Putrescine Improves Oocyte Quality in Aged Mice by Modulating the IP3R-GRP75-VDAC1 Complex

Putrescine Improves Oocyte Quality in Aged Mice by Modulating the IP3R-GRP75-VDAC1 Complex | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Putrescine Improves Oocyte Quality in Aged Mice by Modulating the IP3R-GRP75-VDAC1 Complex Man Ni, Shuang Guo, Li Cheng, Boya La, Zhengjie Yan, Yugui Cui, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7823915/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objectives Female fertility declines with age, primarily due to a decrease in both oocyte quantity and quality. While putrescine supplementation has been shown to improve oocyte quality in aged mice, the underlying mechanisms remain unclear. In particular, whether putrescine modulates mitochondrial-associated membranes (MAM) and mitigates mitochondrial calcium overload via the IP3R-GRP75-VDAC1 complex has yet to be elucidated. Materials and methods In this study, we investigated the effects of putrescine on oocyte quality using three groups: eight-week-old mice (Young), 40-week-old mice (Old), and 40-week-old mice with 0.5 mM putrescine supplementation during in vitro maturation (Put). Key parameters assessed included oocyte mass, MAM number, mitochondrial calcium levels, mitochondrial function, and apoptosis. Results Aged mice exhibited significantly lower anti-Müllerian hormone (AMH) levels and a reduced oocyte count, accompanied by a decline in oocyte quality. Putrescine supplementation significantly improved first polar body extrusion and blastocyst formation rates in aged oocytes. Additionally, it reduced MAM formation and weakened IP3R-GRP75-VDAC1 interactions, alleviating mitochondrial calcium overload. Consequently, mitochondrial function was enhanced, ATP production increased, and apoptosis reduced. Conclusion Putrescine ameliorates the quality of aged oocytes by modulating Ca 2+ transfer at MAM. These findings provide novel insights into the role of putrescine in improving oocyte quality and suggest its potential as an in vitro maturation (IVM) supplement to enhance reproductive outcomes in older women by modulating MAM. Biological sciences/Cell biology Biological sciences/Developmental biology Biological sciences/Physiology Putrescine IP3R-GRP75-VDAC1 complex MAM Aging Oocyte maturation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction As women age, fertility progressively declines, primarily due to a reduction in both the quantity and quality of oocytes [ 1 ]. Senescent oocytes exhibit endoplasmic reticulum stress (ERS) accompanied by an amplified unfolded protein response [ 2 ]. Furthermore, abnormalities in mitochondrial fusion and fission are frequently observed in these oocytes, resulting in reduced membrane potential and compromised ATP production [ 3 ]. Despite these insights, the role of MAM in aging oocytes remains insufficiently investigated. The endoplasmic reticulum (ER) and mitochondria are physically connected at a specialized interface termed the mitochondria-associated endoplasmic reticulum membranes (MAM) [ 4 ]. This interface facilitates essential cellular processes, including lipid synthesis and transport, calcium homeostasis, reactive oxygen species production, mitochondrial autophagy, and the regulation of ER stress [ 5 ]. Calcium ions (Ca²⁺), serving as second messengers, are indispensable for MAM activity [ 6 ]. The primary pathway for Ca²⁺ transport at the MAM is mediated by the IP3R-GRP75-VDAC1 complex [ 7 ]. Upon activation by phospholipase C (PLC), inositol trisphosphate receptors (IP3Rs) in the ER lumen release Ca²⁺ ions. The molecular chaperone GRP75 anchors IP3R to VDAC1, facilitating Ca²⁺ transfer. These ions subsequently enter mitochondria via VDAC1 in the outer mitochondrial membrane and the mitochondrial calcium uniporter (MCU) in the inner membrane, regulating mitochondrial respiration and ATP production [ 8 ]. MAM disruption impairs ER-mediated Ca²⁺ release via IP3R, leading to reduced ATP synthesis and compromised cellular viability [ 9 ]. Conversely, excessive or prolonged mitochondrial Ca²⁺ accumulation can induce the opening of the mitochondrial permeability transition pore (MPTP), causing cytochrome C release, activation of Caspase9 and Caspase3, and ultimately apoptosis [ 10 ]. Proteins such as Sig-1R, Mfn2, and CypD interact with the IP3R-GRP75-VDAC1 complex to co-regulate Ca²⁺ transport [ 11 ]. Dysregulated Ca²⁺ signaling at the MAM has been associated with various age-related conditions, including neurodegenerative disorders [ 12 ], diabetes-related complications [ 13 ], cancer, and diminished oocyte quality in obese mice [ 14 ]. However, its specific contribution to the aging process of oocytes remains inadequately explored. Putrescine, a polyamine synthesized from ornithine by the enzyme ornithine decarboxylase (ODC), plays a pivotal role in antioxidant defense, anti-apoptotic regulation, and anti-inflammatory processes [ 15 ]. In mammals and rodents, pre-ovulatory surges of luteinizing hormone (LH) induce a transient yet marked increase in ODC expression in the ovary, stimulating putrescine production [ 16 ]. However, with aging, ODC activity decreases, leading to reduced synthesis of putrescine in mice [ 17 ]. Supplementation with putrescine, either in the oocyte maturation medium or via drinking water during ovulation, has been shown to decrease oocyte aneuploidy and embryo resorption, thereby improving fertility in aged mice [ 18 ]. Additionally, putrescine improves oocyte and blastocyst quality by promoting nuclear maturation of oocytes, resulting in higher live birth rates [ 19 ]. Furthermore, putrescine has been found to delay post-ovulatory oocyte aging by upregulating PDK4 expression and enhancing mitochondrial function [ 20 ]. While significant progress has been made, the role of MAM in oocyte aging remains inadequately explored. In this study, we established a mouse model of age-related ovarian reserve depletion. We investigated alterations in oocyte quality, MAM, and mitochondrial function in aging mice, while also exploring the protective effects of putrescine. Previous research has demonstrated that the IP3R-GRP75-VDAC1 complex plays a pivotal role in the transfer of Ca²⁺ from the endoplasmic reticulum to the mitochondria. Based on this, we assessed whether putrescine could alleviate mitochondrial calcium overload by modulating the interaction between IP3R, GRP75, and VDAC1. Such modulation may enhance mitochondrial function, reduce apoptosis, and improve oocyte quality. This study provides valuable insights into the potential of putrescine to enhance oocyte quality in aged mice, laying the groundwork for its future clinical applications. 2. Materials and methods 2.1 Mice and ethics statement All animal experiments were approved by the Animal Ethics Committee of Nanjing Medical University (IACUC-2208018). Mice were obtained from the Laboratory Animal Base of Nanjing Medical University and maintained under a 12-hour light/dark cycle at 26°C with unrestricted access to food and water. Euthanasia was performed using a small animal carbon dioxide euthanasia chamber (CL-1000M, Shanghai Yuyan Instrument, China). All methods were performed in accordance with the relevant guidelines and regulations. The study is reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ). 2.2 Oocyte collection and maturation The experiments were conducted on C57BL/6J mice. The young control group consisted of mice aged 8–10 weeks, while the old experimental group consisted of mice aged 36–40 weeks. Each mouse received 10 IU of PMSG, and oocytes were collected 46–48 hours later. The number of cumulus-oocyte complexes (COCs) obtained from each mouse’s ovaries was recorded and classified into three groups: young (Young), old (Old), and putrescine (Put). The oocytes were cultured for 14–16 hours at 37°C in a 5% CO₂ incubator using IVM culture medium (M2115, Nanjing Aibei Biotechnology, China), with or without the addition of 0.5 mM putrescine (P5780, Sigma, USA) [ 21 ]. Following this, hyaluronidase (M2215, Nanjing Aibei Biotechnology, China) was used to detach the granulosa cells, and the first polar body extrusion of the oocyte was observed under a stereomicroscope. MII-stage oocytes were collected for subsequent experiments. 2.3 IVF of MII oocytes Male C57BL/6J mice were euthanized, and their epididymides were removed. The vas deferens was then incised with a 1 mL syringe needle to allow spermatozoa to enter the TYH culture medium (M2035, Nanjing Aibei Biotechnology, China) for 60 minutes. The mature oocytes were washed three times in HTF solution (M1135, Nanjing Aibei Biotechnology, China) and then co-cultured with capacitated spermatozoa for 4–6 hours. The oocytes were washed with KSOM culture medium (M1435, Nanjing Aibei Biotechnology, China) and cultured in fresh droplets. The embryos were observed and photographed as they developed into the two-cell stage (24–30 hours after fertilization) and blastocyst stage (96–100 hours after fertilization). All cultures were conducted at 37°C in a 5% CO₂ incubator, and the experiment was repeated at least three times, with 30–40 oocytes per group in each trial. 2.4 AMH Assay Blood was collected from the medial canthus vein one week after 8-week-old and 40-week-old mice were housed for equilibration. The blood samples were left at room temperature for 2 hours before being centrifuged at 4°C and 3,000 rpm for 15 minutes. The serum was then collected, and serum AMH levels were measured using the Mouse AMH Assay Kit (ML037597, Shanghai Enzyme-linked Biotechnology, China) according to the provided instructions. The experiment was conducted at least three times, with each trial including a minimum of 15 mice per group. 2.5 Transmission electron microscopy (TEM) Thirty MII-stage oocytes were collected from each group and fixed in 2.5% glutaraldehyde for 2 hours at room temperature. The oocytes were then stained with eosin, embedded in 10 µL of 1.5% agarose, and centrifuged to concentrate the oocytes at the bottom of the EP tubes. The agarose was solidified and fixed with glutaraldehyde before being transported on ice to the Analysis and Testing Centre of Nanjing Medical University for sample preparation and sectioning. The specimen was subsequently observed and photographed using a JEM-1400 Flash transmission electron microscope. 2.6 Determination of mitochondrial ROS and mitochondrial membrane potentials Reactive oxygen species (ROS) and mitochondrial membrane potential (Δψm) levels in oocytes were assessed using DCFH-DA (S0033S, Beyotime, China) and JC-1 (S2003S, Beyotime, China), respectively. MII-stage oocytes were incubated with DCFH-DA or JC-1 for 30 minutes in a humidified environment with 5% CO 2 at 37°C. After incubation, the oocytes were washed three times with M2 culture medium (M1250, Nanjing Aibei Biotechnology, China) and subsequently placed in a confocal dish (801001, Nest, China). Fluorescence intensity was quantified using a Nikon Eclipse Ti confocal microscope. Each group consisted of 10 to 15 oocytes, and the experiment was repeated at least three times for each indicator. 2.7 ATP assay ATP content in oocytes was measured using the Enhanced ATP Assay Kit (S0027, Beyotime, China). Each group consisted of twenty MII-stage oocytes, which were washed three times in PBS-PVA and transferred to 10 µL of lysate. The total volume in each group was maintained at 20 µL. The standards were prepared with concentrations of 0.01 µM, 0.03 µM, 0.1 µM, 0.3 µM, 1 µM, and 3 µM. The ATP Assay Reagent and ATP Assay Reagent Diluent were combined in a 1:4 ratio to prepare the ATP Assay Working Solution. To eliminate background ATP, 100 µL of ATP Assay Working Solution was added to each EP tube and incubated at room temperature for 3–5 minutes. Each test tube was mixed with 20 µL of either standard or sample, and the relative luminescence unit (RLU) values were determined using a GloMax 20/20 luminometer (Promega, USA). The ATP concentration of each sample was calculated based on the standard curve. 2.8 The colocalization of mitochondria and ER The endoplasmic reticulum and mitochondria in oocytes were stained using ER Tracker (63ES20, Yeasen, China) and Mitotracker (M7512, Invitrogen, USA), respectively. The staining solution was prepared by diluting ER Tracker and Mitotracker stock solutions in a 1:1000 ratio. After three washes with M2 culture medium, stage MII oocytes were incubated in the staining solution at 37°C with 5% CO 2 for 30 minutes. Subsequently, the oocytes were washed three times with M2 culture medium and imaged using a Nikon Eclipse Ti confocal microscope. Fifteen oocytes were included per group for each indicator, and the experiment was repeated at least three times. 2.9 Measurement of [Ca 2+ ] i , [Ca 2+ ] m , and [Ca 2+ ] ER levels Fluo-4 AM (F14217, ThermoFisher, USA), Rhod-2 AM (MX4507, Making Bio, China), and Mag-Fluo-4 AM (MX4544, Making Bio, China) were employed to assess cytoplasmic, mitochondrial, and endoplasmic reticulum Ca²⁺ levels, respectively. The staining working solution was prepared according to the recommended concentrations in the manufacturer's instructions. Subsequently, Stage MII oocytes were incubated in the staining working solution for 30 minutes. Afterwards, the oocytes were washed three times with M2 culture medium and re-incubated in fresh M2 culture medium for 30 minutes to facilitate complete de-esterification. The incubations were conducted at 37°C in a 5% CO₂ incubator, and the resulting images were captured using a Nikon Eclipse Ti confocal microscope. Each indicator was stained using 15 oocytes per group, and the experiment was repeated at least three times per group. 2.10 MPTP assay The MPTP assay kit (C2009S, Beyotime, China) was employed to assess the degree of mitochondrial permeability transition pore opening in oocytes. Calcein AM staining solution, fluorescence quenching working solution, and ionomycin control were prepared separately according to the manufacturer's instructions. The oocytes were transferred to the appropriate staining solution and incubated at 37°C in a 5% CO₂ incubator for 30 minutes. Afterward, they were washed three times with M2 culture medium before continuing the incubation for another 30 minutes. The oocytes were observed under a Nikon Eclipse Ti confocal microscope. The experiment was repeated at least three times, using 15 oocytes per group in each trial. 2.11 Measurement of early apoptosis levels The Annexin V-FITC Apoptosis Detection Kit (C1077S, Beyotime, China) was employed to assess early apoptosis levels in oocytes. Mix 5 µL of Annexin V-mCherry with 194 µL of Annexin V-mCherry Binding Buffer to create the staining working solution. The oocytes, previously washed three times with PBS-PVA, were incubated in the staining solution for 20–30 minutes at room temperature. Subsequently, they were immediately placed under a Nikon Eclipse Ti confocal microscope for imaging. The experiment was repeated at least three times, using 15 oocytes per group in each trial. 2.12 RNA extraction and gene expression determination by real-time quantitative PCR RNA was extracted from groups of 20 oocytes using the RNeasy Plus Micro Kit (74034, QIAGEN, Germany). First-strand cDNA was synthesized through reverse transcription using PrimeScript™ RT Master Mix (Takara, Japan). RT-qPCR was performed using SYBR Green in 96-well plates and the ABI StepOnePlus system (Applied Biosystems, USA). Relative mRNA levels were normalized to the endogenous GAPDH levels and calculated using the 2 −△△CT method. The primer sequences relevant to this study are provided below : Table 1 Primer sequences Gene Primer (5′→ 3′) GAPDH-F AGGTCGGTGTGAACGGATTTG GAPDH-R TGTAGACCATGTAGTTGAGGTCA IP3R-F CGTTTTGAGTTTGAAGGCGTTT IP3R-R CATCTTGCGCCAATTCCCG GRP75-F ATGGCTGGAATGGCCTTAGC GRP75-R CATCTTGCGCCAATTCCCG VDAC1-F CCCACATACGCCGATCTTGG VDAC1-R GTGGTTTCCGTGTTGGCAGA Caspase3-F TGGTGATGAAGGGGTCATTTATG Caspase3-R TTCGGCTTTCCAGTCAGACTC Caspase9-F GACGCTCTGCTGAGTCGAG Caspase9-R GGTCTAGGGGTTTAACAGCCTC 2.13 In situ Proximity ligation assay (PLA) Protein-protein interactions were visualized using the Duolink In Situ Detection Kit (DUO92101, Sigma-Aldrich, USA) according to the manufacturer’s protocol. Stage MII oocytes were collected, their zona pellucida was stripped using 1% HCl, washed three times with PBS-PVA, fixed with 4% paraformaldehyde, and their membranes were permeabilized using 0.5% Triton. The oocytes were blocked at room temperature for 1 hour using a blocking solution and incubated overnight at 4°C with the primary antibody. The oocytes were washed and then probed with oligonucleotide-coupled probes. The probes were ligated and amplified according to the manufacturer’s protocol. Finally, the specimens were stained with DAPI and placed under a Nikon Eclipse Ti confocal microscope for observation and photography. The primary antibodies used for the PLA experiments were anti-rabbit VDAC1 (1:50, ab15898, Abcam, UK), anti-mouse monoclonal IP3R1 (1:50, sc13337, Santa Cruz, USA), anti-mouse monoclonal GRP75 (1:50, sc271197, Santa Cruz, USA), and anti-rabbit IP3R1 (1:50, PA1-901, Invitrogen, USA). The experiments were conducted at least three times, with 15–20 oocytes per group per trial, and analyzed using Fiji's Analyze Particles feature. 2.14 Statistical analysis The experiments were conducted at least three times. All results were analyzed using the GraphPad Prism version 8 software and expressed as means ± SEM. Differences between groups were analyzed for statistical significance using Student’s t-test or one-way ANOVA. Significance levels are indicated as follows: * ( P < 0.05), ** ( P < 0.01), *** ( P < 0.001), and **** ( P < 0.0001). 3. Results 3.1 Establishment of age-related diminished ovarian reserve mouse model An age-related diminished ovarian reserve (AR-DOR) mouse model was established using 36- to 40-week-old mice, with 8- to 10-week-old mice serving as young controls [ 22 ]. Images of the dorsal and lateral sides (Fig. 1 A) and ovaries (Fig. 1 B) of both groups of mice are presented. Anti-Müllerian hormone (AMH) levels and the number of oocytes obtained are key indicators of ovarian function in mice. Mice in the aging group exhibited a marked decline in ovarian index (Fig. 1 C), AMH levels (Fig. 1 D), and the number of oocytes retrieved (Fig. 1 E). These findings indicate impaired ovarian function, thereby validating the AR-DOR mouse model. 3.2 Putrescine improves oocyte quality in aged mice The extrusion of the first polar body is a key indicator of oocyte nuclear maturation. The rate of first polar body extrusion was significantly lower in oocytes from aged mice compared to those from young mice, but it was significantly improved by the addition of putrescine to the IVM solution (Fig. 2 A, B). Additionally, the two-cell formation rate in aging oocytes showed a tendency to decrease, although this was only marginally alleviated by putrescine supplementation, with no significant difference observed (Fig. 2 A, C). Blastocyst formation, a hallmark of oocyte cytoplasmic maturation, was significantly reduced in oocytes from aged mice, but was notably increased after the inclusion of putrescine (Fig. 2 A, D). These results demonstrate that the addition of putrescine during in vitro culture significantly enhances oocyte quality in aged mice. 3.3 The addition of putrescine to the IVM solution resulted in a decrease in the number of MAM in oocytes of aging mice Transmission electron microscopy was used to observe the mitochondria and endoplasmic reticulum in mouse oocytes (Fig. 3 A). There was no significant difference in the ratio of the length of the MAM portion to the mitochondrial circumference in the oocytes of the Young, Old, and Put groups (Fig. 3 C). In oocytes from aged mice, the distance between the endoplasmic reticulum and mitochondria was shorter than that in young control mice. Additionally, the spacing between the two organelles increased with the addition of putrescine (Fig. 3 D). Mitochondria and endoplasmic reticulum in oocytes were labeled using Mitotracker and ER tracker, respectively (Fig. 3 B). These results indicate a significant increase in endoplasmic reticulum and mitochondria colocalization in the aged group compared to the younger group. Conversely, colocalization was significantly reduced in the putrescine group (Fig. 3 E). This suggests that putrescine may mitigate the abnormal increase in the number of MAM in oocytes from aging mice. 3.4 Putrescine reduces the strength of interaction between IP3R, GRP75, and VDAC1 Ca²⁺ plays a crucial role as a signaling molecule in communication between the endoplasmic reticulum and mitochondria. This process is primarily regulated by the IP3R-GRP75-VDAC1 complex located in the mitochondria-associated membranes. the interaction between IP3R-GRP75, IP3R-VDAC1, and GRP75-VDAC1 was assessed using in situ proximity ligation assays (Fig. 4 A). The results indicated that the interaction between IP3R, GRP75, and VDAC1 was enhanced in the Old group and significantly reduced in the Put group. (Fig. 4 B). In addition, quantitative PCR was used to measure the gene expression of IP3R, GRP75, and VDAC in oocytes (Fig. 4 C). The study found a statistically significant increase in IP3R expression in the Old group and a significant decrease in the Put group. Additionally, the Old group exhibited significantly higher levels of GRP75 expression, while the Put group showed significantly lower levels. Although no significant differences were observed in VDAC1 expression among the three groups, an increasing trend was noted in the Old group, and a decreasing trend was observed in the Put group. These findings suggest that putrescine regulates the gene expression of IP3R and GRP75 in aged oocytes and affects the interaction between IP3R, GRP75, and VDAC1, which are key proteins involved in Ca²⁺ transport between the endoplasmic reticulum and mitochondria. 3.5 Putrescine improves calcium overload in aging mice Oocyte mitochondria, endoplasmic reticulum, and cytoplasmic calcium were labeled using calcium probes (Fig. 5 A). The addition of putrescine significantly alleviated mitochondrial calcium overload in oocytes from Old group mice (Fig. 5 B). Additionally, putrescine significantly increased endoplasmic reticulum Ca²⁺ levels in oocytes from the Old group (Fig. 5 C). No significant difference in cytoplasmic calcium intensity was observed among the three groups (Fig. 5 D). It is possible that increased interactions between IP3R-GRP75-VDAC1 complexes in oocytes from aged mice may facilitate the transport of ER Ca²⁺ to mitochondria, leading to mitochondrial calcium overload. Putrescine may reduce mitochondrial calcium overload by decreasing the interaction between IP3R, GRP75, and VDAC1. 3.6 Putrescine improves mitochondrial function in ageing mice Mitochondrial calcium overload leads to a reduction in mitochondrial membrane potential. The mitochondrial membrane potential (Fig. 6 A) of oocytes from the Old group was significantly reduced. However, it was significantly restored with the addition of putrescine (Fig. 6 C). In the Old group, ROS levels (Fig. 6 B) in oocytes were markedly increased, but were markedly reduced in the Put group (Fig. 6 E). Additionally, putrescine supplementation significantly enhanced mitochondrial ATP production in oocytes from the Old group (Fig. 6 D). These findings indicate that putrescine improves mitochondrial function in aging mice. 3.7 Putrescine reduces oocyte apoptosis in aging mice Mitochondrial calcium overload can induce the opening of the mitochondrial permeability transition pore (MPTP) in the inner mitochondrial membrane. MPTP opening (Fig. 7 A) was markedly elevated in oocytes from the Old group and substantially reduced in the Put group (Fig. 7 C). Caspase9 expression was significantly upregulated in oocytes from the Old group and downregulated in the Put group (Fig. 7 E). Similarly, Caspase3 expression was significantly upregulated in oocytes from the Old group and downregulated in the Put group (Fig. 7 F). The level of oocyte apoptosis (Fig. 7 B) was markedly elevated in the Old group. However, putrescine supplementation markedly decreased oocyte apoptosis (Fig. 7 D). These findings indicate that putrescine effectively mitigates apoptosis in oocytes of aging mice. 4. Discussion Prior studies have demonstrated that putrescine reduces oxidative stress by regulating the antioxidant system and decreasing ROS production [ 20 ]. Moreover, putrescine enhances oocyte and embryo quality, reduces the incidence of miscarriage [ 18 ], restores oocyte maturation potential, and decreases aneuploidy in oocytes of aged mice [ 17 ]. IVM is an assisted reproductive technique used for fertility preservation, especially in individuals with polycystic ovary syndrome (PCOS) and cancer patients with a high number of antral follicles [ 23 ]. Significant progress has been made in IVM culture methods through advancements in animal studies, promoting their routine clinical application. Our prior research demonstrated that adding putrescine to IVM medium improved oocyte maturation and embryonic development in aging mice and exhibited long-term genetic and epigenetic safety in offspring [ 24 ]. Consistent with previous studies, our findings further confirmed that the addition of putrescine to IVM medium mitigated oxidative stress in oocytes of aged mice while enhancing oocyte quality. MAMs have been extensively studied in aging-related diseases [ 25 ]. Senescent mice exhibit increased endoplasmic reticulum stress [ 26 ], attenuated mitochondrial autophagy [ 27 ], and increased oocyte apoptosis. However, MAM involvement in senescent mouse oocytes has not been documented. The IP3R-GRP75-VDAC1 complex plays a crucial role in Ca²⁺ transport between the endoplasmic reticulum and mitochondria [ 28 ]. Knockdown of IP3R in C2C12 myotubular cells reduced its interaction with GRP75 and VDAC1, suggesting a correlation between IP3R and GRP75 expression and their interaction with VDAC1. Additionally, GRP75 knockdown weakened its interaction with IP3R1 and VDAC1 [ 29 ]. In porcine oocytes, mitochondrial Ca²⁺ concentration was significantly reduced upon IP3R1 knockdown [ 30 ]. Similarly, GRP75 knockdown in ovarian cancer cell lines markedly decreased the IP3R-VDAC1 interaction and [Ca²⁺] m levels, whereas GRP75 overexpression markedly strengthened their interaction within the MAM, leading to an increase in [Ca²⁺] m levels [ 31 ]. Our study demonstrated a significant increase in the interactions between IP3R, GRP75, and VDAC1, along with a shortening of the distance between the endoplasmic reticulum and mitochondria and an increased number of MAM in oocytes of aged mice. These changes led to mitochondrial calcium overloading. The addition of putrescine to IVM cultures diminished protein interactions within the IP3R-GRP75-VDAC1 complex, reduced the number of MAM, and alleviated mitochondrial calcium overload. These findings indicate that putrescine enhances oocyte quality by regulating the IP3R-GRP75-VDAC1 complex, thereby reducing mitochondrial calcium overload. Mitochondrial calcium is a double-edged sword. Appropriate calcium levels maintain mitochondrial function and promote efficient energy production. Therefore, maintaining calcium homeostasis is essential for preserving mitochondrial function. However, mitochondrial calcium overload can lead to dysfunction, impaired ATP production, and ultimately apoptosis [ 32 ]. Diabetic retinopathy promotes MAM formation via the IP3R1-GRP75-VDAC1 axis, resulting in mitochondrial calcium overload and enhanced Ca²⁺-dependent apoptotic pathways [ 13 ]. The study has shown that increased MPTP opening leads to decreased mitochondrial membrane potential, markedly reduced ATP production, and significantly elevated ROS levels in oocytes from aging mice. These changes culminate in the activation of Caspase9 and Caspase3, leading to increased apoptosis. The addition of putrescine significantly improved mitochondrial function, enhanced ATP production, and mitigated apoptosis. Although we have refined our experimental protocol, it remains subject to certain inherent limitations. To validate the interaction between the IP3R-GRP75-VDAC1 complex, we employed the in situ proximity ligation assay to demonstrate protein interactions. This approach was chosen because of the limited availability of senescent mouse oocytes and the substantial quantity required, making co-immunoprecipitation cost-prohibitive. Moving forward, we will investigate whether putrescine affects endoplasmic reticulum function by modulating MAM, potentially influencing the endoplasmic reticulum-Ca²⁺-mitochondrial signaling pathway. These findings may offer novel clinical insights for enhancing in vitro oocyte maturation culture in elderly patients. 5. Conclusion Putrescine regulates the IP3R-GRP75-VDAC1 complex in mature oocytes, enhancing mitochondrial calcium homeostasis and restoring mitochondrial function, thereby improving oocyte quality. Our study provides new evidence supporting the use of putrescine as a clinical IVM additive by regulating Ca²⁺ transport within MAM in oocytes. Declarations Ethics Approval and Consent to Participate This study was approved by the Animal Ethics Committee of Nanjing Medical University (IACUC-2208018). Consent for publication Not applicable. Conflict of Interest Statement The authors declare no competing interests. Funding This work was supported by the grants from the National Key Research and Development Program of China (2021YFC2700404). Availability of data and materials All data generated and/or analyzed during this study are included in this published article. References ESHRE Capri Workshop Group. Fertility and ageing. Hum. Reprod. Update . 11 , 261–276. https://doi.org/10.1093/humupd/dmi006 (2005). Takehara, I. et al. Impact of endoplasmic reticulum stress on oocyte aging mechanisms. Mol. Hum. Reprod. 26 , 567–575. https://doi.org/10.1093/molehr/gaaa040 (2020). Van Der Reest, J., Nardini Cecchino, G., Haigis, M. C. & Kordowitzki, P. Mitochondria: Their relevance during oocyte ageing. Ageing Res. Rev. 70 , 101378. https://doi.org/10.1016/j.arr.2021.101378 (2021). Liu, Y. et al. Mitochondria-associated endoplasmic reticulum membrane (MAM): a dark horse for diabetic cardiomyopathy treatment. Cell. Death Discov . 10 , 148. https://doi.org/10.1038/s41420-024-01918-3 (2024). Janikiewicz, J. et al. Mitochondria-associated membranes in aging and senescence: structure, function, and dynamics. Cell. Death Dis. 9 , 332. https://doi.org/10.1038/s41419-017-0105-5 (2018). Vallese, F., Barazzuol, L., Maso, L., Brini, M. & Calì, T. ER-Mitochondria Calcium Transfer, Organelle Contacts and Neurodegenerative Diseases. In: (ed Islam, M. S.) Calcium Signaling, vol. 1131, Cham: Springer International Publishing; 719–746. https://doi.org/10.1007/978-3-030-12457-1_29 . (2020). Hayashi, T., Rizzuto, R., Hajnoczky, G. & Su, T-P. MAM: more than just a housekeeper. Trends Cell Biol. 19 , 81–88. https://doi.org/10.1016/j.tcb.2008.12.002 (2009). Atakpa-Adaji, P. & Ivanova, A. IP 3 R at ER-Mitochondrial Contact Sites: Beyond the IP 3 R-GRP75-VDAC1 Ca 2+ Funnel. Contact 6 , 25152564231181020. https://doi.org/10.1177/25152564231181020 (2023). Wang, Q. et al. Targeting GRP75 with a Chlorpromazine Derivative Inhibits Endometrial Cancer Progression Through GRP75–IP3R-Ca 2+ ‐AMPK Axis. Adv. Sci. 11 , 2304203. https://doi.org/10.1002/advs.202304203 (2024). Baumgartner, H. K. et al. Calcium Elevation in Mitochondria Is the Main Ca2 + Requirement for Mitochondrial Permeability Transition Pore (mPTP) Opening. J. Biol. Chem. 284 , 20796–20803. https://doi.org/10.1074/jbc.M109.025353 (2009). Jiang, R-Q., Li, Q-Q. & Sheng, R. Mitochondria associated ER membranes and cerebral ischemia: Molecular mechanisms and therapeutic strategies. Pharmacol. Res. 191 , 106761. https://doi.org/10.1016/j.phrs.2023.106761 (2023). Hedskog, L. et al. Modulation of the endoplasmic reticulum–mitochondria interface in Alzheimer’s disease and related models. Proc. Natl. Acad. Sci. USA . 110 , 7916–7921. https://doi.org/10.1073/pnas.1300677110 (2013). Li, Y. et al. GRP75 Modulates Endoplasmic Reticulum–Mitochondria Coupling and Accelerates Ca2+-Dependent Endothelial Cell Apoptosis in Diabetic Retinopathy. Biomolecules 12 , 1778. https://doi.org/10.3390/biom12121778 (2022). Zhao, L. et al. Enriched endoplasmic reticulum-mitochondria interactions result in mitochondrial dysfunction and apoptosis in oocytes from obese mice. J. Anim. Sci. Biotechnol. 8 , 62. https://doi.org/10.1186/s40104-017-0195-z (2017). Holbert, C. E., Cullen, M. T., Casero, R. A. & Stewart, T. M. Polyamines in cancer: integrating organismal metabolism and antitumour immunity. Nat. Rev. Cancer . 22 , 467–480. https://doi.org/10.1038/s41568-022-00473-2 (2022). Tao, Y. et al. Can peri-ovulatory putrescine supplementation improve egg quality in older infertile women? J. Assist. Reprod. Genet. 36 , 395–402. https://doi.org/10.1007/s10815-018-1327-x (2019). Tao, Y. & Liu, X. J. Deficiency of ovarian ornithine decarboxylase contributes to aging-related egg aneuploidy in mice. Aging Cell. 12 , 42–49. https://doi.org/10.1111/acel.12016 (2013). Tao, Y., Liu, D., Mo, G., Wang, H. & Liu, X. J. Peri-ovulatory putrescine supplementation reduces embryo resorption in older mice. Hum. Reprod. 30 , 1867–1875. https://doi.org/10.1093/humrep/dev130 (2015). Liu, D., Mo, G., Tao, Y., Wang, H. & Liu, X. J. Putrescine supplementation during in vitro maturation of aged mouse oocytes improves the quality of blastocysts. Reprod. Fertil. Dev. 29 , 1392. https://doi.org/10.1071/RD16061 (2017). Xu, W. et al. Putrescine delays postovulatory aging of mouse oocytes by upregulating PDK4 expression and improving mitochondrial activity. Aging 10 , 4093–4106. https://doi.org/10.18632/aging.101699 (2018). Xie, S. et al. Putrescine promotes maturation of oocytes from reproductively old mice via mitochondrial autophagy. Reprod. Biomed. Online . 50 , 104495. https://doi.org/10.1016/j.rbmo.2024.104495 (2025). Marchante, M. et al. Deciphering reproductive aging in women using a NOD/SCID mouse model for distinct physiological ovarian phenotypes. Aging https://doi.org/10.18632/aging.205086 (2023). Gilchrist, R. B. & Smitz, J. Oocyte in vitro maturation: physiological basis and application to clinical practice. Fertil. Steril. 119 , 524–539. https://doi.org/10.1016/j.fertnstert.2023.02.010 (2023). Shi, C. et al. Epigenetic effect of putrescine supplementation during in vitro maturation of oocytes on offspring in mice. J. Assist. Reprod. Genet. 39 , 681–694. https://doi.org/10.1007/s10815-022-02448-6 (2022). Gil-Hernández, A. & Silva-Palacios, A. Relevance of endoplasmic reticulum and mitochondria interactions in age-associated diseases. Ageing Res. Rev. 64 , 101193. https://doi.org/10.1016/j.arr.2020.101193 (2020). Lane, S. L. et al. Increased Systemic Antioxidant Power Ameliorates the Aging-Related Reduction in Oocyte Competence in Mice. IJMS 22 , 13019. https://doi.org/10.3390/ijms222313019 (2021). Jin, X. et al. RAB7 activity is required for the regulation of mitophagy in oocyte meiosis and oocyte quality control during ovarian aging. Autophagy 18 , 643–660. https://doi.org/10.1080/15548627.2021.1946739 (2022). De Ridder, I. et al. The ER-mitochondria interface, where Ca2 + and cell death meet. Cell. Calcium . 112 , 102743. https://doi.org/10.1016/j.ceca.2023.102743 (2023). Thoudam, T. et al. PDK4 Augments ER–Mitochondria Contact to Dampen Skeletal Muscle Insulin Signaling During Obesity. Diabetes 68 , 571–586. https://doi.org/10.2337/db18-0363 (2019). Zhang, C. et al. IP3R1 regulates calcium balance in porcine oocyte maturation and early embryonic development. Theriogenology 209 , 151–161. https://doi.org/10.1016/j.theriogenology.2023.06.021 (2023). Li, J. et al. GRP75-faciliated Mitochondria-associated ER Membrane (MAM) Integrity controls Cisplatin-resistance in Ovarian Cancer Patients. Int. J. Biol. Sci. 18 , 2914–2931. https://doi.org/10.7150/ijbs.71571 (2022). Romero-Garcia, S. & Prado-Garcia, H. Mitochondrial calcium: Transport and modulation of cellular processes in homeostasis and cancer (Review). Int. J. Oncol. https://doi.org/10.3892/ijo.2019.4696 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7823915","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":549335326,"identity":"4ba91585-1c58-42f4-9c1f-72e29f950f65","order_by":0,"name":"Man Ni","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Man","middleName":"","lastName":"Ni","suffix":""},{"id":549335327,"identity":"027711e2-cdef-4d3a-90c4-02ecabd65049","order_by":1,"name":"Shuang Guo","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Guo","suffix":""},{"id":549335332,"identity":"dc5ecae8-cd09-480a-967f-286ccc4000f2","order_by":2,"name":"Li Cheng","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Cheng","suffix":""},{"id":549335333,"identity":"f36da0a8-3db1-40ae-9782-c0c995ba5308","order_by":3,"name":"Boya La","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Boya","middleName":"","lastName":"La","suffix":""},{"id":549335334,"identity":"84c8e443-4bff-4086-ba14-dcc301d6e3fc","order_by":4,"name":"Zhengjie Yan","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University, Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhengjie","middleName":"","lastName":"Yan","suffix":""},{"id":549335336,"identity":"e2a3364e-7868-44aa-9f33-01792512aaa2","order_by":5,"name":"Yugui Cui","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University, Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yugui","middleName":"","lastName":"Cui","suffix":""},{"id":549335339,"identity":"a46fb4e0-58c0-4e2e-90ff-c6a66d034c3b","order_by":6,"name":"Lianju Qin","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University, Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lianju","middleName":"","lastName":"Qin","suffix":""},{"id":549335342,"identity":"3f324325-8b09-443f-afcc-4ecb76344c89","order_by":7,"name":"Jiayin Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYBACxgbGBgaGAgkGfmbmww9I0GIgwSDZzpZmQIJdQLUG53kUJIhSzDwjue0Bg4FF4ubDPECdNTbRhB02I7HdAOiwxG2HeQ88YDiWlttAhJY2CYgWvgQDxobDJGjZ3MxjIEGalg3MRGvpeQjWYjzjMDCQE4jxi2F7+jMJhoo62f7+w4cffKixIULLhAQG5j8wXgIh5SAgz3+AGGWjYBSMglEwogEAo4Y6c+AxJMUAAAAASUVORK5CYII=","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University, Nanjing Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jiayin","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-10-10 07:38:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7823915/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7823915/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96710547,"identity":"3f14f2ae-49df-4637-ad24-08ca6d58280d","added_by":"auto","created_at":"2025-11-25 10:10:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5240930,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/050cf03cb7ade68d8899c80f.docx"},{"id":96683447,"identity":"186e3cbe-4567-4b32-9004-a911da313abd","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9054,"visible":true,"origin":"","legend":"","description":"","filename":"832a6046d7de41fb99ad1a0e799845d0.json","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/c53d2c6e25c607ef99910e58.json"},{"id":96710438,"identity":"e3b7c102-2537-4b7a-b5a2-a3693e9851fb","added_by":"auto","created_at":"2025-11-25 10:10:39","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101355,"visible":true,"origin":"","legend":"","description":"","filename":"832a6046d7de41fb99ad1a0e799845d01enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/6f4137e6d468904d7b1bd15b.xml"},{"id":96683457,"identity":"28dc1742-a128-49dc-a3d9-9f52b3e3fd7a","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2584884,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/08a30f6125daf00051f60c47.jpeg"},{"id":96683451,"identity":"85c391e2-243b-46fc-9e4e-c175902dacdf","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4344764,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/177eba9f60122d357f19bdbf.jpeg"},{"id":96710725,"identity":"04dddd5b-275c-4185-8f3f-c6c7493aad5d","added_by":"auto","created_at":"2025-11-25 10:11:07","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5720726,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/1afb32428689212f739f1a5d.jpeg"},{"id":96710728,"identity":"fd6c9d03-5567-464b-849a-17edcf0d442f","added_by":"auto","created_at":"2025-11-25 10:11:07","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5830954,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/a51f5745fd691936f56019e1.jpeg"},{"id":96683470,"identity":"b1bc4a9a-f6c2-49a9-adb5-0be036fefebf","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3405900,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/01203f55a6e9efc73bf73ada.jpeg"},{"id":96710674,"identity":"ca0977b5-8473-4bf7-8ad0-c00ca7894937","added_by":"auto","created_at":"2025-11-25 10:11:03","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4496804,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/ca524a3f8fcc712d310c5502.jpeg"},{"id":96710912,"identity":"7535ca2a-dbfa-4bbf-a7f2-07ae51c1c9df","added_by":"auto","created_at":"2025-11-25 10:11:24","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2858556,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/3a0cd4e18a94cfdd30790584.jpeg"},{"id":96683461,"identity":"e1bd6919-3d45-4f18-92ab-6acb7616ad7d","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104549,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/9ec6f9729925dc56a4f92458.png"},{"id":96710524,"identity":"e62961d6-c192-4d3b-aa9b-9e7b5557e17e","added_by":"auto","created_at":"2025-11-25 10:10:50","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154187,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/8807f32f9e7cd43979068088.png"},{"id":96683463,"identity":"6dcc2815-fa5b-4485-a825-974c0d381de1","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":227671,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/93babc414b0f3f3eeb5909d3.png"},{"id":96683468,"identity":"9048f29e-fd65-4bf7-a1f5-60c86a9efcaf","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91035,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/1f6027f045d99e353bbb7836.png"},{"id":96711438,"identity":"2a4094e4-838a-46e5-9c81-470135506864","added_by":"auto","created_at":"2025-11-25 10:12:01","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66772,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/9fe6a78e605daa8dd4b920eb.png"},{"id":96683458,"identity":"a89ae29c-c132-419c-87f4-a059ae5af465","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65356,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/5cbb3bacec30e12874365540.png"},{"id":96710465,"identity":"cc16fdf4-f7c8-4176-924d-91bdcc323317","added_by":"auto","created_at":"2025-11-25 10:10:41","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56731,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/afe72c759062310c08bf7f37.png"},{"id":96683465,"identity":"66f0e7b6-bd1b-4c31-8b5f-376fa7355067","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99472,"visible":true,"origin":"","legend":"","description":"","filename":"832a6046d7de41fb99ad1a0e799845d01structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/7082f4fd6cd5c5c54e546e5b.xml"},{"id":96683467,"identity":"747347b7-bbda-4123-ae67-c7cafdd59097","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"html","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110549,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/a1cba88d8424c945cd6e425d.html"},{"id":96683446,"identity":"57110817-bd84-45b9-a4ba-9ee4b0889a8d","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":458232,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of a mouse model for AR-DOR. A. Comparison of dorsal and lateral volumes between 8-week-old young mice and 10-month-old aged mice, n = 3. B. Comparison of ovarian size between 8-week-old young mice and 10-month-old aged mice, n = 3. C. The ovarian index is defined as the ratio of ovarian weight to body weight. The statistical graph illustrates the ovarian index for young and aged groups, n = 30. D. An enzyme-linked immunosorbent assay (ELISA) was used to quantify AMH levels in mice. Statistical analysis of AMH levels in young and aged mouse groups is presented in the graph, n = 100. E. Oocytes were collected 46–48 hours after intraperitoneal injection of each mouse with 10 IU of PMSG. Statistical analysis of the number of oocytes per mouse in young and aged groups is presented in the graph, n = 100. Statistical signifcance is indicated as follows: ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/bdf9acab8d3775a8cf7cfe41.png"},{"id":96711437,"identity":"513227fb-0831-4bb3-9c3d-34a873121f7f","added_by":"auto","created_at":"2025-11-25 10:12:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1116746,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine enhances oocyte quality in aged mice. A. Representative images of the extrusion of the first polar body from mouse oocytes, as well as the development of the two-cell stage and blastocysts, n = 20–30. B. Statistical analysis of the first polar body extrusion rate, n = 20–30. C. Statistical analysis of the 2-cell rate, n = 20–30. D. Statistical analysis of the blastocyst rate, n = 20–30. Statistical signifcance is indicated as follows: *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/39a7081952f43e42e0d59548.png"},{"id":96683449,"identity":"64380de3-9a30-4d72-925b-7039ab8721f4","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1596683,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine reduces the number of MAM in aged mice. A. Characteristic features of MAM in oocyte electron microscopy. The endoplasmic reticulum and mitochondria are labeled in red. The dashed line indicates the length of mitochondria near the endoplasmic reticulum, while the arrowed line represents the MAM region. The first row displays the image at 200,000× magnification, scale bar = 500 nm. The second row shows a magnified 4×image of the red box from the first row, scale bar = 200 nm. B.Characteristic fluorescence colocalization of the endoplasmic reticulum and mitochondria in the Young, Aged, and Put groups. ER Tracker and Mitotracker were used to localize the endoplasmic reticulum and mitochondria in oocytes, respectively. The endoplasmic reticulum was labeled with green fluorescence, mitochondria with red fluorescence, and their colocalization resulted in yellow fluorescence, n = 10–15. C. Statistical analysis of the ratio between the length of the MAM portion of the mitochondrial structure and the total mitochondrial circumference, n = 20. D.Statistical analysis of the distances between the endoplasmic reticulum and mitochondria, n = 20. E. The colocalization of the endoplasmic reticulum and mitochondria was analyzed using Pearson's coefficient, n = 10–15. Statistical signifcance is indicated as follows: **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01,****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/34b609721293e4d5e0e3370f.png"},{"id":96711571,"identity":"451ab515-fc6f-4634-800e-3a3075899f41","added_by":"auto","created_at":"2025-11-25 10:12:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1577913,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine regulates the IP3R-GRP75-VDAC1 complex. A. The intensity of protein interactions between IP3R, GRP75, and VDAC1 in oocytes from the Young, Old, and Put groups was determined using an in situ Proximity Ligation Assay, with each dot-shaped red fluorescent signal representing an interaction between the corresponding proteins at the site. B. Statistical analysis plot of the interaction strength between IP3R, GRP75 and VDAC1 in the Young, Old, and Put groups, n = 15–20. C.Statistical analysis of the mRNA expression levels of IP3R, GRP75, and VDAC1 in oocytes from the Young, Old, and Put groups, n = 20. Statistical signifcance is indicated as follows: *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/c6f9c36297d16d3556afa5be.png"},{"id":96683453,"identity":"62ec8258-050a-4801-9b49-686a5d26e431","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":966824,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine alleviates mitochondrial calcium overload in aged oocytes. A. The intracellular ([Ca²⁺]\u003csub\u003ei\u003c/sub\u003e), mitochondrial ([Ca²⁺]\u003csub\u003em\u003c/sub\u003e), and endoplasmic reticulum ([Ca²⁺]\u003csub\u003eER\u003c/sub\u003e) calcium levels in the Young, Old, and Put groups were determined using Fluo-4 AM, Rhod-2 AM, and Mag-Fluo-4 AM, respectively. B. Statistical analysis of mitochondrial ([Ca²⁺]\u003csub\u003em\u003c/sub\u003e) fluorescence intensity in the Young, Old, and Put groups, n = 15. C. Statistical analysis of endoplasmic reticulum ([Ca²⁺]\u003csub\u003eER\u003c/sub\u003e) fluorescence intensity in the Young, Old, and Put groups, n = 15. D. Statistical analysis of intracellular ([Ca²⁺]\u003csub\u003ei\u003c/sub\u003e) fluorescence intensity in the Young, Old, and Put groups, n = 15. Statistical signifcance is indicated as follows: *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001. Abbreviations: [Ca²⁺]\u003csub\u003ei\u003c/sub\u003e: intracellular Ca²⁺ concentration, [Ca²⁺]\u003csub\u003eER\u003c/sub\u003e: endoplasmic reticulum Ca²⁺ concentration, [Ca²⁺]\u003csub\u003em\u003c/sub\u003e: mitochondrial Ca²⁺ concentration.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/295729583bb2a5a3b722b08d.png"},{"id":96683454,"identity":"8736f355-1b3d-43a0-9ba6-0dd0503a6e92","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1532814,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine improves mitochondrial function in aged mice. \u003cstrong\u003eA.\u003c/strong\u003e Mitochondrial membrane potential was evaluated using JC-1 staining. The red-to-green fluorescence intensity ratio was used to quantify mitochondrial membrane potential, where a higher ratio indicates a greater membrane potential. \u003cstrong\u003eB.\u003c/strong\u003e Oocyte ROS intensity was measured using DCFH-DA. Fluorescence intensity was used to quantify intracellular ROS content in oocytes. \u003cstrong\u003eC.\u003c/strong\u003e Statistical analysis of mitochondrial membrane potential (\u003cem\u003eΔψm\u003c/em\u003e), n = 10–15 . \u003cstrong\u003eD.\u003c/strong\u003e Statistical analysis of ATP content in oocytes from the Young, Old, and Put groups, n = 20. \u003cstrong\u003eE.\u003c/strong\u003e Statistical analysis of ROS fluorescence intensity, n = 10–15. Statistical signifcance is indicated as follows: **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/5449025c8a5d5e5a0e353330.png"},{"id":96683455,"identity":"75ef67ac-8834-4db9-891b-0916af545493","added_by":"auto","created_at":"2025-11-25 04:22:20","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":966758,"visible":true,"origin":"","legend":"\u003cp\u003ePutrescine reduces oocyte apoptosis in aging mice. A. The degree of MPTP opening was quantified by measuring the intensity of green fluorescence using Calcein AM. A lower fluorescence intensity indicates a greater MPTP opening. B. Annexin V staining was employed to assess apoptosis levels in oocytes from the Young, Old, and Put groups. Red fluorescence on the oocyte membrane indicated the presence of apoptosis. C. Statistical analysis of MPTP opening, n = 15. D. The oocyte apoptosis rate in each group was analyzed statistically using Annexin V staining, n = 15. E. Statistical analysis of Caspase9 mRNA expression levels in oocytes from the Young, Old, and Put groups, n = 20. F. Statistical analysis of Caspase3 mRNA expression levels in oocytes from the Young, Old, and Put groups, n = 20. Statistical signifcance is indicated as follows: **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ***\u003cem\u003eP \u0026lt; 0.0001. \u003c/em\u003eAbbreviations: MPTP: mitochondrial permeability transition pore.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/c6b70cf0ffff919ca6efc219.png"},{"id":99797060,"identity":"e2eef4e0-322f-4b82-88a0-311a1a72408d","added_by":"auto","created_at":"2026-01-08 13:44:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8951982,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7823915/v1/4f451c05-1da8-4887-8212-87ae5d2316bc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Putrescine Improves Oocyte Quality in Aged Mice by Modulating the IP3R-GRP75-VDAC1 Complex","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAs women age, fertility progressively declines, primarily due to a reduction in both the quantity and quality of oocytes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Senescent oocytes exhibit endoplasmic reticulum stress (ERS) accompanied by an amplified unfolded protein response [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Furthermore, abnormalities in mitochondrial fusion and fission are frequently observed in these oocytes, resulting in reduced membrane potential and compromised ATP production [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite these insights, the role of MAM in aging oocytes remains insufficiently investigated.\u003c/p\u003e\u003cp\u003eThe endoplasmic reticulum (ER) and mitochondria are physically connected at a specialized interface termed the mitochondria-associated endoplasmic reticulum membranes (MAM) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This interface facilitates essential cellular processes, including lipid synthesis and transport, calcium homeostasis, reactive oxygen species production, mitochondrial autophagy, and the regulation of ER stress [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Calcium ions (Ca\u0026sup2;⁺), serving as second messengers, are indispensable for MAM activity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The primary pathway for Ca\u0026sup2;⁺ transport at the MAM is mediated by the IP3R-GRP75-VDAC1 complex [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Upon activation by phospholipase C (PLC), inositol trisphosphate receptors (IP3Rs) in the ER lumen release Ca\u0026sup2;⁺ ions. The molecular chaperone GRP75 anchors IP3R to VDAC1, facilitating Ca\u0026sup2;⁺ transfer. These ions subsequently enter mitochondria via VDAC1 in the outer mitochondrial membrane and the mitochondrial calcium uniporter (MCU) in the inner membrane, regulating mitochondrial respiration and ATP production [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. MAM disruption impairs ER-mediated Ca\u0026sup2;⁺ release via IP3R, leading to reduced ATP synthesis and compromised cellular viability [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Conversely, excessive or prolonged mitochondrial Ca\u0026sup2;⁺ accumulation can induce the opening of the mitochondrial permeability transition pore (MPTP), causing cytochrome C release, activation of Caspase9 and Caspase3, and ultimately apoptosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Proteins such as Sig-1R, Mfn2, and CypD interact with the IP3R-GRP75-VDAC1 complex to co-regulate Ca\u0026sup2;⁺ transport [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Dysregulated Ca\u0026sup2;⁺ signaling at the MAM has been associated with various age-related conditions, including neurodegenerative disorders [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], diabetes-related complications [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], cancer, and diminished oocyte quality in obese mice [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, its specific contribution to the aging process of oocytes remains inadequately explored.\u003c/p\u003e\u003cp\u003ePutrescine, a polyamine synthesized from ornithine by the enzyme ornithine decarboxylase (ODC), plays a pivotal role in antioxidant defense, anti-apoptotic regulation, and anti-inflammatory processes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In mammals and rodents, pre-ovulatory surges of luteinizing hormone (LH) induce a transient yet marked increase in ODC expression in the ovary, stimulating putrescine production [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, with aging, ODC activity decreases, leading to reduced synthesis of putrescine in mice [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Supplementation with putrescine, either in the oocyte maturation medium or via drinking water during ovulation, has been shown to decrease oocyte aneuploidy and embryo resorption, thereby improving fertility in aged mice [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additionally, putrescine improves oocyte and blastocyst quality by promoting nuclear maturation of oocytes, resulting in higher live birth rates [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Furthermore, putrescine has been found to delay post-ovulatory oocyte aging by upregulating PDK4 expression and enhancing mitochondrial function [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. While significant progress has been made, the role of MAM in oocyte aging remains inadequately explored.\u003c/p\u003e\u003cp\u003eIn this study, we established a mouse model of age-related ovarian reserve depletion. We investigated alterations in oocyte quality, MAM, and mitochondrial function in aging mice, while also exploring the protective effects of putrescine. Previous research has demonstrated that the IP3R-GRP75-VDAC1 complex plays a pivotal role in the transfer of Ca\u0026sup2;⁺ from the endoplasmic reticulum to the mitochondria. Based on this, we assessed whether putrescine could alleviate mitochondrial calcium overload by modulating the interaction between IP3R, GRP75, and VDAC1. Such modulation may enhance mitochondrial function, reduce apoptosis, and improve oocyte quality. This study provides valuable insights into the potential of putrescine to enhance oocyte quality in aged mice, laying the groundwork for its future clinical applications.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Mice and ethics statement\u003c/h2\u003e\u003cp\u003e All animal experiments were approved by the Animal Ethics Committee of Nanjing Medical University (IACUC-2208018). Mice were obtained from the Laboratory Animal Base of Nanjing Medical University and maintained under a 12-hour light/dark cycle at 26\u0026deg;C with unrestricted access to food and water. Euthanasia was performed using a small animal carbon dioxide euthanasia chamber (CL-1000M, Shanghai Yuyan Instrument, China). All methods were performed in accordance with the relevant guidelines and regulations. The study is reported in accordance with ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Oocyte collection and maturation\u003c/h2\u003e\u003cp\u003eThe experiments were conducted on C57BL/6J mice. The young control group consisted of mice aged 8\u0026ndash;10 weeks, while the old experimental group consisted of mice aged 36\u0026ndash;40 weeks. Each mouse received 10 IU of PMSG, and oocytes were collected 46\u0026ndash;48 hours later. The number of cumulus-oocyte complexes (COCs) obtained from each mouse\u0026rsquo;s ovaries was recorded and classified into three groups: young (Young), old (Old), and putrescine (Put). The oocytes were cultured for 14\u0026ndash;16 hours at 37\u0026deg;C in a 5% CO₂ incubator using IVM culture medium (M2115, Nanjing Aibei Biotechnology, China), with or without the addition of 0.5 mM putrescine (P5780, Sigma, USA) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Following this, hyaluronidase (M2215, Nanjing Aibei Biotechnology, China) was used to detach the granulosa cells, and the first polar body extrusion of the oocyte was observed under a stereomicroscope. MII-stage oocytes were collected for subsequent experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 IVF of MII oocytes\u003c/h2\u003e\u003cp\u003eMale C57BL/6J mice were euthanized, and their epididymides were removed. The vas deferens was then incised with a 1 mL syringe needle to allow spermatozoa to enter the TYH culture medium (M2035, Nanjing Aibei Biotechnology, China) for 60 minutes. The mature oocytes were washed three times in HTF solution (M1135, Nanjing Aibei Biotechnology, China) and then co-cultured with capacitated spermatozoa for 4\u0026ndash;6 hours. The oocytes were washed with KSOM culture medium (M1435, Nanjing Aibei Biotechnology, China) and cultured in fresh droplets. The embryos were observed and photographed as they developed into the two-cell stage (24\u0026ndash;30 hours after fertilization) and blastocyst stage (96\u0026ndash;100 hours after fertilization). All cultures were conducted at 37\u0026deg;C in a 5% CO₂ incubator, and the experiment was repeated at least three times, with 30\u0026ndash;40 oocytes per group in each trial.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 AMH Assay\u003c/h2\u003e\u003cp\u003eBlood was collected from the medial canthus vein one week after 8-week-old and 40-week-old mice were housed for equilibration. The blood samples were left at room temperature for 2 hours before being centrifuged at 4\u0026deg;C and 3,000 rpm for 15 minutes. The serum was then collected, and serum AMH levels were measured using the Mouse AMH Assay Kit (ML037597, Shanghai Enzyme-linked Biotechnology, China) according to the provided instructions. The experiment was conducted at least three times, with each trial including a minimum of 15 mice per group.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Transmission electron microscopy (TEM)\u003c/h2\u003e\u003cp\u003eThirty MII-stage oocytes were collected from each group and fixed in 2.5% glutaraldehyde for 2 hours at room temperature. The oocytes were then stained with eosin, embedded in 10 \u0026micro;L of 1.5% agarose, and centrifuged to concentrate the oocytes at the bottom of the EP tubes. The agarose was solidified and fixed with glutaraldehyde before being transported on ice to the Analysis and Testing Centre of Nanjing Medical University for sample preparation and sectioning. The specimen was subsequently observed and photographed using a JEM-1400 Flash transmission electron microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Determination of mitochondrial ROS and mitochondrial membrane potentials\u003c/h2\u003e\u003cp\u003eReactive oxygen species (ROS) and mitochondrial membrane potential (Δψm) levels in oocytes were assessed using DCFH-DA (S0033S, Beyotime, China) and JC-1 (S2003S, Beyotime, China), respectively. MII-stage oocytes were incubated with DCFH-DA or JC-1 for 30 minutes in a humidified environment with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. After incubation, the oocytes were washed three times with M2 culture medium (M1250, Nanjing Aibei Biotechnology, China) and subsequently placed in a confocal dish (801001, Nest, China). Fluorescence intensity was quantified using a Nikon Eclipse Ti confocal microscope. Each group consisted of 10 to 15 oocytes, and the experiment was repeated at least three times for each indicator.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 ATP assay\u003c/h2\u003e\u003cp\u003eATP content in oocytes was measured using the Enhanced ATP Assay Kit (S0027, Beyotime, China). Each group consisted of twenty MII-stage oocytes, which were washed three times in PBS-PVA and transferred to 10 \u0026micro;L of lysate. The total volume in each group was maintained at 20 \u0026micro;L. The standards were prepared with concentrations of 0.01 \u0026micro;M, 0.03 \u0026micro;M, 0.1 \u0026micro;M, 0.3 \u0026micro;M, 1 \u0026micro;M, and 3 \u0026micro;M. The ATP Assay Reagent and ATP Assay Reagent Diluent were combined in a 1:4 ratio to prepare the ATP Assay Working Solution. To eliminate background ATP, 100 \u0026micro;L of ATP Assay Working Solution was added to each EP tube and incubated at room temperature for 3\u0026ndash;5 minutes. Each test tube was mixed with 20 \u0026micro;L of either standard or sample, and the relative luminescence unit (RLU) values were determined using a GloMax 20/20 luminometer (Promega, USA). The ATP concentration of each sample was calculated based on the standard curve.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 The colocalization of mitochondria and ER\u003c/h2\u003e\u003cp\u003eThe endoplasmic reticulum and mitochondria in oocytes were stained using ER Tracker (63ES20, Yeasen, China) and Mitotracker (M7512, Invitrogen, USA), respectively. The staining solution was prepared by diluting ER Tracker and Mitotracker stock solutions in a 1:1000 ratio. After three washes with M2 culture medium, stage MII oocytes were incubated in the staining solution at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e for 30 minutes. Subsequently, the oocytes were washed three times with M2 culture medium and imaged using a Nikon Eclipse Ti confocal microscope. Fifteen oocytes were included per group for each indicator, and the experiment was repeated at least three times.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Measurement of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e, [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003em\u003c/sub\u003e, and [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003eER\u003c/sub\u003e levels\u003c/h2\u003e\u003cp\u003eFluo-4 AM (F14217, ThermoFisher, USA), Rhod-2 AM (MX4507, Making Bio, China), and Mag-Fluo-4 AM (MX4544, Making Bio, China) were employed to assess cytoplasmic, mitochondrial, and endoplasmic reticulum Ca\u0026sup2;⁺ levels, respectively. The staining working solution was prepared according to the recommended concentrations in the manufacturer's instructions. Subsequently, Stage MII oocytes were incubated in the staining working solution for 30 minutes. Afterwards, the oocytes were washed three times with M2 culture medium and re-incubated in fresh M2 culture medium for 30 minutes to facilitate complete de-esterification. The incubations were conducted at 37\u0026deg;C in a 5% CO₂ incubator, and the resulting images were captured using a Nikon Eclipse Ti confocal microscope. Each indicator was stained using 15 oocytes per group, and the experiment was repeated at least three times per group.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 MPTP assay\u003c/h2\u003e\u003cp\u003eThe MPTP assay kit (C2009S, Beyotime, China) was employed to assess the degree of mitochondrial permeability transition pore opening in oocytes. Calcein AM staining solution, fluorescence quenching working solution, and ionomycin control were prepared separately according to the manufacturer's instructions. The oocytes were transferred to the appropriate staining solution and incubated at 37\u0026deg;C in a 5% CO₂ incubator for 30 minutes. Afterward, they were washed three times with M2 culture medium before continuing the incubation for another 30 minutes. The oocytes were observed under a Nikon Eclipse Ti confocal microscope. The experiment was repeated at least three times, using 15 oocytes per group in each trial.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Measurement of early apoptosis levels\u003c/h2\u003e\u003cp\u003eThe Annexin V-FITC Apoptosis Detection Kit (C1077S, Beyotime, China) was employed to assess early apoptosis levels in oocytes. Mix 5 \u0026micro;L of Annexin V-mCherry with 194 \u0026micro;L of Annexin V-mCherry Binding Buffer to create the staining working solution. The oocytes, previously washed three times with PBS-PVA, were incubated in the staining solution for 20\u0026ndash;30 minutes at room temperature. Subsequently, they were immediately placed under a Nikon Eclipse Ti confocal microscope for imaging. The experiment was repeated at least three times, using 15 oocytes per group in each trial.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12 RNA extraction and gene expression determination by real-time quantitative PCR\u003c/h2\u003e\u003cp\u003eRNA was extracted from groups of 20 oocytes using the RNeasy Plus Micro Kit (74034, QIAGEN, Germany). First-strand cDNA was synthesized through reverse transcription using PrimeScript\u0026trade; RT Master Mix (Takara, Japan). RT-qPCR was performed using SYBR Green in 96-well plates and the ABI StepOnePlus system (Applied Biosystems, USA). Relative mRNA levels were normalized to the endogenous GAPDH levels and calculated using the 2\u003csup\u003e\u0026minus;△△CT\u003c/sup\u003e method. The primer sequences relevant to this study are provided below :\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer (5\u0026prime;\u0026rarr; 3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIP3R-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGTTTTGAGTTTGAAGGCGTTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIP3R-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATCTTGCGCCAATTCCCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGRP75-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGGCTGGAATGGCCTTAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGRP75-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATCTTGCGCCAATTCCCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVDAC1-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCACATACGCCGATCTTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVDAC1-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGGTTTCCGTGTTGGCAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase3-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGTGATGAAGGGGTCATTTATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase3-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCGGCTTTCCAGTCAGACTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase9-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACGCTCTGCTGAGTCGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase9-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTCTAGGGGTTTAACAGCCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13 In situ Proximity ligation assay (PLA)\u003c/h2\u003e\u003cp\u003eProtein-protein interactions were visualized using the Duolink In Situ Detection Kit (DUO92101, Sigma-Aldrich, USA) according to the manufacturer\u0026rsquo;s protocol. Stage MII oocytes were collected, their zona pellucida was stripped using 1% HCl, washed three times with PBS-PVA, fixed with 4% paraformaldehyde, and their membranes were permeabilized using 0.5% Triton. The oocytes were blocked at room temperature for 1 hour using a blocking solution and incubated overnight at 4\u0026deg;C with the primary antibody. The oocytes were washed and then probed with oligonucleotide-coupled probes. The probes were ligated and amplified according to the manufacturer\u0026rsquo;s protocol. Finally, the specimens were stained with DAPI and placed under a Nikon Eclipse Ti confocal microscope for observation and photography. The primary antibodies used for the PLA experiments were anti-rabbit VDAC1 (1:50, ab15898, Abcam, UK), anti-mouse monoclonal IP3R1 (1:50, sc13337, Santa Cruz, USA), anti-mouse monoclonal GRP75 (1:50, sc271197, Santa Cruz, USA), and anti-rabbit IP3R1 (1:50, PA1-901, Invitrogen, USA). The experiments were conducted at least three times, with 15\u0026ndash;20 oocytes per group per trial, and analyzed using Fiji's Analyze Particles feature.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14 Statistical analysis\u003c/h2\u003e\u003cp\u003eThe experiments were conducted at least three times. All results were analyzed using the GraphPad Prism version 8 software and expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Differences between groups were analyzed for statistical significance using Student\u0026rsquo;s t-test or one-way ANOVA. Significance levels are indicated as follows: * (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), ** (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), *** (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and **** (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Establishment of age-related diminished ovarian reserve mouse model\u003c/h2\u003e\u003cp\u003eAn age-related diminished ovarian reserve (AR-DOR) mouse model was established using 36- to 40-week-old mice, with 8- to 10-week-old mice serving as young controls [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Images of the dorsal and lateral sides (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and ovaries (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) of both groups of mice are presented. Anti-M\u0026uuml;llerian hormone (AMH) levels and the number of oocytes obtained are key indicators of ovarian function in mice. Mice in the aging group exhibited a marked decline in ovarian index (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), AMH levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), and the number of oocytes retrieved (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). These findings indicate impaired ovarian function, thereby validating the AR-DOR mouse model.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Putrescine improves oocyte quality in aged mice\u003c/h2\u003e\u003cp\u003eThe extrusion of the first polar body is a key indicator of oocyte nuclear maturation. The rate of first polar body extrusion was significantly lower in oocytes from aged mice compared to those from young mice, but it was significantly improved by the addition of putrescine to the IVM solution (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). Additionally, the two-cell formation rate in aging oocytes showed a tendency to decrease, although this was only marginally alleviated by putrescine supplementation, with no significant difference observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C). Blastocyst formation, a hallmark of oocyte cytoplasmic maturation, was significantly reduced in oocytes from aged mice, but was notably increased after the inclusion of putrescine (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, D). These results demonstrate that the addition of putrescine during in vitro culture significantly enhances oocyte quality in aged mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.3 The addition of putrescine to the IVM solution resulted in a decrease in the number of MAM in oocytes of aging mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTransmission electron microscopy was used to observe the mitochondria and endoplasmic reticulum in mouse oocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). There was no significant difference in the ratio of the length of the MAM portion to the mitochondrial circumference in the oocytes of the Young, Old, and Put groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In oocytes from aged mice, the distance between the endoplasmic reticulum and mitochondria was shorter than that in young control mice. Additionally, the spacing between the two organelles increased with the addition of putrescine (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Mitochondria and endoplasmic reticulum in oocytes were labeled using Mitotracker and ER tracker, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These results indicate a significant increase in endoplasmic reticulum and mitochondria colocalization in the aged group compared to the younger group. Conversely, colocalization was significantly reduced in the putrescine group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). This suggests that putrescine may mitigate the abnormal increase in the number of MAM in oocytes from aging mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Putrescine reduces the strength of interaction between IP3R, GRP75, and VDAC1\u003c/h2\u003e\u003cp\u003eCa\u0026sup2;⁺ plays a crucial role as a signaling molecule in communication between the endoplasmic reticulum and mitochondria. This process is primarily regulated by the IP3R-GRP75-VDAC1 complex located in the mitochondria-associated membranes. the interaction between IP3R-GRP75, IP3R-VDAC1, and GRP75-VDAC1 was assessed using in situ proximity ligation assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The results indicated that the interaction between IP3R, GRP75, and VDAC1 was enhanced in the Old group and significantly reduced in the Put group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eIn addition, quantitative PCR was used to measure the gene expression of IP3R, GRP75, and VDAC in oocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The study found a statistically significant increase in IP3R expression in the Old group and a significant decrease in the Put group. Additionally, the Old group exhibited significantly higher levels of GRP75 expression, while the Put group showed significantly lower levels. Although no significant differences were observed in VDAC1 expression among the three groups, an increasing trend was noted in the Old group, and a decreasing trend was observed in the Put group.\u003c/p\u003e\u003cp\u003eThese findings suggest that putrescine regulates the gene expression of IP3R and GRP75 in aged oocytes and affects the interaction between IP3R, GRP75, and VDAC1, which are key proteins involved in Ca\u0026sup2;⁺ transport between the endoplasmic reticulum and mitochondria.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Putrescine improves calcium overload in aging mice\u003c/h2\u003e\u003cp\u003eOocyte mitochondria, endoplasmic reticulum, and cytoplasmic calcium were labeled using calcium probes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The addition of putrescine significantly alleviated mitochondrial calcium overload in oocytes from Old group mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Additionally, putrescine significantly increased endoplasmic reticulum Ca\u0026sup2;⁺ levels in oocytes from the Old group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). No significant difference in cytoplasmic calcium intensity was observed among the three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). It is possible that increased interactions between IP3R-GRP75-VDAC1 complexes in oocytes from aged mice may facilitate the transport of ER Ca\u0026sup2;⁺ to mitochondria, leading to mitochondrial calcium overload. Putrescine may reduce mitochondrial calcium overload by decreasing the interaction between IP3R, GRP75, and VDAC1.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Putrescine improves mitochondrial function in ageing mice\u003c/h2\u003e\u003cp\u003eMitochondrial calcium overload leads to a reduction in mitochondrial membrane potential. The mitochondrial membrane potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) of oocytes from the Old group was significantly reduced. However, it was significantly restored with the addition of putrescine (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). In the Old group, ROS levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB) in oocytes were markedly increased, but were markedly reduced in the Put group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Additionally, putrescine supplementation significantly enhanced mitochondrial ATP production in oocytes from the Old group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). These findings indicate that putrescine improves mitochondrial function in aging mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.7 Putrescine reduces oocyte apoptosis in aging mice\u003c/h2\u003e\u003cp\u003eMitochondrial calcium overload can induce the opening of the mitochondrial permeability transition pore (MPTP) in the inner mitochondrial membrane. MPTP opening (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) was markedly elevated in oocytes from the Old group and substantially reduced in the Put group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Caspase9 expression was significantly upregulated in oocytes from the Old group and downregulated in the Put group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Similarly, Caspase3 expression was significantly upregulated in oocytes from the Old group and downregulated in the Put group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). The level of oocyte apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB) was markedly elevated in the Old group. However, putrescine supplementation markedly decreased oocyte apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). These findings indicate that putrescine effectively mitigates apoptosis in oocytes of aging mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePrior studies have demonstrated that putrescine reduces oxidative stress by regulating the antioxidant system and decreasing ROS production [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Moreover, putrescine enhances oocyte and embryo quality, reduces the incidence of miscarriage [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], restores oocyte maturation potential, and decreases aneuploidy in oocytes of aged mice [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. IVM is an assisted reproductive technique used for fertility preservation, especially in individuals with polycystic ovary syndrome (PCOS) and cancer patients with a high number of antral follicles [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Significant progress has been made in IVM culture methods through advancements in animal studies, promoting their routine clinical application. Our prior research demonstrated that adding putrescine to IVM medium improved oocyte maturation and embryonic development in aging mice and exhibited long-term genetic and epigenetic safety in offspring [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Consistent with previous studies, our findings further confirmed that the addition of putrescine to IVM medium mitigated oxidative stress in oocytes of aged mice while enhancing oocyte quality.\u003c/p\u003e\u003cp\u003eMAMs have been extensively studied in aging-related diseases [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Senescent mice exhibit increased endoplasmic reticulum stress [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], attenuated mitochondrial autophagy [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and increased oocyte apoptosis. However, MAM involvement in senescent mouse oocytes has not been documented. The IP3R-GRP75-VDAC1 complex plays a crucial role in Ca\u0026sup2;⁺ transport between the endoplasmic reticulum and mitochondria [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Knockdown of IP3R in C2C12 myotubular cells reduced its interaction with GRP75 and VDAC1, suggesting a correlation between IP3R and GRP75 expression and their interaction with VDAC1. Additionally, GRP75 knockdown weakened its interaction with IP3R1 and VDAC1 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In porcine oocytes, mitochondrial Ca\u0026sup2;⁺ concentration was significantly reduced upon IP3R1 knockdown [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Similarly, GRP75 knockdown in ovarian cancer cell lines markedly decreased the IP3R-VDAC1 interaction and [Ca\u0026sup2;⁺]\u003csub\u003em\u003c/sub\u003e levels, whereas GRP75 overexpression markedly strengthened their interaction within the MAM, leading to an increase in [Ca\u0026sup2;⁺]\u003csub\u003em\u003c/sub\u003e levels [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Our study demonstrated a significant increase in the interactions between IP3R, GRP75, and VDAC1, along with a shortening of the distance between the endoplasmic reticulum and mitochondria and an increased number of MAM in oocytes of aged mice. These changes led to mitochondrial calcium overloading. The addition of putrescine to IVM cultures diminished protein interactions within the IP3R-GRP75-VDAC1 complex, reduced the number of MAM, and alleviated mitochondrial calcium overload. These findings indicate that putrescine enhances oocyte quality by regulating the IP3R-GRP75-VDAC1 complex, thereby reducing mitochondrial calcium overload.\u003c/p\u003e\u003cp\u003eMitochondrial calcium is a double-edged sword. Appropriate calcium levels maintain mitochondrial function and promote efficient energy production. Therefore, maintaining calcium homeostasis is essential for preserving mitochondrial function. However, mitochondrial calcium overload can lead to dysfunction, impaired ATP production, and ultimately apoptosis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Diabetic retinopathy promotes MAM formation via the IP3R1-GRP75-VDAC1 axis, resulting in mitochondrial calcium overload and enhanced Ca\u0026sup2;⁺-dependent apoptotic pathways [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The study has shown that increased MPTP opening leads to decreased mitochondrial membrane potential, markedly reduced ATP production, and significantly elevated ROS levels in oocytes from aging mice. These changes culminate in the activation of Caspase9 and Caspase3, leading to increased apoptosis. The addition of putrescine significantly improved mitochondrial function, enhanced ATP production, and mitigated apoptosis.\u003c/p\u003e\u003cp\u003eAlthough we have refined our experimental protocol, it remains subject to certain inherent limitations. To validate the interaction between the IP3R-GRP75-VDAC1 complex, we employed the in situ proximity ligation assay to demonstrate protein interactions. This approach was chosen because of the limited availability of senescent mouse oocytes and the substantial quantity required, making co-immunoprecipitation cost-prohibitive. Moving forward, we will investigate whether putrescine affects endoplasmic reticulum function by modulating MAM, potentially influencing the endoplasmic reticulum-Ca\u0026sup2;⁺-mitochondrial signaling pathway. These findings may offer novel clinical insights for enhancing in vitro oocyte maturation culture in elderly patients.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003ePutrescine regulates the IP3R-GRP75-VDAC1 complex in mature oocytes, enhancing mitochondrial calcium homeostasis and restoring mitochondrial function, thereby improving oocyte quality. Our study provides new evidence supporting the use of putrescine as a clinical IVM additive by regulating Ca\u0026sup2;⁺ transport within MAM in oocytes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Animal Ethics Committee of Nanjing Medical University (IACUC-2208018).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from the National Key Research and Development Program of China (2021YFC2700404).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated and/or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eESHRE Capri Workshop Group. Fertility and ageing. \u003cem\u003eHum. Reprod. Update\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, 261\u0026ndash;276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/humupd/dmi006\u003c/span\u003e\u003cspan address=\"10.1093/humupd/dmi006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTakehara, I. et al. Impact of endoplasmic reticulum stress on oocyte aging mechanisms. \u003cem\u003eMol. Hum. Reprod.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e, 567\u0026ndash;575. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molehr/gaaa040\u003c/span\u003e\u003cspan address=\"10.1093/molehr/gaaa040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Der Reest, J., Nardini Cecchino, G., Haigis, M. C. \u0026amp; Kordowitzki, P. Mitochondria: Their relevance during oocyte ageing. \u003cem\u003eAgeing Res. Rev.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e, 101378. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arr.2021.101378\u003c/span\u003e\u003cspan address=\"10.1016/j.arr.2021.101378\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, Y. et al. Mitochondria-associated endoplasmic reticulum membrane (MAM): a dark horse for diabetic cardiomyopathy treatment. \u003cem\u003eCell. Death Discov\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 148. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41420-024-01918-3\u003c/span\u003e\u003cspan address=\"10.1038/s41420-024-01918-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJanikiewicz, J. et al. Mitochondria-associated membranes in aging and senescence: structure, function, and dynamics. \u003cem\u003eCell. Death Dis.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-017-0105-5\u003c/span\u003e\u003cspan address=\"10.1038/s41419-017-0105-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVallese, F., Barazzuol, L., Maso, L., Brini, M. \u0026amp; Cal\u0026igrave;, T. ER-Mitochondria Calcium Transfer, Organelle Contacts and Neurodegenerative Diseases. In: (ed Islam, M. S.) Calcium Signaling, vol. 1131, Cham: Springer International Publishing; 719\u0026ndash;746. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-12457-1_29\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-12457-1_29\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHayashi, T., Rizzuto, R., Hajnoczky, G. \u0026amp; Su, T-P. MAM: more than just a housekeeper. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 81\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tcb.2008.12.002\u003c/span\u003e\u003cspan address=\"10.1016/j.tcb.2008.12.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAtakpa-Adaji, P. \u0026amp; Ivanova, A. IP\u003csub\u003e3\u003c/sub\u003e R at ER-Mitochondrial Contact Sites: Beyond the IP\u003csub\u003e3\u003c/sub\u003e R-GRP75-VDAC1 Ca\u003csup\u003e2+\u003c/sup\u003e Funnel. \u003cem\u003eContact\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 25152564231181020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/25152564231181020\u003c/span\u003e\u003cspan address=\"10.1177/25152564231181020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, Q. et al. Targeting GRP75 with a Chlorpromazine Derivative Inhibits Endometrial Cancer Progression Through GRP75\u0026ndash;IP3R-Ca\u003csup\u003e2+\u003c/sup\u003e ‐AMPK Axis. \u003cem\u003eAdv. Sci.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 2304203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/advs.202304203\u003c/span\u003e\u003cspan address=\"10.1002/advs.202304203\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaumgartner, H. K. et al. Calcium Elevation in Mitochondria Is the Main Ca2\u0026thinsp;+\u0026thinsp;Requirement for Mitochondrial Permeability Transition Pore (mPTP) Opening. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cb\u003e284\u003c/b\u003e, 20796\u0026ndash;20803. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M109.025353\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M109.025353\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang, R-Q., Li, Q-Q. \u0026amp; Sheng, R. Mitochondria associated ER membranes and cerebral ischemia: Molecular mechanisms and therapeutic strategies. \u003cem\u003ePharmacol. Res.\u003c/em\u003e \u003cb\u003e191\u003c/b\u003e, 106761. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2023.106761\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2023.106761\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHedskog, L. et al. Modulation of the endoplasmic reticulum\u0026ndash;mitochondria interface in Alzheimer\u0026rsquo;s disease and related models. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e. \u003cb\u003e110\u003c/b\u003e, 7916\u0026ndash;7921. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1300677110\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1300677110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, Y. et al. GRP75 Modulates Endoplasmic Reticulum\u0026ndash;Mitochondria Coupling and Accelerates Ca2+-Dependent Endothelial Cell Apoptosis in Diabetic Retinopathy. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 1778. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biom12121778\u003c/span\u003e\u003cspan address=\"10.3390/biom12121778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao, L. et al. Enriched endoplasmic reticulum-mitochondria interactions result in mitochondrial dysfunction and apoptosis in oocytes from obese mice. \u003cem\u003eJ. Anim. Sci. Biotechnol.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40104-017-0195-z\u003c/span\u003e\u003cspan address=\"10.1186/s40104-017-0195-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHolbert, C. E., Cullen, M. T., Casero, R. A. \u0026amp; Stewart, T. M. Polyamines in cancer: integrating organismal metabolism and antitumour immunity. \u003cem\u003eNat. Rev. Cancer\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e, 467\u0026ndash;480. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41568-022-00473-2\u003c/span\u003e\u003cspan address=\"10.1038/s41568-022-00473-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, Y. et al. Can peri-ovulatory putrescine supplementation improve egg quality in older infertile women? \u003cem\u003eJ. Assist. Reprod. Genet.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e, 395\u0026ndash;402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10815-018-1327-x\u003c/span\u003e\u003cspan address=\"10.1007/s10815-018-1327-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, Y. \u0026amp; Liu, X. J. Deficiency of ovarian ornithine decarboxylase contributes to aging-related egg aneuploidy in mice. \u003cem\u003eAging Cell.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 42\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/acel.12016\u003c/span\u003e\u003cspan address=\"10.1111/acel.12016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, Y., Liu, D., Mo, G., Wang, H. \u0026amp; Liu, X. J. Peri-ovulatory putrescine supplementation reduces embryo resorption in older mice. \u003cem\u003eHum. Reprod.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 1867\u0026ndash;1875. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/humrep/dev130\u003c/span\u003e\u003cspan address=\"10.1093/humrep/dev130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, D., Mo, G., Tao, Y., Wang, H. \u0026amp; Liu, X. J. Putrescine supplementation during in vitro maturation of aged mouse oocytes improves the quality of blastocysts. \u003cem\u003eReprod. Fertil. Dev.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 1392. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1071/RD16061\u003c/span\u003e\u003cspan address=\"10.1071/RD16061\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, W. et al. Putrescine delays postovulatory aging of mouse oocytes by upregulating PDK4 expression and improving mitochondrial activity. \u003cem\u003eAging\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 4093\u0026ndash;4106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/aging.101699\u003c/span\u003e\u003cspan address=\"10.18632/aging.101699\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie, S. et al. Putrescine promotes maturation of oocytes from reproductively old mice via mitochondrial autophagy. \u003cem\u003eReprod. Biomed. Online\u003c/em\u003e. \u003cb\u003e50\u003c/b\u003e, 104495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rbmo.2024.104495\u003c/span\u003e\u003cspan address=\"10.1016/j.rbmo.2024.104495\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarchante, M. et al. Deciphering reproductive aging in women using a NOD/SCID mouse model for distinct physiological ovarian phenotypes. \u003cem\u003eAging\u003c/em\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/aging.205086\u003c/span\u003e\u003cspan address=\"10.18632/aging.205086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGilchrist, R. B. \u0026amp; Smitz, J. Oocyte in vitro maturation: physiological basis and application to clinical practice. \u003cem\u003eFertil. Steril.\u003c/em\u003e \u003cb\u003e119\u003c/b\u003e, 524\u0026ndash;539. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fertnstert.2023.02.010\u003c/span\u003e\u003cspan address=\"10.1016/j.fertnstert.2023.02.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi, C. et al. Epigenetic effect of putrescine supplementation during in vitro maturation of oocytes on offspring in mice. \u003cem\u003eJ. Assist. Reprod. Genet.\u003c/em\u003e \u003cb\u003e39\u003c/b\u003e, 681\u0026ndash;694. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10815-022-02448-6\u003c/span\u003e\u003cspan address=\"10.1007/s10815-022-02448-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGil-Hern\u0026aacute;ndez, A. \u0026amp; Silva-Palacios, A. Relevance of endoplasmic reticulum and mitochondria interactions in age-associated diseases. \u003cem\u003eAgeing Res. Rev.\u003c/em\u003e \u003cb\u003e64\u003c/b\u003e, 101193. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arr.2020.101193\u003c/span\u003e\u003cspan address=\"10.1016/j.arr.2020.101193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLane, S. L. et al. Increased Systemic Antioxidant Power Ameliorates the Aging-Related Reduction in Oocyte Competence in Mice. \u003cem\u003eIJMS\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 13019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms222313019\u003c/span\u003e\u003cspan address=\"10.3390/ijms222313019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJin, X. et al. RAB7 activity is required for the regulation of mitophagy in oocyte meiosis and oocyte quality control during ovarian aging. \u003cem\u003eAutophagy\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 643\u0026ndash;660. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15548627.2021.1946739\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2021.1946739\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Ridder, I. et al. The ER-mitochondria interface, where Ca2\u0026thinsp;+\u0026thinsp;and cell death meet. \u003cem\u003eCell. Calcium\u003c/em\u003e. \u003cb\u003e112\u003c/b\u003e, 102743. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ceca.2023.102743\u003c/span\u003e\u003cspan address=\"10.1016/j.ceca.2023.102743\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThoudam, T. et al. PDK4 Augments ER\u0026ndash;Mitochondria Contact to Dampen Skeletal Muscle Insulin Signaling During Obesity. \u003cem\u003eDiabetes\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 571\u0026ndash;586. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2337/db18-0363\u003c/span\u003e\u003cspan address=\"10.2337/db18-0363\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, C. et al. IP3R1 regulates calcium balance in porcine oocyte maturation and early embryonic development. \u003cem\u003eTheriogenology\u003c/em\u003e \u003cb\u003e209\u003c/b\u003e, 151\u0026ndash;161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.theriogenology.2023.06.021\u003c/span\u003e\u003cspan address=\"10.1016/j.theriogenology.2023.06.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, J. et al. GRP75-faciliated Mitochondria-associated ER Membrane (MAM) Integrity controls Cisplatin-resistance in Ovarian Cancer Patients. \u003cem\u003eInt. J. Biol. Sci.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 2914\u0026ndash;2931. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/ijbs.71571\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.71571\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRomero-Garcia, S. \u0026amp; Prado-Garcia, H. Mitochondrial calcium: Transport and modulation of cellular processes in homeostasis and cancer (Review). \u003cem\u003eInt. J. Oncol.\u003c/em\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ijo.2019.4696\u003c/span\u003e\u003cspan address=\"10.3892/ijo.2019.4696\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Putrescine, IP3R-GRP75-VDAC1 complex, MAM, Aging, Oocyte maturation","lastPublishedDoi":"10.21203/rs.3.rs-7823915/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7823915/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjectives\u003c/h2\u003e\u003cp\u003eFemale fertility declines with age, primarily due to a decrease in both oocyte quantity and quality. While putrescine supplementation has been shown to improve oocyte quality in aged mice, the underlying mechanisms remain unclear. In particular, whether putrescine modulates mitochondrial-associated membranes (MAM) and mitigates mitochondrial calcium overload via the IP3R-GRP75-VDAC1 complex has yet to be elucidated.\u003c/p\u003e\u003ch2\u003eMaterials and methods\u003c/h2\u003e\u003cp\u003eIn this study, we investigated the effects of putrescine on oocyte quality using three groups: eight-week-old mice (Young), 40-week-old mice (Old), and 40-week-old mice with 0.5 mM putrescine supplementation during in vitro maturation (Put). Key parameters assessed included oocyte mass, MAM number, mitochondrial calcium levels, mitochondrial function, and apoptosis.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eAged mice exhibited significantly lower anti-M\u0026uuml;llerian hormone (AMH) levels and a reduced oocyte count, accompanied by a decline in oocyte quality. Putrescine supplementation significantly improved first polar body extrusion and blastocyst formation rates in aged oocytes. Additionally, it reduced MAM formation and weakened IP3R-GRP75-VDAC1 interactions, alleviating mitochondrial calcium overload. Consequently, mitochondrial function was enhanced, ATP production increased, and apoptosis reduced.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003ePutrescine ameliorates the quality of aged oocytes by modulating Ca\u003csup\u003e2+\u003c/sup\u003e transfer at MAM. These findings provide novel insights into the role of putrescine in improving oocyte quality and suggest its potential as an in vitro maturation (IVM) supplement to enhance reproductive outcomes in older women by modulating MAM.\u003c/p\u003e","manuscriptTitle":"Putrescine Improves Oocyte Quality in Aged Mice by Modulating the IP3R-GRP75-VDAC1 Complex","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-25 04:22:15","doi":"10.21203/rs.3.rs-7823915/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eb6d3276-ba74-45bf-8ed6-50435a553f7e","owner":[],"postedDate":"November 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":58451380,"name":"Biological sciences/Cell biology"},{"id":58451381,"name":"Biological sciences/Developmental biology"},{"id":58451382,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2026-01-07T11:54:30+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-25 04:22:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7823915","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7823915","identity":"rs-7823915","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}