polymorphism (SNP) assays, such as Kompetitive Allele Specific PCR (KASP) markers.\u003c/p\u003e \u003cp\u003eGiven that \u003cem\u003eTsn1\u003c/em\u003e confers susceptibility to multiple wheat pathogens, it is imperative \u003cem\u003eTsn1\u003c/em\u003e be selectively eliminated from wheat breeding lines. Here, we conducted a thorough structural analysis of the \u003cem\u003eTsn1\u003c/em\u003e genomic region, characterizing gene and transposable element (TE) content, and identified syntenic regions in lines with and without \u003cem\u003eTsn1\u003c/em\u003e. We designed high throughput diagnostic SNP markers and validated them on hard red spring wheat, durum, and winter wheat panels, demonstrating their usefulness in marker-assisted elimination of \u003cem\u003eTsn1\u003c/em\u003e. We also discovered novel ToxA-insensitive \u003cem\u003etsn1b\u003c/em\u003e haplotypes and identified and mapped a new genomic region associated with ToxA-sensitivity. Given the presence of multiple ToxA-sensitivity genes in the B subgenome, we propose the first locus mapped, \u003cem\u003eTsn1\u003c/em\u003e, be renamed \u003cem\u003eTsn1-B1\u003c/em\u003e and the second locus, mapped here, be termed \u003cem\u003eTsn1-B2\u003c/em\u003e. For clarity, the proposed names \u003cem\u003eTsn1-B1\u003c/em\u003e and \u003cem\u003eTsn1-B2\u003c/em\u003e will be used henceforth.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003ePlant materials\u003c/p\u003e\n\u003cp\u003eFifteen sequenced hexaploid and three sequenced tetraploid wheat lines were evaluated for ToxA sensitivity (Supplementary Table 1) and used for synteny analysis and/or marker development. Three panels, including the Global Durum Panel (GDP), a winter wheat panel (WWP), and a hard red spring wheat panel (HRSWP), were evaluated for ToxA sensitivity and genotyped with the designed markers to assess their diagnostic capability (Supplementary Table 2). The GDP, WWP, and HRSWP consist of 513, 263, and 812 lines, respectively, and were originally described and phenotyped by Szabo-Hever et al. (2023, 2024) and Peters Haugrud et al. (2023). Here, the GDP has three additional lines, DWRC-801, DWRC-1319, and DWRC-1505, which are described in Supplementary Table 2. One line, Ankar II, was dropped from the WWP due to heterogeneity. Line PI 532255 (HRSW-717) was recently reported to be a durum wheat, and as such, was dropped from the HRSWP (https://npgsweb.ars-grin.gov/).\u003c/p\u003e\n\u003cp\u003eTwo lines from the GDP, DWRC-0110 and DWRC-1007, were selected for further genetic analysis of ToxA sensitivity. Both durum lines were crossed to the North Dakota durum cultivar Lebsock and to each other. F\u003csub\u003e1\u003c/sub\u003e plants from the following crosses were evaluated for ToxA sensitivity: DWRC-0110 \u0026times; Lebsock, DWRC-1007 \u0026times; Lebsock, and DWRC-0110 \u0026times; DWRC-1007. F\u003csub\u003e2\u0026nbsp;\u003c/sub\u003eplants from the DWRC-0110 \u0026times; Lebsock and DWRC-1007 \u0026times; Lebsock populations were evaluated for ToxA-sensitivity and DNA was collected from individual plants for use in bulked segregant analysis (BSA), and in the case of DWRC-1007 \u0026times; Lebsock, low resolution mapping.\u003c/p\u003e\n\u003cp id=\"_Toc106805946\"\u003eToxA production and infiltration\u003c/p\u003e\n\u003cp\u003eHRSWP, GDP, and WWP phenotypic data were originally published in Szabo-Hever et al. (2023, 2024), and Peters Haugrud et al. (2023). Preparation of cultures and infiltration methods for the sequenced wheat lines in Supplementary Table 1 and the re-evaluation of several others were conducted as described by Szabo-Hever et al. (2023). Plants were scored on a 0-3 scale at 5 days after infiltration, according to Seneviratne et al. (2024). A minimum of four plants were evaluated per line. The same growing conditions were used for evaluation of the DWRC-0110 \u0026times; Lebsock and DWRC-1007 \u0026times; Lebsock plants as described by Szabo-Hever et al. (2023), except one plant was planted per cone. ToxA-insensitive F\u003csub\u003e2\u003c/sub\u003e plants were infiltrated a second time to confirm insensitivity.\u0026nbsp;\u003c/p\u003e\n\u003cp id=\"_Toc106805947\"\u003eDNA extraction and gene sequencing\u003c/p\u003e\n\u003cp\u003eDNA from the three panels, \u0026nbsp;DWRC-0110 \u0026times; Lebsock and DWRC-1007 \u0026times; Lebsock F\u003csub\u003e2\u003c/sub\u003e plants, and lines with apparent double crossover was extracted, quantified, and normalized as described in Supplementary M1. \u003cem\u003eTsn1-B1\u003c/em\u003e gene sequences were amplified via PCR in seven fragments using the primers reported in Faris et al. (2010) from lines that were insensitive to ToxA, despite carrying a \u003cem\u003eTsn1-B1\u003c/em\u003e allele. Sequencing was completed over all coding sequence and splice-sites, but not all introns were sequenced due to the size of intron 4 (~3.4 kb). All PCR reactions were 25 \u0026micro;L and consisted of 20 ng/\u0026mu;L of template DNA, 1\u0026times; NH\u003csub\u003e4\u003c/sub\u003e Reaction Buffer (Meridian Bioscience, Cincinnati, OH) (,2.0 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM dNTPs, 0.4 \u0026micro;M of each primer, and 0.1U/\u0026mu;L of BioTaq DNA polymerase (Meridian Bioscience, Cincinnati, OH) . All reactions had an initial denaturation at 94\u0026deg;C for 5 min, followed by 35 cycles at 94\u0026deg;C for 30 s, a 30s annealing step starting at 65\u0026deg;C that decreased by 0.2\u0026deg;C each cycle, and a 72\u0026deg;C extension for 2.5 min, followed by a final extension at 72\u0026deg;C for 7 min. To confirm amplification, 7 \u0026micro;L of each PCR product was electrophoresed on a 1% agarose gel. The remaining PCR product was purified with ExoSAP IT (Thermo Fisher Scientific, Waltham, Massachusetts, USA). PCR products were sequenced with amplification primers reported in Faris et al. (2010) and with internal primers reported in Supplementary Table 3 via Sanger sequencing (Eurofins Genomics, Louisville, KY, USA). Gene sequences were assembled for each line in CodonCode Aligner 9.0.2 (CodonCode Corporation, Centerville, Massachusetts, USA), and point mutations were identified by comparative sequence analysis with the reported functional \u003cem\u003eTsn1-B1\u003c/em\u003e allele in Langdon (Genbank ID: GU259618.1, Faris et al. 2010).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRNA extraction and sequencing\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from ToxA-insensitive lines with wildtype \u003cem\u003eTsn1-B1\u003c/em\u003e alleles and Langdon (Supplementary Table 4) using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with on-column DNase digestion for 20 minutes. cDNA was synthesized from 3 \u0026micro;g RNA using the SuperScript IV First-Strand Synthesis system (Thermo Fisher Scientific, Waltham, MA). First, cDNA samples were tested for DNA contamination via PCR with primers GAPDH.F152 and GAPDH.R338 (Shi et al. 2016). PCR primers used to amplify \u003cem\u003eTsn1-B1\u003c/em\u003e cDNA were reported in Faris et al. (2010) (Supplementary Table 5). To confirm \u003cem\u003eTsn1-B1\u003c/em\u003e expression, cDNA fragment 4 was amplified via PCR with 2 \u0026micro;L template cDNA per 10 \u0026micro;L reaction using the PCR reaction components and conditions described above with a modified annealing temperature of 62\u0026deg;C and an extension time of 1.5 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn lines that had no amplification of fragment 4 and two durum lines (DWRC-1007 and DWRC-0110), PCR was completed with all amplification primers using 3.8 \u0026micro;L of template cDNA per 30 \u0026micro;L reaction. PCR cycling conditions were as described above, but with optimized annealing temperatures as reported in Supplementary Table 5. Amplification of PCR products was confirmed and cleaned-up as described above. Samples were diluted to 1 \u0026micro;L PCR product per 12 \u0026micro;L sequencing reaction and sequenced via Sanger sequencing with the amplification primers (Eurofins Genomics, Louisville, KY, USA).\u003c/p\u003e\n\u003cp id=\"_Toc106805948\"\u003eSynteny analysis\u003c/p\u003e\n\u003cp\u003eSynteny analysis focused on the area between the previously reported flanking markers \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e (Faris et al. 2010). Ten hexaploid lines with complete pseudomolecule assemblies were used for the analysis (Supplementary Table 1) (IWGSC 2018; Walkowiak et al. 2020). Pseudomolecule assemblies were acquired from the Leibniz Institute of Plant Genetics and Crop Plant Research (https://wheat.ipk-gatersleben.de/), but the assemblies are now available on GrainGenes (https://wheat.pw.usda.gov/GG3/). The positions of \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e were identified by conducting BLASTn searches of the amplified marker sequences in the Chinese Spring RefSeq v1.0 (IWGSC 2018) against the hexaploid assemblies. The region between \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e was extracted from chromosome 5B of each assembly using samtools (Li et al. 2009). Lines SY Mattis and ArinaLrFor have a 5B:7B chromosomal translocation (Walkowiak et al. 2020), therefore the \u003cem\u003eTsn1-B1\u003c/em\u003e region was extracted from chromosome 7B of these two lines.\u003c/p\u003e\n\u003cp\u003eSynteny within the extracted genomic region of ToxA-sensitive and ToxA-insensitive lines was identified with Smash ++ (Hosseini et al. 2020) to determine the plausibility of constructing consensus ToxA-sensitive and -insensitive sequences. The parameters used were \u003cem\u003ek\u003c/em\u003e-mer size = 14, number of substitutions in substitution-tolerant Markov model (STMM) = 5, and a minimum segment size of 300 bp. Multiple sequence alignments of the ToxA-sensitive and ToxA-insensitive sequences were generated using K-align 3 (Lassmann 2020), and consensus sensitive and insensitive sequences (\u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons) were generated using Emboss Cons 6.6.0.0 (Rice et al. 2000). Release 19 of the nonredundant Transposable Element Platform (TREP) nucleotide sequence database was used to mask the consensus sequences with RepeatMasker v 4.1.0 (Wicker et al. 2002; Smit et al. 2013-2015). Transposable element (TE) content and distribution was assessed in the consensus sequences by TE class as defined by Wicker et al. (2007), with the percentage of each class being the ratio of the length of the sequences that matched to a TE class and the total length of the consensus sequence (Table 1). Synteny between the masked consensus sequences was identified with Smash ++ using the same parameters as were used for initial synteny analysis. GFF files were constructed for genes, markers, TE, and syntenic regions in \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons and visualized in Geneious Prime 2021.0.3 (https://www.geneious.com) to \u0026nbsp;identify syntenic low-copy DNA regions that could be targeted for marker development.\u003c/p\u003e\n\u003cp id=\"_Toc106805950\"\u003eGene-based haplotype analysis\u003c/p\u003e\n\u003cp\u003eBecause the genomic region between markers \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e was too large (351 kb) to reasonably conduct a nucleotide-based haplotype analysis, a gene-based comparison was conducted to assess structural haplotypes in the \u003cem\u003eTsn1-B1\u003c/em\u003e region in the sequenced hexaploid lines with pseudomolecule assemblies. Given the level of sequence conservation in the \u003cem\u003eTsn1-B1\u003c/em\u003e region in hexaploid \u003cem\u003eTsn1-B1+\u003c/em\u003e and \u003cem\u003eTsn1-B1-\u003c/em\u003e lines (see results), genes were identified in a representative insensitive sequenced line (Chinese Spring) and a sensitive sequenced line (CDC Landmark). Because Chinese Spring does not have \u003cem\u003eTsn1-B1\u003c/em\u003e and may be missing additional genes in the \u003cem\u003eTsn1-B1\u003c/em\u003e region, genes were annotated in the \u003cem\u003eTsn1-B1\u003c/em\u003e region of the ToxA-sensitive line CDC Landmark using the TriAnott pipeline (Leroy et al. 2012). Protein domains were identified using Pfam (http://pfam.xfam.org/, accessed April 20\u003csup\u003eth\u003c/sup\u003e, 2020). Genes smaller than 500 bp or without Pfam matches with an e-value of at least 1\u0026times;10\u003csup\u003e-5\u003c/sup\u003e were considered pseudogenes. Predicted open reading frames with homology to the polypeptide of LTR copia-type domain were considered TEs. The annotated genes in the \u003cem\u003eTsn1-B1\u003c/em\u003e region of the durum reference genome Svevo Rel. 1.0 and the wild emmer (\u003cem\u003eT. turgidum\u003c/em\u003e ssp. \u003cem\u003edicoccoides\u003c/em\u003e (K\u0026ouml;rn. ex Asch. \u0026amp; Graebn.) Thell., (2\u003cem\u003en\u003c/em\u003e = 4\u003cem\u003ex\u003c/em\u003e = 28, AABB genomes)\u0026nbsp;reference genome Zavitan WEWSeq v1.0 were identified on Ensembl Plants (https://plants.ensembl.org) in case there were tetraploid-specific genes that did not show up in the Chinese Spring or CDC Landmark annotations (Maccaferri et al 2019; Avni et al. 2017; IWGSC 2018; Walkowiak et al. 2020). In December 2021, a \u003cem\u003ede novo\u003c/em\u003e annotation of CDC Landmark by Plant Genomes and System Biology and the Earlham Institute was published on Ensembl plants (release 52). The genes annotated in CDC Landmark using the TriAnnott pipeline were compared to those in the \u003cem\u003ede novo\u003c/em\u003e annotation (PGSBv2.1). The presence and position of the annotated genes were identified in the genome assemblies of eight ToxA-sensitive and four ToxA-insensitive wheat lines by conducting BLASTn searches of all the identified annotations against the pseudomolecule level assemblies (Supplementary Table 6). While the presence of these genes could be confirmed in scaffold-level assemblies, the presence of other potential genes not identified in the set of annotated genes could not be ruled out. Therefore, lines with scaffold-level assemblies were excluded from gene-based haplotype analysis.\u003c/p\u003e\n\u003cp id=\"_Toc106805951\"\u003e\u003cem\u003eTsn1-B1\u003c/em\u003e marker development\u003c/p\u003e\n\u003cp\u003eTo identify diagnostic markers for \u003cem\u003eTsn1-B1\u003c/em\u003e, the alignment of the repeat-masked \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons sequences was used to identify SNPs that could be targeted for marker development. Contextual SNP sequences were used in BLASTn searches against additional hexaploid scaffold level assemblies and \u003cem\u003eT. turgidum\u003c/em\u003e assemblies to determine their SNP alleles (Supplementary Table 1). SNPs that did not consistently differentiate ToxA-sensitive from ToxA-insensitive lines were eliminated from consideration.\u003c/p\u003e\n\u003cp\u003eNine semi-thermal asymmetric reverse PCR (STARP) markers were designed according to the recommended parameters reported in Long et al. (2017), with six targeting the distal side of \u003cem\u003eTsn1-B1\u003c/em\u003e and three targeting the proximal side. The STARP markers were first amplified via PCR from sequenced lines with known \u003cem\u003eTsn1-B1\u003c/em\u003e alleles as described in Long et al. (2017) and electrophoresed on 6% nondenaturing polyacrylamide gels. Gels were stained with Gelred\u0026trade; nucleic acid stain (Biotium Corporate, Hayward, CA) and scanned with a Typhoon 9500 variable mode imager (GE healthcare Biosciences, Waukesha, WI). This procedure was also used to evaluate the STARP markers on the WWP and GDP.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Two selected STARP markers flanking \u003cem\u003eTsn1\u003c/em\u003e were converted to KASP by dropping the induced mutation in the STARP forward primer and replacing the STARP tails with KASP fluorescent tails. No adjustments were made to the reverse primer. STARP and KASP markers were evaluated as digital assays by the USDA-ARS small grains genotyping Lab in Fargo, ND. Only the digital KASP assays were evaluated on the HRSWP due to its size. Primer sequences for all four markers are reported in Table 2. For each marker, the accuracy of the phenotypic prediction was calculated using all lines with homozygous alleles for that marker. Prediction accuracies were calculated separately for each marker in the three panels (Table 3).\u003c/p\u003e\n\u003cp\u003eAssessing recombination events\u003c/p\u003e\n\u003cp\u003eApparent crossovers were identified in the panels using lines with homozygous alleles for markers \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e. To identify apparent double crossovers, the reaction to ToxA was used to infer the allelic state of \u003cem\u003eTsn1-B1\u0026nbsp;\u003c/em\u003ein each line, i.e. sensitive to ToxA = dominant \u003cem\u003eTsn1-B1\u003c/em\u003e allele; insensitive to ToxA = recessive or absent \u003cem\u003etsn1-B1\u003c/em\u003e allele. Lines that were ToxA-insensitive but had marker genotypes that would indicate a ToxA-sensitive phenotype were selected for further analysis. First, additional replicates of each line were planted. Each plant was infiltrated with ToxA and scored independently. If the phenotype segregated, indicating seed mixture, the line was excluded from further analysis. DNA was extracted from apparent double crossover lines and a \u003cem\u003eTsn1-B1\u003c/em\u003e gene fragment was amplified to further confirm the presence or absence of a \u003cem\u003eTsn1-B1\u003c/em\u003e DNA sequence.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGenetic evaluation of ToxA-insensitivity in \u003cem\u003eTsn1-B1\u003c/em\u003e+ lines\u003c/p\u003e\n\u003cp\u003eA two-tailed Chi-squared test was used to determine if the DWRC-0110 \u0026times; Lebsock and DWRC-1007 \u0026times; Lebsock F\u003csub\u003e2\u003c/sub\u003e phenotypic data fit the expected 3:1 ratio. BSA was conducted using four bulks from each F\u003csub\u003e2\u003c/sub\u003e population, two sensitive and insensitive bulks, each consisting of eight F\u003csub\u003e2\u003c/sub\u003e plants.. The bulks and parents were genotyped with the 90K iSelect SNP genotyping array (Wang et al. 2014) at the USDA-ARS small grains genotyping lab in Fargo, ND, USA. Clustering of SNPs was analyzed using GenomeStudio 2.0.5 (Illumina, San Diego, CA). Initial BSA of SNPs was conducted by calculating the absolute value of the difference between the theta values of the sensitive and insensitive bulks for each SNP. SNPs were then filtered based on the calculated values being greater than 0.5 to ensure that only SNPs with clear cluster differentiation were being evaluated. Each SNP was visually inspected to ensure that the sensitive and insensitive parents had alternate alleles, the insensitive parent was clustering with the insensitive bulks, and the sensitive bulks were either heterozygous or clustering with the sensitive parents. The probe sequences of SNPs associated with ToxA-sensitivity identified by BSA were used in a BLASTn search of the Svevo Rel. 2.0 assembly (https://wheat.pw.usda.gov/blast/) to determine their genomic position.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLow-resolution mapping was conducted using 121 DWRC-1007 \u0026times; Lebsock F\u003csub\u003e2\u003c/sub\u003e plants. KASP were designed for the SNPs identified in BSA using PolyMarker (Ramirez-Gonzalez et al. 2015) and the Svevo Rel. 1.0 assembly (Maccaferri et al. 2019). Primer3 was used to check the annealing temperature, self-complementarity, and self 3\u0026rsquo; complementarity of primer sequences. Sequences were used in BLASTn searches of the Svevo Rel. 1.0 assembly (Maccaferri et al. 2019) to ensure target specificity. Primer sequences that were not specific or did not meet the desired conditions were manually redesigned using the probe sequences and Svevo Rel. 1.0 assembly. Primer sequences are available in Supplementary Table 7. KASP markers were amplified and scanned on the CFX384 Real-Time System (Bio-Rad, Hercules, CA). Bio-Rad CFX Manager (Bio-Rad, Hercules, CA) was used to analyze KASP amplification and define alleles. The linkage map was assembled using MapDisto v2.1.8.7 (Lorieux 2012) as described by Acharya et al. (2024) and anchored to a physical map constructed based on the physical locations of the SNPs in Svevo Rel. 2.0.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eDevelopment and comparison of \u003cem\u003eTsn1-B1\u003c/em\u003e+ and \u003cem\u003eTsn1-B1\u003c/em\u003e- consensus sequences\u003c/p\u003e\n\u003cp\u003eWheat lines carrying \u003cem\u003eTsn1-B1\u003c/em\u003e exhibit strong necrotic reactions when infiltrated with ToxA, while lines with no \u003cem\u003eTsn1-B1\u003c/em\u003e allele or with a non-functional \u003cem\u003etsn1-B1\u003c/em\u003e allele show an insensitive reaction (Figure 1). Among the 18 sequenced wheat lines, six (33%) were sensitive and 12 (66%) were insensitive to ToxA. The ToxA-insensitive lines included the hexaploids ArinaLrFor, CDC Stanley, Chinese Spring, Julius, Mace, SY Mattis, Claire, Robigus, and Weebil, and the tetraploids Kronos, Svevo, and Zavitan (Supplementary Table 1). The \u003cem\u003eTsn1-B1\u003c/em\u003e region was defined as the sequence flanked by markers \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e. Within the ToxA-insensitive hexaploid lines, the length of the \u003cem\u003eTsn1-B1\u003c/em\u003e region ranged from 281.7 to 298.4 kb with an average length of 288.4 kb. The size of the \u003cem\u003eTsn1-B1\u003c/em\u003e region in the ToxA-insensitive durum cultivar Svevo was 290.8 kb, which was within the range identified in the ToxA-insensitive hexaploid lines. The length of the \u003cem\u003eTsn1-B1\u003c/em\u003e region in the ToxA-insensitive wild emmer Zavitan genome was slightly smaller at 275.7 kb.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eTsn1-B1\u003c/em\u003e region was larger in the ToxA-sensitive lines (CDC Landmark, Jagger, LongReach Lancer, Norin61, Cadenza, and Paragon), which were all hexaploid, where it ranged from 328.6 to 448.4 kb . Among these, Jagger had the smallest \u003cem\u003eTsn1-B1\u003c/em\u003e region at 328.6 kb with the others ranging from 444.9 to 448.4 kb, varying by just 3.5 kb. The smaller \u003cem\u003eTsn1-B1\u003c/em\u003e region in Jagger reduced the average \u003cem\u003eTsn1-B1\u003c/em\u003e region to 416.8 kb for the ToxA-sensitive lines. Overall, there was a substantial difference in the size of the \u003cem\u003eTsn1-B1\u003c/em\u003e region between sensitive and insensitive lines with the \u003cem\u003eTsn1-B1\u003c/em\u003e region being on average 128 kb larger in the ToxA-sensitive lines, i.e. lines that contained \u003cem\u003eTsn1-B1\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA single syntenic block between the sequences of ToxA-insensitive lines was identified. Similarly, a single syntenic block between the sequences of ToxA-sensitive lines was also identified. No structural rearrangements were identified within either the sensitive or insensitive groups. Given this finding, consensus sequences were created for each of the two sensitivity classes, and they are hereafter referred to as \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons.\u003c/p\u003e\n\u003cp\u003eTen syntenic regions ranging in length from approximately 2.5-15.5 kb were identified in \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons, representing low-copy DNA that did not display presence/absence variation between sequences. STARP (\u003cem\u003efcp993\u003c/em\u003e and \u003cem\u003efcp994\u003c/em\u003e) and KASP (\u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e) markers were designed flanking \u003cem\u003eTsn1-B1\u003c/em\u003e in the syntenic regions nearest the gene (Figure 2). The region between \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e was 40.4 kb and 41.5 kb in the Chinese Spring RefSeq v1.0 assembly (IWGSC 2018) and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons, respectively. In \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons, \u003cem\u003efcp991\u0026nbsp;\u003c/em\u003eand \u003cem\u003efcp992\u0026nbsp;\u003c/em\u003ewere 134.8 kb apart and 77.2 kb and 57.5 kb on either side of \u003cem\u003eTsn1-B1.\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons segment (between markers \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e) was 305.5 kb, and 45.44% was identified as repetitive elements. \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons was larger with a length of 332.7 kb and contained 46.30% repetitive elements. In both \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons, gypsy retrotransposons were the largest TE superfamily, representing 30.72% and 25.38% of the total length, respectively (Table 1). There were fewer Copia elements in the \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons compared to the \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons. However, in general, the TE makeup between \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e was relatively similar in \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOnly two gene-based haplotypes were identified in the hexaploid pseudomolecule-level assemblies. Haplotype 1 was common among ToxA-insensitive lines and Haplotype 2 was common among ToxA-sensitive lines (Supplementary Table 6). Therefore, the consensus sequences \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons and \u003cem\u003eTsn1-B1\u003c/em\u003e+Cons represent the two gene-based haplotypes, and the positions of the genes in the consensus sequences are displayed in Figure 2. No tetraploid-specific genes were identified.\u003c/p\u003e\n\u003cp\u003eFour genes were common among the sensitive and insensitive pseudomolecule-level assemblies (Supplementary Table 6). One of these was a wall-associated kinase (\u003cem\u003eTraesCS5B02G368200\u003c/em\u003e, WAK), which contained the sequence for marker \u003cem\u003efcp620\u003c/em\u003e and resided at the very proximal end of genomic region under investigation. The other three genes common to both haplotypes were in the distal region of the segment between \u003cem\u003efcp992\u003c/em\u003e and \u003cem\u003efcp394\u003c/em\u003e and consisted of genes that encode an RNA recognition motif domain (\u003cem\u003eTraesCS5B02G368400\u003c/em\u003e, RNP), a potassium transporter (\u003cem\u003eTraesCS5B02G368500\u003c/em\u003e, PT), and a palmitoyltransferase (\u003cem\u003eTraesCS5B02G368600\u003c/em\u003e, PLTF). Within Haplotype 1, a gene encoding cathepsin propeptide inhibitor and peptidase domains (\u003cem\u003eTraesCS5B02G368300\u003c/em\u003e, CPI-Peptidase) was identified between \u003cem\u003efcp620\u003c/em\u003e and \u003cem\u003efcp991\u003c/em\u003e. Two unique genes were identified in Haplotype 2. The first unique gene in Haplotype 2 encoded proteins with endonuclease/exonuclease/phosphatase family, DUF4283, and zinc knuckle protein domains according to the TriAnnot gene prediction. However, the PGSBv2.1 annotation of this gene (\u003cem\u003eTraesLDM5B03G02955820\u003c/em\u003e) indicated that the sequence containing the endonuclease/exonuclease/phosphatase family protein domains was not part of the open reading frame that coded for the DUF4283 and zinc knuckle domains (DUF-ZK). The second unique gene to Haplotype 2 was \u003cem\u003eTsn1-B1\u003c/em\u003e.\u003c/p\u003e\n\u003cp id=\"_Toc106805955\"\u003eMarker validation\u003c/p\u003e\n\u003cp\u003eThe HRSWP, GDP, and WWP, which were infiltrated with ToxA in Szabo-Hever et al. (2023, 2024), and Peters Haugrud et al. (2023), were used to validate markers \u003cem\u003efcp991,\u003c/em\u003e \u003cem\u003efcp992\u003c/em\u003e, \u003cem\u003efcp993\u003c/em\u003e, and \u003cem\u003efcp994\u003c/em\u003e. For the HRSWP, GDP, and WWP, 52.1%, 29.0%, and 38.4% of the lines were sensitive to ToxA, respectively (Figure 3, Supplementary Table 2). The distribution of phenotypic scores was bimodal in both the panels and the sequenced lines, with most of the lines having a score of 0-0.49 or 2.5-3.0.\u003c/p\u003e\n\u003cp\u003eKASP markers \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e were used to genotype the WWP, GDP, and HRSWP (Figure 4). In all panels, clear clusters formed, representing the \u003cem\u003eTsn1-B1\u003c/em\u003e+ and \u003cem\u003eTsn1-B1\u003c/em\u003e- alleles. When the KASP markers \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u0026nbsp;\u003c/em\u003epredicted a line would be insensitive, it was true in 99.32-100% of cases in all three panels (Table 4). Each panel contained a few lines where the marker alleles predicted the line to be sensitive to ToxA, but the line was experimentally found to be insensitive. Because of this, the accuracy predicting when a line would be sensitive to ToxA was lower (89.47-95.55%).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSTARP markers \u003cem\u003efcp993\u003c/em\u003e and \u003cem\u003efcp994\u003c/em\u003e were used to genotype the GDP and WWP and produced strong bands that were easy to discriminate (Supplementary Figure 1). They were 99.41-100% accurate when predicting the insensitive phenotype and 89.10-95.19% accurate when predicting the sensitive phenotype, similar to the accuracies found using the KASP markers (Table 4). As the KASP markers were run on all three panels, further analysis focused on the alleles determined by the KASP markers.\u003c/p\u003e\n\u003cp\u003eIn total, 1,531 lines had homozygous alleles for both \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e. When ToxA sensitivity was treated as a marker for \u003cem\u003eTsn1-B1\u003c/em\u003e, there was no recombination detected between the markers and \u003cem\u003eTsn1-B1\u003c/em\u003e for 94.97% of those lines. Of the remaining lines, six had a single crossover between \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003eTsn1-B1\u003c/em\u003e, nine had single crossovers between \u003cem\u003efcp992\u003c/em\u003e and \u003cem\u003eTsn1-B1\u003c/em\u003e, and 62 had apparent double crossover events, with a crossover occurring between \u003cem\u003eTsn1-B1\u003c/em\u003e and both flanking markers. Given the preponderance of apparent double crossovers and that 96.77% of the apparent double crossovers were insensitive to ToxA, a \u003cem\u003eTsn1-B1\u003c/em\u003e internal marker (\u003cem\u003efcp623\u003c/em\u003e or \u003cem\u003eTsn1-B1\u003c/em\u003e sequencing primer pair) was used to confirm double crossover events. A true double crossover event between \u003cem\u003efcp991 and fcp992\u0026nbsp;\u003c/em\u003eresulting in marker alleles predictive of sensitivity, but showing an insensitive phenotype, would mean that the line would not have a \u003cem\u003eTsn1-B1\u003c/em\u003e allele, and therefore \u003cem\u003efcp623\u0026nbsp;\u003c/em\u003eand/or \u003cem\u003eTsn1-B1\u003c/em\u003e sequencing reactions would fail to amplify any fragment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn sixty-two lines with apparent double crossovers, only two were true double crossovers. The two lines with true double crossover events were both sensitive, with flanking markers predicting that the line should be insensitive. The remaining sixty lines were all insensitive with flanking markers predicting they should be sensitive, but analysis with marker \u003cem\u003efcp623\u0026nbsp;\u003c/em\u003eora\u003cem\u003e\u0026nbsp;Tsn1-B1\u0026nbsp;\u003c/em\u003esequencing primer pair showed that all 60 lines possessed an allele of \u003cem\u003eTsn1-B1\u003c/em\u003e, or at least a fragment of the gene, which suggested they were not true crossovers and that further analysis of the alleles present in these lines was necessary.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIdentification of novel \u003cem\u003etsn1-B1b\u0026nbsp;\u003c/em\u003ehaplotypes\u003c/p\u003e\n\u003cp\u003eTo further investigate the cause for ToxA insensitivity in \u003cem\u003eTsn1-B1+\u0026nbsp;\u003c/em\u003elines, \u003cem\u003eTsn1-B1\u003c/em\u003e was sequenced from the 60 lines that were insensitive to ToxA despite having a \u003cem\u003eTsn1-B1\u003c/em\u003e amplicon. Mutations that altered the coding sequence were found in 63.33% of lines, explaining their insensitivity (Figure 5, Supplementary Table 4). Ten insensitive haplotypes of the insensitive \u003cem\u003eTsn1-B1\u003c/em\u003e allele, \u003cem\u003etsn1-B1b\u003c/em\u003e, were identified and designated \u003cem\u003etsn1-B1b_h1\u0026nbsp;\u003c/em\u003ethrough\u003cem\u003e\u0026nbsp;tsn1-B1b_h10\u003c/em\u003e. Previously, four naturally occurring mutations in \u003cem\u003eTsn1-B1\u003c/em\u003e were reported (Faris et al. 2010), and three of them were observed in this study. The frameshift mutations at 4,616 bp\u0026nbsp;(\u003cem\u003etsn1\u003c/em\u003e\u003cem\u003e-B1\u003c/em\u003e\u003cem\u003eb_h2\u003c/em\u003e) and 6,634 (\u003cem\u003etsn1-B1b_h4\u003c/em\u003e)\u0026nbsp;reported in lines TA2601 and Ching Feng, respectively, were observed here in both the HRSWP and WWP. The nonsense mutation at 9,767 bp (\u003cem\u003etsn1-B1b_h9\u003c/em\u003e) reported in the hexaploid wheat lines Huo Mai, Novo, and Puseas was only identified in the HRSWP. The frameshift \u0026nbsp;at 8,145 bp previously reported in Siu Mak (\u003cem\u003etsn1-B1b_h6)\u003c/em\u003e was not identified in any of the lines sequenced in this study. Six novel \u003cem\u003etsn1-B1b\u0026nbsp;\u003c/em\u003ehaplotypes were identified here with four being missense mutations (\u003cem\u003etsn1-B1b_h1, tsn1-B1b_h5, tsn1-B1b_h7,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;tsn1-B1b_h8\u003c/em\u003e)and two being frameshift mutations (\u003cem\u003etsn1-B1b_h3\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;tsn1-B1b_h10\u003c/em\u003e). Haplotype \u003cem\u003etsn1-B1b_h3\u003c/em\u003e was specific to tetraploid wheat, whereas the other nine mutation haplotypes were specific to hexaploids.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInterestingly, 22 of the 60 lines that were insensitive to ToxA and carried a \u003cem\u003eTsn1-B1\u003c/em\u003e allele had the same gene sequence as ToxA-sensitive lines (\u003cem\u003eTsn1-B1a_h1\u003c/em\u003e, Figure 5, Supplementary Table 4). Amplification of \u003cem\u003eTsn1-B1\u003c/em\u003e cDNA was confirmed in 18 of the 22 lines indicating that \u003cem\u003eTsn1-B1\u0026nbsp;\u003c/em\u003ewas not expressed in four of the lines, which were all from the HRSWP. The remaining 18 lines appeared to have a functional \u003cem\u003eTsn1-B1\u0026nbsp;\u003c/em\u003egene, and we hypothesized that these lines had a mutation in a different gene required in the disease response pathway rendering them insensitive to ToxA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGenetic analysis of ToxA-insensitive lines carrying a functional \u003cem\u003eTsn1-B1\u0026nbsp;\u003c/em\u003egene\u003c/p\u003e\n\u003cp\u003eSeveral crosses were made to test the hypothesis that the ToxA-insensitive lines expressing haplotype \u003cem\u003eTsn1-B1a_h1\u0026nbsp;\u003c/em\u003ecarried a mutation at a second locus necessary for expression of a ToxA-sensitive phenotype. Two ToxA-insensitive lines, DWRC-0110 and DWRC-1007 (Figure 1), were found to express \u003cem\u003eTsn1-B1a_h1\u003c/em\u003e with no mutations or alterations in splicing. DWRC-0110 and DWRC-1007 were crossed to each other for an allelism test and to the ToxA-sensitive durum cultivar Lebsock (Figure 1) for mapping and evaluation of inheritance of ToxA-sensitivity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll F\u003csub\u003e1\u003c/sub\u003e plants from the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock crosses were sensitive to ToxA, indicating that sensitivity was a dominant trait. All F\u003csub\u003e1\u003c/sub\u003e plants from the DWRC-0110 × DWRC-1007 cross were insensitive to ToxA, indicating that they likely shared the same insensitivity locus. Sensitivity in the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F\u003csub\u003e2\u003c/sub\u003e populations fit the expected genetic ratio of 3 sensitive: 1 insensitive, indicating sensitivity was inherited as a dominant monogenic trait in these populations.\u003c/p\u003e\n\u003cp\u003eBecause both parents of the populations carried and expressed \u003cem\u003eTsn1-B1a_h1\u003c/em\u003e, but differed in ToxA sensitivity (Figure 1), we expected ToxA sensitivity to map to another locus. BSA using insensitive and sensitive bulks from the DWRC-0110 × Lebsock and DWRC-1007 × Lebsock F\u003csub\u003e2\u003c/sub\u003e populations identified 12 SNPs associated with ToxA sensitivity in each population (Supplementary Tables 7 and 8). A BLASTn search using the SNP probe sequences revealed that all SNPs resided on the short arm of chromosome 2B in the Svevo Rel. 2.0 assembly, confirming the hypothesis that an additional locus, which we designated \u003cem\u003eTsn1-B2\u003c/em\u003e, was conferring ToxA-sensitivity. In DWRC-0110 × Lebsock, the SNPs were between position 11.36 Mb and 30.5 Mb, and in DWRC-1007 × Lebsock the SNPs were at positions 9.15-30.5 Mb.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLow resolution mapping of \u003cem\u003eTsn1-B2\u003c/em\u003e was conducted using 120 DWRC-1007 × Lebsock F\u003csub\u003e2\u003c/sub\u003e plants. Nine of twelve KASP (\u003cem\u003efcp1013-1021\u003c/em\u003e, Supplementary Table 6) designed from SNPs identified via BSA produced clear cluster differentiation and thus were used for mapping (Figure 6). The low-resolution map was 20.7 cM long and spanned a physical distance of 21.3 Mb in Svevo Rel. 2.0. The \u003cem\u003eTsn1-B1\u003c/em\u003e locus was delineated to a 4.8 cM region, flanked by markers \u003cem\u003efcp1016\u003c/em\u003e and \u003cem\u003efcp1019\u003c/em\u003e, corresponding to a 8.6 Mb region in Svevo Rel. 2.0 (14.2-22.8 Mb).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe primary goal of this research was to develop highly robust and effective markers for high-throughput marker-assisted elimination of functional \u003cem\u003eTsn1-B1\u003c/em\u003e alleles. We found that, among the cultivated and breeding lines in the WWP and HRSWP, 22.0 and 50.88% of the lines were sensitive to ToxA, respectively, indicating that ToxA sensitivity, and therefore susceptibility to SNB, tan spot, and spot blotch, is relatively common in cultivated bread wheats. A similar trend was observed in the durum panel, where 24.0% of the modern lines were sensitive to ToxA. While phenotypic testing of breeding lines for sensitivity to ToxA is possible, performing infiltrations is quite laborious and requires growing yeast cultures to produce ToxA. Additionally, because \u003cem\u003eTsn1-B1\u003c/em\u003e confers dominant sensitivity to ToxA, homozygous ToxA-sensitive lines cannot be distinguished from heterozygous lines, thus limiting the amount of genetic information that can be obtained. For efficient low-cost high throughput selection of lines insensitive to ToxA, marker-assisted selection is more user-friendly and preferred by most wheat breeding programs because it is easy to incorporate additional markers into their already-established marker-assisted selection programs. The codominant KASP and STARP (gel-based assay) markers developed here, \u003cem\u003efcp991\u003c/em\u003e-\u003cem\u003efcp994\u003c/em\u003e, tightly flank \u003cem\u003eTsn1-B1\u003c/em\u003e and correctly identify ToxA-insensitive plants with greater than 99% accuracy. While it is possible that additional markers could be developed to select for other insensitive \u003cem\u003etsn1-B1b\u003c/em\u003e haplotypes, it would not be efficient to use them given the relative rarity of these haplotypes (0.8%-0.07%).\u003c/p\u003e \u003cp\u003e \u003cem\u003eTsn1-B1\u003c/em\u003e arose when separate PK and NB-LRR genes went through a gene fusion event, likely in the diploid B-progenitor of polyploid wheat (Faris et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Tetraploid wild emmer wheat (\u003cem\u003eT. turgidum\u003c/em\u003e ssp. \u003cem\u003edicoccoides\u003c/em\u003e) either obtained \u003cem\u003eTsn1-B1\u003c/em\u003e through the hybridization event between the diploid B-progenitor, closely related to \u003cem\u003eAegilops speltoides\u003c/em\u003e Tausch. (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;14, SS genome), and \u003cem\u003eT. urartu\u003c/em\u003e Tumanian ex Gandilyan (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;14, AA genome) that formed wild emmer wheat, or through subsequent outcrossing with a wild diploid B-genome species. During a second amphiploidization event, a \u003cem\u003eT. turgidum\u003c/em\u003e ssp. and the diploid wild goat grass \u003cem\u003eAe. tauschii\u003c/em\u003e Coss. (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;14, DD) hybridized to form hexaploid wheat \u003cem\u003eT. aestivum\u003c/em\u003e (AABBDD genomes). \u003cem\u003eTsn1-B1\u003c/em\u003e was introduced into hexaploid wheat either through this event, or through gene flow via subsequent outcrossing event(s). These hybridization events act as significant bottlenecks for genetic diversity. In line with that trend, Faris et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) observed greater sequence diversity in \u003cem\u003eAe. speltoides\u003c/em\u003e, \u003cem\u003eT. turgidum\u003c/em\u003e ssp. \u003cem\u003edicoccum\u003c/em\u003e, and \u003cem\u003eT. turgidum\u003c/em\u003e ssp. \u003cem\u003edicoccoides\u003c/em\u003e accessions than in spring wheats.\u003c/p\u003e \u003cp\u003eIn all three diversity panels evaluated in this study, greater haplotype diversity was found among the landraces than cultivated lines. However, only two haplotypes were identified in the GDP, whereas four and eight haplotypes were identified in the WWP and HRSWP, respectively. In the GDP, only one intragenic mutation was identified (\u003cem\u003etsn1-B1b_h3\u003c/em\u003e) and it was exclusive to durum landraces. The \u003cem\u003eTsn1-B1\u0026thinsp;+\u003c/em\u003e\u0026thinsp;ToxA-insensitive cultivated durum lines all expressed \u003cem\u003eTsn1-B1a_h1\u003c/em\u003e, and it is likely they were insensitive to ToxA because they carried a mutation in a different gene necessary for ToxA sensitivity, possibly \u003cem\u003eTsn1-B2\u003c/em\u003e. Of the four ToxA-insensitive lines that had, but did not express, \u003cem\u003eTsn1-B1a_h1\u003c/em\u003e, three of them were landraces. One was a Finnish cultivar, Kimmo, released in 1941. It appears that the variant inhibiting the expression of \u003cem\u003eTsn1-B1\u003c/em\u003e has not been selected for in modern cultivars. Based on the greater haplotype diversity of the insensitive \u003cem\u003etsn1-B1b\u003c/em\u003e allele in hexaploid wheats relative to durum wheat, it appears that more of the mutations in \u003cem\u003eTsn1-B1\u003c/em\u003e occurred after the formation of hexaploid wheat. However, the rarity of these mutations suggests that the mutations occurred relatively recently.\u003c/p\u003e \u003cp\u003eTwo highly conserved gene-based haplotypes for the \u003cem\u003eTsn1-B1\u003c/em\u003e region were identified among sequenced wheat lines where one haplotype was conserved among lines having \u003cem\u003eTsn1-B1\u003c/em\u003e and the other among lines lacking \u003cem\u003eTsn1-B1\u003c/em\u003e. There were two major differences between the two haplotypes. First, the region between the 6th and 7th syntenic low-copy DNA blocks identified between \u003cem\u003eTsn1-B1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;and \u003cem\u003eTsn1-B1\u003c/em\u003e- consensus sequences was expanded in \u003cem\u003eTsn1-B1\u003c/em\u003e-Cons. The expanded region contained a greater number of TEs and a gene unique to the \u003cem\u003eTsn1-B1\u003c/em\u003e- lines (CPI-peptidase). This likely resulted from an insertion/deletion event that led to the deletion of the DUF-ZK gene in \u003cem\u003eTsn1-B1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;lines and the introduction of CPI-peptidase in \u003cem\u003eTsn1-B1\u003c/em\u003e- lines. Second, the region between the 7th and 8th syntenic blocks is expanded in \u003cem\u003eTsn1-B1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Cons, again containing a greater number of TE and a unique gene, \u003cem\u003eTsn1-B1\u003c/em\u003e. This was also likely the result of an insertion/deletion event leading to the acquisition of \u003cem\u003eTsn1-B1\u003c/em\u003e in the \u003cem\u003eTsn1-B1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;lines. These insertion/deletion events would have most likely occurred in a wheat progenitor before the formation of cultivated durum or common wheat, and the cultivated lines likely acquired the segment extending from the 6th syntenic block to the location of \u003cem\u003efcp992\u003c/em\u003e through a recombination event. Further genomic analysis of this region in the wheat progenitors, including the diploid ancestors, would likely shed more light on the evolutionary events that shaped this region.\u003c/p\u003e \u003cp\u003eThe evaluation of the efficacy of markers for \u003cem\u003eTsn1-B1\u003c/em\u003e led to the identification of a second locus on chromosome 2B (\u003cem\u003eTsn1-B2\u003c/em\u003e) in durum wheat associated with ToxA-sensitivity. The \u003cem\u003eTsc2\u003c/em\u003e gene, which is a susceptibility gene that recognizes the necrotrophic effector Ptr ToxB produced by \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e is also located on wheat chromosome arm 2BS (reviewed by Faris et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), but comparisons of the physical locations of the two genes indicated that \u003cem\u003eTsn1-2B\u003c/em\u003e was located at least 7 Mb distal to \u003cem\u003eTsc2\u003c/em\u003e. No markers on chromosome 5B were identified by BSA, confirming that both DWRC-0110 and DWRC-1007 have functional \u003cem\u003eTsn1-B1\u003c/em\u003e alleles, despite being insensitive to ToxA. Based on the F\u003csub\u003e1\u003c/sub\u003e and F\u003csub\u003e2\u003c/sub\u003e phenotypes in the DWRC-0110 \u0026times; Lebsock and DWRC-1007 \u0026times; Lebsock populations, sensitivity to ToxA was dominant, and the dominant allele at \u003cem\u003eTsn1-B2\u003c/em\u003e was required to express sensitivity. It is likely that the recessive \u003cem\u003etsn1-B2\u003c/em\u003e allele is relatively rare, and that is why it has not been detected before. A gene required in the ToxA-sensitivity pathway may underlie the \u003cem\u003eTsn1-B2\u003c/em\u003e locus. It is interesting to note that among dozens of studies involving the genetic evaluation and mapping of ToxA sensitivity (Friesen and Faris \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Faris et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Peters Haugrud et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e for reviews) and the development of chemically-induced ToxA-insensitive mutants (Faris et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) in wheat, no locus other than \u003cem\u003eTsn1\u003c/em\u003e on chromosome 5B has been implicated in governing ToxA sensitivity. Fine mapping and cloning are underway using the DWRC-1007 \u0026times; Lebsock population to better define the \u003cem\u003eTsn1-B2\u003c/em\u003e locus and ultimately uncover the mechanism that makes \u003cem\u003eTsn1-B2\u003c/em\u003e necessary for ToxA sensitivity, which should extend our knowledge of the compatible \u003cem\u003eTsn1\u003c/em\u003e-ToxA interaction and wheat-pathogen interactions in general.\u003c/p\u003e \u003cp\u003eDozens of studies have demonstrated the role of \u003cem\u003eTsn1\u003c/em\u003e as a susceptibility factor in the development of tan spot, SNB, and spot blotch (Friesen and Faris \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Faris et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Peters Haugrud et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e for reviews). The markers developed here can be used to reliably and efficiently select lines with absent alleles for \u003cem\u003eTsn1-B1\u003c/em\u003e using either high-throughput platforms (both KASP and STARP markers) or using relatively low-throughput, low-cost gel-based assays (STARP markers). Including these markers in marker-assisted selection arrays would allow the efficient selection of lines insensitive to ToxA, and therefore less susceptible to \u003cem\u003eP. nodorum\u003c/em\u003e, \u003cem\u003eP. tritici-repentis\u003c/em\u003e, and \u003cem\u003eB. sorokiniana\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Danielle Holmes, Mary Osenga, Stephanie McCoy, and Heaven James for technical assistance. Figures 3 and 5 were created in BioRender. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by USDA-ARS CRIS Project: 3060-21000-046-000D.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKLDR and JD Faris designed the experiments; KLDR, KA, TMP, GS, ARPH, AS-H, and JD Fiedler conducted the experiments and collected the data; KLDR, KA, TMP, and JD Faris analyzed and interpreted the data; and KLDR and JD Faris wrote the paper.\u0026nbsp;All the authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available as supplementary materials and/or from the corresponding author on reasonable request. \u003cem\u003eTsn1-B1\u003c/em\u003e sequences generated here have been deposited in GenBank under accession numbers XXX-XXX\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNA\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbdullah S, Sehgal SK, Ali S, Liatukas Z, Ittu M, Kaur N (2017) Characterization of \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e (tan spot of wheat) races in Baltic states and Romania. Plant Pathol J 33:133\u0026ndash;139\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAcharya K, Liu Z, Schachterle J, Kumari P, Manan F, Xu SS, Green AJ, Faris JD (2024) Genetic mapping of QTLs for resistance to bacterial leaf streak in hexaploid wheat. Theor Appl Genet 137:265. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-024-04767-x\u003c/span\u003e\u003cspan address=\"10.1007/s00122-024-04767-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntoni EA, Rybak K, Tucker MP, Hane JK, Solomon PS, Drenth A, Shankar M, Oliver RP (2010) Ubiquity of ToxA and absence of ToxB in Australian populations of \u003cem\u003ePyrenophora tritici\u003c/em\u003e - \u003cem\u003erepentis\u003c/em\u003e. Austral Plant Pathol 39:63\u0026ndash;68\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvni R, Nave M, Barad O et al (2017) Wild emmer genome architecture and diversity elucidate wheat evolution and domestication. Science 357:93\u0026ndash;97\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallance GM, Lamari L, Bernier CC (1989) Purification and characterization of a host-selective necrosis toxin from \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e. Physiol Mol Plant Pathol 35:203\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBucknell AH, McDonald MC (2023) That\u0026rsquo;s no moon, it\u0026rsquo;s a Starship: Giant transposons driving fungal horizontal gene transfer. Mol Microbiol 120:555\u0026ndash;563. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mmi.15118\u003c/span\u003e\u003cspan address=\"10.1111/mmi.15118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBulli P, Zhang J, Chao S, Chen X, Pumphrey M (2016) Genetic architecture of resistance to stripe rust in a global winter wheat germplasm collection. G3-Genes Genom Genet. 6:2237\u0026ndash;2253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1534/g3.116.028407\u003c/span\u003e\u003cspan address=\"10.1534/g3.116.028407\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiuffetti LM, Manning VA, Pandelova I, Betts MF, Martinez JP (2010) Host-selective toxins, Ptr ToxA and Ptr ToxB, as necrotrophic effectors in the \u003cem\u003ePyrenophora tritici\u003c/em\u003e-\u003cem\u003erepentis\u003c/em\u003e-wheat interaction. New Phytol 187:911\u0026ndash;919\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Abeysekara NS, McClean PE, Xu SS, Friesen TL (2012) Tan spot susceptibility governed by the \u003cem\u003eTsn1\u003c/em\u003e locus and race-nonspecific resistance quantitative trait loci in a population derived from the wheat lines Salamouni and Katepwa. Mol Breed 30:1669\u0026ndash;1678\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Friesen TL (2009) Reevaluation of a tetraploid wheat population indicates that the \u003cem\u003eTsn1\u003c/em\u003e-ToxA interaction is the only factor governing Stagonospora nodorum blotch susceptibility. Phytopathology 99:906\u0026ndash;912\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Friesen TL (2020) Plant genes hijacked by necrotrophic fungal pathogens. Curr Opin Plant Biol 56:74\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pbi.2020.04.003\u003c/span\u003e\u003cspan address=\"10.1016/j.pbi.2020.04.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Haen KM, Gill BS (2000) Saturation mapping of a gene-rich recombination hot spot region in wheat. Genetics 154:823\u0026ndash;835\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Liu Z, Xu SS (2013) Genetics of tan spot resistance in wheat. Theor Appl Genet 126:2197\u0026ndash;2217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-013-2157-y\u003c/span\u003e\u003cspan address=\"10.1007/s00122-013-2157-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaris JD, Zhang Z, Lu H, Lu Z, Reddy L, Cloutier S, Fellers JP, Meinhardt SW, Rasmussen JB, Xu SS, Oliver RP, Simons KJ, Friesen TL (2010) A unique wheat disease resistance-like gene governs effector-triggered susceptibility to necrotrophic pathogens. Proc Natl Acad Sci USA 107:13544\u0026ndash;13549\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriesen TL, Faris JD (2010) Characterization of the wheat-\u003cem\u003eStagonospora nodorum\u003c/em\u003e disease system - what is the molecular basis of this quantitative necrotrophic disease interaction? Can J Plant Pathol 32:20\u0026ndash;28\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriesen TL, Faris JD (2021) Characterization of effector\u0026ndash;target interactions in necrotrophic pathosystems reveals trends and variation in host manipulation. Annu Rev Phytopathol 59:77\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-phyto-120320-012807\u003c/span\u003e\u003cspan address=\"10.1146/annurev-phyto-120320-012807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriesen TL, Stukenbrock EH, Liu Z, Meinhardt S, Ling H, Faris JD, Rasmussen JB, Solomon PS, McDonald BA, Oliver RP (2006) Emergence of a new disease as a result of interspecific virulence gene transfer. Nat Genet 38:953\u0026ndash;956\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriesen TL, Holmes DJ, Bowden RL, Faris JD (2018) \u003cem\u003eToxA\u003c/em\u003e is present in U.S. \u003cem\u003eBipolaris sorokiniana\u003c/em\u003e population and is a significant virulence factor on wheat harboring \u003cem\u003eTsn1\u003c/em\u003e. Plant Dis 102:2446\u0026ndash;2452\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGourlie R, McDonald M, Hafez M, Ortega-Polo R, Low KE, Abbott DW, Strelkov SE, Daayf F, Aboukhaddour R (2022) The pangenome of the wheat pathogen \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e reveals novel transposons associated with necrotrophic effectors ToxA and ToxB. BMC Biol 20:239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12915-022-01433-w\u003c/span\u003e\u003cspan address=\"10.1186/s12915-022-01433-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosseini M, Pratas D, Morgenstern B, Pinho AJ (2020) Smash++: an alignment-free and memory-efficient tool to find genomic rearrangements. GigaScience 9:giaa048. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/gigascience/giaa048\u003c/span\u003e\u003cspan address=\"10.1093/gigascience/giaa048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e:, International Wheat Genome Sequencing Consortium (IWGSC), IWGSC RefSeq principal investigators, Appels R et al (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 361:eaar7191\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKariyawasam GK, Nelson AC, Williams SJ, Solomon PS, Faris JD, Friesen TL (2023) The necrotrophic pathogen \u003cem\u003eParastagonospora nodorum\u003c/em\u003e is a master manipulator of wheat defense. MPMI 36:764\u0026ndash;773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/MPMI-05-23-0067-IRW\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-05-23-0067-IRW\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamari L, Bernier CC (1989) Evaluations of wheat lines and cultivars to tan spot [\u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e] based on lesion type. Can J Plant Pathol 11:49\u0026ndash;56\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLassmann T (2019) Kalign 3: multiple sequence alignment of large datasets. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btz795\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btz795\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Bioinformatics btz795\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078\u0026ndash;2079\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Friesen TL, Ling H, Meinhardt SW, Oliver RP, Rasmussen JB, Faris JD (2006) The \u003cem\u003eTsn1\u003c/em\u003e-ToxA interaction in the wheat-\u003cem\u003eStagonospora nodorum\u003c/em\u003e pathosystem parallels that of the wheat-tan spot system. Genome 49:1265\u0026ndash;1273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLong YM, Chao WS, Ma GJ, Xu SS, Qi LL (2017) An innovative SNP genotyping method adapting to multiple platforms and throughputs. Theor Appl Genet 130:597\u0026ndash;607\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorieux M (2012) MapDisto: fast and efficient computation of genetic linkage maps. Mol Breed 30:1231\u0026ndash;1235\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaccaferri M, Harris NS, Twardziok SO et al (2019) Durum wheat genome highlights past domestication signatures and future improvement targets. Nat Genet 51:885\u0026ndash;895\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaccaferri M, Zhang J, Bulli P, Abate Z, Chao S, Cantu D, Bossolini E, Chen X, Pumphrey M, Dubcovsky J (2015) A genome-wide association study of resistance to stripe rust (\u003cem\u003ePuccinia striiformis\u003c/em\u003e f. sp. \u003cem\u003etritici\u003c/em\u003e) in a worldwide collection of hexaploid spring wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.). G3-Genes. Genom Genet 5:449\u0026ndash;465\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManan F, Shi G, Gong H, Hou H, Khan H, Leng Y, Castell-Miller C, Ali S, Faris JD, Zhong S, Steffenson BJ, Liu Z (2023) Prevalence and importance of the necrotrophic effector gene ToxA in \u003cem\u003eBipolaris sorokiniana\u003c/em\u003e populations collected from spring wheat and barley. Plant Dis 107:2424\u0026ndash;2430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-08-22-2011-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-08-22-2011-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazzucotelli E, Sciara G, Mastrangelo AM et al (2020) The Global Durum Wheat Panel (GDP): An international platform to identify and exchange beneficial alleles. Front Plant Sci 11:569905\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDonald MC, Ahren D, Simpfendorfer S, Milgate A, Solomon PS (2018) The discovery of the virulence gene \u003cem\u003eToxA\u003c/em\u003e in the wheat and barley pathogen \u003cem\u003eBipolaris sorokiniana\u003c/em\u003e. Mol Plant Pathol 19:432\u0026ndash;439\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDonald MC, Oliver RP, Friesen TL, Brunner PC, McDonald BA (2013) Global diversity and distribution of three necrotrophic effectors in \u003cem\u003ePhaeosphaeria nodorum\u003c/em\u003e and related species. New Phytol 199:241\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMihalyov PD, Nichols VA, Bulli P, Rouse MN, Pumphrey MO (2017) Multi-locus mixed model analysis of stem rust resistance in winter wheat. Plant Genome. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3835/plantgenome2017.01.0001\u003c/span\u003e\u003cspan address=\"10.3835/plantgenome2017.01.0001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreno MV, Stenglein S, Perell\u0026oacute; AE (2015) Distribution of races and Tox genes in \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e isolates from wheat in Argentina. Trop Plant Pathol 40:141\u0026ndash;146\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuleta KT, Chen X, Pumphrey M (2020) Genome-wide mapping of resistance to stripe rust caused by \u003cem\u003ePuccinia striiformis\u003c/em\u003e f. sp. \u003cem\u003etritici\u003c/em\u003e in hexaploid wheat. Crop Sci 60:115\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavathe S, Yadav PS, Chand R, Mishra VK, Vasistha NK, Meher PK, Joshi AK, Gupta PK (2020) \u003cem\u003eToxA\u003c/em\u003e - \u003cem\u003eTsn1\u003c/em\u003e Interaction for spot blotch susceptibility in Indian wheat: An example of inverse gene-for-gene relationship. Plant Dis 104:71\u0026ndash;81\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePallotta MA, Warner P, Fox RL, Kuchel H, Jefferies SJ, Langridge P (2003) Marker assisted wheat breeding in the southern region of Australia. Proceedings of the Tenth International Wheat Genetics Symposium (1\u0026ndash;6 September 2003, Paestum, Italy) pp. 789\u0026ndash;791\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeters Haugrud AR, Shi G, Seneviratne S, Running KLD, Zhang Z, Singh G, Szabo-Hever A, Acharya K, Friesen TL, Liu Z, Faris JD (2023) Genome-wide association mapping of resistance to the foliar diseases septoria nodorum blotch and tan spot in a global winter wheat collection. Mol Breed 43:54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11032-023-01400-5\u003c/span\u003e\u003cspan address=\"10.1007/s11032-023-01400-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeters Haugrud AR, Zhang Z, Friesen TL, Faris JD (2022) Genetics of resistance to septoria nodorum blotch in wheat. Theor Appl Genet 135:3685\u0026ndash;3707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-022-04036-9\u003c/span\u003e\u003cspan address=\"10.1007/s00122-022-04036-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamirez-Gonzalez RH, Uauy C, Caccamo M (2015) PolyMarker: A fast polyploid primer design pipeline. Bioinformatics 31:2038\u0026ndash;2039. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btv069\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btv069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavary S, Willocquet L, Pethybridge SJ et al (2019) The global burden of pathogens and pests on major food crops. Nat Ecol Evol 3:430\u0026ndash;439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41559-018-0793-y\u003c/span\u003e\u003cspan address=\"10.1038/s41559-018-0793-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeneviratne S, Shi G, Szabo-Hever A, Zhang Z, Peters Haugrud AR, Running KLD, Singh G, Nandety RS, Fiedler JD, McClean PE, Xu SS, Friesen TL, Faris JD (2024) Evolution, diversity, and function of the disease susceptibility gene \u003cem\u003eSnn1\u003c/em\u003e in wheat. Plant J 119:1720\u0026ndash;1736. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/tpj.16879\u003c/span\u003e\u003cspan address=\"10.1111/tpj.16879\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShabeer A, Bockus WW (1988) Tan spot effects on yield and yield components relative to growth stage in winter wheat. Plant Dis 72:599\u0026ndash;602\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaw DE (1957) Studies on \u003cem\u003eLeptosphaeria avenaria\u003c/em\u003e. f. sp. \u003cem\u003etriticea\u003c/em\u003e on cereals and grasses. Can J Bot 35:113\u0026ndash;118\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi G, Zhang Z, Friesen TL, Raats D, Fahima T, Brueggeman RS, Lu S, Trick HN, Liu Z, Chao W, Frenkel Z, Xu SS, Rasmussen JB, Faris JD (2016) The hijacking of a receptor kinase-driven pathway by a wheat fungal pathogen leads to disease. Sci Adv 2:e1600822. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.1600822\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.1600822\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmit AFA, Hubley R, Green P (2013\u0026ndash;2015) RepeatMasker Open-4.0 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.repeatmasker.org\u003c/span\u003e\u003cspan address=\"http://www.repeatmasker.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahbandeh M (2024) Global wheat production from 1990/1991 to 2023/2024 (in million metric tons). Statista. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.statista.com/statistics/267268/production-of-wheat-worldwide-since-1990/#:~:text=Wheat%3A%20production%20volume%20worldwide1990%2F1991% 2D2023%2F2024\u0026amp;text=In%20the%20marketing%20year%20of,almost%20785%20 million%20metric%20tons\u003c/span\u003e\u003cspan address=\"https://www.statista.com/statistics/267268/production-of-wheat-worldwide-since-1990/#:~:text=Wheat%3A%20production%20volume%20worldwide1990%2F1991% 2D2023%2F2024\u0026amp;text=In%20the%20marketing%20year%20of,almost%20785%20 million%20metric%20tons\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 7 July 2024\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzabo-Hever A, Running KLD, Seneviratne S, Singh G, Zhang Z, Peters Haugrud AR, Maccaferri M, Tuberosa R, Xu SS, Friesen TL, Faris JD (2024) Evaluation of durum and hard red spring wheat panels for sensitivity to necrotrophic effectors produced by \u003cem\u003eParastagonospora nodorum\u003c/em\u003e. Plant Dis PDIS. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-05-24-0990-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-05-24-0990-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. -05-24-0990-RE\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzabo-Hever A, Singh G, Peters Haugrud AR, Running KLD, Seneviratne S, Zhang Z, Shi G, Bassi FM, Maccaferri M, Cattivelli L, Tuberosa R, Friesen TL, Liu Z, Xu SS, Faris JD (2023) Association mapping of resistance to tan spot in the Global Durum Panel. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PHYTO-02-23-0043-R\u003c/span\u003e\u003cspan address=\"10.1094/PHYTO-02-23-0043-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Phytopathology PHYTO-02-23-0043-R\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTomas A, Bockus WW (1987) Cultivar-specific toxicity of culture filtrate of \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e. Phytopathology 77:1337\u0026ndash;1340\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVirdi SK, Liu Z, Overlander ME, Zhang Z, Xu SS, Friesen TL, Faris JD (2016) New insights into the roles of host gene-necrotrophic effector interactions in governing susceptibility of durum wheat to tan spot and spetoria nodorum blotch. G3-Genes. Genom Genet 6:4139\u0026ndash;4150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D (2020) Multiple wheat genomes reveal global variation in modern breeding. Nature 588:277\u0026ndash;283\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWicker T, Matthews DE, Keller B (2002) TREP: a database for Triticeae repetitive elements. Trends Plant Sci 7:561\u0026ndash;562\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWicker T, Sabot F, Hua-Van A et al (2007) A unified classification system for eukaryotic transposable elements. Nat Rev Genet 8:973\u0026ndash;982\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu L, He X, Lozano N, Zhang X, Singh PK (2021) ToxA, a significant virulence factor involved in wheat spot blotch disease, exists in the Mexican population of \u003cem\u003eBipolaris sorokiniana\u003c/em\u003e. Trop Plant Pathol 46:201\u0026ndash;206\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Friesen TL, Xu SS, Shi G, Liu Z, Rasmussen JB, Faris JD (2011) Two putatively homoeologous wheat genes mediate recognition of SnTox3 to confer effector-triggered susceptibility to \u003cem\u003eStagnonospora nodorum\u003c/em\u003e. Plant J 65:27\u0026ndash;38\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei B, Despins T, Fernandez MR, Strelkov SE, Ruan Y, Graf R, Aboukhaddour R (2021) Race distribution of \u003cem\u003ePyrenophora tritici-repentis\u003c/em\u003e in relation to ploidy level and susceptibility of durum and winter bread wheat. Can J Plant Pathol 43:582\u0026ndash;598. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/07060661.2020.1870002\u003c/span\u003e\u003cspan address=\"10.1080/07060661.2020.1870002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWulff BB, Krattinger SG (2022) The long road to engineering durable disease resistance in wheat. Curr Opin Biotechnol 73:270\u0026ndash;275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.copbio.2021.09.002\u003c/span\u003e\u003cspan address=\"10.1016/j.copbio.2021.09.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. TE content and distribution in the \u003cem\u003eTsn1\u003c/em\u003e region defined by markers \u003cem\u003efcp620\u0026nbsp;\u003c/em\u003eand \u003cem\u003efcp494\u003c/em\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"552\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"bottom\" style=\"width: 264px;\"\u003e\n \u003cp\u003eClassification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"bottom\" style=\"width: 134px;\"\u003e\n \u003cp\u003e\u003cem\u003eTsn1-B1\u003c/em\u003e+Cons\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"bottom\" style=\"width: 153px;\"\u003e\n \u003cp\u003e\u003cem\u003eTsn1-B1\u003c/em\u003e-Cons\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eOrder\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eSuperfamily\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003eLength (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003eLength (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"bottom\" style=\"width: 552px;\"\u003e\n \u003cp\u003eClass I elements\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Retrotransposons)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eLTR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eCopia (RLC)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e51,970\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e15.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e28,937\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e9.47\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eGypsy (RLG)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e102,193\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e30.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e77,540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e25.38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (RLX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e24,026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e7.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e26,702\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e8.74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eLINE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (RIX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e14,252\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e4.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e8,616\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e2.82\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eSINE\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (RSX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e1,370\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e1,003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"bottom\" style=\"width: 552px;\"\u003e\n \u003cp\u003eClass II elements\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(DNA Transposons)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (DXX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e119\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eSubclass 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eTIR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eTc1-\u003cem\u003eMariner\u003c/em\u003e (DTT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e982\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e1,653\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003e\u003cem\u003ehAT\u0026nbsp;\u003c/em\u003e(DTA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e159\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003e\u003cem\u003eMutator\u003c/em\u003e (DTM)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e436\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e3,271\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e1.07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003e\u003cem\u003ePIF-Harbinger\u003c/em\u003e (DTH)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e1,110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e3,681\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003e\u003cem\u003eCACTA\u003c/em\u003e (DTC)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e69,162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e20.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e66,043\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e21.62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (DTX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" style=\"width: 552px;\"\u003e\n \u003cp\u003eSubclass 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eHelitron (DHH)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e1,890\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e945\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eOthers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eUnknown (XXX)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e333\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 153px;\"\u003e\n \u003cp\u003eSSRs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e2,210\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 90px;\"\u003e\n \u003cp\u003e2,542\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003e0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 2. \u003cem\u003eTsn1\u003c/em\u003e marker primers\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"680\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eMarker type\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 51px;\"\u003e\n \u003cp\u003eMarker name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 389px;\"\u003e\n \u003cp\u003ePrimer Sequence\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePosition of SNP\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eKASP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;fcp991\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eTsn1-B1_1Ka-FAM\u003c/p\u003e\n \u003cp\u003eTsn1-B1_1Ka-HEX\u003c/p\u003e\n \u003cp\u003eTsn1-B1_1Ka-Com\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 389px;\"\u003e\n \u003cp\u003eGAAGGTGACCAAGTTCATGCTTCTTGTATGGAGCAGCGACTAGG\u003cu\u003eT\u003c/u\u003e\u003c/p\u003e\n \u003cp\u003eGAAGGTCGGAGTCAACGGATTTCTTGTATGGAGCAGCGACTAGGG\u003c/p\u003e\n \u003cp\u003eACTTCCTACTGGTTATGGAATGGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e546,766,568\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eKASP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp992\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eTsn1-B1_2Ka-FAM\u003c/p\u003e\n \u003cp\u003eTsn1-B1_2Ka-HEX\u003c/p\u003e\n \u003cp\u003eTsn1-B1_2Ka-Com\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 389px;\"\u003e\n \u003cp\u003eGAAGGTGACCAAGTTCATGCTCTAGTGCCATCTACCAATCCC\u003cu\u003eC\u003c/u\u003e\u003c/p\u003e\n \u003cp\u003eGAAGGTCGGAGTCAACGGATTCTAGTGCCATCTACCAATCCCT\u003c/p\u003e\n \u003cp\u003eTACAGATGTCCAGAACCTTTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e546,806,925\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eSTARP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp993\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eTsn1-B1_1St-Tail2\u003c/p\u003e\n \u003cp\u003eTsn1-B1_1St-Tail1\u003c/p\u003e\n \u003cp\u003eTsn1-B1_1St-Com\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 389px;\"\u003e\n \u003cp\u003eGACGCAAGTGAGCAGTATGACTCTTGTATGGAGCAGCGACTAAG\u003cu\u003eT\u003c/u\u003e\u003c/p\u003e\n \u003cp\u003eGCAACAGGAACCAGCTATGACTCTTGTATGGAGCAGCGACTCGGG\u003c/p\u003e\n \u003cp\u003eACTTCCTACTGGTTATGGAATGGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e546,766,568\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eSTARP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp994\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eTsn1-B1_2St-Tail1\u003c/p\u003e\n \u003cp\u003eTsn1-B1_2St-Tail2\u003c/p\u003e\n \u003cp\u003eTsn1-B1_2St-Com\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 389px;\"\u003e\n \u003cp\u003eGCAACAGGAACCAGCTATGACCTAGTGCCATCTACCAATTCC\u003cu\u003eC\u003c/u\u003e\u003c/p\u003e\n \u003cp\u003eGACGCAAGTGAGCAGTATGACCTAGTGCCATCTACCAATCTCT\u003c/p\u003e\n \u003cp\u003eTACAGATGTCCAGAACCTTTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e546,806,925\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003ea\u0026nbsp;\u003c/sup\u003eFor each marker, the primer targeting the insensitive allele is listed first and the SNP associated with the insensitive allele is underlined.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003csup\u003eb\u0026nbsp;\u003c/sup\u003eSNP positions (in bp) are based on the IWGSC RefSeq v1.0 assembly\u003c/p\u003e\n\u003cp\u003eTable 3. Accuracies of correct phenotypic prediction given the marker prediction for KASP markers \u003cem\u003efcp991\u003c/em\u003e and \u003cem\u003efcp992\u003c/em\u003e and STARP markers \u003cem\u003efcp993\u003c/em\u003e and \u003cem\u003efcp994\u0026nbsp;\u003c/em\u003ein three panels\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 283px;\"\u003e\n \u003cp\u003eAccuracy predicting insensitive phenotype (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 270px;\"\u003e\n \u003cp\u003eAccuracy predicting sensitive phenotype (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003epanel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp991\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp992\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp993\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp994\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp991\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 67px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp992\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 69px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp993\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\n \u003cp\u003e\u003cem\u003efcp994\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003eHRSW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e99.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e99.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e89.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 67px;\"\u003e\n \u003cp\u003e89.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 69px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003eGDP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e99.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e99.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e89.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 67px;\"\u003e\n \u003cp\u003e89.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 69px;\"\u003e\n \u003cp\u003e90.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\n \u003cp\u003e89.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003eWW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e99.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e94.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 67px;\"\u003e\n \u003cp\u003e94.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 69px;\"\u003e\n \u003cp\u003e95.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\n \u003cp\u003e95.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 4. Inheritance of ToxA-sensitivity\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"608\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 174px;\"\u003e\n \u003cp\u003epopulation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003egeneration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 98px;\"\u003e\n \u003cp\u003enumber of sensitive plants\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 110px;\"\u003e\n \u003cp\u003enumber of insensitive plants\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003egenetic ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 174px;\"\u003e\n \u003cp\u003eDWRC-0110 \u0026times; Lebsock\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 98px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 98px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e3:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45px;\"\u003e\n \u003cp\u003e0.524\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.469\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 174px;\"\u003e\n \u003cp\u003eDWRC-1007 \u0026times; Lebsock\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 98px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 98px;\"\u003e\n \u003cp\u003e93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e3:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45px;\"\u003e\n \u003cp\u003e0.400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.527\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003eDWRC-0110 \u0026times; DWRC-1007\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 98px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Tsn1, wheat, ToxA, disease resistance, susceptibility, marker-assisted selection","lastPublishedDoi":"10.21203/rs.3.rs-5953910/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5953910/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe wheat \u003cem\u003eTsn1\u003c/em\u003e gene recognizes the necrotrophic effector ToxA, which is produced by three different necrotrophic fungal pathogens. A compatible \u003cem\u003eTsn1\u003c/em\u003e-ToxA interaction leads to host-induced responses that result in the development of disease. Therefore, marker-assisted elimination of functional \u003cem\u003eTsn1\u003c/em\u003e alleles is an effective strategy for the development of disease resistant varieties. To develop such markers, available wheat genome assemblies were used to compare gene and transposable element content in lines with and without \u003cem\u003eTsn1\u003c/em\u003e (\u003cem\u003eTsn1\u003c/em\u003e- and \u003cem\u003eTsn1\u003c/em\u003e+), revealing two conserved haplotypes. Because \u003cem\u003eTsn1\u003c/em\u003e is almost always absent in insensitive lines, Kompetitive Allele Specific PCR (KASP) markers were designed in flanking syntenic regions of \u003cem\u003eTsn1\u003c/em\u003e- and \u003cem\u003eTsn1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;assemblies. The KASP markers were validated in more than 1,500 diverse lines. The markers correctly predicted a ToxA-insensitive phenotype in 99.33\u0026ndash;100% of the lines, but they were less effective at predicting a ToxA-sensitive phenotype (89.50-94.55%) due to 60 insensitive lines with sensitive marker alleles. Sequence analysis of \u003cem\u003eTsn1\u003c/em\u003e from these lines revealed that some were not transcribed and others contained point mutations. However, some carried and expressed the dominant \u003cem\u003eTsn1\u003c/em\u003e allele, and subsequent analysis of two such lines revealed a second locus controlling ToxA sensitivity on chromosome 2B, termed \u003cem\u003eTsn1-B2\u003c/em\u003e. Genetic mapping of \u003cem\u003eTsn1-B2\u003c/em\u003e in a biparental durum population define the locus to a 4.8 cM region corresponding to 8.6 Mb in Svevo Rel 2.0. The markers presented here could be used for reliable and robust marker-assisted elimination of \u003cem\u003eTsn1\u003c/em\u003e in a high-throughput manner, furthering the development of wheat genetically resistant to multiple pathogens.\u003c/p\u003e","manuscriptTitle":"Development of diagnostic markers for the disease susceptibility gene Tsn1 in wheat reveals novel resistance alleles and a new locus required for ToxA sensitivity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-17 20:04:59","doi":"10.21203/rs.3.rs-5953910/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accept","date":"2025-05-01T05:18:38+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-04-17T00:44:33+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-16T09:32:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-16T03:34:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2025-04-15T18:38:18+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5d603560-615a-4516-9c87-47f6945e2189","owner":[],"postedDate":"April 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-30T16:00:15+00:00","versionOfRecord":{"articleIdentity":"rs-5953910","link":"https://doi.org/10.1007/s00122-025-04952-6","journal":{"identity":"theoretical-and-applied-genetics","isVorOnly":false,"title":"Theoretical and Applied Genetics"},"publishedOn":"2025-06-28 15:57:24","publishedOnDateReadable":"June 28th, 2025"},"versionCreatedAt":"2025-04-17 20:04:59","video":"","vorDoi":"10.1007/s00122-025-04952-6","vorDoiUrl":"https://doi.org/10.1007/s00122-025-04952-6","workflowStages":[]},"version":"v1","identity":"rs-5953910","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5953910","identity":"rs-5953910","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}