The CRISPR/Cas13 system edits viral spike and nucleocapsid RNA to resist SARS-CoV-2 infection

The CRISPR/Cas13 system edits viral spike and nucleocapsid RNA to resist SARS-CoV-2 infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The CRISPR/Cas13 system edits viral spike and nucleocapsid RNA to resist SARS-CoV-2 infection La Wang, WenJia Wang, RuiXi Luo, ZunLi Ke, WeiYi Tian This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3747482/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background As a new type of virus that seriously threatens public health worldwide, there are currently very limited effective methods of prevention and control for severe acute respiratory syndrome (SARS)-CoV-2. Therefore, people urgently need an efficient and specific mechanism to prevent COVID-19. CRISPR/Cas13 is a natural defense system in bacteria that has been successfully applied for the prevention and treatment of many viruses, including SARS-CoV-2. How to efficiently and specifically destroy SARS-CoV-2 RNA and avoid virus escape caused by base mutations is still an urgent problem. Methods By comparing and analyzing existing sequences in NCBI, highly conserved segments of protein-coding sequences were obtained to construct a highly specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d for the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence. Results This study focused on the spike (S) glycoprotein and nucleocapsid (N) protein. We found that the CRISPR/Cas13d system was able to effectively edit the SARS-CoV-2 genes at the mRNA or protein level. However, the results also showed that the combination of multiple crRNA could not effectively further improve the editing efficiency. Conclusions The CRISPR/Cas13 system was able to edit spike and nucleocapsid viral RNA to resist SARS-CoV-2 infection. This study provides strong theoretical support for the prevention and treatment of COVID-19. SARS-CoV-2 CRISPR/Cas13 system Spike glycoprotein Nucleocapsid protein A549 cell Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Since December 2019, coronavirus disease 2019 (COVID-19) has spread around the world. The disease is an acute respiratory infection caused by novel coronavirus (SARS-CoV-2) infection and mainly damages the lungs and immune system [ 1 ]. Severe cases can rapidly progress to acute respiratory distress syndrome, septic shock, metabolic acid poisoning, bleeding and coagulation dysfunction, multiple organ failure, and even death. Faced with the serious threat of this viral infectious disease, we urgently need an efficient and specific means of protection to address the infection and spread of this novel coronavirus. SARS-CoV-2 belongs to the β coronavirus genus, which has an envelope with widely spaced spikes arranged on the envelope. The particles are circular or elliptical in shape, with a diameter of 60–140 nm [ 2 ]. Its genome mainly encodes five proteins, namely replicase (orf1/ab) and the structural protein (S) spike, envelope (E) protein, membrane (M) protein, and nucleocapsid (N) protein [ 3 ], all of which play important roles in the life cycle of the virus. Spike glycoprotein S has adsorption and membrane fusion functions, playing an important role in virus adhesion to and invasion of host cells [ 4 ]; Replicase and N are mainly involved in the transcription and replication of the viral genome [ 5 ]. Therefore, both proteins can serve as important target proteins for blocking virus infection in host cells. In research on preventing and treating major human diseases caused by virus infection, in addition to vaccine immunity [ 6 , 7 ], the clustered regularly interspaced short palindromic repeats (CRISPR) and associated (Cas) protein system is also an emerging and efficient strategy for virus detection [ 8 – 10 ] and virus prevention and control [ 11 – 13 ]. The novel coronavirus is a sense RNA virus, so researchers have applied the latest CRISPR/Cas13d technology to SARS-CoV-2 research. The characteristic of Cas13d is that it can directly target and cleave the RNA of the target virus, disrupt the viral RNA structure, and inhibit replication of viral genes and the expression of functional proteins. In addition, compared with the traditional gene editing Cas9 system, Cas13d has more advantages in destroying novel coronavirus RNA, mainly reflected in the following: 1. Cas13d relies on crRNA to target and cleave viral RNA without damaging DNA; 2. Cas13d can attack any site of viral RNA (there is no requirement for the target flanking sequence); 3. Cas13d has a length of 930 amino acids, which is much smaller than other known nucleases, making it easier to package in small capacity vectors, such as adeno-associated virus (AAV) vectors; 4. higher regulatory activity on RNA; and 5. lower miss rate [ 14 , 15 ]. In the study of SARS-CoV-2, researchers developed a preventive antiviral CRISPR strategy in human cells using CRISPR/Cas13d technology, which was applied to SARS-CoV-2, influenza virus, and various other coronaviruses. This effort mainly targets the RNA replicase gene (RdRP) and nucleocapsid protein-encoding gene (N) of SARS-CoV-2, influenza virus, and other coronaviruses by selecting 40 candidate sequences from them to detect expression inhibition of the aforementioned virus gene fragments. The results show that the CRISPR system is suitable for research on various coronaviruses, including SARS-CoV-2 [ 12 , 13 , 16 ]. Although the above studies have confirmed that CRISPR/Cas13d technology can be used in prevention and treatment of many viruses, including novel coronavirus, how to efficiently and specifically target novel coronavirus RNA and solve the problem of RNA virus escape remains to be addressed. In this study, we focused on the spike (S) glycoprotein and nucleocapsid (N) protein. By comparing and analyzing existing sequences in NCBI, highly conserved segments of the coding protein sequence were obtained to construct a specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d for the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence. However, the experimental results also showed that the combination of multiable crRNA could not effectively further improve the editing efficiency. This study provides strong theoretical support for the prevention and treatment of COVID-19. 2. Materials and Methods 2.1. Cell culture and passage A549 cells (human non-small cell lung cancer cells) were received as a gift from Xinqiao Hospital in Chongqing and cultured in F12K (PM150910, Procell, Wuhan, China) supplemented with 10% (v/v) total body serum (FBS) (FSP500, Excell Bio, Guangzhou, China), 0.5% penicillin, and 0.5% streptomycin sulfate (Procell, Wuhan, China). A549 cells were cultured at 37 ℃ and 5% CO2 saturated humidity until density > 80%. The cells were digested with 1–2 ml of 0.25% trypsin (Procell, Wuhan, China) for 1–2 minutes and processed immediately. Complete culture medium was added, and a single-cell suspension was produced. The cells were aliquoted into 3 bottles (Costar Corning, New York, USA) and cultured on a large scale. 2.2. Virus gene synthesis and plasmid construction The gene sequences of the spike ( S ) (Gene ID: 43740568) and nucleocapsid ( N ) (Gene ID: 43740575) of SARS-CoV-2 were retrieved from the National Center for Biotechnology Information (NCBI), synthesized and constructed using the corresponding expression plasmid at Beijing Tsingke Biotech Co., Ltd. (Beijing, China), as shown in Table 1. PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE (138147) and pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP (155307) were purchased from Addgene (USA) through Beijing Zhongyuan Heju Biotechnology Co., Ltd. (Beijing, China). 2.3. CRISPR RNA (crRNA) prediction and plasmid construction We downloaded the S and N protein genes from all sequenced SARS-CoV-2 virus strains in NCBI. Then, we analyzed the highly conserved region sequence through sequence alignment and selected 22 nucleotide (nt) sequences per interval from the conserved sequences as a candidate target. Further comparative analysis was conducted with the human transcriptome (HG38; including noncoding RNA) and the SARS-CoV-2 virus genome. Finally, two target sequences were screened for S and N. The screened target crRNA sequences were cloned and inserted into pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP using a single restriction endonuclease site BbsI for subsequent editing efficiency validation experiments (Table 1). 2.4. Construction of a Cas13d stable transgenic cell line with chronic virus infection A549 cells in the logarithmic growth phase were used to produce cell suspensions at a density of 5×10 4 cells per ml. The cell suspensions (100 µL) were added and cultured in 96-well culture plates per well overnight in a 37 ℃ incubator. Different concentrations of puromycin were added to achieve final concentrations of 0, 0.1, 0.2, 0.4, 0.6, 0.8, 1, 1.5, and 2 µg/mL. Cell viability was checked daily, and the optimal concentration of purinomycin to kill all cells in 5–7 days was selected as the concentration for subsequent use. The PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE plasmid was packaged with lentivirus at Guangzhou Aidi Gene Technology Co., Ltd. (1×10 8 ) and stored at -80 ℃. The lentivirus was diluted to the desired concentration with the corresponding culture medium before use. The day before virus infection, A549 cells were inoculated in a 6-well cell culture plate, and the cell convergence rate reached 30–60% on the day of infection. Thirty microliters of virus solution (MOI = 30) was added to each well, and the plate was incubated in a 37 ℃ incubator for 24 hours. Then, the medium with viruses was replaced with fresh medium until 48 hours. Subsequently, the optimal concentration (0.7 µg/mL) of puromycin culture medium was added to replace the medium containing a large number of dead cells every 2–3 days. Finally, the resistant cells were identified, subcultured, expanded, and frozen. Expression of Cas13d was detected through qPCR to determine whether the stably transfected cell line was successfully constructed. 2.5. Grouping and cell transfection Grouping according to experimental requirements was as follows: 1. Mock group, transfected with PCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR and pHR-u6-BbsI-crScaffold-EF1-PuroR-T2A-BFP, 2. S1crRNA group, transfected with S and pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP, 3. S2crRNA group, transfected with S and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP, 4. S1 + S2crRNA (S:ScrRNA = 1:1) group, transfected with S, pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP, 5. The S1 + S2crRNA (S:ScrRNA = 1:2) group was transfected with S, pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP at a 1:2 ratio. The groups for N were similar to those for S above. A549 cells (10 6 cells/well) were seeded in 6- or 24-well plates (Costar Corning, New York, USA) for 6 h. During the transfection process, we added 1.5 and 0.5 µg plasmid to LipofectamineTM 2000 at a ratio of 1:4. We thoroughly mixed and incubated the samples in a PE tube for 30 minutes and then added them to 6-well and 24-well plates for a total of 8 hours of incubation with serum-free media without antibiotics. The cells were cultured in fresh and complete medium for 40 hours before other treatments. Table 1. The plasmids, primers, and crRNAs used in this study pLentiRNACRISPR_hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-PuroR-WPRE (qPCR) 5’-GAGCGGACTGAGGCACTGGGT-3’ 5’-GGTAGTTGAGGGTGGAGATGT-3’ PCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR (qPCR) 5’-TTCAGTTGTAAACATTCAAAAAG-3’ 5’-AAAAAGAAGAAGGCTGATGA-3’ pTwist-CMV-N-3Flag-Ubc-PuroR-T2A (qPCR) 5’-AAAAAGAAGAAGGCTGATGA-3’ 5’-TTGTTGCAATTGTTTGGAGA-3’ Homo GAPDH (qPCR) 5’-TCAAGAAGGTGGTGAAGCAGG-3’ 5’-TCAAAGGTGGAGGAGTGGGT-3’ pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP 5’-AAACGTATAGGTTTAATGGTATTGGAG-3’ 5’-GAAC CTCCAATACCATTAAACCTATA G-3’ pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP 5’-AAACG TCATTCAAGGAGGAGTTAGATA-3’ 5’-GAAC TATCTAACTCCTCCTTGAATGA G-3’ pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP 5’-AAACG TCTTGGTTCACCGCTCTCACTC-3’ 5’-GAAC GAGTGAGAGCGGTGAACCAAGA G-3’ pHR-u6-BbsI-N2crRNA-EF1-PuroR-T2A-BFP 5’-AAACG TTCTAAGAAGCCTCGGCAAAAA-3’ 5’-GAAC TTTTTGCCGAGGCTTCTTAGAA G-3’ 2.6. Real-time qPCR detection Total RNA from A549 cells was extracted using TRIzol reagent and reverse transcribed to cDNA using Superscript First-Strand Synthesis System (Invitrogen). cDNA was amplified using real-time quantitative PCR with SYBR Green Master Mix (VAZYME, China) for real-time quantitative PCR amplification of cDNA using the specific primers in Table 1. Homo sapiens GAPDH was used as an internal control. All primers were obtained from Sangon Biotech (Shanghai, China). 2.7. Western blotting Immunoblotting was performed as reported previously [ 17 ]. Briefly, cells were collected from each group. Protein samples were separated by 12% SDS–PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk for 1 hour at room temperature and treated with primary antibodies. Rabbit anti-Flag antibody (ab205606, Abcam, Cambridge, UK) and rabbit anti-GAPDH antibody (AB-P-R 001, Xianzhi Biological Co., Ltd, Hangzhou, China) were used at 1:1000 dilutions. All blots were treated with HRP-labeled secondary antibody. Finally, the density of the bands was analyzed by Image Lab 5.2.1 (Bio-Rad, Inc. USA) using the ECL detection reagent from Thermo Scientific. 2.8. Flow cytometry analysis Treated cells were digested with 0.25% trypsin without EDTA and then collected by centrifugation at 1500 rpm for 5 minutes. The supernatant was removed, and fresh PBS was added to resuspend the cells, which were centrifuged at 1500 rpm for 5 minutes and washed twice with PBS. Then, 200 µL of PBS was added to resuspend the cells. Anti-Flag antibody was added to each flow cytometry tube (2 µl/test) and incubated at 4 ℃ in the dark for 30 minutes. The cells were centrifuged at 1500 rpm for 5 minutes and washed twice with PBS. Subsequently, the above steps were repeated with a fluorescent secondary antibody. The cells were incubated at room temperature in the dark for 20–30 min, centrifuged at 1500 rpm for 5 min and washed twice with PBS. Finally, 200 µl of PBS was added to resuspend the cells for analysis by flow cytometry (CytoFLEX, Beckman Coulter, California, USA). 2.9. Immunofluorescence analysis Immunofluorescence was performed as reported previously [ 17 ]. First, cells in 24-well plates were washed in PBS/0.1% Triton X-100 (PBST) twice and fixed in 4% formaldehyde/PBS for 15 min before being washed with PBST again. Second, the cells were incubated in 5% goat serum at 37 ℃ for 30 minutes and then with rabbit anti-Flag primary antibody (ab205606, Abcam, Cambridge, UK) at a 1:500 dilution. Subsequently, the cells were washed several times with PBST and incubated with the corresponding secondary antibody. Finally, the cells were rinsed with PBS for 5 min (repeated three times) and counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma‒Aldrich, Saint Louis, MO, USA) for 10 min. Fluorescence microscopy (Olympus, Tokyo, Japan) was used to detect fluorescence. 2.10. Statistical analysis All statistical analyses were performed with SPSS 18.0 software. Data are presented as the mean ± SE. In all tests, a P value less than 0.05 was considered statistically significant, and 0.01 was considered a very significant difference. Student’s t test was used for comparisons between two groups. These analyses were performed using OriginLab Origin V8.0 (OriginLab, Northampton, USA). 3. Results 3.1. Plasmid construction and stable transfection cell line screening We synthesized the spike (S) protein and nucleocapsid (N) protein of SARS CoV-2 and constructed them in the corresponding expression plasmid (Fig. 1 A). Through sequence alignment and analysis, we obtained specific conserved sites for S and N and constructed corresponding crRNA plasmids (Table 1). PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE (138147) and pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP (155307) were purchased from Addgene. We used lentivirus packaging of the cas13d plasmid to infect A549 cells and obtained a stable and highly expressing cas3d A549 cell line through long-term antibiotic screening. qPCR confirmed this result (Fig. 1 B). 3.2. The CRISPR/Cas13d system intervened in mRNA expression of viral S and N Through real-time fluorescence quantitative detection after transfection of the corresponding plasmids, we found that the CRISPR/Cas13d system and specific target crRNA can effectively reduce mRNA expression of the corresponding genes. For spike, the editing efficiency of S1crRNA was over 80%; S2crRNA also showed over 50% editing. When S1crRNA and S2crRNA were combined, we found that the editing efficiency was improved, but the difference was not significant compared to S1crRNA alone. Interestingly, when we combined S1crRNA and S2crRNA and further increased the crRNA, the editing efficiency unexpectedly decreased (Fig. 2 A). We considered that the increase in plasmid concentrations may have interfered with the original transfection efficiency, so we removed this group in subsequent experiments. For the nucleocapsid, both N1crRNA and N2crRNA significantly reduced the mRNA expression level to lower than 20% when editing alone. Surprisingly, when they were used together, the efficiency of gene editing actually decreased (Fig. 2 B). The above results indicated that the CRISPR/Cas13d system was able to effectively edit the SARS CoV-2 gene at the mRNA level. However, not all results matched our expectations. 3.3. CRISPR/Cas13d system editing of viruses at the protein level We further examined the impact of the CRISPR/Cas13d system on expression of these two key viral proteins. The results showed that the trend of changes in protein levels was almost consistent with that in mRNA levels, while the decrease in protein levels was not significant compared to that in mRNA levels in terms of editing efficiency (Fig. 3 ). For the spike protein, the editing efficiency of S1crRNA was approximately 65%, and that of S2crRNA was only 18%. When coediting, we found that the previously improved editing efficiency at the mRNA level disappeared at the protein level (Fig. 3 A). When the proportion of crRNA was increased for joint editing, the editing effect was not significant (Fig. 3 A). For the nucleocapsid protein, the editing efficiency at the protein level was only 20–40%, while that at the RNA level was above 80% (Fig. 3 B). 3.4. Flow cytometry analysis of the editing status of the CRISPR/Cas13d system For spike, A549 cells transfected with BFP-crRNA successfully were selected by flow cytometry (Fig. 4 A). We found that approximately 50% of the total cells were successfully transfected with U6-crRNA (Fig. 4 A). These 50% positive cells were used to analyze the editing efficiency of the CRISPR/Cas13d system on spikes. Thus, we can effectively avoid editing efficiency deviations caused by transfection efficiency. The spike plasmid PCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR was expressed together with a GFP fluorescent protein label. We found that almost all BFP-positive cells showed red fluorescence of Flag and green fluorescence of GFP in the mock crRNA group. After transfection with ScrRNA, we found a significant decrease in the number of double-positive cells, with a decrease of 69% in S1crRNA, nearly 30% in S2crRNA, and a decrease of 78% in S1 + S2crRNA cotransfection (Fig. 4 A and C). In the nucleocapsid group, the proportion of cells with blue fluorescence of BFP and red fluorescence of Flag in the blank group was also approximately 50%. This result is similar to that of the spike group from the perspective of transfection efficiency (Fig. 4 B). Our subsequent analysis was based on these 50% double-positive cells. It was found that N1crRNA can mediate loss of red fluorescence in approximately half of double-positive cells and that N2crRNA can mediate the inability of over 60% of cells to express nucleocapsid protein (Fig. 4 B and C). These results were quite similar to the above qPCR results. 3.5. The editing effect of the CRISPR/Cas13d system by immunofluorescence detection To confirm the above experimental results, we detected the editing effect of the CRISPR/Cas13d system on viral genes through immunofluorescence. Fluorescence observation revealed a large and strong amount of red fluorescence for the mock crRNA group. After transfection with the corresponding crRNA, the fluorescence quantity and intensity were significantly reduced (Fig. 5 ). From the changes in fluorescence intensity, the immunofluorescence results were consistent with the previous qPCR and flow cytometry results. 4. Discussion At present, the COVID-19 pandemic has gradually disappeared, but many people around us have obvious sequelae after COVID-19, including but not limited to chest tightness, shortness of breath, limb impairment, and loss of sense of smell and taste[ 18 – 21 ]. In addition, reinfection by SARS-CoV-2 can occur, especially in the elderly and children [ 22 , 23 ]. In other words, research on COVID-19 prevention and control methods should not stagnate with the disappearance of the pandemic, and more effective prevention measures are needed. Many protocols based on CRISPR for detecting SARS-CoV-2 have been published recently [ 11 , 24 , 25 ]. Cas13 can be used in forward transcriptomic pooled screens and to predict optimized Cas13 guide RNAs for all protein-coding transcripts in the human genome [ 26 ]. Based on previous studies, we attempted to clarify the editing effect of the CRISPR‒Cas system on key viral proteins in vitro, providing new ideas for virus prevention and control work. Compared to other CRISPR‒Cas systems, CRISPR‒Cas13d has higher editing efficiency and lower off-target effects [ 16 ]. This means that it can edit more genes in a shorter time, and fewer nontarget genes are mistakenly edited [ 27 , 28 ]. This makes CRISPR‒Cas13d a very promising gene editing tool that can be used to treat hereditary diseases, study gene function, and develop new treatment methods. The editing effect of Cas13 in the proliferation process of other viruses, especially RNA viruses, has been confirmed[ 28 , 29 ]. The SARS-CoV-2 spike glycoprotein has adsorption and membrane fusion functions, playing an important role in virus adhesion and invasion of host cells [ 4 ]. The replicase and nucleocapsid protein N are mainly involved in transcription and replication of the viral genome [ 5 ]. Here, we show that the CRISPR‒Cas13d system can effectively target the spike protein and nucleocapsid protein of SARS-CoV-2. If these two key proteins are edited and cannot be expressed during virus infection, the proliferation process of the virus will be interrupted. Therefore, we selected these two proteins for our study. At the same time, SARS-CoV-2 is an RNA virus. When its genetic material enters the host cell, the gene editing system can begin, thus directly destroying its genome to achieve antiviral effects [ 12 , 27 ]. All our results showed that when overexpressing key viral genes in vitro, the CRISPR‒Cas13d system can effectively edit and significantly reduce their expression. However, there are still some issues and shortcomings that need to be considered in our experimental results. On the one hand, all of our experiments were conducted in vitro, and the virus's genes were overexpressed through artificial transfection, which means that its process may be significantly different from the virus infection process. Therefore, the editing efficiency we detected can only serve as a reference. Only further animal experiments can clarify the true editing efficiency. On the other hand, as an RNA virus, when SARS-CoV-2 enters the host cell with the CRISPR‒Cas13d system, gene editing may have started, rather than waiting until it guides the host cell to express viral proteins. Therefore, theoretically speaking, the editing efficiency should be lower than the actual infection situation. Overall, this study focuses on the spike glycoprotein and nucleocapsid protein. By comparing and analyzing existing sequences in NCBI, highly conserved segments of the coding protein sequence were obtained to construct a highly specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d to the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence. However, the experimental results also found that the combination of multiable crRNA could not effectively further improve the editing efficiency. This study provides strong theoretical support for the prevention and treatment of SARS-CoV-2. Declarations Author Contributions: La Wang designed the project; Ruixi Luo and La Wang conducted the experiments; Wenjia Wang and Zunli Ke analyzed and studied the data; La Wang wrote the original draft; Weiyi Tian reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by the Young Scientific and Technological Talents Growth Project of Guizhou Provincial Department of Education (Qianjiaohe KY word [2021]198), the Program of the National Natural Science Foundation of China (Grant No. 81960796). Institutional Review Board Statement: Not applicable. Conflicts of Interest: The authors declare no conflicts of interest. References Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, Xiang H, Cheng Z, Xiong Y et al (2020) Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA 323(11):1061–1069 Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Si HR, Zhu Y, Li B, Huang CL et al (2020) A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579(7798):270–273 Chan JF, Kok KH, Zhu Z, Chu H, To KK, Yuan S, Yuen KY (2020) Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan. Emerg microbes infections 9(1):221–236 Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, Zhang Q, Shi X, Wang Q, Zhang L et al (2020) Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 581(7807):215–220 Jiang S, Hillyer C, Du L (2020) Neutralizing Antibodies against SARS-CoV-2 and Other Human Coronaviruses. Trends Immunol 41(5):355–359 Prompetchara E, Ketloy C, Palaga T (2020) Immune responses in COVID-19 and potential vaccines: Lessons learned from SARS and MERS epidemic. Asian Pac J Allergy Immunol 38(1):1–9 Ahn DG, Shin HJ, Kim MH, Lee S, Kim HS, Myoung J, Kim BT, Kim SJ (2020) Current Status of Epidemiology, Diagnosis, Therapeutics, and Vaccines for Novel Coronavirus Disease 2019 (COVID-19). J Microbiol Biotechnol 30(3):313–324 Broughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A et al (2020) CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38(7):870–874 Cordes AK, Heim A (2020) Rapid random access detection of the novel SARS-coronavirus-2 (SARS-CoV-2, previously 2019-nCoV) using an open access protocol for the Panther Fusion. J Clin virology: official publication Pan Am Soc Clin Virol 125:104305 Guo L, Sun X, Wang X, Liang C, Jiang H, Gao Q, Dai M, Qu B, Fang S, Mao Y et al (2020) SARS-CoV-2 detection with CRISPR diagnostics. Cell discovery 6:34 Mantena S, Pillai PP, Petros BA, Welch NL, Myhrvold C, Sabeti PC, Metsky HC (2023) : Model-directed generation of CRISPR-Cas13a guide RNAs designs artificial sequences that improve nucleic acid detection. bioRxiv: the preprint server for biology Hussein M, Andrade Dos Ramos Z, Vink MA, Kroon P, Yu Z, Enjuanes L, Zuniga S, Berkhout B, Herrera-Carrillo E (2023) : Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2. Viruses 15(3) Nguyen TM, Zhang Y, Pandolfi PP (2020) Virus against virus: a potential treatment for 2019-nCov (SARS-CoV-2) and other RNA viruses. Cell Res 30(3):189–190 Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD (2018) Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell 173(3):665–676e614 Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA (2018) Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Mol Cell 70(2):327–339 e325 Cheng X, Li Z, Shan R, Li Z, Wang S, Zhao W, Zhang H, Chao L, Peng J, Fei T et al (2023) Modeling CRISPR-Cas13d on-target and off-target effects using machine learning approaches. Nat Commun 14(1):752 Xiao Q, Wang L, Zhou XL, Zhu Y, Dong ZQ, Chen P, Lu C, Pan MH (2019) BmAtg13 promotes the replication and proliferation of Bombyx mori nucleopolyhedrovirus. Pestic Biochem Physiol 157:143–151 Rass V, Tymoszuk P, Sahanic S, Heim B, Ausserhofer D, Lindner A, Kofler M, Mahlknecht P, Boehm A, Hufner K et al (2023) : Distinct smell and taste disorder phenotype of post-acute COVID-19 sequelae. European archives of oto-rhino-laryngology: official journal of the European Federation of Oto-Rhino-Laryngological Societies 280(11):5115–5128 Zhao S, Abdurehim A, Yuan Y, Yang T, Li C, Zhang Y, Li Y, Sun X, Xie J Natural Products: A Potential New Hope to Defeat Post-Acute Sequelae of COVID-19. Current topics in medicinal chemistry 2023 Johnston J, Dorrian D, Linden D, Stanel SC, Rivera-Ortega P, Chaudhuri N (2023) : Pulmonary Sequelae of COVID-19: Focus on Interstitial Lung Disease. Cells 12(18) Bowe B, Xie Y, Al-Aly Z (2023) Postacute sequelae of COVID-19 at 2 years. Nat Med 29(9):2347–2357 Matuchansky C (2023) Natural SARS-CoV-2 infection-induced immune protection against re-infection. Lancet 402(10408):1131 Qu Z (2023) Cautionary notes on the COVID-19 re-infection study. Lancet 402(10408):1130–1131 Zhang Y, Cai X, Ge W, Wang D, Zhu G, Qian L, Xiang N, Yue L, Liang S, Zhang F et al (2022) Potential Use of Serum Proteomics for Monitoring COVID-19 Progression to Complement RT-PCR Detection. J Proteome Res 21(1):90–100 Fasching CL, Servellita V, McKay B, Nagesh V, Broughton JP, Sotomayor-Gonzalez A, Wang B, Brazer N, Reyes K, Streithorst J et al (2022) COVID-19 Variant Detection with a High-Fidelity CRISPR-Cas12 Enzyme. J Clin Microbiol 60(7):e0026122 Wessels HH, Mendez-Mancilla A, Guo X, Legut M, Daniloski Z, Sanjana NE (2020) Massively parallel Cas13 screens reveal principles for guide RNA design. Nat Biotechnol 38(6):722–727 Liu Z, Gao X, Kan C, Li L, Zhang Y, Gao Y, Zhang S, Zhou L, Zhao H, Li M et al (2023) CRISPR-Cas13d effectively targets SARS-CoV-2 variants, including Delta and Omicron, and inhibits viral infection. MedComm 4(1):e208 Zhang YY, Sun MX, Lian Y, Wang TY, Jia MY, Leng C, Chen M, Bai YZ, Meng F, Cai XH et al (2022) CRISPR-Cas13d Exhibits Robust Antiviral Activity Against Seneca Valley Virus. Front Microbiol 13:835040 Mahas A, Aman R, Mahfouz M (2019) CRISPR-Cas13d mediates robust RNA virus interference in plants. Genome Biol 20(1):263 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3747482","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":259492860,"identity":"c9b5f6af-8111-4ab9-8770-c71b461808a0","order_by":0,"name":"La Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYLCCBwwSzPbHG8BsxgaitCQw2LAznDlAmpY0foYbCURqMTh+9vCLhJrD0owzn1/+zMNgI7vhAPOzB3i1nMlLs0g4dtiYWTqnwJiHIc14wwE2cwN8WswO5JgZJLAdTmaTzklI5mE4nLjhAA+bBF4t598Atfw7XN8jeSbhMA/DfyK03MgxfpDYlsYsIcF+sJmH4QBhLfY33pgxJPbZMBvw5DAzzjFINp55mM0MrxbJ/hzjDx++STAbsB9//OFNhZ1s3/HmZ3i1AAHMGTwGTDygoGImoB6k5AOEZn/A+IOw6lEwCkbBKBiBAADtqExxgZ4qnwAAAABJRU5ErkJggg==","orcid":"","institution":"Guizhou University of Traditional Chinese Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"La","middleName":"","lastName":"Wang","suffix":""},{"id":259492861,"identity":"b1b220ad-cef6-4485-a465-a28a62f5d85b","order_by":1,"name":"WenJia Wang","email":"","orcid":"","institution":"Guizhou University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"WenJia","middleName":"","lastName":"Wang","suffix":""},{"id":259492862,"identity":"05045703-1b1a-40b2-8378-e82a5ce717d2","order_by":2,"name":"RuiXi Luo","email":"","orcid":"","institution":"Guizhou University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"RuiXi","middleName":"","lastName":"Luo","suffix":""},{"id":259492863,"identity":"265c67a9-882a-4d64-815c-713ffd4ed169","order_by":3,"name":"ZunLi Ke","email":"","orcid":"","institution":"Guizhou University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"ZunLi","middleName":"","lastName":"Ke","suffix":""},{"id":259492864,"identity":"54e1e860-3930-4fa8-8166-dd5f8e1a2cba","order_by":4,"name":"WeiYi Tian","email":"","orcid":"","institution":"Guizhou University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"WeiYi","middleName":"","lastName":"Tian","suffix":""}],"badges":[],"createdAt":"2023-12-13 08:59:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3747482/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3747482/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":48331668,"identity":"5064d380-232e-48b4-8a4c-bee057880db0","added_by":"auto","created_at":"2023-12-16 23:04:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2605467,"visible":true,"origin":"","legend":"\u003cp\u003ePlasmid construction and screening validation of stably transfected cell lines. A. Construction of experimentally related plasmids. B. Quantitative detection of expression of the stable cell line CAS13. (*\u003cem\u003e p\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e p\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/be92afceb28112990648628a.jpg"},{"id":48331667,"identity":"241564d0-2bf4-4902-9b2f-e924ea600298","added_by":"auto","created_at":"2023-12-16 23:04:07","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2528501,"visible":true,"origin":"","legend":"\u003cp\u003eReal-time fluorescence quantitative detection of the CRISPR/Cas13d system intervention effect on viruses S and N. A. Editing of mRNA of viral spike proteins by the CRISPR/Cas13d system. B. Editing of mRNA of viral nucleocapsid proteins by the CRISPR/Cas13d system. (*\u003cem\u003e p\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e p\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/6456a0fa5f173c67a74b64b0.jpg"},{"id":48331665,"identity":"5caf7273-8451-4e7a-b31a-00aea98035d9","added_by":"auto","created_at":"2023-12-16 23:04:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2988026,"visible":true,"origin":"","legend":"\u003cp\u003eImmunoblotting detection of the effect of CRISPR/Cas13d system intervention of virus S and N. A. The effect of the CRISPR/Cas13d system on the expression of viral spike proteins. B. The effect of the CRISPR/Cas13d system on the expression of viral nucleocapsid proteins. (*\u003cem\u003e p\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e p\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/40c06787e7019596d3bb7914.jpg"},{"id":48331669,"identity":"d6c40367-1726-43da-9976-a899e7172b84","added_by":"auto","created_at":"2023-12-16 23:04:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":10122238,"visible":true,"origin":"","legend":"\u003cp\u003eFlow cytometry detection of the effect of CRISPR/Cas13d system intervention on virus S and N. A. The effect of the CRISPR/Cas13d system on the expression of viral spike proteins. B. The effect of the CRISPR/Cas13d system on the expression of viral nucleocapsid proteins. (*\u003cem\u003e p\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e p\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/38ad322ddae0006927e41f68.jpg"},{"id":48331670,"identity":"55751748-a2bb-4253-a647-f298a6c8ea74","added_by":"auto","created_at":"2023-12-16 23:04:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":19295021,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of CRISPR/Cas13d system intervention on virus S and N using immunofluorescence detection. A. The effect of the CRISPR/Cas13d system on expression of viral spike protein. B. The effect of the CRISPR/Cas13d system on expression of viral nucleocapsid protein.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/81d51a36da5fee70bffe94e8.jpg"},{"id":49863704,"identity":"d1a381a3-a1e5-44c8-800f-9fc6ff49ce46","added_by":"auto","created_at":"2024-01-19 09:38:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":845273,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3747482/v1/03a2a433-5425-45e4-ab2a-6dbf19449972.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The CRISPR/Cas13 system edits viral spike and nucleocapsid RNA to resist SARS-CoV-2 infection","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eSince December 2019, coronavirus disease 2019 (COVID-19) has spread around the world. The disease is an acute respiratory infection caused by novel coronavirus (SARS-CoV-2) infection and mainly damages the lungs and immune system [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Severe cases can rapidly progress to acute respiratory distress syndrome, septic shock, metabolic acid poisoning, bleeding and coagulation dysfunction, multiple organ failure, and even death. Faced with the serious threat of this viral infectious disease, we urgently need an efficient and specific means of protection to address the infection and spread of this novel coronavirus.\u003c/p\u003e \u003cp\u003eSARS-CoV-2 belongs to the β coronavirus genus, which has an envelope with widely spaced spikes arranged on the envelope. The particles are circular or elliptical in shape, with a diameter of 60\u0026ndash;140 nm [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Its genome mainly encodes five proteins, namely replicase (orf1/ab) and the structural protein (S) spike, envelope (E) protein, membrane (M) protein, and nucleocapsid (N) protein [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], all of which play important roles in the life cycle of the virus. Spike glycoprotein S has adsorption and membrane fusion functions, playing an important role in virus adhesion to and invasion of host cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]; Replicase and N are mainly involved in the transcription and replication of the viral genome [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, both proteins can serve as important target proteins for blocking virus infection in host cells.\u003c/p\u003e \u003cp\u003eIn research on preventing and treating major human diseases caused by virus infection, in addition to vaccine immunity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], the clustered regularly interspaced short palindromic repeats (CRISPR) and associated (Cas) protein system is also an emerging and efficient strategy for virus detection [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and virus prevention and control [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The novel coronavirus is a sense RNA virus, so researchers have applied the latest CRISPR/Cas13d technology to SARS-CoV-2 research. The characteristic of Cas13d is that it can directly target and cleave the RNA of the target virus, disrupt the viral RNA structure, and inhibit replication of viral genes and the expression of functional proteins. In addition, compared with the traditional gene editing Cas9 system, Cas13d has more advantages in destroying novel coronavirus RNA, mainly reflected in the following: 1. Cas13d relies on crRNA to target and cleave viral RNA without damaging DNA; 2. Cas13d can attack any site of viral RNA (there is no requirement for the target flanking sequence); 3. Cas13d has a length of 930 amino acids, which is much smaller than other known nucleases, making it easier to package in small capacity vectors, such as adeno-associated virus (AAV) vectors; 4. higher regulatory activity on RNA; and 5. lower miss rate [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the study of SARS-CoV-2, researchers developed a preventive antiviral CRISPR strategy in human cells using CRISPR/Cas13d technology, which was applied to SARS-CoV-2, influenza virus, and various other coronaviruses. This effort mainly targets the RNA replicase gene (RdRP) and nucleocapsid protein-encoding gene (N) of SARS-CoV-2, influenza virus, and other coronaviruses by selecting 40 candidate sequences from them to detect expression inhibition of the aforementioned virus gene fragments. The results show that the CRISPR system is suitable for research on various coronaviruses, including SARS-CoV-2 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Although the above studies have confirmed that CRISPR/Cas13d technology can be used in prevention and treatment of many viruses, including novel coronavirus, how to efficiently and specifically target novel coronavirus RNA and solve the problem of RNA virus escape remains to be addressed.\u003c/p\u003e \u003cp\u003eIn this study, we focused on the spike (S) glycoprotein and nucleocapsid (N) protein. By comparing and analyzing existing sequences in NCBI, highly conserved segments of the coding protein sequence were obtained to construct a specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d for the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence. However, the experimental results also showed that the combination of multiable crRNA could not effectively further improve the editing efficiency. This study provides strong theoretical support for the prevention and treatment of COVID-19.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Cell culture and passage\u003c/h2\u003e \u003cp\u003eA549 cells (human non-small cell lung cancer cells) were received as a gift from Xinqiao Hospital in Chongqing and cultured in F12K (PM150910, Procell, Wuhan, China) supplemented with 10% (v/v) total body serum (FBS) (FSP500, Excell Bio, Guangzhou, China), 0.5% penicillin, and 0.5% streptomycin sulfate (Procell, Wuhan, China). A549 cells were cultured at 37 ℃ and 5% CO2 saturated humidity until density\u0026thinsp;\u0026gt;\u0026thinsp;80%. The cells were digested with 1\u0026ndash;2 ml of 0.25% trypsin (Procell, Wuhan, China) for 1\u0026ndash;2 minutes and processed immediately. Complete culture medium was added, and a single-cell suspension was produced. The cells were aliquoted into 3 bottles (Costar Corning, New York, USA) and cultured on a large scale.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Virus gene synthesis and plasmid construction\u003c/h2\u003e \u003cp\u003eThe gene sequences of the \u003cem\u003espike\u003c/em\u003e (\u003cem\u003eS\u003c/em\u003e) (Gene ID: 43740568) and \u003cem\u003enucleocapsid\u003c/em\u003e (\u003cem\u003eN\u003c/em\u003e) (Gene ID: 43740575) of SARS-CoV-2 were retrieved from the National Center for Biotechnology Information (NCBI), synthesized and constructed using the corresponding expression plasmid at Beijing Tsingke Biotech Co., Ltd. (Beijing, China), as shown in Table\u0026nbsp;1. PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE (138147) and pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP (155307) were purchased from Addgene (USA) through Beijing Zhongyuan Heju Biotechnology Co., Ltd. (Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. CRISPR RNA (crRNA) prediction and plasmid construction\u003c/h2\u003e \u003cp\u003eWe downloaded the S and N protein genes from all sequenced SARS-CoV-2 virus strains in NCBI. Then, we analyzed the highly conserved region sequence through sequence alignment and selected 22 nucleotide (nt) sequences per interval from the conserved sequences as a candidate target. Further comparative analysis was conducted with the human transcriptome (HG38; including noncoding RNA) and the SARS-CoV-2 virus genome. Finally, two target sequences were screened for S and N. The screened target crRNA sequences were cloned and inserted into pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP using a single restriction endonuclease site BbsI for subsequent editing efficiency validation experiments (Table\u0026nbsp;1).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Construction of a Cas13d stable transgenic cell line with chronic virus infection\u003c/h2\u003e \u003cp\u003eA549 cells in the logarithmic growth phase were used to produce cell suspensions at a density of 5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per ml. The cell suspensions (100 \u0026micro;L) were added and cultured in 96-well culture plates per well overnight in a 37 ℃ incubator. Different concentrations of puromycin were added to achieve final concentrations of 0, 0.1, 0.2, 0.4, 0.6, 0.8, 1, 1.5, and 2 \u0026micro;g/mL. Cell viability was checked daily, and the optimal concentration of purinomycin to kill all cells in 5\u0026ndash;7 days was selected as the concentration for subsequent use. The PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE plasmid was packaged with lentivirus at Guangzhou Aidi Gene Technology Co., Ltd. (1\u0026times;10\u003csup\u003e8\u003c/sup\u003e) and stored at -80 ℃. The lentivirus was diluted to the desired concentration with the corresponding culture medium before use. The day before virus infection, A549 cells were inoculated in a 6-well cell culture plate, and the cell convergence rate reached 30\u0026ndash;60% on the day of infection. Thirty microliters of virus solution (MOI\u0026thinsp;=\u0026thinsp;30) was added to each well, and the plate was incubated in a 37 ℃ incubator for 24 hours. Then, the medium with viruses was replaced with fresh medium until 48 hours. Subsequently, the optimal concentration (0.7 \u0026micro;g/mL) of puromycin culture medium was added to replace the medium containing a large number of dead cells every 2\u0026ndash;3 days. Finally, the resistant cells were identified, subcultured, expanded, and frozen. Expression of Cas13d was detected through qPCR to determine whether the stably transfected cell line was successfully constructed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Grouping and cell transfection\u003c/h2\u003e \u003cp\u003eGrouping according to experimental requirements was as follows: 1. Mock group, transfected with PCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR and pHR-u6-BbsI-crScaffold-EF1-PuroR-T2A-BFP, 2. S1crRNA group, transfected with S and pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP, 3. S2crRNA group, transfected with S and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP, 4. S1\u0026thinsp;+\u0026thinsp;S2crRNA (S:ScrRNA\u0026thinsp;=\u0026thinsp;1:1) group, transfected with S, pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP, 5. The S1\u0026thinsp;+\u0026thinsp;S2crRNA (S:ScrRNA\u0026thinsp;=\u0026thinsp;1:2) group was transfected with S, pHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP and pHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP at a 1:2 ratio. The groups for N were similar to those for S above. A549 cells (10\u003csup\u003e6\u003c/sup\u003e cells/well) were seeded in 6- or 24-well plates (Costar Corning, New York, USA) for 6 h. During the transfection process, we added 1.5 and 0.5 \u0026micro;g plasmid to LipofectamineTM 2000 at a ratio of 1:4. We thoroughly mixed and incubated the samples in a PE tube for 30 minutes and then added them to 6-well and 24-well plates for a total of 8 hours of incubation with serum-free media without antibiotics. The cells were cultured in fresh and complete medium for 40 hours before other treatments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTable\u0026nbsp;1. The plasmids, primers, and crRNAs used in this study\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c3\" namest=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epLentiRNACRISPR_hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-PuroR-WPRE (qPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-GAGCGGACTGAGGCACTGGGT-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-GGTAGTTGAGGGTGGAGATGT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR (qPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-TTCAGTTGTAAACATTCAAAAAG-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-AAAAAGAAGAAGGCTGATGA-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTwist-CMV-N-3Flag-Ubc-PuroR-T2A (qPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AAAAAGAAGAAGGCTGATGA-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-TTGTTGCAATTGTTTGGAGA-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHomo GAPDH (qPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-TCAAGAAGGTGGTGAAGCAGG-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-TCAAAGGTGGAGGAGTGGGT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epHR-u6-BbsI-S1crRNA-EF1-PuroR-T2A-BFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AAACGTATAGGTTTAATGGTATTGGAG-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-GAAC CTCCAATACCATTAAACCTATA G-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epHR-u6-BbsI-S2crRNA-EF1-PuroR-T2A-BFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AAACG TCATTCAAGGAGGAGTTAGATA-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-GAAC TATCTAACTCCTCCTTGAATGA G-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AAACG TCTTGGTTCACCGCTCTCACTC-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-GAAC GAGTGAGAGCGGTGAACCAAGA G-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epHR-u6-BbsI-N2crRNA-EF1-PuroR-T2A-BFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-AAACG TTCTAAGAAGCCTCGGCAAAAA-3\u0026rsquo;\u003c/p\u003e \u003cp\u003e5\u0026rsquo;-GAAC TTTTTGCCGAGGCTTCTTAGAA G-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Real-time qPCR detection\u003c/h2\u003e \u003cp\u003eTotal RNA from A549 cells was extracted using TRIzol reagent and reverse transcribed to cDNA using Superscript First-Strand Synthesis System (Invitrogen). cDNA was amplified using real-time quantitative PCR with SYBR Green Master Mix (VAZYME, China) for real-time quantitative PCR amplification of cDNA using the specific primers in Table\u0026nbsp;1. \u003cem\u003eHomo sapiens\u003c/em\u003e GAPDH was used as an internal control. All primers were obtained from Sangon Biotech (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Western blotting\u003c/h2\u003e \u003cp\u003eImmunoblotting was performed as reported previously [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Briefly, cells were collected from each group. Protein samples were separated by 12% SDS\u0026ndash;PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk for 1 hour at room temperature and treated with primary antibodies. Rabbit anti-Flag antibody (ab205606, Abcam, Cambridge, UK) and rabbit anti-GAPDH antibody (AB-P-R 001, Xianzhi Biological Co., Ltd, Hangzhou, China) were used at 1:1000 dilutions. All blots were treated with HRP-labeled secondary antibody. Finally, the density of the bands was analyzed by Image Lab 5.2.1 (Bio-Rad, Inc. USA) using the ECL detection reagent from Thermo Scientific.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Flow cytometry analysis\u003c/h2\u003e \u003cp\u003eTreated cells were digested with 0.25% trypsin without EDTA and then collected by centrifugation at 1500 rpm for 5 minutes. The supernatant was removed, and fresh PBS was added to resuspend the cells, which were centrifuged at 1500 rpm for 5 minutes and washed twice with PBS. Then, 200 \u0026micro;L of PBS was added to resuspend the cells. Anti-Flag antibody was added to each flow cytometry tube (2 \u0026micro;l/test) and incubated at 4 ℃ in the dark for 30 minutes. The cells were centrifuged at 1500 rpm for 5 minutes and washed twice with PBS. Subsequently, the above steps were repeated with a fluorescent secondary antibody. The cells were incubated at room temperature in the dark for 20\u0026ndash;30 min, centrifuged at 1500 rpm for 5 min and washed twice with PBS. Finally, 200 \u0026micro;l of PBS was added to resuspend the cells for analysis by flow cytometry (CytoFLEX, Beckman Coulter, California, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Immunofluorescence analysis\u003c/h2\u003e \u003cp\u003eImmunofluorescence was performed as reported previously [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. First, cells in 24-well plates were washed in PBS/0.1% Triton X-100 (PBST) twice and fixed in 4% formaldehyde/PBS for 15 min before being washed with PBST again. Second, the cells were incubated in 5% goat serum at 37 ℃ for 30 minutes and then with rabbit anti-Flag primary antibody (ab205606, Abcam, Cambridge, UK) at a 1:500 dilution. Subsequently, the cells were washed several times with PBST and incubated with the corresponding secondary antibody. Finally, the cells were rinsed with PBS for 5 min (repeated three times) and counterstained with 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI) (Sigma‒Aldrich, Saint Louis, MO, USA) for 10 min. Fluorescence microscopy (Olympus, Tokyo, Japan) was used to detect fluorescence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed with SPSS 18.0 software. Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. In all tests, a P value less than 0.05 was considered statistically significant, and 0.01 was considered a very significant difference. Student\u0026rsquo;s t test was used for comparisons between two groups. These analyses were performed using OriginLab Origin V8.0 (OriginLab, Northampton, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Plasmid construction and stable transfection cell line screening\u003c/h2\u003e \u003cp\u003eWe synthesized the spike (S) protein and nucleocapsid (N) protein of SARS CoV-2 and constructed them in the corresponding expression plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Through sequence alignment and analysis, we obtained specific conserved sites for S and N and constructed corresponding crRNA plasmids (Table\u0026nbsp;1). PLentiRNACRISPR_ HU6-DR_ BsmBI-EFS-RfxCas13d-NLS-2A-UroR-WPRE (138147) and pHR-u6-BbsI-N1crRNA-EF1-PuroR-T2A-BFP (155307) were purchased from Addgene. We used lentivirus packaging of the cas13d plasmid to infect A549 cells and obtained a stable and highly expressing cas3d A549 cell line through long-term antibiotic screening. qPCR confirmed this result (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. The CRISPR/Cas13d system intervened in mRNA expression of viral S and N\u003c/h2\u003e \u003cp\u003eThrough real-time fluorescence quantitative detection after transfection of the corresponding plasmids, we found that the CRISPR/Cas13d system and specific target crRNA can effectively reduce mRNA expression of the corresponding genes. For spike, the editing efficiency of S1crRNA was over 80%; S2crRNA also showed over 50% editing. When S1crRNA and S2crRNA were combined, we found that the editing efficiency was improved, but the difference was not significant compared to S1crRNA alone. Interestingly, when we combined S1crRNA and S2crRNA and further increased the crRNA, the editing efficiency unexpectedly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We considered that the increase in plasmid concentrations may have interfered with the original transfection efficiency, so we removed this group in subsequent experiments. For the nucleocapsid, both N1crRNA and N2crRNA significantly reduced the mRNA expression level to lower than 20% when editing alone. Surprisingly, when they were used together, the efficiency of gene editing actually decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The above results indicated that the CRISPR/Cas13d system was able to effectively edit the SARS CoV-2 gene at the mRNA level. However, not all results matched our expectations.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. CRISPR/Cas13d system editing of viruses at the protein level\u003c/h2\u003e \u003cp\u003eWe further examined the impact of the CRISPR/Cas13d system on expression of these two key viral proteins. The results showed that the trend of changes in protein levels was almost consistent with that in mRNA levels, while the decrease in protein levels was not significant compared to that in mRNA levels in terms of editing efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). For the spike protein, the editing efficiency of S1crRNA was approximately 65%, and that of S2crRNA was only 18%. When coediting, we found that the previously improved editing efficiency at the mRNA level disappeared at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). When the proportion of crRNA was increased for joint editing, the editing effect was not significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). For the nucleocapsid protein, the editing efficiency at the protein level was only 20\u0026ndash;40%, while that at the RNA level was above 80% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Flow cytometry analysis of the editing status of the CRISPR/Cas13d system\u003c/h2\u003e \u003cp\u003eFor spike, A549 cells transfected with BFP-crRNA successfully were selected by flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). We found that approximately 50% of the total cells were successfully transfected with U6-crRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). These 50% positive cells were used to analyze the editing efficiency of the CRISPR/Cas13d system on spikes. Thus, we can effectively avoid editing efficiency deviations caused by transfection efficiency. The spike plasmid PCDH-CMV-S-Flag-EF1-copGFP-T2A-PuroR was expressed together with a GFP fluorescent protein label. We found that almost all BFP-positive cells showed red fluorescence of Flag and green fluorescence of GFP in the mock crRNA group. After transfection with ScrRNA, we found a significant decrease in the number of double-positive cells, with a decrease of 69% in S1crRNA, nearly 30% in S2crRNA, and a decrease of 78% in S1\u0026thinsp;+\u0026thinsp;S2crRNA cotransfection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and C). In the nucleocapsid group, the proportion of cells with blue fluorescence of BFP and red fluorescence of Flag in the blank group was also approximately 50%. This result is similar to that of the spike group from the perspective of transfection efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Our subsequent analysis was based on these 50% double-positive cells. It was found that N1crRNA can mediate loss of red fluorescence in approximately half of double-positive cells and that N2crRNA can mediate the inability of over 60% of cells to express nucleocapsid protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and C). These results were quite similar to the above qPCR results.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. The editing effect of the CRISPR/Cas13d system by immunofluorescence detection\u003c/h2\u003e \u003cp\u003eTo confirm the above experimental results, we detected the editing effect of the CRISPR/Cas13d system on viral genes through immunofluorescence. Fluorescence observation revealed a large and strong amount of red fluorescence for the mock crRNA group. After transfection with the corresponding crRNA, the fluorescence quantity and intensity were significantly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). From the changes in fluorescence intensity, the immunofluorescence results were consistent with the previous qPCR and flow cytometry results.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAt present, the COVID-19 pandemic has gradually disappeared, but many people around us have obvious sequelae after COVID-19, including but not limited to chest tightness, shortness of breath, limb impairment, and loss of sense of smell and taste[\u003cspan additionalcitationids=\"CR19 CR20\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In addition, reinfection by SARS-CoV-2 can occur, especially in the elderly and children [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In other words, research on COVID-19 prevention and control methods should not stagnate with the disappearance of the pandemic, and more effective prevention measures are needed. Many protocols based on CRISPR for detecting SARS-CoV-2 have been published recently [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Cas13 can be used in forward transcriptomic pooled screens and to predict optimized Cas13 guide RNAs for all protein-coding transcripts in the human genome [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Based on previous studies, we attempted to clarify the editing effect of the CRISPR‒Cas system on key viral proteins in vitro, providing new ideas for virus prevention and control work.\u003c/p\u003e \u003cp\u003eCompared to other CRISPR‒Cas systems, CRISPR‒Cas13d has higher editing efficiency and lower off-target effects [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This means that it can edit more genes in a shorter time, and fewer nontarget genes are mistakenly edited [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This makes CRISPR‒Cas13d a very promising gene editing tool that can be used to treat hereditary diseases, study gene function, and develop new treatment methods. The editing effect of Cas13 in the proliferation process of other viruses, especially RNA viruses, has been confirmed[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The SARS-CoV-2 spike glycoprotein has adsorption and membrane fusion functions, playing an important role in virus adhesion and invasion of host cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The replicase and nucleocapsid protein N are mainly involved in transcription and replication of the viral genome [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Here, we show that the CRISPR‒Cas13d system can effectively target the spike protein and nucleocapsid protein of SARS-CoV-2. If these two key proteins are edited and cannot be expressed during virus infection, the proliferation process of the virus will be interrupted. Therefore, we selected these two proteins for our study. At the same time, SARS-CoV-2 is an RNA virus. When its genetic material enters the host cell, the gene editing system can begin, thus directly destroying its genome to achieve antiviral effects [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. All our results showed that when overexpressing key viral genes in vitro, the CRISPR‒Cas13d system can effectively edit and significantly reduce their expression.\u003c/p\u003e \u003cp\u003eHowever, there are still some issues and shortcomings that need to be considered in our experimental results. On the one hand, all of our experiments were conducted in vitro, and the virus's genes were overexpressed through artificial transfection, which means that its process may be significantly different from the virus infection process. Therefore, the editing efficiency we detected can only serve as a reference. Only further animal experiments can clarify the true editing efficiency. On the other hand, as an RNA virus, when SARS-CoV-2 enters the host cell with the CRISPR‒Cas13d system, gene editing may have started, rather than waiting until it guides the host cell to express viral proteins. Therefore, theoretically speaking, the editing efficiency should be lower than the actual infection situation.\u003c/p\u003e \u003cp\u003eOverall, this study focuses on the spike glycoprotein and nucleocapsid protein. By comparing and analyzing existing sequences in NCBI, highly conserved segments of the coding protein sequence were obtained to construct a highly specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d to the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence. However, the experimental results also found that the combination of multiable crRNA could not effectively further improve the editing efficiency. This study provides strong theoretical support for the prevention and treatment of SARS-CoV-2.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e La Wang designed the project; Ruixi Luo and La Wang conducted the experiments; Wenjia Wang and Zunli Ke analyzed and studied the data;\u0026nbsp;La Wang wrote the original draft;\u0026nbsp;Weiyi Tian reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was supported by\u0026nbsp;the\u0026nbsp;Young Scientific and Technological Talents Growth Project of Guizhou Provincial Department of Education (Qianjiaohe KY word [2021]198),\u0026nbsp;the Program of the National Natural Science Foundation of China (Grant No. 81960796).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no\u0026nbsp;conflicts\u0026nbsp;of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, Xiang H, Cheng Z, Xiong Y et al (2020) Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA 323(11):1061\u0026ndash;1069\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Si HR, Zhu Y, Li B, Huang CL et al (2020) A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579(7798):270\u0026ndash;273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan JF, Kok KH, Zhu Z, Chu H, To KK, Yuan S, Yuen KY (2020) Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan. Emerg microbes infections 9(1):221\u0026ndash;236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan J, Ge J, Yu J, Shan S, Zhou H, Fan S, Zhang Q, Shi X, Wang Q, Zhang L et al (2020) Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 581(7807):215\u0026ndash;220\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang S, Hillyer C, Du L (2020) Neutralizing Antibodies against SARS-CoV-2 and Other Human Coronaviruses. Trends Immunol 41(5):355\u0026ndash;359\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrompetchara E, Ketloy C, Palaga T (2020) Immune responses in COVID-19 and potential vaccines: Lessons learned from SARS and MERS epidemic. Asian Pac J Allergy Immunol 38(1):1\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhn DG, Shin HJ, Kim MH, Lee S, Kim HS, Myoung J, Kim BT, Kim SJ (2020) Current Status of Epidemiology, Diagnosis, Therapeutics, and Vaccines for Novel Coronavirus Disease 2019 (COVID-19). J Microbiol Biotechnol 30(3):313\u0026ndash;324\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A et al (2020) CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38(7):870\u0026ndash;874\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCordes AK, Heim A (2020) Rapid random access detection of the novel SARS-coronavirus-2 (SARS-CoV-2, previously 2019-nCoV) using an open access protocol for the Panther Fusion. J Clin virology: official publication Pan Am Soc Clin Virol 125:104305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo L, Sun X, Wang X, Liang C, Jiang H, Gao Q, Dai M, Qu B, Fang S, Mao Y et al (2020) SARS-CoV-2 detection with CRISPR diagnostics. Cell discovery 6:34\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMantena S, Pillai PP, Petros BA, Welch NL, Myhrvold C, Sabeti PC, Metsky HC (2023) : Model-directed generation of CRISPR-Cas13a guide RNAs designs artificial sequences that improve nucleic acid detection. \u003cem\u003ebioRxiv: the preprint server for biology\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHussein M, Andrade Dos Ramos Z, Vink MA, Kroon P, Yu Z, Enjuanes L, Zuniga S, Berkhout B, Herrera-Carrillo E (2023) : Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2. \u003cem\u003eViruses\u003c/em\u003e 15(3)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen TM, Zhang Y, Pandolfi PP (2020) Virus against virus: a potential treatment for 2019-nCov (SARS-CoV-2) and other RNA viruses. Cell Res 30(3):189\u0026ndash;190\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKonermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD (2018) Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell 173(3):665\u0026ndash;676e614\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA (2018) Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Mol Cell 70(2):327\u0026ndash;339 e325\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng X, Li Z, Shan R, Li Z, Wang S, Zhao W, Zhang H, Chao L, Peng J, Fei T et al (2023) Modeling CRISPR-Cas13d on-target and off-target effects using machine learning approaches. Nat Commun 14(1):752\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao Q, Wang L, Zhou XL, Zhu Y, Dong ZQ, Chen P, Lu C, Pan MH (2019) BmAtg13 promotes the replication and proliferation of Bombyx mori nucleopolyhedrovirus. Pestic Biochem Physiol 157:143\u0026ndash;151\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRass V, Tymoszuk P, Sahanic S, Heim B, Ausserhofer D, Lindner A, Kofler M, Mahlknecht P, Boehm A, Hufner K et al (2023) : Distinct smell and taste disorder phenotype of post-acute COVID-19 sequelae. \u003cem\u003eEuropean archives of oto-rhino-laryngology: official journal of the European Federation of Oto-Rhino-Laryngological Societies\u003c/em\u003e 280(11):5115\u0026ndash;5128\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao S, Abdurehim A, Yuan Y, Yang T, Li C, Zhang Y, Li Y, Sun X, Xie J Natural Products: A Potential New Hope to Defeat Post-Acute Sequelae of COVID-19. \u003cem\u003eCurrent topics in medicinal chemistry\u003c/em\u003e 2023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnston J, Dorrian D, Linden D, Stanel SC, Rivera-Ortega P, Chaudhuri N (2023) : Pulmonary Sequelae of COVID-19: Focus on Interstitial Lung Disease. Cells 12(18)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBowe B, Xie Y, Al-Aly Z (2023) Postacute sequelae of COVID-19 at 2 years. Nat Med 29(9):2347\u0026ndash;2357\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatuchansky C (2023) Natural SARS-CoV-2 infection-induced immune protection against re-infection. Lancet 402(10408):1131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu Z (2023) Cautionary notes on the COVID-19 re-infection study. Lancet 402(10408):1130\u0026ndash;1131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Cai X, Ge W, Wang D, Zhu G, Qian L, Xiang N, Yue L, Liang S, Zhang F et al (2022) Potential Use of Serum Proteomics for Monitoring COVID-19 Progression to Complement RT-PCR Detection. J Proteome Res 21(1):90\u0026ndash;100\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFasching CL, Servellita V, McKay B, Nagesh V, Broughton JP, Sotomayor-Gonzalez A, Wang B, Brazer N, Reyes K, Streithorst J et al (2022) COVID-19 Variant Detection with a High-Fidelity CRISPR-Cas12 Enzyme. J Clin Microbiol 60(7):e0026122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWessels HH, Mendez-Mancilla A, Guo X, Legut M, Daniloski Z, Sanjana NE (2020) Massively parallel Cas13 screens reveal principles for guide RNA design. Nat Biotechnol 38(6):722\u0026ndash;727\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Gao X, Kan C, Li L, Zhang Y, Gao Y, Zhang S, Zhou L, Zhao H, Li M et al (2023) CRISPR-Cas13d effectively targets SARS-CoV-2 variants, including Delta and Omicron, and inhibits viral infection. MedComm 4(1):e208\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang YY, Sun MX, Lian Y, Wang TY, Jia MY, Leng C, Chen M, Bai YZ, Meng F, Cai XH et al (2022) CRISPR-Cas13d Exhibits Robust Antiviral Activity Against Seneca Valley Virus. Front Microbiol 13:835040\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahas A, Aman R, Mahfouz M (2019) CRISPR-Cas13d mediates robust RNA virus interference in plants. Genome Biol 20(1):263\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SARS-CoV-2, CRISPR/Cas13 system, Spike glycoprotein, Nucleocapsid protein, A549 cell","lastPublishedDoi":"10.21203/rs.3.rs-3747482/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3747482/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAs a new type of virus that seriously threatens public health worldwide, there are currently very limited effective methods of prevention and control for severe acute respiratory syndrome (SARS)-CoV-2. Therefore, people urgently need an efficient and specific mechanism to prevent COVID-19. CRISPR/Cas13 is a natural defense system in bacteria that has been successfully applied for the prevention and treatment of many viruses, including SARS-CoV-2. How to efficiently and specifically destroy SARS-CoV-2 RNA and avoid virus escape caused by base mutations is still an urgent problem.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eBy comparing and analyzing existing sequences in NCBI, highly conserved segments of protein-coding sequences were obtained to construct a highly specific crRNA plasmid. The A549 cell line stably expressing Cas13d was constructed by a lentivirus system. The cleavage efficiency of Cas13d for the target protein RNA of SARS-CoV-2 was confirmed by qPCR, WB, flow cytometry and immunofluorescence.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThis study focused on the spike (S) glycoprotein and nucleocapsid (N) protein. We found that the CRISPR/Cas13d system was able to effectively edit the SARS-CoV-2 genes at the mRNA or protein level. However, the results also showed that the combination of multiple crRNA could not effectively further improve the editing efficiency.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe CRISPR/Cas13 system was able to edit spike and nucleocapsid viral RNA to resist SARS-CoV-2 infection. This study provides strong theoretical support for the prevention and treatment of COVID-19.\u003c/p\u003e","manuscriptTitle":"The CRISPR/Cas13 system edits viral spike and nucleocapsid RNA to resist SARS-CoV-2 infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-12-16 23:04:02","doi":"10.21203/rs.3.rs-3747482/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f3225497-35ba-469a-a315-2ed465c71438","owner":[],"postedDate":"December 16th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-19T09:30:17+00:00","versionOfRecord":[],"versionCreatedAt":"2023-12-16 23:04:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3747482","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3747482","identity":"rs-3747482","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}