Evaluation value of miR-26a/b-5p on survival prognosis of endometrial carcinoma and identification of its relationship with epigenetic modifier gene EZH2
preprint
OA: closed
CC-BY-4.0
Abstract
Abstract Objective Investigate the prognostic value of miR-26a/b-5p in endometrial carcinoma (EC), and to analyze the relationship between miR-26a/b-5p and target gene EZH2. Methods The expression levels of miR-26a-5p and miR-26b-5p were detected by RT-PCR in 60 cases of EC patients with cancer and normal endometrial tissue adjacent to cancer; Collect medical records of EC patients. To compare the expression difference of miR-26a-5p and miR-26b-5p in cancer tissues and normal endometrial tissues adjacent to cancer, and to compare the expression difference of miR-26a-5p and miR-26b-5p in EC patients with different clinical and pathological characteristics, and to analyze the impact of miR-26a-5p and miR-26b-5p expression levels on survival and prognosis of EC patients. In addition, the target genes of miR-26a-5p and miR-26b-5p were analyzed by bioinformatics analysis to explore their possible mechanisms in the occurrence and development of EC. Results The expression levels of miR-26a-5p and miR-26b-5p in cancer tissues were lower than those in adjacent normal endometrial tissues (P < 0.001); In EC patients, the low expression of miR-26a-5p was significantly correlated with lymph node metastasis, poor differentiation of tumor tissue, and positive ascitic heterotypic cells. The low expression of miR-26b-5p was significantly correlated with advanced patients and lymph node metastasis (P < 0.05). The overall survival rate and tumor free survival rate of the miR-26a-5p overexpression group and the miR-26b-5p overexpression group were higher than those of the corresponding low expression group (P < 0.05); The lower expression levels of miR-26a-5p and miR-26b-5p, the late FIGO stage and the age ≥ 55 years old are independent risk factors for the overall survival rate of EC cancer patients, while the lower expression level of miR-26a-5p and lymph node metastasis are independent risk factors for the tumor free survival rate of EC patients (P < 0.05). EZH2 is the key target gene of miR-26a-5p and miR-26b-5p in EC. EZH2 is highly expressed in EC patient samples (P < 0.05), and can affect the survival rate of EC patients. Conclusion miR-26a-5p and miR-26b-5p are related to the occurrence and progress of EC, and can affect the survival and prognosis of EC patients. They may be used as biological markers to monitor the progress and prognosis of EC, and have the potential to be new targets for treatment of EC, and miR-26a-5p and miR-26b-5p may regulate the occurrence and development of EC by targeting EZH2.
Full text
103,750 characters
· extracted from
preprint-html
· click to expand
Evaluation value of miR-26a/b-5p on survival prognosis of endometrial carcinoma and identification of its relationship with epigenetic modifier gene EZH2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Evaluation value of miR-26a/b-5p on survival prognosis of endometrial carcinoma and identification of its relationship with epigenetic modifier gene EZH2 Yanlu Luo, Jiangtao Fan, Yanrong Huang, Jiahuang Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4245082/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective Investigate the prognostic value of miR-26a/b-5p in endometrial carcinoma (EC), and to analyze the relationship between miR-26a/b-5p and target gene EZH2. Methods The expression levels of miR-26a-5p and miR-26b-5p were detected by RT-PCR in 60 cases of EC patients with cancer and normal endometrial tissue adjacent to cancer; Collect medical records of EC patients. To compare the expression difference of miR-26a-5p and miR-26b-5p in cancer tissues and normal endometrial tissues adjacent to cancer, and to compare the expression difference of miR-26a-5p and miR-26b-5p in EC patients with different clinical and pathological characteristics, and to analyze the impact of miR-26a-5p and miR-26b-5p expression levels on survival and prognosis of EC patients. In addition, the target genes of miR-26a-5p and miR-26b-5p were analyzed by bioinformatics analysis to explore their possible mechanisms in the occurrence and development of EC. Results The expression levels of miR-26a-5p and miR-26b-5p in cancer tissues were lower than those in adjacent normal endometrial tissues (P < 0.001); In EC patients, the low expression of miR-26a-5p was significantly correlated with lymph node metastasis, poor differentiation of tumor tissue, and positive ascitic heterotypic cells. The low expression of miR-26b-5p was significantly correlated with advanced patients and lymph node metastasis (P < 0.05). The overall survival rate and tumor free survival rate of the miR-26a-5p overexpression group and the miR-26b-5p overexpression group were higher than those of the corresponding low expression group (P < 0.05); The lower expression levels of miR-26a-5p and miR-26b-5p, the late FIGO stage and the age ≥ 55 years old are independent risk factors for the overall survival rate of EC cancer patients, while the lower expression level of miR-26a-5p and lymph node metastasis are independent risk factors for the tumor free survival rate of EC patients (P < 0.05). EZH2 is the key target gene of miR-26a-5p and miR-26b-5p in EC. EZH2 is highly expressed in EC patient samples (P < 0.05), and can affect the survival rate of EC patients. Conclusion miR-26a-5p and miR-26b-5p are related to the occurrence and progress of EC, and can affect the survival and prognosis of EC patients. They may be used as biological markers to monitor the progress and prognosis of EC, and have the potential to be new targets for treatment of EC, and miR-26a-5p and miR-26b-5p may regulate the occurrence and development of EC by targeting EZH2. Endometrial carcinoma miR-26a-5p miR-26b-5p Survival prognosis Target gene EZH2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Preface Endometrial carcinoma (EC) is the most common gynecological malignant tumor in economically developed countries, and its incidence in Europe is as high as 13.6/100000 women [1]. Some scholars predict that the incidence of EC will increase by 50-100% in 2025 [2]. At present, the treatment of endometrial cancer is mainly surgery, supplemented by radiotherapy, chemotherapy, endocrine therapy and biological therapy [3]. Early diagnosis and treatment can greatly improve the prognosis of EC patients. Therefore, it is of great significance to seek potential therapeutic targets and biomarkers of EC from the perspective of molecular mechanism. MicroRNAs (miRNAs) can regulate gene expression by combining with the 3 '- Untranslated regions (3' - UTR) of target mRNA, and can play a role in human cancer as tumor inhibitors or carcinogens [4-5]. MiR-26 is considered as a tumor suppressor. Genomic data analysis shows that the human miR-26 family consists of three members, namely miR-26a-1, miR-26a-2 and miR-26b [6]. The study found that the expression of miR-26a/b-5p was down regulated in many solid tumors, and its low expression was related to tumor metastasis, recurrence and survival. According to the previous research of our research group and Jayaraman's research, miR-26a/b-5p is down regulated in EC, which has broad application prospects as a biological marker and therapeutic target for EC diagnosis and prognosis [7-8]. However, at present, the clinical significance of miR-26a/b-5p in EC and its specific mechanism of action are not completely clear. Based on this, this study analyzed the expression level, clinical significance and prognostic value of miR-26a/b-5p in EC, predicted its target through bioinformatics, and explored the possible mechanism of miR-26a/b-5p in EC, providing a new direction for molecular mechanism research of EC. Methods 1.1 Patients and sample collection 60 EC patients who received surgical treatment in the First Affiliated Hospital of Guangxi Medical University from July 2016 to February 2017 were collected as the study subjects. The cancerous tissue and normal endometrial tissue adjacent to cancer that were removed during surgery were collected. The adjacent non cancerous endometrial tissue was at least 2cm away from the tumor. All tissue samples were stored in liquid nitrogen tanks at - 80 ° C. Inclusive criteria: (1) After preoperative diagnosis and curettage, pathological examination confirmed endometrial cancer; (2) All patients did not receive chemotherapy or radiotherapy before operation; (3) Independent review and diagnosis by two pathologists. Exclusion criteria: other malignant tumors. This study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University. This study obtained the informed consent of patients and their families, and signed the relevant informed consent form. 1.2 Detection of miR-26a/b-5p expression level Take out the sample tissue from liquid nitrogen and put it into a mortar. Add proper amount of liquid nitrogen and grind it together. Clean the mortar thoroughly before grinding the next sample to avoid cross contamination. According to the manufacturer's instructions, RNAiso is used to indicate pure RNA by measuring by NanoDrop 2000 (Wilmington, DE, USA), considering the absorbance parameter of 260/280 nm ratio of about 2.0. Only RNA samples with good proportion and yield of more than 500 ng were selected for microRNA expression analysis. According to the manufacturer's recommendation, 100 ng total RNA was reverse transcribed using the Mir-X miRNA first strand synthesis kit (Takara Bio Inc., Dalian, China). Use specific microRNA primers (miR-26a-5p, miR-26b-5p) to quantify the obtained cDNA three times through qRT-PCR, and use SYBR Green method in 7500 PCR instrument (application of biological system). The abundance of miR-26a/b-5p in each sample was standardized to its reference value. We selected U6 as the internal reference gene for this study. The expression of miR-26a/b-5p in tissue experiments was calculated using the formula 2-Δct, ΔCt = (Ct miR-26a/b-5p – Ct U6)。 The primer sequence is: miR-26a-5p-F:ACCAAGTAATCCAGGATAGGCTAAA miR-26b-5p-F:ATCGGGTAATTCAGGATAGGTAAAA U6-F:GGAACGATACAGAGAAGATTAGC U6-R:TGAACGCTTCACGAATTTGCG 1.3 Collection and follow-up of clinical and pathological data of EC patients The clinicopathological information of patients was obtained through the medical records of the First Affiliated Hospital of Guangxi Medical University, including age, FIGO stage, lymph node metastasis, vascular invasion, ascites detection, deep muscle layer invasion, tumor size, tissue differentiation, and tumor classification (type I: estrogen dependent; type II: estrogen independent; This classification is based on the expression of estrogen and progesterone receptors detected by the pathology department ) and other relevant data. The recurrence and death of 60 patients within 5 years after operation were obtained through telephone follow-up and medical follow-up. 45 patients completed the follow-up, and 15 patients lost the follow-up. All patients received standard treatment suitable for their respective stages after surgery, and 17 patients of them were confirmed to have died of EC during 5-year follow-up. Recurrence time refers to the time from the day of operation to the time when the recurrence is confirmed by pathology or radiology; Time of death refers to the time from the day of operation to the day of death of the patient. 1.4 Grouping According to the median level of miR-26a-5p and miR-26b-5p expression as the threshold, 60 EC patients were equally divided into two groups: miR-26a-5p high expression group, miR-26a-5p low expression group, miR-26b-5p high expression group, and miR-26b-5p low expression group, with 30 cases in each group; Then, the four groups were divided according to the common clinicopathological factors such as age, stage, lymph node metastasis, vascular invasion, deep muscle invasion, ascites heterotypic cell detection results, tumor tissue differentiation, tumor size and tumor classification. 1.5 Bioinformatics Analysis of miR-26a/b-5p Target Genes The target genes of miR-26a/b-5p were cross-identified by miRDB, miRTarBase, and TargetScan. In addition, we used the GEPIA (http://gepia.cancerpku.cn/) website to analyze differentially expressed genes in endometrial cancer; The top 50 pivotal target genes of miR-26a/b-5p in the PPI network were screened by Cytoscape software, and the key target genes were finally determined. The expression levels of key target genes of miR-26a/b-5p in EC were analyzed by GEPIA, and the effect of key target genes of miR-26a/b-5p on the survival of EC patients was evaluated by The KaplanMeier Plotter (https://kmplot.com/analysis/) website.. 1.6 Statistical analysis SPSS26.0 was used for statistical analysis of the data. The measurement data were described by means of mean ± standard deviation. Two independent sample t-tests were used for comparison between groups; Counting data were expressed in cases (percentage), and X2 test was used for comparison between groups; Kaplan Meier method was used to calculate the survival rate, and Log-rank test was used to check whether there was any difference in the survival curve between the comparison groups; Cox regression was used to analyze the factors affecting the overall survival of patients. The factors with statistically significant differences in single factor Cox regression analysis and the factors that may affect the survival of patients in the profession were included in the multi factor Cox regression, and stepwise regression was performed to calculate the risk ratio (HR) and its corresponding 95% confidence interval (CI). In this study, the difference was statistically significant in both sides of the P<0.05. Results 2.1 Comparison of miR-26a/b-5p expression level in EC tissues and paracancerous tissues The results showed that the expression levels of miR-26a-5p and miR-26b-5p in cancer tissues were lower than those in adjacent normal endometrial tissues in 60 EC patients (all P<0.001); The relative expression of miR-26a-5p was 0.408 ± 0.144 in cancer tissues and 1.400 ± 0.258 in normal endometrial tissues; The relative expression of miR-26b-5p in cancer tissue was 0.157 ± 0.035, while in normal endometrial tissue was 0.721 ± 0.084, as shown in Figure 1. 2.2 Relationship between miR-26a/b-5p and clinicopathological characteristics of EC patients By comparing the expression levels of miR-26a-5p and miR-26b-5p between groups, the results showed that the low expression of miR-26a-5p in EC patients was significantly correlated with lymph node metastasis, poor differentiation of tumor tissue, and positive ascites heterotypic cells (P<0.05); The low expression of miR-26b-5p was significantly correlated with advanced patients and lymph node metastasis (P<0.05). However, the expression of miR-26a-5p was not related to other clinicopathological characteristics, such as age, clinical stage of tumor, vascular invasion, deep muscle invasion, tumor type and tumor size, while miR-26b-5p was not related to age, vascular invasion, deep muscle invasion, tissue differentiation, ascitic heterotypic cells, tumor type and tumor size (P>0.05), as shown in Table 1. 2.2 The relationship between miR-26a/b-5p and survival prognosis of EC patients 2.2.1 Effect of miR-26a/b-5p expression level on 5-year survival of EC patients Kaplan Meier method was used to calculate the survival rate. The 5-year average survival time of the high expression group of miR-26a-5p was 56.292 ± 2.062 (months), the 5-year survival rate was 86.1%, and the 5-year average survival time of the low expression group of miR-26a-5p was 40.630 ± 4.394 (months), the 5-year survival rate was 56.8%. The 5-year average survival time of the high expression group of miR-26b-5p was 54.963 ± 2.483 (months), and the 5-year survival rate was 86.2%. The 5-year average survival time of the low expression group of miR-26b-5p was 41.827 ± 4.370 (months), and the 5-year survival rate was 44.5%. The overall survival rate of miR-26a-5p high expression group was higher than that of miR-26a-5p low expression group (Log-rank c2=6.331, P=0.012); The overall survival rate of the miR-26b-5p overexpression group was higher than that of the miR-26b-5p low expression group (Log rank c2=8.238, P=0.004), as shown in Figure 2. In addition, the 5-year average tumor-free survival time of the high miR-26a-5p expression group was 54.637 ± 2.142 (months), the 5-year tumor-free survival rate was 78.3%, the 5-year average tumor-free survival time of the low miR-26a-5p expression group was 38.481 ± 4.778 (months), the 5-year tumor-free survival rate was 58.3%, the 5-year average tumor-free survival time of the high miR-26b-5p expression group was 53.256 ± 2.953 (months), and the 5-year tumor-free survival rate was 81.9%, The mean 5-year tumor-free survival time of the low expression group of miR-26b-5p was 38.846 ± 4.463 (months), and the 5-year tumor-free survival rate was 48.3%. The tumor-free survival rate of miR-26a-5p high expression group was higher than that of miR-26a-5p low expression group (Log rank c2=6.244, P=0.012); The tumor-free survival rate of the high expression group of miR-26b-5p was higher than that of the low expression group of miR-26b-5p (Log rank c2=6.421, P=0.011). As shown in Figure 3. 2.2.2 Single factor analysis on influencing factors of 5-year survival of EC patients In COX univariate analysis, the expression levels of miR-26a-5p and miR-26b-5p were related to the overall survival rate of endometrial cancer (miR-26a-5p: P=0.018; miR-26b-5p: P=0.009). Age, FIGO stage, tumor tissue differentiation, lymph node metastasis and vascular invasion were all factors influencing the overall survival rate of endometrial cancer (all P<0.05). In the COX univariate analysis of tumor-free survival rate, we found that the expression level of miR-26a-5p and miR-26b-5p can affect the recurrence rate after EC surgery (miR-26a-5p: P=0.02; miR-26b-5p: P=0.019). FIGO stage and lymph node metastasis are the influencing factors of the recurrence rate after EC surgery (P<0.05), as shown in Table 2. 2.2.3 Multifactor analysis of influencing factors of 5-year survival of EC patients The statistically significant factors in the univariate analysis were included in the Cox regression analysis model. The results showed that the lower expression levels of miR-26a-5p and miR-26b-5p, the late FIGO stage, and the age ≥ 55 years were independent risk factors for the overall survival rate of EC cancer patients; The reduction of miR-26a-5p expression and lymph node metastasis are independent risk factors for tumor free survival of EC patients, as shown in Table 3. 2.3 Bioinformatics analysis results of miR-26a/b-5p target gene Eight target genes of miR-26a-5p and 110 target genes of miR-26b-5 were found through cross identification of miRDB, miRTarBase and TargetScan databases, as shown in Figure 4; In addition, the first 50 hub genes of miR-26a-5p and miR-26b-5p were screened by using the node connectivity (degree) of Cytoscape software (Figure 5), indicating that these target genes may play a more important role. Subsequently, GEIPA database was used to identify the differentially expressed genes between endometrial cancer samples and normal samples (screening criteria: |Log FC|>1, P<0.05), and 2038 up-regulated genes and 3489 down-regulated genes were obtained, as shown in Figure 6. Since previous studies and this study both showed that miR-26a-5p and miR-26b-5p were low expressed in EC, their target genes should be those up-regulated in EC. Therefore, we respectively connected the 2038 genes up-regulated in EC with the top 50 hub genes of PPI of miR-26a-5p and miR-26b-5p, and finally determined that the key target gene of miR-26a-5p and miR-26b-5p in EC was human Zeste homolog enhancer 2 (EZH2). In GEPIA database, EZH2 was highly expressed in EC patients compared with normal samples (P<0.05), as shown in Figure 7. Kaplan Meier Plotter showed that RFS in EZH2 high expression group was lower than that in EZH2 low expression group (P<0.05), as shown in Figure 8. Discussion With the improvement of medical level, the prognosis of EC patients has been greatly improved, but its incidence is still increasing, and the prognosis of EC patients with high-risk factors and advanced diagnosis is still not ideal. In recent years, it has become a research hotspot to explore the diagnostic means and therapeutic targets of tumors based on molecular mechanism research. Therefore, it will have important clinical value to seek new diagnostic biomarkers and therapeutic targets by studying the pathogenesis of EC. MiRNA has been confirmed to be abnormally expressed in a variety of tumors, and is one of the hot molecules in tumor molecular mechanism research [8-9]. It was found that miR-26a/b-5p was down regulated in EC, suggesting that miR-26a/b-5p, as a tumor suppressor, participates in the regulation of the occurrence and development of EC [8]. In this study, the expression level of miR-26a/b-5p in endometrial carcinoma tissue and normal adjacent endometrial tissue of the same EC patient was detected. The results showed that the expression level of miR-26a/b-5p in endometrial carcinoma tissue was lower than that in normal adjacent endometrial tissue (p<0.05); Our research results, as well as those of Jayaraman and others [7], indicate that miR-26a-5p and miR-26b-5p, as tumor suppressor miRNAs, play a key role in the development of endometrial cancer. However, for the folding changes of miR-26a-5p and miR-26b-5p, this study is somewhat different from the results of Jayaraman et al. (miR-26a-5p: 3.1/3.4; miR-26b-5p: 2.6/4.6); The possible reason is that the control group selected by Jayaraman and others is the endometrial tissue of normal people, while the control group selected in this study is the corresponding non cancerous endometrial tissue of EC patients, which suggests that studying the dynamic changes of miR-26a-5p, miR-26b-5p expression levels in the occurrence and progression of endometrial cancer may have some value, for example, comparing the differences in the expression levels of miR-26a-5p and miR-26b-5p in normal endometrial tissue, atypical endometrial hyperplasia tissue, adjacent non-cancerous tissue, and endometrial cancer tissue may provide new ideas for the identification of these diseases. This study explored the relationship between the expression levels of miR-26a-5p, miR-26b-5p and the clinicopathological characteristics of EC patients. The results showed that the expression levels of miR-26a-5p and miR-26b-5p in lymph node metastasis group were lower than those in non lymph node metastasis group; In addition, the low expression level of miR-26a-5p was also associated with ascites heterotypic cell positive and poor tumor tissue differentiation, while miR-26b-5p was associated with late tumor stage. This indicates that the expression levels of miR-26a-5p and miR-26b-5p are significantly related to EC tumor invasion and metastasis. In clinical practice, it may be possible to predict EC metastasis and deterioration by detecting the expression levels of miR-26a-5p and miR-26b-5p. However, the sample size of this study is small, and the selected clinical samples are tissues, which are difficult to obtain, invasive, and cumbersome in processing. In the future, a larger cohort is needed for further research, and the expression and clinical significance of miR-26a-5p and miR-26b-5p in the serum of EC patients and normal people need to be analyzed and verified. In addition, this study also explored the relationship between miR-26a-5p, miR-26b-5p and survival and prognosis of EC patients. The results showed that the 5-year overall survival rate and tumor-free survival rate of the high expression group of miR-26a-5p and miR-26b-5p were higher than those of the low expression group. In order to further explore the influence of miR-26a-5p and miR-26b-5p on the survival and prognosis of EC patients, this study also conducted a multivariate Cox regression analysis. The results showed that the expression level of miR-26a-5p was an independent factor affecting the 5-year overall survival rate and tumor-free survival rate of EC patients, while the expression level of miR-26b-5p was only an independent factor influencing the 5-year overall survival rate. It shows that the decrease of miR-26a-5p expression can lead to the increase of postoperative recurrence rate and the shortening of survival time of EC patients, while the decrease of miR-26b-5p expression can lead to the shortening of survival time of EC patients, suggesting that the decrease of miR-26a-5p and miR-26b-5p expression can lead to poor prognosis of EC patients. In fact, previous studies have confirmed that tumor patients with high expression of miR-26a-5p have a better prognosis, with a longer overall survival (OS) and recurrence time (TTR) [10]. For example, in hepatocellular carcinoma, miR-26a-5p and miR-26b-5p enhance levels of the oncogenic cytokine IL-6, thereby promoting the onset and progression of hepatocellular carcinoma[11]. In gastric cancer tissue, patients with low expression of miR-26a-5p have shorter median OS time and relapse free survival (RFS) than patients with high expression of miR-26a-5p [12-13]. Ding et al. found that the low expression of miR-26b-5p was associated with the reduction of metastasis free survival and overall survival of breast cancer patients[14]. According to Xie et al., the increased expression level of miR-26a-5p is related to the late clinical stage and distant metastasis of osteosarcoma patients, and its expression level can be an independent influencing factor for the survival rate of osteosarcoma [15]. Gonzalez Ariagada and his colleagues detected the expression level of miR-26-5p in the tumor tissues of patients with head and neck squamous cell carcinoma (HNSCC) with or without lymph node metastasis. The results showed that the expression level of miR-26-5p in metastatic primary HNSCC was high, and the high expression of miR-26-5p was related to lymph node metastasis, poor differentiation and shortened disease-free survival of HNSCC patients [16]. The above research shows that miR-26a-5p and miR-26b-5p have important research value as biological markers to evaluate tumor prognosis, and can be used as candidate markers for prognosis evaluation of EC patients. MiRNAs regulate tumor progression by inhibiting the expression of target genes. Therefore, this study also predicted the target genes of miR-26a-5p and miR-26b-5p through bioinformatics. It was found that miR-26a-5p and miR-26b-5p could regulate the expression of EZH2 in EC, and it was speculated that EZH2 was the key target gene for miR-26a-5p and miR-26b-5p to play a role in EC. EZH2 plays an important role in epigenetic modification. It can methylate histone H3K27 in the nucleus, and affect stem cell differentiation and development by regulating the expression of target genes. It has been proved to be a cancer promoting factor for many tumors [17]. This study explored the expression of EZH2 in EC and its prognostic value. The results showed that the expression of EZH2 was up-regulated in EC, and the high expression of EZH2 was associated with poor survival and prognosis of EC patients. Previous studies have found that EZH2 is up-regulated in endometrial cancer tissues and cells, indicating that EZH2 is a new prognostic biomarker and a potential target for EC therapy [18], which is consistent with our results.Now, researchers have developed many drugs under research for single or multiple targets of EZH2 through screening the compound library and structural optimization. Recently, a histone methyltransferase EZH2 inhibitor developed by Hengrui Group has entered the phase 3 clinical trial phase, which will provide a new scheme for the treatment of multiple malignant tumors. However, at present, the specific mechanism of miR-26a-5p and miR-26b-5p regulating EZH2 in EC needs further study, and how EZH2 as a key target plays a role in EC needs more research. Declarations Ethics approval and consent to participate This study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University (Nanning, China), No. 2021(KY-E-200). This study obtained the informed consent of patients and their families, and signed the relevant informed consent form. Consent for publication Not applicable. Availability of data and materials Not applicable. Competing interests The authors report no confict of interest. Funding The study was supported by the National Natural Science Foundation of China (No.81960464) Authors' contributions JF formulated the research protocol and guided the work. YL collected and analyzed the data for this study and wrote the article, and is the first author.YH and JY collected the data for this study. References Markowska A, Szarszewska M, Knapp P, et al. The role of nesfatin and selected molecular factors in various types of endometrial cancer[J]. Ginekol Pol, 2019, 90(10): 571-576. Adishesh M and Hapangama DK. Enriching Personalized Endometrial Cancer Research with the Harmonization of Biobanking Standards[J]. Cancers (Basel), 2019, 11(11). MacKintosh ML and Crosbie EJ. Prevention Strategies in Endometrial Carcinoma[J]. Curr Oncol Rep, 2018, 20(12): 101. Ma M, Hui J, Zhang QY, et al. Long non-coding RNA nuclear-enriched abundant transcript 1 inhibition blunts myocardial ischemia reperfusion injury via autophagic flux arrest and apoptosis in streptozotocin-induced diabetic rats[J]. Atherosclerosis, 2018, 277: 113-122. Xia T, Xiao B-X and Guo J-M. Acting mechanisms and research methods of long noncoding RNAs[J]. Hereditas (Beijing), 2013, 35(3): 269-280. Yahya SMM, Nabih HK, Elsayed GH, Mohamed SIA, Elfiky AM, Salem SM. Restoring microRNA-34a overcomes acquired drug resistance and disease progression in human breast cancer cell lines via suppressing the ABCC1 gene. Breast Cancer Res Treat. 2024;204(1):133-149. Reicher A, Fosselteder J, Kwong LN, et al. Crosstalk between the Notch signaling pathway and long non-coding RNAs[J]. Cancer Lett, 2018, 420: 91-96. Acharya A, Berry DC, Zhang H, et al. miR-26 suppresses adipocyte progenitor differentiation and fat production by targeting Fbxl19. Genes Dev. 2019;33(19-20):1367-1380. Fan JT, Zhou ZY, Luo YL, et al. Exosomal lncRNA NEAT1 from cancer-associated fibroblasts facilitates endometrial cancer progression via miR-26a/b-5p-mediated STAT3/YKL-40 signaling pathway. Neoplasia. 2021;23(7):692-703. Jayaraman M, Radhakrishnan R, Mathews CA, et al. Identification of novel diagnostic and prognostic miRNA signatures in endometrial cancer[J]. Genes Cancer, 2017, 8(5-6): 566-576. Ricci C, Marzocchi C and Battistini S. MicroRNAs as Biomarkers in Amyotrophic Lateral Sclerosis[J]. Cells, 2018, 7(11). Stappert L, Klaus F and Brüstle O. MicroRNAs Engage in Complex Circuits Regulating Adult Neurogenesis[J]. Front Neurosci, 2018, 12: 707. Yang X, Liang L, Zhang XF, et al. MicroRNA-26a suppresses tumor growth and metastasis of human hepatocellular carcinoma by targeting interleukin-6-Stat3 pathway[J]. Hepatology, 2013, 58(1): 158-170. Lin Y, Jian Z, Jin H, et al. Long non-coding RNA DLGAP1-AS1 facilitates tumorigenesis and epithelial-mesenchymal transition in hepatocellular carcinoma via the feedback loop of miR-26a/b-5p/IL-6/JAK2/STAT3 and Wnt/β-catenin pathway. Cell Death Dis. 2020;11(1):34. Published 2020 Jan 16. Deng M, Tang HL, Lu XH, et al. miR-26a suppresses tumor growth and metastasis by targeting FGF9 in gastric cancer[J]. PLoS One, 2013, 8(8): e72662. Qiu X, Zhu H, Liu S, et al. Expression and prognostic value of microRNA-26a and microRNA-148a in gastric cancer[J]. J Gastroenterol Hepatol, 2017, 32(4): 819-827. Ding Q, Wang Y, Zuo Z, et al. Decreased expression of microRNA-26b in locally advanced and inflammatory breast cancer[J]. Hum Pathol, 2018, 77: 121-129. Song QC, Shi ZB, Zhang YT, et al. Downregulation of microRNA-26a is associated with metastatic potential and the poor prognosis of osteosarcoma patients[J]. Oncol Rep, 2014, 31(3): 1263-1270. Xie XY, Chen XM, Shi L, Liu JW. Increased expression of microRNA-26a-5p predicted a poor survival outcome in osteosarcoma patients: An observational study. Medicine (Baltimore). 2021;100(12):e24765. González-Arriagada WA, Olivero P, Rodríguez B, et al. Clinicopathological significance of miR-26, miR-107, miR-125b, and miR-203 in head and neck carcinomas[J]. Oral Dis[J]. 2018, 24(6): 930-939. Huang J, Gou H, Yao J, Yi K, Jin Z, Matsuoka M, Zhao T. The noncanonical role of EZH2 in cancer[J]. Cancer Sci, 2021, 112(4):1376-1382. Gui T, Liu M, Yao B, et al. TCF3 is epigenetically silenced by EZH2 and DNMT3B and functions as a tumor suppressor in endometrial cancer[J]. Cell Death Differ, 2021,28(12):3316-3328. Tables Table 1 The relationship between the expression level of miR-26a/b-5p and the clinicopathological parameters of endometrial carcinoma clinicopathologic factors miR-26a-5p P miR-26a-5p P High Low High Low n(%) n(%) n(%) n(%) Age ≥55y 14 (46.7) 16(53.3) 14 (46.7) 16(53.3) <55y 16 (53.3) 14(46.7) 0.606 16 (53.3) 14(46.7) 0.606 In installments I-II 24 (80) 18 (60) 25 (83.3) 17(56.7) III-IV 6 (20) 12 (40) 0.091 5 (16.7) 13(43.3) 0.024 lymph node metastasis be 6 (20) 17(56.7) 7 (23.3) 16(53.3) no 24 (80) 13(43.7) 0.003 23 (76.7) 14(46.7) 0.017 vascular invasion be 3 (10) 6 (20) 2 (6.7) 7(23.3) no 27 (90) 24 (80) 0.278 28 (93.3) 23(76.7) 0.071 Deep muscle infiltration be 10 (33.3) 8(26.7) 11 (36.7) 7(23.3) no 20 (66.7) 22(73.3) 0.573 19 (63.3) 23(76.7) 0.260 Ascites heterogeneous cells (+) 4 (13.3) 11(36.7) 5 (16.7) 10(33.3) (-) 26 (86.7) 19 63.3) 0.037 25 (83.3) 20(66.7) 0.136 Tumor differentiation G1 23 (76.7) 13(43.3) 21 (70) 15 (50) G2 4 (13.3) 11(36.7) 4 (13.3) 11(36.7) G3 3 (10) 6 (20) 0.03 0 5 (16.7) 4(13.3) 0.112 Tumor size ≥2cm 16 (53.3) 17(56.7) 14 (46.7) 19(63.3) <2cm 14 (46.7) 13(43.3) 0.795 16 (53.3) 11(36.7) 0.194 Tumor typing Type I 26 (86.7) 22(73.3) 22 (73.3) 26(86.7) Type II 4 (13.3) 8 (26.7) 0.197 8 (26.7) 4 (13.3) 0.197 Table 2 The relationship between the expression level of miR-26a/b-5p and clinicopathological parameters and the survival rate of endometrial cancer patients clinicopathologic factors 5 years overall Survival rate HR (95% CI) P 5 years tumor free Survival rate HR (95% CI) P Age ≥55y <55y In installments I-II III-IV lymph node metastasis be no vascular invasion be no deep muscle invasion be no Ascites heterogeneous cells sun cloudy Tumor differentiation tall middle low Tumor size ≥2cm <2cm Tumor type Type I Type II miR-26a-5p Highly Expressive low expression miR-26b-5p Highly Expressive low expression 53.5% 82.7% 0.222(0.072-0.688) 0.009 85.0% 30.1% 5.756(2.115-15.668) 0.001 33.1% 88.9% 0.145(0.047-0.447) 0.001 17.8% 79.5% 0.203(0.074-0.561) 0.002 50.8% 73.0% 0.807(0.298-2.185) 0.673 45.7% 74.7% 0.495(0.174-1.409) 0.187 0.025 81.8% 53.3% 2.975(0.956-9.261) 0.06 40.0% 4.911(1.492-16.165) 0.009 59.9% 79.5% 0.520(0.183-1.477) 0.22 70.2% 58.3% 1.066(0.292-3.882) 0.923 83.3% 58.3% 0.283(0.099-0.809) 0.018 86.5% 54.1% 0.221(0.071-0.684) 0.009 54.3% 75.7% 0.507(0.195-1.315) 0.163 75.5% 43.1% 3.038(1.201-7.681) 0.019 31.9% 84.7% 0.168(0.059-0.478) 0.001 53.3% 69.4% 0.424(0.138-1.305) 0.135 58.9% 69.5% 0.823(0.308-2.201) 0.698 63.5% 80.0% 1.637(0.376-7.128) 0.512 72.8% 0.298 54.9% 1.628(0.543-4.879) 0.384 53.3% 2.474(0.760-8.046) 0.132 66.6% 66.5% 0.986(0.389-2.500) 0.976 75% 64.4% 0.842(0.244-2.911) 0.786 78.3% 58.3% 0.304(0.112-0.828) 0.02 81.9% 48.3% 0.287(0.101-0.815) 0.019 Table 3 Cox regression analysis results of multiple factors of miR-26a/b-5p affecting total survival and tumor free survival of patients clinicopathologic factors 5-year overall survival rate 5-year tumor-free survival rate HR(95% CI) P HR(95% CI) P Expression of miR-26a-5p Highly Expressive low expression Expression of miR-26b-5p Highly Expressive low expression Age ≥55y <55y In installments Phase I-II Phase III-IV lymph node metastasis be no 0.122(0.031-0.475) 0.002 0.232(0.068-0.796) 0.02 0.196(0.051-0.760) 0.018 5.267(1.242-22.326) 0.024 0.289(0.096-0.87) 0.027 0.259(0.075-0.901) 0.034 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4245082","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":292078698,"identity":"d47e072f-dea2-4f27-8a8b-259153fa7848","order_by":0,"name":"Yanlu Luo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYBACfvnnxz98+FFTz8beQKQWyYacNMaZPccS+HgOEKnF4ECCGTMHG3OCnEQC0bYcSHvMwMOWxyb5eOMNhhqbaIJa+BkbjxsXWMgUs0mnFVswHEvLbSBoSzNDgvQMHjbGNukcMwnGhsOEtRgcYzCQ5mFjZmyTPEOsljMMZiAtiW0SPERqkZzBk2wIDGRjNh6gXxKI8Qu/BPvBB8ColJNvP7zxxocaG8JaUBxJdNQgaSFVxygYBaNgFIwMAADwJDt5dIEDBQAAAABJRU5ErkJggg==","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yanlu","middleName":"","lastName":"Luo","suffix":""},{"id":292078699,"identity":"de4faa54-96c2-416e-b195-7cec84ea7f7b","order_by":1,"name":"Jiangtao Fan","email":"","orcid":"","institution":"First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiangtao","middleName":"","lastName":"Fan","suffix":""},{"id":292078700,"identity":"e0d7e92a-3cf8-460f-8720-7fd7c934cd44","order_by":2,"name":"Yanrong Huang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yanrong","middleName":"","lastName":"Huang","suffix":""},{"id":292078703,"identity":"8c34f652-8e50-4631-8f4c-be648a8d031d","order_by":3,"name":"Jiahuang Yang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiahuang","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-04-10 04:46:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4245082/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4245082/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55317215,"identity":"cfd749fd-19a3-4a22-af92-d0f906706add","added_by":"auto","created_at":"2024-04-25 15:50:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":385613,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of miR-26a-5p and miR-26b-5p in endometrial carcinoma and normal endometrial tissue (* p\u0026lt;0.05, * * p\u0026lt;0.01, * * * p\u0026lt;0.001)\u003c/p\u003e\n\u003cp\u003eA: miR-26a-5p \u0026nbsp;B: miR-26b-5p\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/866dc4d2bbee66f1fc2c7534.png"},{"id":55317214,"identity":"69e9e059-d86b-47ab-b033-25820638ebb3","added_by":"auto","created_at":"2024-04-25 15:50:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":194682,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the total survival curve between the two groups\u003c/p\u003e\n\u003cp\u003eA: miR-26a-5p \u0026nbsp;B: miR-26b-5p\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/4edcf87482acf85ea0a498b4.png"},{"id":55317221,"identity":"baa7fba4-8c5f-45f5-8132-401a0d74b322","added_by":"auto","created_at":"2024-04-25 15:50:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":152672,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of tumor-free survival curves between two groups\u003c/p\u003e\n\u003cp\u003eA: miR-26a-5p \u0026nbsp;B: miR-26b-5p\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/7491eaa147fbd7f1bf04134b.png"},{"id":55317220,"identity":"b743a7a3-3a20-4fdc-a198-f8c925329bce","added_by":"auto","created_at":"2024-04-25 15:50:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":203036,"visible":true,"origin":"","legend":"\u003cp\u003eVenn diagram of three datasets\u003c/p\u003e\n\u003cp\u003eA: miR-26a-5p \u0026nbsp;B: miR-26b-5p\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/ec368c32541645b278624bea.png"},{"id":55317218,"identity":"83b44b75-ec79-4dcb-9783-da96060b07b9","added_by":"auto","created_at":"2024-04-25 15:50:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":176525,"visible":true,"origin":"","legend":"\u003cp\u003eTranscription factor prediction\u003c/p\u003e\n\u003cp\u003eA: miR-26a-5p \u0026nbsp;B: miR-26b-5p\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/60eabafff5ac3e9e5b8c9d30.png"},{"id":55317217,"identity":"fd55f20d-7299-4d0a-92bc-46fd28e95643","added_by":"auto","created_at":"2024-04-25 15:50:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":301111,"visible":true,"origin":"","legend":"\u003cp\u003eDifferentially expressed genes in EC.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/5e009cb16533dc953d800472.png"},{"id":55317219,"identity":"9fc651ee-2b1f-4e2f-83c3-e49ef1ede991","added_by":"auto","created_at":"2024-04-25 15:50:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":149127,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of EZH2 in EC\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/d4bac0f97d952ac35375af6c.png"},{"id":55317222,"identity":"c0ad079f-07e8-43c3-b3a2-8f7cc64ea07b","added_by":"auto","created_at":"2024-04-25 15:50:57","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":286121,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between EZH2 with RFS in EC\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/6705dd17aed709c948d3b840.png"},{"id":55320292,"identity":"bb4f2d4d-525a-42fd-819c-9f73972ca8a9","added_by":"auto","created_at":"2024-04-25 16:07:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1926089,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4245082/v1/94e86ea4-882d-4419-b466-62c1c586a7fd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Evaluation value of miR-26a/b-5p on survival prognosis of endometrial carcinoma and identification of its relationship with epigenetic modifier gene EZH2","fulltext":[{"header":"Preface","content":"\u003cp\u003e\u0026nbsp; \u0026nbsp;Endometrial carcinoma (EC) is the most common gynecological malignant tumor in economically developed countries, and its incidence in Europe is as high as 13.6/100000 women [1]. Some scholars predict that the incidence of EC will increase by 50-100% in 2025 [2]. At present, the treatment of endometrial cancer is mainly surgery, supplemented by radiotherapy, chemotherapy, endocrine therapy and biological therapy [3]. Early diagnosis and treatment can greatly improve the prognosis of EC patients. Therefore, it is of great significance to seek potential therapeutic targets and biomarkers of EC from the perspective of molecular mechanism. MicroRNAs (miRNAs) can regulate gene expression by combining with the 3 \u0026apos;- Untranslated regions (3\u0026apos; - UTR) of target mRNA, and can play a role in human cancer as tumor inhibitors or carcinogens [4-5]. MiR-26 is considered as a tumor suppressor. Genomic data analysis shows that the human miR-26 family consists of three members, namely miR-26a-1, miR-26a-2 and miR-26b [6]. The study found that the expression of miR-26a/b-5p was down regulated in many solid tumors, and its low expression was related to tumor metastasis, recurrence and survival. According to the previous research of our research group and Jayaraman\u0026apos;s research, miR-26a/b-5p is down regulated in EC, which has broad application prospects as a biological marker and therapeutic target for EC diagnosis and prognosis [7-8]. However, at present, the clinical significance of miR-26a/b-5p in EC and its specific mechanism of action are not completely clear. Based on this, this study analyzed the expression level, clinical significance and prognostic value of miR-26a/b-5p in EC, predicted its target through bioinformatics, and explored the possible mechanism of miR-26a/b-5p in EC, providing a new direction for molecular mechanism research of EC.\u003c/p\u003e\n"},{"header":"Methods","content":"\u003cp\u003e1.1 Patients and sample collection\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; 60 EC patients who received surgical treatment in the First Affiliated Hospital of Guangxi Medical University from July 2016 to February 2017 were collected as the study subjects. The cancerous tissue and normal endometrial tissue adjacent to cancer that were removed during surgery were collected. The adjacent non cancerous endometrial tissue was at least 2cm away from the tumor. All tissue samples were stored in liquid nitrogen tanks at - 80 \u0026deg; C. Inclusive criteria: (1) After preoperative diagnosis and curettage, pathological examination confirmed endometrial cancer; (2) All patients did not receive chemotherapy or radiotherapy before operation; (3) Independent review and diagnosis by two pathologists. Exclusion criteria: other malignant tumors. This study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University. This study obtained the informed consent of patients and their families, and signed the relevant informed consent form.\u003c/p\u003e\n\u003cp\u003e1.2 Detection of miR-26a/b-5p expression level\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Take out the sample tissue from liquid nitrogen and put it into a mortar. Add proper amount of liquid nitrogen and grind it together. Clean the mortar thoroughly before grinding the next sample to avoid cross contamination. According to the manufacturer\u0026apos;s instructions, RNAiso is used to indicate pure RNA by measuring by NanoDrop 2000 (Wilmington, DE, USA), considering the absorbance parameter of 260/280 nm ratio of about 2.0. Only RNA samples with good proportion and yield of more than 500 ng were selected for microRNA expression analysis. According to the manufacturer\u0026apos;s recommendation, 100 ng total RNA was reverse transcribed using the Mir-X miRNA first strand synthesis kit (Takara Bio Inc., Dalian, China). Use specific microRNA primers (miR-26a-5p, miR-26b-5p) to quantify the obtained cDNA three times through qRT-PCR, and use SYBR Green method in 7500 PCR instrument (application of biological system). The abundance of miR-26a/b-5p in each sample was standardized to its reference value. We selected U6 as the internal reference gene for this study. The expression of miR-26a/b-5p in tissue experiments was calculated using the formula 2-\u0026Delta;ct, \u0026Delta;Ct = (Ct miR-26a/b-5p \u0026ndash; Ct U6)。\u0026nbsp; The primer sequence is:\u003c/p\u003e\n\u003cp\u003emiR-26a-5p-F:ACCAAGTAATCCAGGATAGGCTAAA\u003c/p\u003e\n\u003cp\u003emiR-26b-5p-F:ATCGGGTAATTCAGGATAGGTAAAA\u003c/p\u003e\n\u003cp\u003eU6-F:GGAACGATACAGAGAAGATTAGC\u003c/p\u003e\n\u003cp\u003eU6-R:TGAACGCTTCACGAATTTGCG\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e1.3 Collection and follow-up of clinical and pathological data of EC patients\u003c/p\u003e\n\u003cp\u003eThe clinicopathological information of patients was obtained through the medical records of the First Affiliated Hospital of Guangxi Medical University, including age, FIGO stage, lymph node metastasis, vascular invasion, ascites detection, deep muscle layer invasion, tumor size, tissue differentiation, and tumor classification (type I: estrogen dependent; type II: estrogen independent; This classification is based on the expression of estrogen and progesterone receptors detected by the pathology department ) and other relevant data. The recurrence and death of 60 patients within 5 years after operation were obtained through telephone follow-up and medical follow-up. 45 patients completed the follow-up, and 15 patients lost the follow-up. All patients received standard treatment suitable for their respective stages after surgery, and 17 patients of them were confirmed to have died of EC during 5-year follow-up. Recurrence time refers to the time from the day of operation to the time when the recurrence is confirmed by pathology or radiology; Time of death refers to the time from the day of operation to the day of death of the patient.\u003c/p\u003e\n\u003cp\u003e1.4 Grouping\u003c/p\u003e\n\u003cp\u003eAccording to the median level of miR-26a-5p and miR-26b-5p expression as the threshold, 60 EC patients were equally divided into two groups: miR-26a-5p high expression group, miR-26a-5p low expression group, miR-26b-5p high expression group, and miR-26b-5p low expression group, with 30 cases in each group; Then, the four groups were divided according to the common clinicopathological factors such as age, stage, lymph node metastasis, vascular invasion, deep muscle invasion, ascites heterotypic cell detection results, tumor tissue differentiation, tumor size and tumor classification.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e1.5 Bioinformatics Analysis of \u0026nbsp;miR-26a/b-5p Target Genes\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; The target genes of miR-26a/b-5p were cross-identified by miRDB, miRTarBase, and TargetScan. In addition, we used the GEPIA (http://gepia.cancerpku.cn/) website to analyze differentially expressed genes in endometrial cancer; The top 50 pivotal target genes of miR-26a/b-5p in the PPI network were screened by Cytoscape software, and the key target genes were finally determined. The expression levels of key target genes of miR-26a/b-5p in EC were analyzed by GEPIA, and the effect of key target genes of miR-26a/b-5p on the survival of EC patients was evaluated by The KaplanMeier Plotter (https://kmplot.com/analysis/) website..\u003c/p\u003e\n\u003cp\u003e1.6 Statistical analysis\u003c/p\u003e\n\u003cp\u003eSPSS26.0 was used for statistical analysis of the data. The measurement data were described by means of mean \u0026plusmn; standard deviation. Two independent sample t-tests were used for comparison between groups; Counting data were expressed in cases (percentage), and X2 test was used for comparison between groups; Kaplan Meier method was used to calculate the survival rate, and Log-rank test was used to check whether there was any difference in the survival curve between the comparison groups; Cox regression was used to analyze the factors affecting the overall survival of patients. The factors with statistically significant differences in single factor Cox regression analysis and the factors that may affect the survival of patients in the profession were included in the multi factor Cox regression, and stepwise regression was performed to calculate the risk ratio (HR) and its corresponding 95% confidence interval (CI). In this study, the difference was statistically significant in both sides of the P\u0026lt;0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e2.1 Comparison of miR-26a/b-5p expression level in EC tissues and paracancerous tissues\u003c/p\u003e\n\u003cp\u003eThe results showed that the expression levels of miR-26a-5p and miR-26b-5p in cancer tissues were lower than those in adjacent normal endometrial tissues in 60 EC patients (all P\u0026lt;0.001); The relative expression of miR-26a-5p was 0.408 \u0026plusmn; 0.144 in cancer tissues and 1.400 \u0026plusmn; 0.258 in normal endometrial tissues; The relative expression of miR-26b-5p in cancer tissue was 0.157 \u0026plusmn; 0.035, while in normal endometrial tissue was 0.721 \u0026plusmn; 0.084, as shown in Figure 1.\u003c/p\u003e\n\u003cp\u003e2.2 Relationship between miR-26a/b-5p and clinicopathological characteristics of EC patients\u003c/p\u003e\n\u003cp\u003eBy comparing the expression levels of miR-26a-5p and miR-26b-5p between groups, the results showed that the low expression of miR-26a-5p in EC patients was significantly correlated with lymph node metastasis, poor differentiation of tumor tissue, and positive ascites heterotypic cells (P\u0026lt;0.05); The low expression of miR-26b-5p was significantly correlated with advanced patients and lymph node metastasis (P\u0026lt;0.05). However, the expression of miR-26a-5p was not related to other clinicopathological characteristics, such as age, clinical stage of tumor, vascular invasion, deep muscle invasion, tumor type and tumor size, while miR-26b-5p was not related to age, vascular invasion, deep muscle invasion, tissue differentiation, ascitic heterotypic cells, tumor type and tumor size (P\u0026gt;0.05), as shown in Table 1.\u003c/p\u003e\n\u003cp\u003e2.2 The relationship between miR-26a/b-5p and survival prognosis of EC patients\u003c/p\u003e\n\u003cp\u003e2.2.1 Effect of miR-26a/b-5p expression level on 5-year survival of EC patients\u003c/p\u003e\n\u003cp\u003eKaplan Meier method was used to calculate the survival rate. The 5-year average survival time of the high expression group of miR-26a-5p was 56.292 \u0026plusmn; 2.062 (months), the 5-year survival rate was 86.1%, and the 5-year average survival time of the low expression group of miR-26a-5p was 40.630 \u0026plusmn; 4.394 (months), the 5-year survival rate was 56.8%. The 5-year average survival time of the high expression group of miR-26b-5p was 54.963 \u0026plusmn; 2.483 (months), and the 5-year survival rate was 86.2%. The 5-year average survival time of the low expression group of miR-26b-5p was 41.827 \u0026plusmn; 4.370 (months), and the 5-year survival rate was 44.5%. The overall survival rate of miR-26a-5p high expression group was higher than that of miR-26a-5p low expression group (Log-rank c2=6.331, P=0.012); The overall survival rate of the miR-26b-5p overexpression group was higher than that of the miR-26b-5p low expression group (Log rank c2=8.238, P=0.004), as shown in Figure 2. In addition, the 5-year average tumor-free survival time of the high miR-26a-5p expression group was 54.637 \u0026plusmn; 2.142 (months), the 5-year tumor-free survival rate was 78.3%, the 5-year average tumor-free survival time of the low miR-26a-5p expression group was 38.481 \u0026plusmn; 4.778 (months), the 5-year tumor-free survival rate was 58.3%, the 5-year average tumor-free survival time of the high miR-26b-5p expression group was 53.256 \u0026plusmn; 2.953 (months), and the 5-year tumor-free survival rate was 81.9%, The mean 5-year tumor-free survival time of the low expression group of miR-26b-5p was 38.846 \u0026plusmn; 4.463 (months), and the 5-year tumor-free survival rate was 48.3%. The tumor-free survival rate of miR-26a-5p high expression group was higher than that of miR-26a-5p low expression group (Log rank c2=6.244, P=0.012); The tumor-free survival rate of the high expression group of miR-26b-5p was higher than that of the low expression group of miR-26b-5p (Log rank c2=6.421, P=0.011). As shown in Figure 3.\u003c/p\u003e\n\u003cp\u003e2.2.2 Single factor analysis on influencing factors of 5-year survival of EC patients\u003c/p\u003e\n\u003cp\u003eIn COX univariate analysis, the expression levels of miR-26a-5p and miR-26b-5p were related to the overall survival rate of endometrial cancer (miR-26a-5p: P=0.018; miR-26b-5p: P=0.009). Age, FIGO stage, tumor tissue differentiation, lymph node metastasis and vascular invasion were all factors influencing the overall survival rate of endometrial cancer (all P\u0026lt;0.05). In the COX univariate analysis of tumor-free survival rate, we found that the expression level of miR-26a-5p and miR-26b-5p can affect the recurrence rate after EC surgery (miR-26a-5p: P=0.02; miR-26b-5p: P=0.019). FIGO stage and lymph node metastasis are the influencing factors of the recurrence rate after EC surgery (P\u0026lt;0.05), as shown in Table 2.\u003c/p\u003e\n\u003cp\u003e2.2.3 Multifactor analysis of influencing factors of 5-year survival of EC patients\u003c/p\u003e\n\u003cp\u003eThe statistically significant factors in the univariate analysis were included in the Cox regression analysis model. The results showed that the lower expression levels of miR-26a-5p and miR-26b-5p, the late FIGO stage, and the age \u0026ge; 55 years were independent risk factors for the overall survival rate of EC cancer patients; The reduction of miR-26a-5p expression and lymph node metastasis are independent risk factors for tumor free survival of EC patients, as shown in Table 3.\u003c/p\u003e\n\u003cp\u003e2.3 Bioinformatics analysis results of miR-26a/b-5p target gene\u003c/p\u003e\n\u003cp\u003eEight target genes of miR-26a-5p and 110 target genes of miR-26b-5 were found through cross identification of miRDB, miRTarBase and TargetScan databases, as shown in Figure 4; In addition, the first 50 hub genes of miR-26a-5p and miR-26b-5p were screened by using the node connectivity (degree) of Cytoscape software (Figure 5), indicating that these target genes may play a more important role.\u003c/p\u003e\n\u003cp\u003eSubsequently, GEIPA database was used to identify the differentially expressed genes between endometrial cancer samples and normal samples (screening criteria: |Log FC|\u0026gt;1, P\u0026lt;0.05), and 2038 up-regulated genes and 3489 down-regulated genes were obtained, as shown in Figure 6. Since previous studies and this study both showed that miR-26a-5p and miR-26b-5p were low expressed in EC, their target genes should be those up-regulated in EC. Therefore, we respectively connected the 2038 genes up-regulated in EC with the top 50 hub genes of PPI of miR-26a-5p and miR-26b-5p, and finally determined that the key target gene of miR-26a-5p and miR-26b-5p in EC was human Zeste homolog enhancer 2 (EZH2).\u003c/p\u003e\n\u003cp\u003eIn GEPIA database, EZH2 was highly expressed in EC patients compared with normal samples (P\u0026lt;0.05), as shown in Figure 7. Kaplan Meier Plotter showed that RFS in EZH2 high expression group was lower than that in EZH2 low expression group (P\u0026lt;0.05), as shown in Figure 8.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWith the improvement of medical level, the prognosis of EC patients has been greatly improved, but its incidence is still increasing, and the prognosis of EC patients with high-risk factors and advanced diagnosis is still not ideal. In recent years, it has become a research hotspot to explore the diagnostic means and therapeutic targets of tumors based on molecular mechanism research. Therefore, it will have important clinical value to seek new diagnostic biomarkers and therapeutic targets by studying the pathogenesis of EC. MiRNA has been confirmed to be abnormally expressed in a variety of tumors, and is one of the hot molecules in tumor molecular mechanism research [8-9]. It was found that miR-26a/b-5p was down regulated in EC, suggesting that miR-26a/b-5p, as a tumor suppressor, participates in the regulation of the occurrence and development of EC [8]. In this study, the expression level of miR-26a/b-5p in endometrial carcinoma tissue and normal adjacent endometrial tissue of the same EC patient was detected. The results showed that the expression level of miR-26a/b-5p in endometrial carcinoma tissue was lower than that in normal adjacent endometrial tissue (p\u0026lt;0.05); Our research results, as well as those of Jayaraman and others [7], indicate that miR-26a-5p and miR-26b-5p, as tumor suppressor miRNAs, play a key role in the development of endometrial cancer. However, for the folding changes of miR-26a-5p and miR-26b-5p, this study is somewhat different from the results of Jayaraman et al. (miR-26a-5p: 3.1/3.4; miR-26b-5p: 2.6/4.6); The possible reason is that the control group selected by Jayaraman and others is the endometrial tissue of normal people, while the control group selected in this study is the corresponding non cancerous endometrial tissue of EC patients, which suggests that studying the dynamic changes of miR-26a-5p, miR-26b-5p expression levels in the occurrence and progression of endometrial cancer may have some value, for example, comparing the differences in the expression levels of miR-26a-5p and miR-26b-5p in normal endometrial tissue, atypical endometrial hyperplasia tissue, adjacent non-cancerous tissue, and endometrial cancer tissue may provide new ideas for the identification of these diseases.\u003c/p\u003e\n\u003cp\u003eThis study explored the relationship between the expression levels of miR-26a-5p, miR-26b-5p and the clinicopathological characteristics of EC patients. The results showed that the expression levels of miR-26a-5p and miR-26b-5p in lymph node metastasis group were lower than those in non lymph node metastasis group; In addition, the low expression level of miR-26a-5p was also associated with ascites heterotypic cell positive and poor tumor tissue differentiation, while miR-26b-5p was associated with late tumor stage. This indicates that the expression levels of miR-26a-5p and miR-26b-5p are significantly related to EC tumor invasion and metastasis. In clinical practice, it may be possible to predict EC metastasis and deterioration by detecting the expression levels of miR-26a-5p and miR-26b-5p. However, the sample size of this study is small, and the selected clinical samples are tissues, which are difficult to obtain, invasive, and cumbersome in processing. In the future, a larger cohort is needed for further research, and the expression and clinical significance of miR-26a-5p and miR-26b-5p in the serum of EC patients and normal people need to be analyzed and verified.\u003c/p\u003e\n\u003cp\u003eIn addition, this study also explored the relationship between miR-26a-5p, miR-26b-5p and survival and prognosis of EC patients. The results showed that the 5-year overall survival rate and tumor-free survival rate of the high expression group of miR-26a-5p and miR-26b-5p were\u0026nbsp;higher than those of the low expression group. In order to further explore the influence of miR-26a-5p and miR-26b-5p on the survival and prognosis of EC patients, this study also conducted a multivariate Cox regression analysis. The results showed that the expression level of miR-26a-5p was an independent factor affecting the 5-year overall survival rate and tumor-free survival rate of EC patients, while the expression level of miR-26b-5p was only an independent factor influencing the 5-year overall survival rate. It shows that the decrease of miR-26a-5p expression can lead to the increase of postoperative recurrence rate and the shortening of survival time of EC patients, while the decrease of miR-26b-5p expression can lead to the shortening of survival time of EC patients, suggesting that the decrease of miR-26a-5p and miR-26b-5p expression can lead to poor prognosis of EC patients. In fact, previous studies have confirmed that tumor patients with high expression of miR-26a-5p have a better prognosis, with a longer overall survival (OS) and recurrence time (TTR) [10]. For example, in hepatocellular carcinoma, miR-26a-5p and miR-26b-5p enhance levels of the oncogenic cytokine IL-6, thereby promoting the onset and progression of hepatocellular carcinoma[11]. In gastric cancer tissue, patients with low expression of miR-26a-5p have shorter median OS time and relapse free survival (RFS) than patients with high expression of miR-26a-5p [12-13]. Ding et al. found that the low expression of miR-26b-5p was associated with the reduction of metastasis free survival and overall survival of breast cancer patients[14]. According to Xie et al., the increased expression level of miR-26a-5p is related to the late clinical stage and distant metastasis of osteosarcoma patients, and its expression level can be an independent influencing factor for the survival rate of osteosarcoma [15]. Gonzalez Ariagada and his colleagues detected the expression level of miR-26-5p in the tumor tissues of patients with head and neck squamous cell carcinoma (HNSCC) with or without lymph node metastasis. The results showed that the expression level of miR-26-5p in metastatic primary HNSCC was high, and the high expression of miR-26-5p was related to lymph node metastasis, poor differentiation and shortened disease-free survival of HNSCC patients [16]. The above research shows that miR-26a-5p and miR-26b-5p have important research value as biological markers to evaluate tumor prognosis, and can be used as candidate markers for prognosis evaluation of EC patients.\u003c/p\u003e\n\u003cp\u003eMiRNAs regulate tumor progression by inhibiting the expression of target genes. Therefore, this study also predicted the target genes of miR-26a-5p and miR-26b-5p through bioinformatics. It was found that miR-26a-5p and miR-26b-5p could regulate the expression of EZH2 in EC, and it was speculated that EZH2 was the key target gene for miR-26a-5p and miR-26b-5p to play a role in EC. EZH2 plays an important role in epigenetic modification. It can methylate histone H3K27 in the nucleus, and affect stem cell differentiation and development by regulating the expression of target genes. It has been proved to be a cancer promoting factor for many tumors [17]. This study explored the expression of EZH2 in EC and its prognostic value. The results showed that the expression of EZH2 was up-regulated in EC, and the high expression of EZH2 was associated with poor survival and prognosis of EC patients. Previous studies have found that EZH2 is up-regulated in endometrial cancer tissues and cells, indicating that EZH2 is a new prognostic biomarker and a potential target for EC therapy [18], which is consistent with our results.Now, researchers have developed many drugs under research for single or multiple targets of EZH2 through screening the compound library and structural optimization. Recently, a histone methyltransferase EZH2 inhibitor developed by Hengrui Group has entered the phase 3 clinical trial phase, which will provide a new scheme for the treatment of multiple malignant tumors. However, at present, the specific mechanism of miR-26a-5p and miR-26b-5p regulating EZH2 in EC needs further study, and how EZH2 as a key target plays a role in EC needs more research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University\u0026nbsp;(Nanning, China), No. 2021(KY-E-200). This study obtained the informed consent of patients and their families, and signed the relevant informed consent form.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report no confict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported by the National Natural Science Foundation of China (No.81960464)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJF formulated the research protocol and guided the work. YL collected and analyzed the data for this study and wrote the article, and is the first author.YH and JY collected the data for this study.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMarkowska A, Szarszewska M, Knapp P, et al. The role of nesfatin and selected molecular factors in various types of endometrial cancer[J]. Ginekol Pol, 2019, 90(10): 571-576.\u003c/li\u003e\n\u003cli\u003eAdishesh M and Hapangama DK. Enriching Personalized Endometrial Cancer Research with the Harmonization of Biobanking Standards[J]. Cancers (Basel), 2019, 11(11).\u003c/li\u003e\n\u003cli\u003eMacKintosh ML and Crosbie EJ. Prevention Strategies in Endometrial Carcinoma[J]. Curr Oncol Rep, 2018, 20(12): 101.\u003c/li\u003e\n\u003cli\u003eMa M, Hui J, Zhang QY, et al. Long non-coding RNA nuclear-enriched abundant transcript 1 inhibition blunts myocardial ischemia reperfusion injury via autophagic flux arrest and apoptosis in streptozotocin-induced diabetic rats[J]. Atherosclerosis, 2018, 277: 113-122.\u003c/li\u003e\n\u003cli\u003eXia T, Xiao B-X and Guo J-M. Acting mechanisms and research methods of long noncoding RNAs[J]. Hereditas (Beijing), 2013, 35(3): 269-280. Yahya SMM, Nabih HK, Elsayed GH, Mohamed SIA, Elfiky AM, Salem SM. Restoring microRNA-34a overcomes acquired drug resistance and disease progression in human breast cancer cell lines via suppressing the ABCC1 gene. Breast Cancer Res Treat. 2024;204(1):133-149.\u003c/li\u003e\n\u003cli\u003eReicher A, Fosselteder J, Kwong LN, et al. Crosstalk between the Notch signaling pathway and long non-coding RNAs[J]. Cancer Lett, 2018, 420: 91-96. Acharya A, Berry DC, Zhang H, et al. miR-26 suppresses adipocyte progenitor differentiation and fat production by targeting Fbxl19. Genes Dev. 2019;33(19-20):1367-1380.\u003c/li\u003e\n\u003cli\u003eFan JT, Zhou ZY, Luo YL, et al. Exosomal lncRNA NEAT1 from cancer-associated fibroblasts facilitates endometrial cancer progression via miR-26a/b-5p-mediated STAT3/YKL-40 signaling pathway. Neoplasia. 2021;23(7):692-703.\u003c/li\u003e\n\u003cli\u003eJayaraman M, Radhakrishnan R, Mathews CA, et al. Identification of novel diagnostic and prognostic miRNA signatures in endometrial cancer[J]. Genes Cancer, 2017, 8(5-6): 566-576.\u003c/li\u003e\n\u003cli\u003eRicci C, Marzocchi C and Battistini S. MicroRNAs as Biomarkers in Amyotrophic Lateral Sclerosis[J]. Cells, 2018, 7(11).\u003c/li\u003e\n\u003cli\u003eStappert L, Klaus F and Br\u0026uuml;stle O. MicroRNAs Engage in Complex Circuits Regulating Adult Neurogenesis[J]. Front Neurosci, 2018, 12: 707.\u003c/li\u003e\n\u003cli\u003eYang X, Liang L, Zhang XF, et al. MicroRNA-26a suppresses tumor growth and metastasis of human hepatocellular carcinoma by targeting interleukin-6-Stat3 pathway[J]. Hepatology, 2013, 58(1): 158-170. Lin Y, Jian Z, Jin H, et al. Long non-coding RNA DLGAP1-AS1 facilitates tumorigenesis and epithelial-mesenchymal transition in hepatocellular carcinoma via the feedback loop of miR-26a/b-5p/IL-6/JAK2/STAT3 and Wnt/\u0026beta;-catenin pathway. Cell Death Dis. 2020;11(1):34. Published 2020 Jan 16. \u003c/li\u003e\n\u003cli\u003eDeng M, Tang HL, Lu XH, et al. miR-26a suppresses tumor growth and metastasis by targeting FGF9 in gastric cancer[J]. PLoS One, 2013, 8(8): e72662.\u003c/li\u003e\n\u003cli\u003eQiu X, Zhu H, Liu S, et al. Expression and prognostic value of microRNA-26a and microRNA-148a in gastric cancer[J]. J Gastroenterol Hepatol, 2017, 32(4): 819-827.\u003c/li\u003e\n\u003cli\u003eDing Q, Wang Y, Zuo Z, et al. Decreased expression of microRNA-26b in locally advanced and inflammatory breast cancer[J]. Hum Pathol, 2018, 77: 121-129.\u003c/li\u003e\n\u003cli\u003eSong QC, Shi ZB, Zhang YT, et al. Downregulation of microRNA-26a is associated with metastatic potential and the poor prognosis of osteosarcoma patients[J]. Oncol Rep, 2014, 31(3): 1263-1270. Xie XY, Chen XM, Shi L, Liu JW. Increased expression of microRNA-26a-5p predicted a poor survival outcome in osteosarcoma patients: An observational study. Medicine (Baltimore). 2021;100(12):e24765.\u003c/li\u003e\n\u003cli\u003eGonz\u0026aacute;lez-Arriagada WA, Olivero P, Rodr\u0026iacute;guez B, et al. Clinicopathological significance of miR-26, miR-107, miR-125b, and miR-203 in head and neck carcinomas[J]. Oral Dis[J]. 2018, 24(6): 930-939.\u003c/li\u003e\n\u003cli\u003eHuang J, Gou H, Yao J, Yi K, Jin Z, Matsuoka M, Zhao T. The noncanonical role of EZH2 in cancer[J]. Cancer Sci, 2021, 112(4):1376-1382. \u003c/li\u003e\n\u003cli\u003eGui T, Liu M, Yao B, et al. TCF3 is epigenetically silenced by EZH2 and DNMT3B and functions as a tumor suppressor in endometrial cancer[J]. Cell Death Differ, 2021,28(12):3316-3328. \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 The relationship between the expression level of miR-26a/b-5p and the clinicopathological parameters of endometrial carcinoma\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eclinicopathologic factors\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;miR-26a-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003emiR-26a-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHigh \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Low\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHigh \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Low\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;n(%)\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; n(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;n(%)\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; n(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ge;55y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e14 (46.7) \u0026nbsp;16(53.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e14 (46.7) \u0026nbsp;16(53.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e<55y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e16 (53.3) \u0026nbsp;14(46.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.606\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e16 (53.3) \u0026nbsp;14(46.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.606\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIn installments\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eI-II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e24 (80) \u0026nbsp; \u0026nbsp; 18 (60)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e25 (83.3) \u0026nbsp;17(56.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eIII-IV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6 (20) \u0026nbsp; \u0026nbsp; \u0026nbsp; 12 (40)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.091\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5 (16.7) \u0026nbsp; \u0026nbsp;13(43.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e0.024\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003elymph node metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6 (20) \u0026nbsp; \u0026nbsp; \u0026nbsp; 17(56.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7 (23.3) \u0026nbsp; \u0026nbsp;16(53.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e24 (80) \u0026nbsp; \u0026nbsp; 13(43.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e0.003\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e23 (76.7) \u0026nbsp;14(46.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003evascular invasion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3 (10) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 6 (20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2 (6.7) \u0026nbsp; \u0026nbsp; \u0026nbsp; 7(23.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e27 (90) \u0026nbsp; \u0026nbsp; \u0026nbsp;24 (80)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.278\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e28 (93.3) \u0026nbsp; 23(76.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.071\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eDeep muscle infiltration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10 (33.3) \u0026nbsp; \u0026nbsp;8(26.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e11 (36.7) \u0026nbsp; \u0026nbsp;7(23.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e20 (66.7) \u0026nbsp; 22(73.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.573\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e19 (63.3) \u0026nbsp; 23(76.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.260\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAscites heterogeneous cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e(+)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4 (13.3) \u0026nbsp; \u0026nbsp; 11(36.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5 (16.7) \u0026nbsp; \u0026nbsp; 10(33.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e(-)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e26 (86.7) \u0026nbsp; 19 63.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e0.037\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e25 (83.3) \u0026nbsp; 20(66.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.136\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTumor differentiation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e23 (76.7) \u0026nbsp; 13(43.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e21 (70) \u0026nbsp; \u0026nbsp; 15 (50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4 (13.3) \u0026nbsp; \u0026nbsp; 11(36.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4 (13.3) \u0026nbsp; \u0026nbsp;11(36.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3 (10) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 6 (20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.03\u003c/strong\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5 (16.7) \u0026nbsp; \u0026nbsp; 4(13.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.112\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ge;2cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e16 (53.3) \u0026nbsp; 17(56.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14 (46.7) \u0026nbsp;19(63.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e<2cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14 (46.7) \u0026nbsp; 13(43.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.795\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e16 (53.3) \u0026nbsp;11(36.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.194\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumor typing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eType I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e26 (86.7) \u0026nbsp; 22(73.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e22 (73.3) \u0026nbsp; 26(86.7) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eType II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4 (13.3) \u0026nbsp; \u0026nbsp; \u0026nbsp;8 (26.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.197\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e8 (26.7) \u0026nbsp; \u0026nbsp; \u0026nbsp;4 (13.3) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.197\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2 The relationship between the expression level of miR-26a/b-5p and clinicopathological parameters and the survival rate of endometrial cancer patients\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.171717171717173%\"\u003e\n \u003cp\u003eclinicopathologic factors\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.41414141414141%\" valign=\"top\"\u003e\n \u003cp\u003e5 years overall\u003c/p\u003e\n \u003cp\u003eSurvival rate \u0026nbsp; \u0026nbsp; HR (95% CI) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.41414141414141%\" valign=\"top\"\u003e\n \u003cp\u003e5 years tumor free\u003c/p\u003e\n \u003cp\u003eSurvival rate \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;HR (95% CI) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; P\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003cp\u003e\u0026ge;55y\u003c/p\u003e\n \u003cp\u003e<55y\u003c/p\u003e\n \u003cp\u003eIn installments\u003c/p\u003e\n \u003cp\u003eI-II\u003c/p\u003e\n \u003cp\u003eIII-IV\u003c/p\u003e\n \u003cp\u003elymph node metastasis\u003c/p\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003cp\u003evascular invasion\u003c/p\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003cp\u003edeep muscle invasion\u003c/p\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003cp\u003eAscites heterogeneous cells\u003c/p\u003e\n \u003cp\u003esun\u003c/p\u003e\n \u003cp\u003ecloudy\u003c/p\u003e\n \u003cp\u003eTumor differentiation\u003c/p\u003e\n \u003cp\u003etall\u003c/p\u003e\n \u003cp\u003emiddle\u003c/p\u003e\n \u003cp\u003elow\u003c/p\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003cp\u003e\u0026ge;2cm\u003c/p\u003e\n \u003cp\u003e<2cm\u003c/p\u003e\n \u003cp\u003eTumor type\u003c/p\u003e\n \u003cp\u003eType I\u003c/p\u003e\n \u003cp\u003eType II\u003c/p\u003e\n \u003cp\u003emiR-26a-5p\u003c/p\u003e\n \u003cp\u003eHighly Expressive\u003c/p\u003e\n \u003cp\u003elow expression\u003c/p\u003e\n \u003cp\u003emiR-26b-5p\u003c/p\u003e\n \u003cp\u003eHighly Expressive\u003c/p\u003e\n \u003cp\u003elow expression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.41414141414141%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e53.5%\u003c/p\u003e\n \u003cp\u003e82.7% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.222(0.072-0.688)\u0026nbsp; \u003cstrong\u003e0.009\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e85.0%\u003c/p\u003e\n \u003cp\u003e30.1% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 5.756(2.115-15.668)\u0026nbsp;\u003cstrong\u003e0.001\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e33.1%\u003c/p\u003e\n \u003cp\u003e88.9% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.145(0.047-0.447)\u0026nbsp; \u0026nbsp;\u003cstrong\u003e0.001\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e17.8%\u003c/p\u003e\n \u003cp\u003e79.5% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.203(0.074-0.561)\u0026nbsp; \u003cstrong\u003e0.002\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e50.8%\u003c/p\u003e\n \u003cp\u003e73.0% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.807(0.298-2.185)\u0026nbsp; \u0026nbsp;0.673\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e45.7%\u003c/p\u003e\n \u003cp\u003e74.7% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.495(0.174-1.409)\u0026nbsp; \u0026nbsp;0.187\u003c/p\u003e\n \u003cp\u003e0.025\u003c/p\u003e\n \u003cp\u003e81.8%\u003c/p\u003e\n \u003cp\u003e53.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 2.975(0.956-9.261)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.06\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e40.0% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 4.911(1.492-16.165)\u0026nbsp; \u003cstrong\u003e0.009\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e59.9%\u003c/p\u003e\n \u003cp\u003e79.5% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.520(0.183-1.477)\u0026nbsp; \u0026nbsp; 0.22\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e70.2%\u003c/p\u003e\n \u003cp\u003e58.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;1.066(0.292-3.882)\u0026nbsp; \u0026nbsp; 0.923\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e83.3%\u003c/p\u003e\n \u003cp\u003e58.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.283(0.099-0.809)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.018\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e86.5%\u003c/p\u003e\n \u003cp\u003e54.1% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.221(0.071-0.684)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.009\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.41414141414141%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e54.3%\u003c/p\u003e\n \u003cp\u003e75.7% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.507(0.195-1.315)\u0026nbsp; \u0026nbsp;0.163\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e75.5%\u003c/p\u003e\n \u003cp\u003e43.1% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;3.038(1.201-7.681)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.019\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e31.9%\u003c/p\u003e\n \u003cp\u003e84.7% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.168(0.059-0.478)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.001\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e53.3%\u003c/p\u003e\n \u003cp\u003e69.4% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.424(0.138-1.305)\u0026nbsp; \u0026nbsp; 0.135\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e58.9%\u003c/p\u003e\n \u003cp\u003e69.5% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.823(0.308-2.201)\u0026nbsp; \u0026nbsp; \u0026nbsp;0.698\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e63.5%\u003c/p\u003e\n \u003cp\u003e80.0% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;1.637(0.376-7.128)\u0026nbsp; \u0026nbsp; \u0026nbsp;0.512\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e72.8% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.298\u003c/p\u003e\n \u003cp\u003e54.9% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;1.628(0.543-4.879)\u0026nbsp; \u0026nbsp; \u0026nbsp;0.384\u003c/p\u003e\n \u003cp\u003e53.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;2.474(0.760-8.046)\u0026nbsp; \u0026nbsp; \u0026nbsp;0.132\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e66.6%\u003c/p\u003e\n \u003cp\u003e66.5% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.986(0.389-2.500)\u0026nbsp; \u0026nbsp; \u0026nbsp;0.976\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e75%\u003c/p\u003e\n \u003cp\u003e64.4% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.842(0.244-2.911)\u0026nbsp; \u0026nbsp; 0.786\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e78.3%\u003c/p\u003e\n \u003cp\u003e58.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.304(0.112-0.828)\u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.02\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e81.9%\u003c/p\u003e\n \u003cp\u003e48.3% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.287(0.101-0.815)\u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cstrong\u003e0.019\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Table 3 Cox regression analysis results of multiple factors of miR-26a/b-5p affecting total survival and tumor free survival of patients\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.31313131313131%\"\u003e\n \u003cp\u003eclinicopathologic factors\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003e5-year overall survival rate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003e5-year tumor-free survival rate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.31313131313131%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003eHR(95% CI) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003eHR(95% CI) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;P\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.31313131313131%\"\u003e\n \u003cp\u003eExpression of miR-26a-5p\u003c/p\u003e\n \u003cp\u003eHighly Expressive\u003c/p\u003e\n \u003cp\u003elow expression\u003c/p\u003e\n \u003cp\u003eExpression of miR-26b-5p\u003c/p\u003e\n \u003cp\u003eHighly Expressive\u003c/p\u003e\n \u003cp\u003elow expression\u003c/p\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003cp\u003e\u0026ge;55y\u003c/p\u003e\n \u003cp\u003e<55y\u003c/p\u003e\n \u003cp\u003eIn installments\u003c/p\u003e\n \u003cp\u003ePhase I-II\u003c/p\u003e\n \u003cp\u003ePhase III-IV\u003c/p\u003e\n \u003cp\u003elymph node metastasis\u003c/p\u003e\n \u003cp\u003ebe\u003c/p\u003e\n \u003cp\u003eno\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003e0.122(0.031-0.475) \u0026nbsp; \u003cstrong\u003e0.002\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.232(0.068-0.796) \u0026nbsp;\u003cstrong\u003e0.02\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.196(0.051-0.760) \u0026nbsp;\u003cstrong\u003e0.018\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e5.267(1.242-22.326) \u0026nbsp;\u003cstrong\u003e0.024\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.343434343434346%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.289(0.096-0.87) \u0026nbsp; \u0026nbsp; \u003cstrong\u003e0.027\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.259(0.075-0.901) \u0026nbsp; \u003cstrong\u003e0.034\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometrial carcinoma, miR-26a-5p, miR-26b-5p, Survival prognosis, Target gene, EZH2","lastPublishedDoi":"10.21203/rs.3.rs-4245082/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4245082/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInvestigate the prognostic value of miR-26a/b-5p in endometrial carcinoma (EC), and to analyze the relationship between miR-26a/b-5p and target gene EZH2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels of miR-26a-5p and miR-26b-5p were detected by RT-PCR in 60 cases of EC patients with cancer and normal endometrial tissue adjacent to cancer; Collect medical records of EC patients. To compare the expression difference of miR-26a-5p and miR-26b-5p in cancer tissues and normal endometrial tissues adjacent to cancer, and to compare the expression difference of miR-26a-5p and miR-26b-5p in EC patients with different clinical and pathological characteristics, and to analyze the impact of miR-26a-5p and miR-26b-5p expression levels on survival and prognosis of EC patients. In addition, the target genes of miR-26a-5p and miR-26b-5p were analyzed by bioinformatics analysis to explore their possible mechanisms in the occurrence and development of EC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels of miR-26a-5p and miR-26b-5p in cancer tissues were lower than those in adjacent normal endometrial tissues (P \u0026lt; 0.001); In EC patients, the low expression of miR-26a-5p was significantly correlated with lymph node metastasis, poor differentiation of tumor tissue, and positive ascitic heterotypic cells. The low expression of miR-26b-5p was significantly correlated with advanced patients and lymph node metastasis (P \u0026lt; 0.05). The overall survival rate and tumor free survival rate of the miR-26a-5p overexpression group and the miR-26b-5p overexpression group were higher than those of the corresponding low expression group (P \u0026lt; 0.05); The lower expression levels of miR-26a-5p and miR-26b-5p, the late FIGO stage and the age ≥ 55 years old are independent risk factors for the overall survival rate of EC cancer patients, while the lower expression level of miR-26a-5p and lymph node metastasis are independent risk factors for the tumor free survival rate of EC patients (P \u0026lt; 0.05). EZH2 is the key target gene of miR-26a-5p and miR-26b-5p in EC. EZH2 is highly expressed in EC patient samples (P \u0026lt; 0.05), and can affect the survival rate of EC patients.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003emiR-26a-5p and miR-26b-5p are related to the occurrence and progress of EC, and can affect the survival and prognosis of EC patients. They may be used as biological markers to monitor the progress and prognosis of EC, and have the potential to be new targets for treatment of EC, and miR-26a-5p and miR-26b-5p may regulate the occurrence and development of EC by targeting EZH2.\u003c/p\u003e","manuscriptTitle":"Evaluation value of miR-26a/b-5p on survival prognosis of endometrial carcinoma and identification of its relationship with epigenetic modifier gene EZH2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-25 15:50:50","doi":"10.21203/rs.3.rs-4245082/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e90e8e55-51dd-4635-8498-db4b9fac0941","owner":[],"postedDate":"April 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-26T12:47:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-25 15:50:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4245082","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4245082","identity":"rs-4245082","version":["v1"]},"buildId":"cTy_lsJlmDsVRNrSptgXS","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.
My notes (saved in your browser only)
Ask this paper
Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works
Citation neighborhood (sparse)
Too few in-corpus citations on either side for a chart; here are the lists.
Cites (1)
References (14)
- Enriching Personalized Endometrial Cancer Research with the Harmonization of Biobanking Standards. via crossref
- doi:10.1007/s11912-018-0747-1 via crossref
- doi:10.1016/j.atherosclerosis.2018.08.031 via crossref
- doi:10.1016/j.neo.2021.05.004 via crossref
- doi:10.18632/genesandcancer.144 via crossref
- doi:10.3390/cells7110219 via crossref
- doi:10.3389/fnins.2018.00707 via crossref
- doi:10.1371/journal.pone.0072662 via crossref
- doi:10.1111/jgh.13533 via crossref
- doi:10.1016/j.humpath.2018.04.002 via crossref
- doi:10.1111/odi.12872 via crossref
- doi:10.1111/cas.14840 via crossref
- doi:10.5603/gp.2019.0099 via crossref
- doi:10.1038/s41418-021-00824-w via crossref
Source provenance
- crossref
- last seen: 2026-09-06T06:31:36.509020+00:00
- europepmc
- last seen: 2026-05-20T01:45:00.602351+00:00
- unpaywall
- last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0