Macrophage induces angiogenesis via HIF signaling in denervated muscle following nerve injury. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Macrophage induces angiogenesis via HIF signaling in denervated muscle following nerve injury. Yurie Sato-Yamada, Meircurius Dwi Condro Surboyo, Andrea Rosenkranz, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6200278/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 8 You are reading this latest preprint version Abstract Skeletal muscle and blood vessels typically maintain independent homeostasis under normal physiological conditions. However, peripheral nerve injury often leads to skeletal muscle denervation, affecting the richly vascularized tissue. While previous studies have focused on the degradation processes in denervated skeletal muscle, the response of blood vessels to denervation remains poorly understood. This study utilized an animal denervated muscle model to investigate the changes in blood vessel behavior following denervation. Sciatic nerve ligation induced hypoxia and triggered angiogenesis during the acute phase after injury. In the chronic phase, however, quiescent endothelial cells were observed, with no active angiogenesis, despite the presence of a complex microvascular network in the long-term denervated muscle. Notably, we found that macrophages accumulated in short-term denervated muscle, sensing hypoxia and activating the HIF-1 signaling pathway, which drives angiogenesis during acute phase. Macrophage depletion suppressed the expression of pro-angiogenic factors and inhibited angiogenesis, underscoring their essential role in angiogenesis following muscle denervation. This study provides novel insights into the dynamic process of angiogenesis in denervated muscle and highlights the critical involvement of macrophages in this process. Biological sciences/Cell biology Biological sciences/Molecular biology Health sciences/Diseases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Skeletal muscle, a highly vascularized tissue, relies on a dynamic interaction with blood vessels to maintain homeostasis under normal physiological conditions [ 1 ][ 2 ]. Microcapillaries play a critical role in supplying oxygen and nutrients to skeletal muscle, while myocytes also contribute to vasodilation, regulating capillary surface area [ 1 ][ 3 ]. In response to increased metabolic demands, skeletal muscle activates angiogenesis—the process through which new blood vessels form from pre-existing ones—thereby enhancing nutrient and oxygen delivery [ 4 ]. This process involves the degradation of the basement membrane surrounding blood vessels, followed by the proliferation and migration of endothelial cells (ECs) to form new capillaries [ 4 ]. Angiogenesis is tightly regulated by a network of pro-angiogenic and anti-angiogenic factors, including growth factors, cytokines, and extracellular matrix proteins. Peripheral nerve injury leads to nerve degeneration and subsequent skeletal muscle denervation [ 5 ]. Neural activity is essential for maintaining normal muscle structure and function, and its loss disrupts this balance. Following denervation, myocytes undergo molecular changes within hours, activating signaling pathways that lead to muscle fiber degeneration and prolonged atrophy [ 6 ][ 7 ]. Macrophages play a crucial role in these processes by mediating tissue repair through both pro-angiogenic and anti-angiogenic mechanisms. Additionally, denervation results in hypoxic conditions within the muscle, driven by factors such as impaired blood flow regulation, increased metabolic demands, reduced capillary density, and insufficient angiogenesis. Hypoxia-inducible factors (HIFs), the master regulators of angiogenesis, play a central role in modulating macrophage behavior under these hypoxic conditions [ 8 ][ 9 ]. HIFs regulate genes involved in oxygen homeostasis, cell survival, inflammation, and angiogenesis. These HIF1 regulated genes mediate the cellular response to low oxygen levels and, when activated, upregulate pro-angiogenic genes that promote blood vessel development. Angiogenesis is not only vital for physiological processes such as wound healing [ 10 ], but also plays a central role in pathological conditions such as cancer [ 8 ], diabetic retinopathy [ 11 ], and rheumatoid arthritis [ 12 ]. Despite extensive studies on skeletal muscle degradation following denervation, the response of blood vessels to denervation is poorly understood, particularly in the early stages. Much of the existing literature focuses on the long-term effects of denervation on vascular remodeling [ 13 ][ 14 ], with fewer studies addressing the acute phase of denervation. This study aims to investigate the vascular response in skeletal muscle during both the acute and chronic phases of denervation, shedding light on the underlying mechanisms of angiogenesis and the role of macrophages in this process. Results This study investigates the vascular responses to muscle denervation, utilizing a tightly ligatured sciatic nerve model in mice. The lumbrical and tibialis anterior (TA) muscles were, located in the hind leg and paw, respectively, were analyzed for changes of muscle capillaries following nerve injury. Early Angiogenesis in Denervated Muscles Upon nerve injury, no immediate disruption in blood flow was observed in the lumbrical muscle, which does not share its blood supply with the sciatic nerve (Fig. 1A). To assess circulation, 150 kDa FITC-dextran was injected into the tail vein of wild type mice 30 minutes after nerve ligation. The distribution of FITC was comparable between the contralateral and ipsilateral sides, suggesting that sciatic nerve ligation did not disrupt blood flow to the lumbrical muscle (Fig. 1B). At postoperative day 3 (PO day 3), we observed a loss of pre-synaptic overlap at the motor endplates, confirming axonal degeneration in the lumbrical muscle (Fig. 1C). Using Tie2Cre;R26RTd-Tomato mice, we visualized endothelial cells (ECs) tagged with Td-Tomato fluorescence. On the ipsilateral side of the denervated muscle at PO day 3, we noted a more complex microvascular network with increased capillary branching compared to the contralateral side (Fig. 1D, 1E), along with a significant increase in vessel density (Fig. 1E). To assess endothelial cell (EC) proliferation, EdU, a thymidine analogue incorporated into the DNA of proliferating cells, was injected. EdU-positive ECs were predominantly located at the base of the vessel branches (Fig. 1F), in line with their role in vascular sprouting. These ECs exhibited extended cytoplasmic projections (Fig. 1G), characteristic of tip cells involved in angiogenesis. These findings suggest that denervation induces angiogenesis in the acute phase. Endothelial Cell Activation in Denervated Muscle Under normal conditions, ECs are quiescent and maintain the integrity of the vascular barrier. After activation, they undergo structural changes that contribute to neovascularization. To assess EC activation,the expression of leukocyte adhesion molecules (Vcam1, Icam1, and Selectin), proteins commonly upregulated in activated ECs, were measured.These molecules were significantly elevated in the denervated lumbrical muscle compared to the contralateral side at PO day 3 (Fig. 2A). Immunohistochemistry for CD105, a marker of activated ECs, revealed extensive CD105-positive ECs in the denervated muscle (Fig. 2B), further confirming EC activation. Next vessel integrity was assessed by examining Type IV collagen, a major component of the vascular basal membrane. In the contralateral muscle, blood vessels were overlapped with Type IV collagen (Fig. 2B), while many vessels in the denervated muscle lacked this immunoreactivity, suggesting immature and destabilized vessels. Furthermore, mRNA expression of pro-angiogenic factors, including angiopoetin (Agp) 2, platelet-derived growth factor (Pdgf) β, placental growth factor (Pgf), matrix metalloprotease (Mmp) 2, and Mmp3, was elevated in the denervated lumbrical muscle at PO day 3 (Fig. 2C), supporting the occurrence of angiogenesis. Angiogenesis Becomes Inactive in Long-Term Denervated Muscle At the chronic stage (PO day 28), the microvascular network remained complex, and vessel density was still higher in the denervated muscle compared to the contralateral side (Fig. 3A, 3B). However, no further increase in vessel density was observed after PO day 3, suggesting that angiogenesis had plateaued. The EdU assay revealed a significant decrease in EC proliferation at PO day 28 compared to PO day 3 (Fig. 3C, 3D). Moreover, the expression of leukocyte adhesion molecules (Vcam1, Icam1, Selectin) was reduced in the denervated muscle at PO day 28 (Fig. 3E), indicating decreased EC activation. Immunohistochemistry for CD105 confirmed the reduction of activated ECs in the long-term denervated muscle (Fig. 3F). Additionally, TUNEL assays detected apoptosis in ECs, suggesting that angiogenesis was inactive, and that vascular pruning and regression were occurring (Fig. 3G). Hypoxia and Macrophage Involvement in Angiogenesis Tissue hypoxia is a key driver of angiogenesis, regulated by HIFs. To evaluate hypoxia in denervated muscle, hypoxyprobe-1 (Pimonidazole) was injected andhypoxic cells were observed in the ipsilateral TA muscle at PO day 3 (Fig. 4A). Hypoxia decreased by PO day 28, confirming the acute phase of denervation was hypoxic. qPCR analysis showed that HIF-1α expression, along with its target genes (Vegf and Glut1), was upregulated at PO day 3 and downregulated at PO day 28 (Fig. 4B), indicating activation of the hypoxia signaling pathway in the acute phase. Macrophages, known to sense hypoxia, are crucial for angiogenesis in response to tissue damage. Immunohistochemistry for CD68, a pan-macrophage marker, revealed extensive macrophage infiltration in the denervated muscle at PO day 3 (Fig. 4C). Co-localization of hypoxyprobe-1 and CD68 confirmed that macrophages were the primary cells sensing hypoxia, comprising 79.67% of hypoxic cells (Fig. 4D). To evaluate macrophage activate HIF1 signaling in denervated muscle, we performed macrophage depletion using PLX3397, a CSF1 receptor inhibitor. The number of macrophage was significantly reduced in denervated muscle of PLX3397-treated mice (Fig. 4E). Macrophage depletion significantly reduced HIF signaling, with no increase in Hif-1α, Vegf, or Glut1 expression (Fig. 4F). Macrophages Are Essential for Angiogenesis in Denervated Muscle To assess the role of macrophages in angiogenesis, we examined blood vessel formation in macrophage-depleted mice. In PLX3397-treated Tie2-Tomato mice, no significant difference in blood vessel density was observed between the ipsilateral and contralateral sides (Fig. 5A). Similarly, the number of proliferating ECs, as assessed by EdU incorporation, was significantly reduced in the denervated muscle (Fig. 5B). Additionally, expression level of Vcam, Icam, Selectin, which are markers of activated endothelial cell were significantly lower (Fig. 5C), suggesting that macrophage depletion inhibited angiogenesis in denervated muscle. qPCR analysis revealed a significant downregulation of pro-angiogenic genes, such as Pgf, Mmp2, and Mmp3, in macrophage-depleted mice (Fig. 5D), supporting the critical role of macrophages in angiogenesis. These findings highlight that macrophages are essential for activating ECs and driving angiogenesis in denervated muscle via HIF signaling. Discussion This study demonstrates that muscle denervation induces a robust angiogenic response in the acute phase, marked by significant endothelial cell (EC) activation, vessel sprouting, and the formation of an immature vasculature. However, as time progresses, angiogenesis becomes inactive, and vascular remodeling leads to vessel pruning. Peripheral nerve injury frequently results in skeletal muscle denervation, which significantly contributes to morbidity and disability, especially among young, otherwise healthy individuals [ 1 ][ 2 ]. While numerous studies have explored the biological mechanisms behind denervated muscle, particularly focusing on the pathological processes leading to muscle weakness, the impact of denervation on skeletal muscle blood vessels remains less understood. The present study provides new insights into how denervation influences the vasculature, highlighting the role of hypoxia and angiogenesis in the acute phase following nerve injury. Hypoxia in denervated muscle has been previously reported [ 3 ][ 4 ][ 13 ], consistent with the findings of this study. Under normal conditions, muscle contractions generate mechanical stimuli that enhance blood flow. However, denervated muscle loses its ability to contract and relax, leading to a reduction in blood flow and, consequently, hypoxia. Additionally, denervated muscle experiences increased oxygen consumption due to the upregulation of proteolytic and glycolytic activity associated with muscle fiber degeneration [ 3 ][ 5 ][ 6 ]. These factors likely contribute to the hypoxic conditions observed in this model of denervation. Theseresults reveal that during the acute phase following nerve injury, denervated muscle undergoes a proliferative response in endothelial cells, leading to the formation of new, branching blood vessels (Fig. 1E-G). This angiogenic response is likely an adaptive mechanism to address hypoxia, as angiogenesis is a well-known physiological and pathological response in a variety of contexts, including embryonic development and disease [ 7 ][ 16 ][ 17 ]. Hypoxic conditions trigger rapid endothelial activation, which in turn promotes new blood vessel formation, largely through the upregulation of vascular endothelial growth factor (VEGF) [ 8 ]. Consistent with this, increased Vegf expression was observed in denervated muscle at PO day 3 (Fig. 4B). Furthermore, our findings suggest that other pro-angiogenic factors, along with hypoxia-sensing macrophages, contribute to this process (Fig. 5D). These data indicate that the hypoxia-induced upregulation of pro-angiogenic factors drives angiogenesis in short-term denervated muscle. An important aspect of these findings is the role of macrophages in the angiogenic response. Approximately 80% of macrophages in denervated muscle were immunoreactive to hypoxyprobe-1, indicating their response to hypoxic conditions. Macrophage depletion impaired the upregulation of hypoxia-inducible factor 1-alpha (HIF-1α) and its downstream target genes, highlighting the central role of macrophages in the hypoxic response. Macrophage infiltration in denervated muscle during the acute phase following nerve injury is well-documented [ 9 ], and similar phenomena have been observed in neurodegenerative diseases, such as amyotrophic lateral sclerosis [ 10 ], spinal muscular atrophy [ 11 ], and Guillain-Barré syndrome [ 12 ]. These findings suggest that macrophages play a pivotal role in denervated muscle, particularly by responding to hypoxic conditions and contributing to angiogenesis. Macrophages are known to rapidly alter their gene expression in response to low oxygen levels [ 13 ][ 14 ][ 41 ], and in this study, hypoxic conditions were observed which is associated with macrophages, resulting in the accumulation of transcription factors such as HIF-1α. These factors bind to hypoxia response elements in various genes, thereby enhancing their transcription [ 15 ]. As expected, macrophage activation in response to hypoxia led to the upregulation of pro-angiogenic molecules, including VEGF, fibroblast growth factor (FGF), and matrix metalloproteinases (MMPs). Notably,elevated mRNA expression of Ccl2 and Il-6, two pro-angiogenic factors regulated by HIF-1 were observed, which coincided with macrophage infiltration at PO day 3. Macrophage depletion significantly reduced the expression of these pro-angiogenic factors and inhibited angiogenesis, further supporting the hypothesis that macrophages are key contributors to angiogenesis in denervated skeletal muscle. The intriguing role of macrophages in angiogenesis raises important questions regarding the mechanisms underlying this phenomenon. Thesedata suggest that macrophages actively promote angiogenesis in denervated muscle; however, it remains unclear why this angiogenic response is limited to the acute phase following nerve injury. In the chronic phase, a downregulation of endothelial activation markers and pro-angiogenic factors (Fig. 3E, 3F, 4B), as well as the expression of apoptosis markers in some endothelial cells was observed (Fig. 3G). Similar declines in angiogenesis have been reported in long-term denervated muscle, where the upregulation of pro-angiogenic factors, including VEGF, is associated with capillary regression [ 20 ][ 21 ]. Two possible explanations for the downregulation of angiogenesis in chronic denervation are: (1) a reduction in the number of macrophages that promote angiogenesis via HIF-1 signaling, and (2) a shift in the functional phenotype of macrophages between the acute and chronic phases following injury. Macrophages exhibit functional heterogeneity, with their activation status and functions influenced by the local microenvironment [ 23 ]. Typically, macrophages are classified into two main phenotypes: M1 (pro-inflammatory) and M2 (anti-inflammatory). In the acute phase, M1 macrophages are activated to promote debris clearance, while M2 macrophages are involved in tissue repair during the chronic phase [ 23 ][ 24 ]. Recent studies suggest that hypoxia induces M1 macrophage polarization via HIF-1α, which stabilizes and upregulates genes related to glycolysis and inflammation [ 25 ]. In contrast, M2 macrophages exhibit lower sensitivity to hypoxia, as evidenced by reduced expression of hypoxia-related genes in M2 macrophages compared to M1 macrophages in various hypoxic tissues [ 26 ]. Based on these observations, washypothesized that macrophages in short-term denervated muscle may exhibit an M1 phenotype with stabilized HIF-1α, which then transitions to an M2 phenotype in the chronic phase. Further investigation is required to validate this hypothesis and explore the dynamics of macrophage polarization in the context of denervated muscle. In conclusion, these findings provide compelling evidence for the contribution of macrophages to angiogenesis in denervated skeletal muscle during the acute phase following nerve injury. These results offer new insights into the cellular and molecular mechanisms underlying muscle responses to denervation and may inform future therapeutic strategies aimed at promoting muscle regeneration following peripheral nerve injury. Materials and Methods Animals All animal procedures were approved by the Niigata University Institutional Animal Care and Use Committee (approval number SA01198). This study is reported in accordance with ARRIVE guidelines. Male C57BL/6 mice (8–12 weeks old) were used in this experimental study. Additionally, the following genetically modified mouse strains were used: Tie2Cre;R26RTd-tomato (referred to as Tie2 Tomato) and Thy1 GFP mice. Mice were housed under standard laboratory conditions in a temperature-controlled room with a 12-hour light/dark cycle, and they had free access to food and water. Surgical Procedures To generate models of peripheral nerve injury, two types of sciatic nerve injury were performed; nerve ligation for the axon degeneration model and nerve crush for the axon degeneration-regeneration model. Prior to surgery, mice were anesthetized with a mixture of three anesthetic agents—medetomidine (0.75 mg/kg), midazolam (4 mg/kg), and butorphanol (5 mg/kg)—administered intraperitoneally at a dosage of 0.1 ml/10 g. For the complete axon degeneration model, the left sciatic nerve was exposed and tightly ligated with a 6 − 0 silk suture. For the axon degeneration-regeneration model, the exposed sciatic nerve was crushed for 30 seconds using smooth-jawed micro forceps. After the injury, the surgical site was closed using sutures. Vascular Circulation Assay To evaluate vascular circulation in the denervated muscle, mice subjected to sciatic nerve ligation were injected with 2.5 mg of 150 kDa FITC-dextran (TdBLabs, 21059) in 50 µl of normal saline via the lateral tail vein, 30 minutes after the surgery. Mice were then allowed to circulate the dye for 1 hour, after which tissues were harvested for further analysis. Tissue Preparation and Immunohistochemistry Following deep anesthesia, mice were intracardially perfused with 20 ml of 4% paraformaldehyde (PFA) to fix the tissues. The fixed tissues were processed into 16-µm thick cryosections. These sections were washed in PBS and blocked with 3% normal goat serum for 30 minutes at room temperature. Subsequently, tissue sections were incubated overnight at 4°C with primary antibodies (detailed in Table 1 ). After incubation, sections were incubated with appropriate fluorescent secondary antibodies for 1 hour at room temperature. EdU Proliferation Detection To assess cell proliferation, mice were injected intraperitoneally with 5-ethynyl-2´-deoxyuridine (EdU, Baseclick, BCK-EdU488IM100) at 50 mg/kg daily for 3 days, beginning on the day of nerve injury. After 6 hours post-injection, mice were intracardially perfused with 4% PFA. The dissected lumbrical muscles were then incubated with a reaction cocktail for 1 hour at room temperature. TUNEL Apoptosis Detection Apoptotic cells in the tibialis anterior (TA) muscle were detected using a TUNEL assay (Roche, 11684795910). Frozen muscle sections were processed and stained following the manufacturer's protocol for in situ apoptosis detection. Quantitative Real-Time PCR (qPCR) Analysis RNA was isolated from the contralateral or ipsilateral lumbrical muscle at 3, 7, and 28 days post-injury using the RNeasy kit (QIAGEN). Reverse transcription and quantitative PCR were performed using the qPCR Master Mix kit (Promega, A6001) on a Quant Studio3 real-time PCR machine (Thermo Fisher). The Ct values were normalized to Gapdh, and fold changes were determined using the ΔCt method. Primer sequences are provided in Table 2 . Hypoxia Analysis Hypoxia in the denervated muscle was assessed using the Hypoxyprobe-1 kit (Hypoxyprobe, HP3-100). Mice were administered pimonidazole HCl (1.5 mg/mouse, Hypoxyprobe-1) intraperitoneally. After 3 hours, mice were perfused with 4% PFA, and tissues were collected for further analysis. Macrophage Depletion Macrophages were depleted using PLX3397, a CSF1R inhibitor, administered via oral gavage. PLX3397 (Chemgood LLC) was incorporated into AIN-76A standard chow at a concentration of 290 mg/kg, and mice were provided with this chow for 7 days prior to sciatic nerve ligation. This protocol was employed to specifically deplete macrophages during the experimental period. Table 1 antibody list Dilution Source Identifier Rat anti-CD105 1:100 BioLegend 120401 Goat anti-collagen Ⅳ 1:100 Millipore AB769 Rat anti-CD68 1:200 Bio-Rad MCA1957GA Alexa Fluor 488 Goat anti-rat IgG 1:400 Abcam AB150157 Alexa Fluor 488 Donkey anti-goat IgG 1:400 Abcam AB150129 Alexa Fluor 594 Donkey anti-rat IgG 1:400 Invitrogen A21209 Table 2 qPCR primer list Genes Sequence Vegf F ACTGGACCCTGGCTTTACTG R TCTGCTCTCCTTCTGTCGTG Glut 1 F ACCTCTTCCGAACCGACAGAT R TCTGGAGCCATCAAAGTCCTG HIF1-a F CCAAAGACAATAGCTTCGCA R ACAGTCACCTGGTTGCTGCAA Vcam F GCTGCGAGTCACCATTGTTC R ACTTCGTTCCAGCTTCCCAG Icam F CTGGGCTTGGAGACTCAGTG R CCACACTCTCCGGAAACGAA Selectin F ATGAATGCCTCGCGCTTTCTC R AGATGTGTGTAGTCCCGCTGA Agp2 F TCCTCTTGGGTGCTTTACATG R GTACAGTCTCCGCATTCACCA Pdgfb F GAGGACCACCTCGCCTGCAAG R GCCGGCGGATTCTCACCGTCC Pgf F CCGACTAGCTTCAGTTCGTAG R CTGGTGAGGAGTGTTCCGGC Mmp2 F CTGTCCTGACCAAGGATATAGC R CCTTGATGTCATCATGGGATA Mmp3 F ACTACTATGGCCTTGCAAAAG R CTCCATAGTGTTGGAGTCCAG Statistical Analysis Data was analyzed using GraphPad Prism software. One-way ANOVA with Dunnett’s multiple comparison test and t-tests were applied as appropriate. A p-value of less than 0.05 was considered statistically significant. Declarations Acknowledgement This research was funded by the Japan Society for the Promotion of Science (JSPS; 23K24545, 22K10116, 24K19989). Competing interests The authors declare no competing interests. Data availability Data is provided in within the manuscript. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Author Contribution Y.S-Y and T.M wrote the main manuscript text. All authors prepared figures1-5, and reviewed the manuscript. References Latroche, C., et al., Skeletal Muscle Microvasculature: A Highly Dynamic Lifeline. Physiology (Bethesda), 2015. 30 (6): p. 417-27. . Hellsten, P.S.C.a.Y., vasodilatory-mechanisms-in-contracting-skeletal-muscle.pdf>. 2004. Otrock, Z.K., et al., Understanding the biology of angiogenesis: review of the most important molecular mechanisms. Blood Cells Mol Dis, 2007. 39 (2): p. 212-20. Liu, Z.L., et al., Angiogenic signaling pathways and anti-angiogenic therapy for cancer. Signal Transduct Target Ther, 2023. 8 (1): p. 198. Zimna, A. and M. Kurpisz, Hypoxia-Inducible Factor-1 in Physiological and Pathophysiological Angiogenesis: Applications and Therapies. Biomed Res Int, 2015. 2015 : p. 549412. Tonnesen, M.G., X. Feng, and R.A. Clark, Angiogenesis in wound healing. J Investig Dermatol Symp Proc, 2000. 5 (1): p. 40-6. Ding, R., et al., Vascular endothelial growth factor levels in diabetic peripheral neuropathy: a systematic review and meta-analysis. Front Endocrinol (Lausanne), 2023. 14 : p. 1169405. Elshabrawy, H.A., et al., The pathogenic role of angiogenesis in rheumatoid arthritis. Angiogenesis, 2015. 18 (4): p. 433-48. Grinsell, D. and C.P. Keating, Peripheral nerve reconstruction after injury: a review of clinical and experimental therapies. Biomed Res Int, 2014. 2014 : p. 698256. Midrio, M., The denervated muscle: facts and hypotheses. A historical review. Eur J Appl Physiol, 2006. 98 (1): p. 1-21. Kostrominova, T.Y., Skeletal Muscle Denervation: Past, Present and Future. Int J Mol Sci, 2022. 23 (14). Borisov, A.B., S.-K. Huang, and B.M. Carlson, Remodeling of the vascular bed and progressive loss of capillaries in denervated skeletal muscle. The Anatomical Record, 2000. 258 (3): p. 292-304. BM, C., The biology of long-term denervated skeletal muscle. Eur J Transl Myol., 2014. 24 (1). Andrade, J., et al., Control of endothelial quiescence by FOXO-regulated metabolites. Nat Cell Biol, 2021. 23 (4): p. 413-423. Lamalice, L., F. Le Boeuf, and J. Huot, Endothelial cell migration during angiogenesis. Circ Res, 2007. 100 (6): p. 782-94. Karamysheva, A.F., Mechanisms of angiogenesis. Biochemistry (Mosc), 2008. 73 (7): p. 751-62. Blanco, R. and H. Gerhardt, VEGF and Notch in tip and stalk cell selection. Cold Spring Harb Perspect Med, 2013. 3 (1): p. a006569. Siemerink, M.J., et al., Endothelial tip cells in ocular angiogenesis: potential target for anti-angiogenesis therapy. J Histochem Cytochem, 2013. 61 (2): p. 101-15. Simons, M., Angiogenesis: where do we stand now? Circulation, 2005. 111 (12): p. 1556-66. Patan, S., Vasculogenesis and angiogenesis. Cancer Treat Res, 2004. 117 : p. 3-32. Amersfoort, J., G. Eelen, and P. Carmeliet, Immunomodulation by endothelial cells - partnering up with the immune system? Nat Rev Immunol, 2022. 22 (9): p. 576-588. Gross, S.J., et al., Notch regulates vascular collagen IV basement membrane through modulation of lysyl hydroxylase 3 trafficking. Angiogenesis, 2021. 24 (4): p. 789-805. Wietecha, M.S., W.L. Cerny, and L.A. DiPietro, Mechanisms of vessel regression: toward an understanding of the resolution of angiogenesis. Curr Top Microbiol Immunol, 2013. 367 : p. 3-32. Korn, C. and H.G. Augustin, Mechanisms of Vessel Pruning and Regression. Dev Cell, 2015. 34 (1): p. 5-17. Watson, E.C., Z.L. Grant, and L. Coultas, Endothelial cell apoptosis in angiogenesis and vessel regression. Cell Mol Life Sci, 2017. 74 (24): p. 4387-4403. Krock, B.L., N. Skuli, and M.C. Simon, Hypoxia-induced angiogenesis: good and evil. Genes Cancer, 2011. 2 (12): p. 1117-33. Cattin, A.L., et al., Macrophage-Induced Blood Vessels Guide Schwann Cell-Mediated Regeneration of Peripheral Nerves. Cell, 2015. 162 (5): p. 1127-39. Kadyrov, F.F., et al., Hypoxia sensing in resident cardiac macrophages regulates monocyte fate specification following ischemic heart injury. Nat Cardiovasc Res, 2024. 3 (11): p. 1337-1355. Henze, A.T. and M. Mazzone, The impact of hypoxia on tumor-associated macrophages. J Clin Invest, 2016. 126 (10): p. 3672-3679. Bergmeister, K.D., et al., Acute and long-term costs of 268 peripheral nerve injuries in the upper extremity. PLoS One, 2020. 15 (4): p. e0229530. Hajek, I., E. Gutmann, and I. Syrovy, PROTEOLYTIC ACTIVITY IN DENERVATED AND REINNERVATED MUSCLE. Physiol Bohemoslov (1956), 1964. 13 : p. 32-8. Hájek, I., et al., The incorporation of S35 methionine into proteins of denervated and reinnervated muscle. Physiol Bohemoslov, 1966. 15 (2): p. 148-57. Hudlická, O., Blood flow and oxygen consumption in muscles after section of ventral roots. Circ Res, 1967. 20 (5): p. 570-7. Bass, A., et al., The utilization of metabolites in the denervated muscle during stimulation and the restitution phase. Physiol Bohemoslov (1956), 1962. 11 : p. 413-22. Wilting, J. and B. Christ, Embryonic angiogenesis: a review. Naturwissenschaften, 1996. 83 (4): p. 153-64. Carmeliet, P., VEGF as a key mediator of angiogenesis in cancer. Oncology, 2005. 69 Suppl 3 : p. 4-10. Lu, C.Y., et al., Macrophage-Derived Vascular Endothelial Growth Factor-A Is Integral to Neuromuscular Junction Reinnervation after Nerve Injury. J Neurosci, 2020. 40 (50): p. 9602-9616. . Dachs, E., et al., Defective neuromuscular junction organization and postnatal myogenesis in mice with severe spinal muscular atrophy. J Neuropathol Exp Neurol, 2011. 70 (6): p. 444-61. Koike, H., et al., Ultrastructural mechanisms of macrophage-induced demyelination in Guillain-Barre syndrome. J Neurol Neurosurg Psychiatry, 2020. 91 (6): p. 650-659. Wynn, T.A., A. Chawla, and J.W. Pollard, Macrophage biology in development, homeostasis and disease. Nature, 2013. 496 (7446): p. 445-55. Zhang, C., M. Yang, and A.C. Ericsson, Function of Macrophages in Disease: Current Understanding on Molecular Mechanisms. Front Immunol, 2021. 12 : p. 620510. Jennifer E.Zielloa, b., I.J. , and a. , Hypoxia-InducibleFactor(HIF)-1Regulatory PathwayanditsPotentialforTherapeutic InterventioninMalignancyandIschemia. YALEJOURNALOFBIOLOGYANDMEDICINE, 2007. 80 : p. 51-60. Lee, J.W., et al., Hypoxia signaling in human diseases and therapeutic targets. Exp Mol Med, 2019. 51 (6): p. 1-13. Tian, X., et al., Hypoxia-inducible factor-1alpha enhances the malignant phenotype of multicellular spheroid HeLa cells in vitro. Oncol Lett, 2010. 1 (5): p. 893-897. Hua, S. and T.H. Dias, Hypoxia-Inducible Factor (HIF) as a Target for Novel Therapies in Rheumatoid Arthritis. Front Pharmacol, 2016. 7 : p. 184. Gao, L., et al., The role of hypoxia-inducible factor 1 in atherosclerosis. J Clin Pathol, 2012. 65 (10): p. 872-6. Borisov, A.B., E.I. Dedkov, and B.M. Carlson, Interrelations of myogenic response, progressive atrophy of muscle fibers, and cell death in denervated skeletal muscle. Anat Rec, 2001. 264 (2): p. 203-18. Wagatsuma, A. and T. Osawa, Time course of changes in angiogenesis-related factors in denervated muscle. Acta Physiol (Oxf), 2006. 187 (4): p. 503-9. Jablonka-Shariff, A., et al., Gpr126/Adgrg6 contributes to the terminal Schwann cell response at the neuromuscular junction following peripheral nerve injury. Glia, 2020. 68 (6): p. 1182-1200. Chen, S., et al., Macrophages in immunoregulation and therapeutics. Signal Transduct Target Ther, 2023. 8 (1): p. 207. Strizova, Z., et al., M1/M2 macrophages and their overlaps - myth or reality? Clin Sci (Lond), 2023. 137 (15): p. 1067-1093. Wang, T., et al., HIF1α-Induced Glycolysis Metabolism Is Essential to the Activation of Inflammatory Macrophages. Mediators Inflamm, 2017. 2017 : p. 9029327. Ke, X., et al., Hypoxia modifies the polarization of macrophages and their inflammatory microenvironment, and inhibits malignant behavior in cancer cells. Oncol Lett, 2019. 18 (6): p. 5871-5878. Yamada, Y., et al., Perivascular Hedgehog responsive cells play a critical role in peripheral nerve regeneration via controlling angiogenesis. Neurosci Res, 2021. 173 : p. 62-70 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 19 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 05 May, 2025 Reviews received at journal 24 Apr, 2025 Reviewers agreed at journal 08 Apr, 2025 Reviewers invited by journal 08 Apr, 2025 Editor assigned by journal 08 Apr, 2025 Editor invited by journal 29 Mar, 2025 Submission checks completed at journal 26 Mar, 2025 First submitted to journal 26 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6200278","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":440415547,"identity":"03a4ab6b-fb8e-4179-92f9-9946416ed2b1","order_by":0,"name":"Yurie Sato-Yamada","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNElEQVRIiWNgGAWjYPACZiBOAOIKBh42ZHEDgloOnAFrYWwgXsvBNjAPoQUbMLiRY/jpRo21PAN78rHHH+fdkeHjX/z8wQ+Gwwz87QcYiguwajGWzjmWbtjA8yzd4OC2ZzxsEs8MG3uAWiTOJDAYz8CqxUA6h+0wY4NEjpnEwW2HgVoOGDbw/jvMwHCDgcGYB7stv3P+HbZvkMj/JnFwDkjL8Y+Nf4C2yOPWYiad23Y4EWgLm8TBBqAW/h7DZh6gFgMcWiTPPCuzzu1LT27jeWYmceYYyBaewtkyDOk8hmcSG7D5he948ubbOd+sbfvZk59JVNQctpfvP77h4xsGazm544ePGWMJMYUDHJDoQkS6RAKYAjqJsc0YUweDfAP7AzQh/gNwJvNjLFpGwSgYBaNgxAEAaJxo4mmFfrEAAAAASUVORK5CYII=","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":true,"prefix":"","firstName":"Yurie","middleName":"","lastName":"Sato-Yamada","suffix":""},{"id":440415548,"identity":"4608015e-894e-4093-9d2d-5dd9c412fd1b","order_by":1,"name":"Meircurius Dwi Condro Surboyo","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Meircurius","middleName":"Dwi Condro","lastName":"Surboyo","suffix":""},{"id":440415549,"identity":"bb88538f-4dd8-437f-bed8-ac7a1aa70e79","order_by":2,"name":"Andrea Rosenkranz","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Rosenkranz","suffix":""},{"id":440415550,"identity":"34388871-d2d1-44e2-85ad-bc3e18261ed7","order_by":3,"name":"Tomoaki Ujita","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Tomoaki","middleName":"","lastName":"Ujita","suffix":""},{"id":440415551,"identity":"9945ed6b-5e05-4e81-bd61-099c1224d522","order_by":4,"name":"Fang Meiwen","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Meiwen","suffix":""},{"id":440415552,"identity":"03d567b2-f84b-40f5-b8d9-e57990ed9475","order_by":5,"name":"Prasiddha Fadhlallah","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Prasiddha","middleName":"","lastName":"Fadhlallah","suffix":""},{"id":440415553,"identity":"b6cc5246-0fd9-4490-aa7a-072695c6a478","order_by":6,"name":"Tomoki Maekawa","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Tomoki","middleName":"","lastName":"Maekawa","suffix":""},{"id":440415554,"identity":"0c82f41b-8a65-4d02-8351-28ee0f68e3ad","order_by":7,"name":"Yumiko Sato","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Yumiko","middleName":"","lastName":"Sato","suffix":""},{"id":440415555,"identity":"faff8d10-b11f-4e3f-ad01-b2954e241fdb","order_by":8,"name":"Nagako Yoshiba","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Nagako","middleName":"","lastName":"Yoshiba","suffix":""},{"id":440415556,"identity":"06bacfc9-cb90-4a69-bd06-2e005630184d","order_by":9,"name":"Takeyasu Maeda","email":"","orcid":"","institution":"Niigata University Graduate School","correspondingAuthor":false,"prefix":"","firstName":"Takeyasu","middleName":"","lastName":"Maeda","suffix":""}],"badges":[],"createdAt":"2025-03-11 05:23:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6200278/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6200278/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-07536-y","type":"published","date":"2025-07-19T15:57:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80314607,"identity":"2f45ab95-08be-401f-b329-cea4145d81c7","added_by":"auto","created_at":"2025-04-10 12:10:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":11722165,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/8150ced6455c356e24be5f4a.png"},{"id":80315203,"identity":"abe3c045-2516-4be0-af55-4ab660af7d7d","added_by":"auto","created_at":"2025-04-10 12:18:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5104905,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/b1f3eb48dcce62ecb45b441f.png"},{"id":80314604,"identity":"ebd19d44-891f-49a1-8411-6bbfd3009192","added_by":"auto","created_at":"2025-04-10 12:10:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":11054474,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/b291f348f40dd88218f1c4fc.png"},{"id":80313869,"identity":"c2c69271-3ba3-4598-b8d9-22b4cbec83d2","added_by":"auto","created_at":"2025-04-10 12:02:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":7152888,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/157f3c84d6e4fa478bbef888.png"},{"id":80313839,"identity":"fad35955-e120-418b-b515-d8ef431d90e1","added_by":"auto","created_at":"2025-04-10 12:02:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7635537,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/ab682572f2d918765a0ec2cf.png"},{"id":88506059,"identity":"3e5779f2-a316-4dc8-b81c-7b7c60685b9a","added_by":"auto","created_at":"2025-08-07 07:30:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":41312450,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6200278/v1/60063200-2cd3-46a3-add9-1340441d82f4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Macrophage induces angiogenesis via HIF signaling in denervated muscle following nerve injury.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSkeletal muscle, a highly vascularized tissue, relies on a dynamic interaction with blood vessels to maintain homeostasis under normal physiological conditions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e][\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Microcapillaries play a critical role in supplying oxygen and nutrients to skeletal muscle, while myocytes also contribute to vasodilation, regulating capillary surface area [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e][\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In response to increased metabolic demands, skeletal muscle activates angiogenesis\u0026mdash;the process through which new blood vessels form from pre-existing ones\u0026mdash;thereby enhancing nutrient and oxygen delivery [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This process involves the degradation of the basement membrane surrounding blood vessels, followed by the proliferation and migration of endothelial cells (ECs) to form new capillaries [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Angiogenesis is tightly regulated by a network of pro-angiogenic and anti-angiogenic factors, including growth factors, cytokines, and extracellular matrix proteins.\u003c/p\u003e \u003cp\u003ePeripheral nerve injury leads to nerve degeneration and subsequent skeletal muscle denervation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Neural activity is essential for maintaining normal muscle structure and function, and its loss disrupts this balance. Following denervation, myocytes undergo molecular changes within hours, activating signaling pathways that lead to muscle fiber degeneration and prolonged atrophy [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e][\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Macrophages play a crucial role in these processes by mediating tissue repair through both pro-angiogenic and anti-angiogenic mechanisms. Additionally, denervation results in hypoxic conditions within the muscle, driven by factors such as impaired blood flow regulation, increased metabolic demands, reduced capillary density, and insufficient angiogenesis.\u003c/p\u003e \u003cp\u003eHypoxia-inducible factors (HIFs), the master regulators of angiogenesis, play a central role in modulating macrophage behavior under these hypoxic conditions [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e][\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. HIFs regulate genes involved in oxygen homeostasis, cell survival, inflammation, and angiogenesis. These HIF1 regulated genes mediate the cellular response to low oxygen levels and, when activated, upregulate pro-angiogenic genes that promote blood vessel development. Angiogenesis is not only vital for physiological processes such as wound healing [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], but also plays a central role in pathological conditions such as cancer [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], diabetic retinopathy [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and rheumatoid arthritis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite extensive studies on skeletal muscle degradation following denervation, the response of blood vessels to denervation is poorly understood, particularly in the early stages. Much of the existing literature focuses on the long-term effects of denervation on vascular remodeling [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e][\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], with fewer studies addressing the acute phase of denervation. This study aims to investigate the vascular response in skeletal muscle during both the acute and chronic phases of denervation, shedding light on the underlying mechanisms of angiogenesis and the role of macrophages in this process.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThis study investigates the vascular responses to muscle denervation, utilizing a tightly ligatured sciatic nerve model in mice. The lumbrical and tibialis anterior (TA) muscles were, located in the hind leg and paw, respectively, were analyzed for changes of muscle capillaries following nerve injury.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEarly Angiogenesis in Denervated Muscles\u003c/h2\u003e \u003cp\u003eUpon nerve injury, no immediate disruption in blood flow was observed in the lumbrical muscle, which does not share its blood supply with the sciatic nerve (Fig.\u0026nbsp;1A). To assess circulation, 150 kDa FITC-dextran was injected into the tail vein of wild type mice 30 minutes after nerve ligation. The distribution of FITC was comparable between the contralateral and ipsilateral sides, suggesting that sciatic nerve ligation did not disrupt blood flow to the lumbrical muscle (Fig.\u0026nbsp;1B).\u003c/p\u003e \u003cp\u003eAt postoperative day 3 (PO day 3), we observed a loss of pre-synaptic overlap at the motor endplates, confirming axonal degeneration in the lumbrical muscle (Fig.\u0026nbsp;1C). Using Tie2Cre;R26RTd-Tomato mice, we visualized endothelial cells (ECs) tagged with Td-Tomato fluorescence. On the ipsilateral side of the denervated muscle at PO day 3, we noted a more complex microvascular network with increased capillary branching compared to the contralateral side (Fig.\u0026nbsp;1D, 1E), along with a significant increase in vessel density (Fig.\u0026nbsp;1E).\u003c/p\u003e \u003cp\u003eTo assess endothelial cell (EC) proliferation, EdU, a thymidine analogue incorporated into the DNA of proliferating cells, was injected. EdU-positive ECs were predominantly located at the base of the vessel branches (Fig.\u0026nbsp;1F), in line with their role in vascular sprouting. These ECs exhibited extended cytoplasmic projections (Fig.\u0026nbsp;1G), characteristic of tip cells involved in angiogenesis. These findings suggest that denervation induces angiogenesis in the acute phase.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEndothelial Cell Activation in Denervated Muscle\u003c/h3\u003e\n\u003cp\u003eUnder normal conditions, ECs are quiescent and maintain the integrity of the vascular barrier. After activation, they undergo structural changes that contribute to neovascularization. To assess EC activation,the expression of leukocyte adhesion molecules (Vcam1, Icam1, and Selectin), proteins commonly upregulated in activated ECs, were measured.These molecules were significantly elevated in the denervated lumbrical muscle compared to the contralateral side at PO day 3 (Fig.\u0026nbsp;2A). Immunohistochemistry for CD105, a marker of activated ECs, revealed extensive CD105-positive ECs in the denervated muscle (Fig.\u0026nbsp;2B), further confirming EC activation.\u003c/p\u003e \u003cp\u003eNext vessel integrity was assessed by examining Type IV collagen, a major component of the vascular basal membrane. In the contralateral muscle, blood vessels were overlapped with Type IV collagen (Fig.\u0026nbsp;2B), while many vessels in the denervated muscle lacked this immunoreactivity, suggesting immature and destabilized vessels. Furthermore, mRNA expression of pro-angiogenic factors, including angiopoetin (Agp) 2, platelet-derived growth factor (Pdgf) β, placental growth factor (Pgf), matrix metalloprotease (Mmp) 2, and Mmp3, was elevated in the denervated lumbrical muscle at PO day 3 (Fig.\u0026nbsp;2C), supporting the occurrence of angiogenesis.\u003c/p\u003e\n\u003ch3\u003eAngiogenesis Becomes Inactive in Long-Term Denervated Muscle\u003c/h3\u003e\n\u003cp\u003eAt the chronic stage (PO day 28), the microvascular network remained complex, and vessel density was still higher in the denervated muscle compared to the contralateral side (Fig.\u0026nbsp;3A, 3B). However, no further increase in vessel density was observed after PO day 3, suggesting that angiogenesis had plateaued.\u003c/p\u003e \u003cp\u003eThe EdU assay revealed a significant decrease in EC proliferation at PO day 28 compared to PO day 3 (Fig.\u0026nbsp;3C, 3D). Moreover, the expression of leukocyte adhesion molecules (Vcam1, Icam1, Selectin) was reduced in the denervated muscle at PO day 28 (Fig.\u0026nbsp;3E), indicating decreased EC activation. Immunohistochemistry for CD105 confirmed the reduction of activated ECs in the long-term denervated muscle (Fig.\u0026nbsp;3F). Additionally, TUNEL assays detected apoptosis in ECs, suggesting that angiogenesis was inactive, and that vascular pruning and regression were occurring (Fig.\u0026nbsp;3G).\u003c/p\u003e\n\u003ch3\u003eHypoxia and Macrophage Involvement in Angiogenesis\u003c/h3\u003e\n\u003cp\u003eTissue hypoxia is a key driver of angiogenesis, regulated by HIFs. To evaluate hypoxia in denervated muscle, hypoxyprobe-1 (Pimonidazole) was injected andhypoxic cells were observed in the ipsilateral TA muscle at PO day 3 (Fig.\u0026nbsp;4A). Hypoxia decreased by PO day 28, confirming the acute phase of denervation was hypoxic. qPCR analysis showed that HIF-1α expression, along with its target genes (Vegf and Glut1), was upregulated at PO day 3 and downregulated at PO day 28 (Fig.\u0026nbsp;4B), indicating activation of the hypoxia signaling pathway in the acute phase.\u003c/p\u003e \u003cp\u003eMacrophages, known to sense hypoxia, are crucial for angiogenesis in response to tissue damage. Immunohistochemistry for CD68, a pan-macrophage marker, revealed extensive macrophage infiltration in the denervated muscle at PO day 3 (Fig.\u0026nbsp;4C). Co-localization of hypoxyprobe-1 and CD68 confirmed that macrophages were the primary cells sensing hypoxia, comprising 79.67% of hypoxic cells (Fig.\u0026nbsp;4D). To evaluate macrophage activate HIF1 signaling in denervated muscle, we performed macrophage depletion using PLX3397, a CSF1 receptor inhibitor. The number of macrophage was significantly reduced in denervated muscle of PLX3397-treated mice (Fig.\u0026nbsp;4E). Macrophage depletion significantly reduced HIF signaling, with no increase in Hif-1α, Vegf, or Glut1 expression (Fig.\u0026nbsp;4F).\u003c/p\u003e\n\u003ch3\u003eMacrophages Are Essential for Angiogenesis in Denervated Muscle\u003c/h3\u003e\n\u003cp\u003eTo assess the role of macrophages in angiogenesis, we examined blood vessel formation in macrophage-depleted mice. In PLX3397-treated Tie2-Tomato mice, no significant difference in blood vessel density was observed between the ipsilateral and contralateral sides (Fig.\u0026nbsp;5A). Similarly, the number of proliferating ECs, as assessed by EdU incorporation, was significantly reduced in the denervated muscle (Fig.\u0026nbsp;5B). Additionally, expression level of Vcam, Icam, Selectin, which are markers of activated endothelial cell were significantly lower (Fig.\u0026nbsp;5C), suggesting that macrophage depletion inhibited angiogenesis in denervated muscle. qPCR analysis revealed a significant downregulation of pro-angiogenic genes, such as Pgf, Mmp2, and Mmp3, in macrophage-depleted mice (Fig.\u0026nbsp;5D), supporting the critical role of macrophages in angiogenesis. These findings highlight that macrophages are essential for activating ECs and driving angiogenesis in denervated muscle via HIF signaling.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study demonstrates that muscle denervation induces a robust angiogenic response in the acute phase, marked by significant endothelial cell (EC) activation, vessel sprouting, and the formation of an immature vasculature. However, as time progresses, angiogenesis becomes inactive, and vascular remodeling leads to vessel pruning.\u003c/p\u003e \u003cp\u003ePeripheral nerve injury frequently results in skeletal muscle denervation, which significantly contributes to morbidity and disability, especially among young, otherwise healthy individuals [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e][\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. While numerous studies have explored the biological mechanisms behind denervated muscle, particularly focusing on the pathological processes leading to muscle weakness, the impact of denervation on skeletal muscle blood vessels remains less understood. The present study provides new insights into how denervation influences the vasculature, highlighting the role of hypoxia and angiogenesis in the acute phase following nerve injury.\u003c/p\u003e \u003cp\u003eHypoxia in denervated muscle has been previously reported [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e][\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e][\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], consistent with the findings of this study. Under normal conditions, muscle contractions generate mechanical stimuli that enhance blood flow. However, denervated muscle loses its ability to contract and relax, leading to a reduction in blood flow and, consequently, hypoxia. Additionally, denervated muscle experiences increased oxygen consumption due to the upregulation of proteolytic and glycolytic activity associated with muscle fiber degeneration [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e][\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e][\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. These factors likely contribute to the hypoxic conditions observed in this model of denervation.\u003c/p\u003e \u003cp\u003eTheseresults reveal that during the acute phase following nerve injury, denervated muscle undergoes a proliferative response in endothelial cells, leading to the formation of new, branching blood vessels (Fig.\u0026nbsp;1E-G). This angiogenic response is likely an adaptive mechanism to address hypoxia, as angiogenesis is a well-known physiological and pathological response in a variety of contexts, including embryonic development and disease [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e][\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e][\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Hypoxic conditions trigger rapid endothelial activation, which in turn promotes new blood vessel formation, largely through the upregulation of vascular endothelial growth factor (VEGF) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Consistent with this, increased Vegf expression was observed in denervated muscle at PO day 3 (Fig.\u0026nbsp;4B). Furthermore, our findings suggest that other pro-angiogenic factors, along with hypoxia-sensing macrophages, contribute to this process (Fig.\u0026nbsp;5D). These data indicate that the hypoxia-induced upregulation of pro-angiogenic factors drives angiogenesis in short-term denervated muscle.\u003c/p\u003e \u003cp\u003eAn important aspect of these findings is the role of macrophages in the angiogenic response. Approximately 80% of macrophages in denervated muscle were immunoreactive to hypoxyprobe-1, indicating their response to hypoxic conditions. Macrophage depletion impaired the upregulation of hypoxia-inducible factor 1-alpha (HIF-1α) and its downstream target genes, highlighting the central role of macrophages in the hypoxic response. Macrophage infiltration in denervated muscle during the acute phase following nerve injury is well-documented [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and similar phenomena have been observed in neurodegenerative diseases, such as amyotrophic lateral sclerosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], spinal muscular atrophy [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and Guillain-Barr\u0026eacute; syndrome [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. These findings suggest that macrophages play a pivotal role in denervated muscle, particularly by responding to hypoxic conditions and contributing to angiogenesis. Macrophages are known to rapidly alter their gene expression in response to low oxygen levels [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e][\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e][\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], and in this study, hypoxic conditions were observed which is associated with macrophages, resulting in the accumulation of transcription factors such as HIF-1α. These factors bind to hypoxia response elements in various genes, thereby enhancing their transcription [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. As expected, macrophage activation in response to hypoxia led to the upregulation of pro-angiogenic molecules, including VEGF, fibroblast growth factor (FGF), and matrix metalloproteinases (MMPs). Notably,elevated mRNA expression of Ccl2 and Il-6, two pro-angiogenic factors regulated by HIF-1 were observed, which coincided with macrophage infiltration at PO day 3. Macrophage depletion significantly reduced the expression of these pro-angiogenic factors and inhibited angiogenesis, further supporting the hypothesis that macrophages are key contributors to angiogenesis in denervated skeletal muscle.\u003c/p\u003e \u003cp\u003eThe intriguing role of macrophages in angiogenesis raises important questions regarding the mechanisms underlying this phenomenon. Thesedata suggest that macrophages actively promote angiogenesis in denervated muscle; however, it remains unclear why this angiogenic response is limited to the acute phase following nerve injury. In the chronic phase, a downregulation of endothelial activation markers and pro-angiogenic factors (Fig.\u0026nbsp;3E, 3F, 4B), as well as the expression of apoptosis markers in some endothelial cells was observed (Fig.\u0026nbsp;3G). Similar declines in angiogenesis have been reported in long-term denervated muscle, where the upregulation of pro-angiogenic factors, including VEGF, is associated with capillary regression [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e][\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTwo possible explanations for the downregulation of angiogenesis in chronic denervation are: (1) a reduction in the number of macrophages that promote angiogenesis via HIF-1 signaling, and (2) a shift in the functional phenotype of macrophages between the acute and chronic phases following injury.\u003c/p\u003e \u003cp\u003eMacrophages exhibit functional heterogeneity, with their activation status and functions influenced by the local microenvironment [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Typically, macrophages are classified into two main phenotypes: M1 (pro-inflammatory) and M2 (anti-inflammatory). In the acute phase, M1 macrophages are activated to promote debris clearance, while M2 macrophages are involved in tissue repair during the chronic phase [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e][\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Recent studies suggest that hypoxia induces M1 macrophage polarization via HIF-1α, which stabilizes and upregulates genes related to glycolysis and inflammation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In contrast, M2 macrophages exhibit lower sensitivity to hypoxia, as evidenced by reduced expression of hypoxia-related genes in M2 macrophages compared to M1 macrophages in various hypoxic tissues [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Based on these observations, washypothesized that macrophages in short-term denervated muscle may exhibit an M1 phenotype with stabilized HIF-1α, which then transitions to an M2 phenotype in the chronic phase. Further investigation is required to validate this hypothesis and explore the dynamics of macrophage polarization in the context of denervated muscle.\u003c/p\u003e \u003cp\u003eIn conclusion, these findings provide compelling evidence for the contribution of macrophages to angiogenesis in denervated skeletal muscle during the acute phase following nerve injury. These results offer new insights into the cellular and molecular mechanisms underlying muscle responses to denervation and may inform future therapeutic strategies aimed at promoting muscle regeneration following peripheral nerve injury.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e All animal procedures were approved by the Niigata University Institutional Animal Care and Use Committee (approval number SA01198). This study is reported in accordance with ARRIVE guidelines. Male C57BL/6 mice (8\u0026ndash;12 weeks old) were used in this experimental study. Additionally, the following genetically modified mouse strains were used: Tie2Cre;R26RTd-tomato (referred to as Tie2 Tomato) and Thy1 GFP mice. Mice were housed under standard laboratory conditions in a temperature-controlled room with a 12-hour light/dark cycle, and they had free access to food and water.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSurgical Procedures\u003c/h2\u003e \u003cp\u003eTo generate models of peripheral nerve injury, two types of sciatic nerve injury were performed; nerve ligation for the axon degeneration model and nerve crush for the axon degeneration-regeneration model. Prior to surgery, mice were anesthetized with a mixture of three anesthetic agents\u0026mdash;medetomidine (0.75 mg/kg), midazolam (4 mg/kg), and butorphanol (5 mg/kg)\u0026mdash;administered intraperitoneally at a dosage of 0.1 ml/10 g.\u003c/p\u003e \u003cp\u003eFor the complete axon degeneration model, the left sciatic nerve was exposed and tightly ligated with a 6\u0026thinsp;\u0026minus;\u0026thinsp;0 silk suture. For the axon degeneration-regeneration model, the exposed sciatic nerve was crushed for 30 seconds using smooth-jawed micro forceps. After the injury, the surgical site was closed using sutures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eVascular Circulation Assay\u003c/h2\u003e \u003cp\u003eTo evaluate vascular circulation in the denervated muscle, mice subjected to sciatic nerve ligation were injected with 2.5 mg of 150 kDa FITC-dextran (TdBLabs, 21059) in 50 \u0026micro;l of normal saline via the lateral tail vein, 30 minutes after the surgery. Mice were then allowed to circulate the dye for 1 hour, after which tissues were harvested for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTissue Preparation and Immunohistochemistry\u003c/h2\u003e \u003cp\u003eFollowing deep anesthesia, mice were intracardially perfused with 20 ml of 4% paraformaldehyde (PFA) to fix the tissues. The fixed tissues were processed into 16-\u0026micro;m thick cryosections. These sections were washed in PBS and blocked with 3% normal goat serum for 30 minutes at room temperature. Subsequently, tissue sections were incubated overnight at 4\u0026deg;C with primary antibodies (detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After incubation, sections were incubated with appropriate fluorescent secondary antibodies for 1 hour at room temperature.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEdU Proliferation Detection\u003c/h2\u003e \u003cp\u003eTo assess cell proliferation, mice were injected intraperitoneally with 5-ethynyl-2\u0026acute;-deoxyuridine (EdU, Baseclick, BCK-EdU488IM100) at 50 mg/kg daily for 3 days, beginning on the day of nerve injury. After 6 hours post-injection, mice were intracardially perfused with 4% PFA. The dissected lumbrical muscles were then incubated with a reaction cocktail for 1 hour at room temperature.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL Apoptosis Detection\u003c/h2\u003e \u003cp\u003eApoptotic cells in the tibialis anterior (TA) muscle were detected using a TUNEL assay (Roche, 11684795910). Frozen muscle sections were processed and stained following the manufacturer's protocol for \u003cem\u003ein situ\u003c/em\u003e apoptosis detection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Real-Time PCR (qPCR) Analysis\u003c/h2\u003e \u003cp\u003eRNA was isolated from the contralateral or ipsilateral lumbrical muscle at 3, 7, and 28 days post-injury using the RNeasy kit (QIAGEN). Reverse transcription and quantitative PCR were performed using the qPCR Master Mix kit (Promega, A6001) on a Quant Studio3 real-time PCR machine (Thermo Fisher). The Ct values were normalized to Gapdh, and fold changes were determined using the ΔCt method. Primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eHypoxia Analysis\u003c/h2\u003e \u003cp\u003eHypoxia in the denervated muscle was assessed using the Hypoxyprobe-1 kit (Hypoxyprobe, HP3-100). Mice were administered pimonidazole HCl (1.5 mg/mouse, Hypoxyprobe-1) intraperitoneally. After 3 hours, mice were perfused with 4% PFA, and tissues were collected for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMacrophage Depletion\u003c/h2\u003e \u003cp\u003eMacrophages were depleted using PLX3397, a CSF1R inhibitor, administered via oral gavage. PLX3397 (Chemgood LLC) was incorporated into AIN-76A standard chow at a concentration of 290 mg/kg, and mice were provided with this chow for 7 days prior to sciatic nerve ligation. This protocol was employed to specifically deplete macrophages during the experimental period.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eantibody list\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIdentifier\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat anti-CD105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBioLegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e120401\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat anti-collagen Ⅳ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMillipore\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB769\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat anti-CD68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBio-Rad\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMCA1957GA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlexa Fluor 488 Goat anti-rat IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB150157\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlexa Fluor 488 Donkey anti-goat IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB150129\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlexa Fluor 594 Donkey anti-rat IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA21209\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eqPCR primer list\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eVegf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF ACTGGACCCTGGCTTTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR TCTGCTCTCCTTCTGTCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGlut 1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF ACCTCTTCCGAACCGACAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR TCTGGAGCCATCAAAGTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHIF1-a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF CCAAAGACAATAGCTTCGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR ACAGTCACCTGGTTGCTGCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eVcam\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF GCTGCGAGTCACCATTGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR ACTTCGTTCCAGCTTCCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIcam\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF CTGGGCTTGGAGACTCAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR CCACACTCTCCGGAAACGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSelectin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF ATGAATGCCTCGCGCTTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR AGATGTGTGTAGTCCCGCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAgp2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF TCCTCTTGGGTGCTTTACATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR GTACAGTCTCCGCATTCACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePdgfb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF GAGGACCACCTCGCCTGCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR GCCGGCGGATTCTCACCGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePgf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF CCGACTAGCTTCAGTTCGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR CTGGTGAGGAGTGTTCCGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMmp2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF CTGTCCTGACCAAGGATATAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR CCTTGATGTCATCATGGGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMmp3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF ACTACTATGGCCTTGCAAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR CTCCATAGTGTTGGAGTCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData was analyzed using GraphPad Prism software. One-way ANOVA with Dunnett\u0026rsquo;s multiple comparison test and t-tests were applied as appropriate. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Japan Society for the Promotion of Science (JSPS; 23K24545, 22K10116, 24K19989).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eData is provided in within the manuscript. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.S-Y and T.M wrote the main manuscript text. All authors prepared figures1-5, and reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLatroche, C., et al., \u003cem\u003eSkeletal Muscle Microvasculature: A Highly Dynamic Lifeline.\u003c/em\u003e Physiology (Bethesda), 2015. \u003cstrong\u003e30\u003c/strong\u003e(6): p. 417-27.\u003c/li\u003e\n\u003cli\u003e\u003cem\u003e\u0026lt;tjp0590-6297.pdf\u0026gt;.\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eHellsten, P.S.C.a.Y., \u003cem\u003evasodilatory-mechanisms-in-contracting-skeletal-muscle.pdf\u0026gt;.\u003c/em\u003e 2004.\u003c/li\u003e\n\u003cli\u003eOtrock, Z.K., et al., \u003cem\u003eUnderstanding the biology of angiogenesis: review of the most important molecular mechanisms.\u003c/em\u003e Blood Cells Mol Dis, 2007. \u003cstrong\u003e39\u003c/strong\u003e(2): p. 212-20.\u003c/li\u003e\n\u003cli\u003eLiu, Z.L., et al., \u003cem\u003eAngiogenic signaling pathways and anti-angiogenic therapy for cancer.\u003c/em\u003e Signal Transduct Target Ther, 2023. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 198.\u003c/li\u003e\n\u003cli\u003eZimna, A. and M. Kurpisz, \u003cem\u003eHypoxia-Inducible Factor-1 in Physiological and Pathophysiological Angiogenesis: Applications and Therapies.\u003c/em\u003e Biomed Res Int, 2015. \u003cstrong\u003e2015\u003c/strong\u003e: p. 549412.\u003c/li\u003e\n\u003cli\u003eTonnesen, M.G., X. Feng, and R.A. Clark, \u003cem\u003eAngiogenesis in wound healing.\u003c/em\u003e J Investig Dermatol Symp Proc, 2000. \u003cstrong\u003e5\u003c/strong\u003e(1): p. 40-6.\u003c/li\u003e\n\u003cli\u003eDing, R., et al., \u003cem\u003eVascular endothelial growth factor levels in diabetic peripheral neuropathy: a systematic review and meta-analysis.\u003c/em\u003e Front Endocrinol (Lausanne), 2023. \u003cstrong\u003e14\u003c/strong\u003e: p. 1169405.\u003c/li\u003e\n\u003cli\u003eElshabrawy, H.A., et al., \u003cem\u003eThe pathogenic role of angiogenesis in rheumatoid arthritis.\u003c/em\u003e Angiogenesis, 2015. \u003cstrong\u003e18\u003c/strong\u003e(4): p. 433-48.\u003c/li\u003e\n\u003cli\u003eGrinsell, D. and C.P. Keating, \u003cem\u003ePeripheral nerve reconstruction after injury: a review of clinical and experimental therapies.\u003c/em\u003e Biomed Res Int, 2014. \u003cstrong\u003e2014\u003c/strong\u003e: p. 698256.\u003c/li\u003e\n\u003cli\u003eMidrio, M., \u003cem\u003eThe denervated muscle: facts and hypotheses. A historical review.\u003c/em\u003e Eur J Appl Physiol, 2006. \u003cstrong\u003e98\u003c/strong\u003e(1): p. 1-21.\u003c/li\u003e\n\u003cli\u003eKostrominova, T.Y., \u003cem\u003eSkeletal Muscle Denervation: Past, Present and Future.\u003c/em\u003e Int J Mol Sci, 2022. \u003cstrong\u003e23\u003c/strong\u003e(14).\u003c/li\u003e\n\u003cli\u003eBorisov, A.B., S.-K. Huang, and B.M. Carlson, \u003cem\u003eRemodeling of the vascular bed and progressive loss of capillaries in denervated skeletal muscle.\u003c/em\u003e The Anatomical Record, 2000. \u003cstrong\u003e258\u003c/strong\u003e(3): p. 292-304.\u003c/li\u003e\n\u003cli\u003eBM, C., \u003cem\u003eThe biology of long-term denervated skeletal muscle.\u003c/em\u003e Eur J Transl Myol., 2014. \u003cstrong\u003e24\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eAndrade, J., et al., \u003cem\u003eControl of endothelial quiescence by FOXO-regulated metabolites.\u003c/em\u003e Nat Cell Biol, 2021. \u003cstrong\u003e23\u003c/strong\u003e(4): p. 413-423.\u003c/li\u003e\n\u003cli\u003eLamalice, L., F. Le Boeuf, and J. Huot, \u003cem\u003eEndothelial cell migration during angiogenesis.\u003c/em\u003e Circ Res, 2007. \u003cstrong\u003e100\u003c/strong\u003e(6): p. 782-94.\u003c/li\u003e\n\u003cli\u003eKaramysheva, A.F., \u003cem\u003eMechanisms of angiogenesis.\u003c/em\u003e Biochemistry (Mosc), 2008. \u003cstrong\u003e73\u003c/strong\u003e(7): p. 751-62.\u003c/li\u003e\n\u003cli\u003eBlanco, R. and H. Gerhardt, \u003cem\u003eVEGF and Notch in tip and stalk cell selection.\u003c/em\u003e Cold Spring Harb Perspect Med, 2013. \u003cstrong\u003e3\u003c/strong\u003e(1): p. a006569.\u003c/li\u003e\n\u003cli\u003eSiemerink, M.J., et al., \u003cem\u003eEndothelial tip cells in ocular angiogenesis: potential target for anti-angiogenesis therapy.\u003c/em\u003e J Histochem Cytochem, 2013. \u003cstrong\u003e61\u003c/strong\u003e(2): p. 101-15.\u003c/li\u003e\n\u003cli\u003eSimons, M., \u003cem\u003eAngiogenesis: where do we stand now?\u003c/em\u003e Circulation, 2005. \u003cstrong\u003e111\u003c/strong\u003e(12): p. 1556-66.\u003c/li\u003e\n\u003cli\u003ePatan, S., \u003cem\u003eVasculogenesis and angiogenesis.\u003c/em\u003e Cancer Treat Res, 2004. \u003cstrong\u003e117\u003c/strong\u003e: p. 3-32.\u003c/li\u003e\n\u003cli\u003eAmersfoort, J., G. Eelen, and P. Carmeliet, \u003cem\u003eImmunomodulation by endothelial cells - partnering up with the immune system?\u003c/em\u003e Nat Rev Immunol, 2022. \u003cstrong\u003e22\u003c/strong\u003e(9): p. 576-588.\u003c/li\u003e\n\u003cli\u003eGross, S.J., et al., \u003cem\u003eNotch regulates vascular collagen IV basement membrane through modulation of lysyl hydroxylase 3 trafficking.\u003c/em\u003e Angiogenesis, 2021. \u003cstrong\u003e24\u003c/strong\u003e(4): p. 789-805.\u003c/li\u003e\n\u003cli\u003eWietecha, M.S., W.L. Cerny, and L.A. DiPietro, \u003cem\u003eMechanisms of vessel regression: toward an understanding of the resolution of angiogenesis.\u003c/em\u003e Curr Top Microbiol Immunol, 2013. \u003cstrong\u003e367\u003c/strong\u003e: p. 3-32.\u003c/li\u003e\n\u003cli\u003eKorn, C. and H.G. Augustin, \u003cem\u003eMechanisms of Vessel Pruning and Regression.\u003c/em\u003e Dev Cell, 2015. \u003cstrong\u003e34\u003c/strong\u003e(1): p. 5-17.\u003c/li\u003e\n\u003cli\u003eWatson, E.C., Z.L. Grant, and L. Coultas, \u003cem\u003eEndothelial cell apoptosis in angiogenesis and vessel regression.\u003c/em\u003e Cell Mol Life Sci, 2017. \u003cstrong\u003e74\u003c/strong\u003e(24): p. 4387-4403.\u003c/li\u003e\n\u003cli\u003eKrock, B.L., N. Skuli, and M.C. Simon, \u003cem\u003eHypoxia-induced angiogenesis: good and evil.\u003c/em\u003e Genes Cancer, 2011. \u003cstrong\u003e2\u003c/strong\u003e(12): p. 1117-33.\u003c/li\u003e\n\u003cli\u003eCattin, A.L., et al., \u003cem\u003eMacrophage-Induced Blood Vessels Guide Schwann Cell-Mediated Regeneration of Peripheral Nerves.\u003c/em\u003e Cell, 2015. \u003cstrong\u003e162\u003c/strong\u003e(5): p. 1127-39.\u003c/li\u003e\n\u003cli\u003eKadyrov, F.F., et al., \u003cem\u003eHypoxia sensing in resident cardiac macrophages regulates monocyte fate specification following ischemic heart injury.\u003c/em\u003e Nat Cardiovasc Res, 2024. \u003cstrong\u003e3\u003c/strong\u003e(11): p. 1337-1355.\u003c/li\u003e\n\u003cli\u003eHenze, A.T. and M. Mazzone, \u003cem\u003eThe impact of hypoxia on tumor-associated macrophages.\u003c/em\u003e J Clin Invest, 2016. \u003cstrong\u003e126\u003c/strong\u003e(10): p. 3672-3679.\u003c/li\u003e\n\u003cli\u003eBergmeister, K.D., et al., \u003cem\u003eAcute and long-term costs of 268 peripheral nerve injuries in the upper extremity.\u003c/em\u003e PLoS One, 2020. \u003cstrong\u003e15\u003c/strong\u003e(4): p. e0229530.\u003c/li\u003e\n\u003cli\u003eHajek, I., E. Gutmann, and I. Syrovy, \u003cem\u003ePROTEOLYTIC ACTIVITY IN DENERVATED AND REINNERVATED MUSCLE.\u003c/em\u003e Physiol Bohemoslov (1956), 1964. \u003cstrong\u003e13\u003c/strong\u003e: p. 32-8.\u003c/li\u003e\n\u003cli\u003eH\u0026aacute;jek, I., et al., \u003cem\u003eThe incorporation of S35 methionine into proteins of denervated and reinnervated muscle.\u003c/em\u003e Physiol Bohemoslov, 1966. \u003cstrong\u003e15\u003c/strong\u003e(2): p. 148-57.\u003c/li\u003e\n\u003cli\u003eHudlick\u0026aacute;, O., \u003cem\u003eBlood flow and oxygen consumption in muscles after section of ventral roots.\u003c/em\u003e Circ Res, 1967. \u003cstrong\u003e20\u003c/strong\u003e(5): p. 570-7.\u003c/li\u003e\n\u003cli\u003eBass, A., et al., \u003cem\u003eThe utilization of metabolites in the denervated muscle during stimulation and the restitution phase.\u003c/em\u003e Physiol Bohemoslov (1956), 1962. \u003cstrong\u003e11\u003c/strong\u003e: p. 413-22.\u003c/li\u003e\n\u003cli\u003eWilting, J. and B. Christ, \u003cem\u003eEmbryonic angiogenesis: a review.\u003c/em\u003e Naturwissenschaften, 1996. \u003cstrong\u003e83\u003c/strong\u003e(4): p. 153-64.\u003c/li\u003e\n\u003cli\u003eCarmeliet, P., \u003cem\u003eVEGF as a key mediator of angiogenesis in cancer.\u003c/em\u003e Oncology, 2005. \u003cstrong\u003e69 Suppl 3\u003c/strong\u003e: p. 4-10.\u003c/li\u003e\n\u003cli\u003eLu, C.Y., et al., \u003cem\u003eMacrophage-Derived Vascular Endothelial Growth Factor-A Is Integral to Neuromuscular Junction Reinnervation after Nerve Injury.\u003c/em\u003e J Neurosci, 2020. \u003cstrong\u003e40\u003c/strong\u003e(50): p. 9602-9616.\u003c/li\u003e\n\u003cli\u003e\u003cem\u003e\u0026lt;chiu-et-al-2009-activation-of-innate-and-humoral-immunity-in-the-peripheral-nervous-system-of-als-transgenic-mice.pdf\u0026gt;.\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eDachs, E., et al., \u003cem\u003eDefective neuromuscular junction organization and postnatal myogenesis in mice with severe spinal muscular atrophy.\u003c/em\u003e J Neuropathol Exp Neurol, 2011. \u003cstrong\u003e70\u003c/strong\u003e(6): p. 444-61.\u003c/li\u003e\n\u003cli\u003eKoike, H., et al., \u003cem\u003eUltrastructural mechanisms of macrophage-induced demyelination in Guillain-Barre syndrome.\u003c/em\u003e J Neurol Neurosurg Psychiatry, 2020. \u003cstrong\u003e91\u003c/strong\u003e(6): p. 650-659.\u003c/li\u003e\n\u003cli\u003eWynn, T.A., A. Chawla, and J.W. Pollard, \u003cem\u003eMacrophage biology in development, homeostasis and disease.\u003c/em\u003e Nature, 2013. \u003cstrong\u003e496\u003c/strong\u003e(7446): p. 445-55.\u003c/li\u003e\n\u003cli\u003eZhang, C., M. Yang, and A.C. Ericsson, \u003cem\u003eFunction of Macrophages in Disease: Current Understanding on Molecular Mechanisms.\u003c/em\u003e Front Immunol, 2021. \u003cstrong\u003e12\u003c/strong\u003e: p. 620510.\u003c/li\u003e\n\u003cli\u003eJennifer E.Zielloa, b., I.J. , and a. , \u003cem\u003eHypoxia-InducibleFactor(HIF)-1Regulatory \u003c/em\u003e\u003cem\u003ePathwayanditsPotentialforTherapeutic InterventioninMalignancyandIschemia.\u003c/em\u003e YALEJOURNALOFBIOLOGYANDMEDICINE, 2007. \u003cstrong\u003e80\u003c/strong\u003e: p. 51-60.\u003c/li\u003e\n\u003cli\u003eLee, J.W., et al., \u003cem\u003eHypoxia signaling in human diseases and therapeutic targets.\u003c/em\u003e Exp Mol Med, 2019. \u003cstrong\u003e51\u003c/strong\u003e(6): p. 1-13.\u003c/li\u003e\n\u003cli\u003eTian, X., et al., \u003cem\u003eHypoxia-inducible factor-1alpha enhances the malignant phenotype of multicellular spheroid HeLa cells in vitro.\u003c/em\u003e Oncol Lett, 2010. \u003cstrong\u003e1\u003c/strong\u003e(5): p. 893-897.\u003c/li\u003e\n\u003cli\u003eHua, S. and T.H. Dias, \u003cem\u003eHypoxia-Inducible Factor (HIF) as a Target for Novel Therapies in Rheumatoid Arthritis.\u003c/em\u003e Front Pharmacol, 2016. \u003cstrong\u003e7\u003c/strong\u003e: p. 184.\u003c/li\u003e\n\u003cli\u003eGao, L., et al., \u003cem\u003eThe role of hypoxia-inducible factor 1 in atherosclerosis.\u003c/em\u003e J Clin Pathol, 2012. \u003cstrong\u003e65\u003c/strong\u003e(10): p. 872-6.\u003c/li\u003e\n\u003cli\u003eBorisov, A.B., E.I. Dedkov, and B.M. Carlson, \u003cem\u003eInterrelations of myogenic response, progressive atrophy of muscle fibers, and cell death in denervated skeletal muscle.\u003c/em\u003e Anat Rec, 2001. \u003cstrong\u003e264\u003c/strong\u003e(2): p. 203-18.\u003c/li\u003e\n\u003cli\u003eWagatsuma, A. and T. Osawa, \u003cem\u003eTime course of changes in angiogenesis-related factors in denervated muscle.\u003c/em\u003e Acta Physiol (Oxf), 2006. \u003cstrong\u003e187\u003c/strong\u003e(4): p. 503-9.\u003c/li\u003e\n\u003cli\u003eJablonka-Shariff, A., et al., \u003cem\u003eGpr126/Adgrg6 contributes to the terminal Schwann cell response at the neuromuscular junction following peripheral nerve injury.\u003c/em\u003e Glia, 2020. \u003cstrong\u003e68\u003c/strong\u003e(6): p. 1182-1200.\u003c/li\u003e\n\u003cli\u003eChen, S., et al., \u003cem\u003eMacrophages in immunoregulation and therapeutics.\u003c/em\u003e Signal Transduct Target Ther, 2023. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 207.\u003c/li\u003e\n\u003cli\u003eStrizova, Z., et al., \u003cem\u003eM1/M2 macrophages and their overlaps - myth or reality?\u003c/em\u003e Clin Sci (Lond), 2023. \u003cstrong\u003e137\u003c/strong\u003e(15): p. 1067-1093.\u003c/li\u003e\n\u003cli\u003eWang, T., et al., \u003cem\u003eHIF1\u0026alpha;-Induced Glycolysis Metabolism Is Essential to the Activation of Inflammatory Macrophages.\u003c/em\u003e Mediators Inflamm, 2017. \u003cstrong\u003e2017\u003c/strong\u003e: p. 9029327.\u003c/li\u003e\n\u003cli\u003eKe, X., et al., \u003cem\u003eHypoxia modifies the polarization of macrophages and their inflammatory microenvironment, and inhibits malignant behavior in cancer cells.\u003c/em\u003e Oncol Lett, 2019. \u003cstrong\u003e18\u003c/strong\u003e(6): p. 5871-5878.\u003c/li\u003e\n\u003cli\u003eYamada, Y., et al., \u003cem\u003ePerivascular Hedgehog responsive cells play a critical role in peripheral nerve regeneration via controlling angiogenesis.\u003c/em\u003e Neurosci Res, 2021. \u003cstrong\u003e173\u003c/strong\u003e: p. 62-70\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6200278/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6200278/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSkeletal muscle and blood vessels typically maintain independent homeostasis under normal physiological conditions. However, peripheral nerve injury often leads to skeletal muscle denervation, affecting the richly vascularized tissue. While previous studies have focused on the degradation processes in denervated skeletal muscle, the response of blood vessels to denervation remains poorly understood. This study utilized an animal denervated muscle model to investigate the changes in blood vessel behavior following denervation. Sciatic nerve ligation induced hypoxia and triggered angiogenesis during the acute phase after injury. In the chronic phase, however, quiescent endothelial cells were observed, with no active angiogenesis, despite the presence of a complex microvascular network in the long-term denervated muscle. Notably, we found that macrophages accumulated in short-term denervated muscle, sensing hypoxia and activating the HIF-1 signaling pathway, which drives angiogenesis during acute phase. Macrophage depletion suppressed the expression of pro-angiogenic factors and inhibited angiogenesis, underscoring their essential role in angiogenesis following muscle denervation. This study provides novel insights into the dynamic process of angiogenesis in denervated muscle and highlights the critical involvement of macrophages in this process.\u003c/p\u003e","manuscriptTitle":"Macrophage induces angiogenesis via HIF signaling in denervated muscle following nerve injury.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-10 12:02:19","doi":"10.21203/rs.3.rs-6200278/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-05T10:22:13+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-24T20:23:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"182459857142696255271917648948471753583","date":"2025-04-08T13:41:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-08T12:51:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-08T12:49:46+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-03-29T09:11:07+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-27T01:30:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-27T01:29:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eaf465b3-de26-4bdd-b4b3-1cecbd19454c","owner":[],"postedDate":"April 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46886691,"name":"Biological sciences/Cell biology"},{"id":46886692,"name":"Biological sciences/Molecular biology"},{"id":46886693,"name":"Health sciences/Diseases"}],"tags":[],"updatedAt":"2025-08-07T07:11:51+00:00","versionOfRecord":{"articleIdentity":"rs-6200278","link":"https://doi.org/10.1038/s41598-025-07536-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-19 15:57:04","publishedOnDateReadable":"July 19th, 2025"},"versionCreatedAt":"2025-04-10 12:02:19","video":"","vorDoi":"10.1038/s41598-025-07536-y","vorDoiUrl":"https://doi.org/10.1038/s41598-025-07536-y","workflowStages":[]},"version":"v1","identity":"rs-6200278","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6200278","identity":"rs-6200278","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.