Genotypic Evidence of Extended-spectrum β-lactamase and Carbapenemase-producing Shigatoxigenic and Intimin-producing Shigatoxigenic Multidrug-resistant Escherichia coli from Diarrheic Calves: Hidden Zoonotic and Public Health Risk | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genotypic Evidence of Extended-spectrum β-lactamase and Carbapenemase-producing Shigatoxigenic and Intimin-producing Shigatoxigenic Multidrug-resistant Escherichia coli from Diarrheic Calves: Hidden Zoonotic and Public Health Risk Plabon Ketan Barua, Uaye Mya, Partha Paul, Snigdha Das, Mukta Das Gupta, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8510259/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Apr, 2026 Read the published version in Veterinary Research Communications → Version 1 posted 11 You are reading this latest preprint version Abstract Shiga toxin-producing Escherichia coli (STEC) is a pathotype of E . coli associated with a wide variety of diarrhoea in neonatal calves, causing a global economic loss in the dairy industry with significant zoonotic risks via STEC and intimin-producing STEC, resulting in enteric and systemic illness, including diarrhoea, haemorrhagic colitis (HC), and haemolytic uremic syndrome (HUS) in humans. The prominence of multidrug-resistant (MDR) STEC from neonatal diarrhoeic calves is increasing public health risks and restricted treatment alternatives. The prevalence of STEC was investigated in 75 rectal swabs from diarrhoeic calves aged ≤ 12 weeks, collected before initiating antibiotic treatment. The E. coli isolation rate among diarrhoeic calves was 80% (60/75; 95% CI: 69.17–88.35). The presence of stx genes ( stx1 , stx2 ), intimin-producing eae gene, carbapenemase-producing genes ( bla NDM group and bla KPC group), and extended-spectrum β-lactamase genes ( bla TEM group, bla CTX−M group, and bla SHV group) was screened by polymerase chain reaction (PCR). The prevalence of pathogenic E. coli was 13.33% (10/75; 95% CI: 6.5–23.1). The STEC isolates were detected in 12% (9/75, 95% CI: 5.64–21.56). Of these pathogenic E. coli isolates, the STEC with both stx genes, stx1 only, and stx2 only genotypes were present in 40% (4/10) and 10% (1/10), respectively. Intimin-producing STEC isolates ( eae -STEC) were identified in 40% (4/10) among the pathogenic isolates, with the following genotypes: stx1 + eae (2/10, 20%), stx2 + eae (1/10, 10%), and stx1 + stx2 + eae (1/10, 10%). Only one (1/10, 10%) eae- encoded non-STEC isolate was found, called enteropathogenic E. coli (EPEC). All STEC (100%) isolates were tested positive for either ESBL or carbapenemase or both ESBL and carbapenemase in the phenotypic assays. ESBL-producing STEC isolates were genetically identified in 6.67% (5/75) with the following combinations: three isolates coharbored stx1 - bla TEM , two had stx1 - bla SHV , and stx2 - bla TEM , respectively. All intimin-producing STEC ( eae- STEC) isolates were both ESBL and carbapenemase producers, which were identified in 5.33% (4/75), with followings genotypic expression: stx1 + stx2 + eae / bla TEM + bla CTX−M + bla NDM + bla KPC in 1.33% (1/75), stx1 + eae / bla TEM + bla KPC in 1.33% (1/75), stx1 + eae / bla TEM + bla CTX−M +bla KPC in 1.33% (1/75), and stx1 + eae / bla TEM + bla CTX−M +bla KPC in 1.33% (1/75). ESBL and carbapenemase-producing eae -STEC isolates were more likely to be multidrug-resistant (MDR) than ESBL-STEC and EPEC isolates. The highest antimicrobial resistance rates were observed in ciprofloxacin and meropenem (100%), nitrofurantoin and cefoxitin (90%), ampicillin, streptomycin, and trimethoprim-sulfamethoxazole (80%), chloramphenicol (70%), and doxycycline, tetracycline, and cefotaxime (60%). In contrast, the lowest resistance rates were found in gentamycin (20%) and amoxicillin-clavulanate (40%). In terms of pathogenicity, only STEC isolates induced mild to moderate non-bloody diarrhoea, whereas intimin-producing STEC caused severe bloody diarrhoea with 100% mortality (4/4) ( p < 0.05) in neonatal calves. To the best of our knowledge, this is the first report on ESBL and carbapenemase-producing MDR STEC from diarrhoeic calves in Bangladesh. Shiga toxin-producing Escherichia coli Intimin-producing STEC Extended-spectrum β-lactamase genes Carbapenemase genes Diarrhoeic calves Multidrug resistance Public health risk Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction E. coli strains mainly act as intestinal commensals in animals and humans; some strains can cause a wide range of self-limiting to life-threatening intestinal diseases in calves and humans (Faikh et al. 2017). E. coli is an important pathogenic cause of calf diarrhoea in the early age of life (Moxley and Smith 2010 ). It leads to significant economic losses due to high morbidity and mortality rates in neonatal calves (Constable et al. 2017 ). Shiga toxin ( Stx )-producing E. coli is a major zoonotic foodborne organism causing gastrointestinal diseases in humans (Nada et al. 2023 ). STEC refers to a pathotype of E. coli that can produce Stx1 and/or Stx2 (Etcheverria and Padol 2013; Nada et al. 2023 ). Shiga toxins ( Stx ) are classified into two major families, Stx1 and Stx2 , which share 70% similar amino acid sequences (Caprioli et al. 2012 ; Nada et al. 2023 ). Stx2 is more likely to cause diseases like haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS), whereas stx1 is less likely to produce diseases in humans (Melton-Celsa 2014 ). Additionally, the STEC can express a virulence factor called intimin protein, which is responsible for intricate attachment of STEC to the intestinal epithelium, resulting in attaching and effacing lesions to the intestinal mucosa (Jerse et al. 1990 ). Intimin protein is produced by a chromosome-encoded gene ( eae ), which is a segment of the pathogenicity island called the locus for enterocyte effacement (LEE) (Kaper et al. 1998 ; Kaper and O′Brien 2014). So, severe diarrhoea with HC and HUS are closely associated with both STEC and intimin-producing STEC isolates (Kaper et al. 1998 ; Paton and Paton 1998 ; Kaper and O′Brien 2014). Cattle and calves may disseminate these STEC isolates through fecal contamination in vegetables, beef, milk, and unpasteurized dairy products via direct or indirect contact with live animals (Mughini-Gras et al. 2018; Organization WH 2019; Elmonir et al. 2021 ). Antimicrobial-resistant bacteria represent a significant public health threat, predicted to cause the death of 10 million people per year by 2050 (Mir and Kudva 2019 ). Genes that produce extended spectrum beta-lactamase (ESBL) confer resistance to a wide array of β-lactams, the most commonly used antimicrobials in medical and veterinary clinics. Global surveillance among human population indicates a concerning rise on carbapenemase-producing clinical E. coli isolates (Codjoe and Donkor 2018; Köck et al. 2018 ). Parallel to this trend, reports on ESBL-producing STEC isolates have emerged in human and cattle samples (Day et al. 2016 ; Nagel and Spüler 2019 ; Elafy et al. 2020). This trend represents a critical threat to public health because carbapenemase neutralizes the carbapenems, that mainly used as a final recourse against the multidrug-resistant (MDR) bacteria. These implications are particularly severe for STEC infections because the carbapenem drugs (like meropenem and imipenem) are recommended for the staged STEC infections in humans to cure the HUS or kidney failure (Mir and Kudva 2019 ). Emergence of carbapenemase-producing STEC isolates indicates an impending therapeutic crisis with limited alternative treatments for life-threatening diseases. Though carbapenems are not used in veterinary practices, studies in India found carbapenemase-positive E. coli in mastitic milk (Ghatak et al. 2013) and diarrhoeic calves (Murugan et al. 2019). ESBL-producing E. coli isolates were reported in Bangladesh from clinical human samples (Khan et al. 2018), cow milk (Nahar et al. 2023 ) and subclinical mastitic buffalo milk (Chowdhury et al. 2025). The detection of carbapenem-resistant E. coli in livestock may be linked to anthropogenic contamination via intra or inter-species transmission, or conversely, the natural selection of resistant pathogens and their associated mobile genetic materials (Köck et al. 2018 ; Murugan et al. 2019). Potential zoonotic transmission of these bacteria can enter the food chains, requiring rigorous and continuous monitoring of ESBL and carbapenemase-producing E. coli at both the animal-human interface. Furthermore, STEC isolates were recovered from diarrhoeic calves, including clinical cases in Bangladesh (Johura et al. 2017; Islam et al. 2007). Some of these isolates displayed a variety of patterns of antimicrobial resistance. However, there is no data on ESBL and carbapenemase-producing STEC isolates obtained from diarrhoeic calves in Bangladesh. Therefore, this study aimed to reveal things are followings: 1) investigate the STEC isolates among diarrhoeic calves, their diverse pathogenic severity, followed by death of calves according to STEC’s current genotypic combination, 2) phenotypic and genotypic identification of ESBL and carbapenemase production among the STECs, 3) multidrug-resistance patterns among the pathogenic STEC isolates in the study regions, and finally 4) distribution of virulence, ESBL and carbapenemase genes, which helps clarify the viability of transmission and may be a concern in the development of multi-species reservoirs for virulence and resistance genes. Materials and Methods Ethical approval The Ethics Committee at Chattogram Veterinary and Animal Sciences University (Approval Number : CVASU/Dir(R&E) EC/2025/880/6) provided the approval for this research. We followed all processes and procedures as outlined in the guidelines of the ethics committee. Sampling strategy and study design A cross-sectional study was conducted among diarrhoeic calves in three coastal areas of Bangladesh – Chattogram, Cox’s Bazar, and Noakhali. We employed a multi-stage stratification and purposive sampling method to ensure a comprehensive representation of spatial distribution. Each district was stratified into four cardinal zones: east, west, north, south, and middle. Then, one far-end upazila (sub-district) from each geographical direction was selected, and in total, 15 upazila (5 per district) were selected for this study. Stratification of the subdistricts was conducted by dividing them into five internal directional subregions (east, west, north, south, and middle), resulting in a total of 75 subareas. Geographical stratification was performed using Google Maps. From each of the 75 subareas, one farm was purposively selected where calves were aged ≤ 12 weeks, with manifested diarrhoea (watery or bloody, or mucus) with fever, and before initiating antibiotic therapy at the time of visit. Sample collection Rectal swabs were collected from 75 diarrhoeic calves. The swabs were placed in the test tubes containing 10 mL buffer peptone water (BPW, Oxoid, UK). Stuart Transport Media (STM, Oxoid, UK) was used during distant travel. The swabs were transported immediately to the Microbiology Laboratory at Chattogram Veterinary and Animal Sciences University (CVASU). Cultural isolation of E. coli Pre-enriched BPW culture was subcultured onto a selective medium (MacConkey Agar, Oxoid, UK) and incubated overnight at 37 °C. Isolates with reddish-pink colonies on MacConkey agar were subcultured to Eosin Methylene Blue (EMB – Oxoid, UK) agar and incubated overnight at 37°C. A greenish metallic sheen in EMB agar was phenotypically identified as E. coli . Furthermore, an indole test (a biochemical test) was performed to confirm the cultural identification. Lastly, we performed Gram staining to confirm the microscopic rod shape and its Gram-negative nature. Molecular detection of Escherichia coli , STEC, eae- STEC and EPEC The DNA was extracted through the crude boiling method (Wani et al. 2003; Bhat et al. 2008). All isolates were tested for the adk gene through uniplex PCR assays by using the primer sequences listed in the Table. 1. For PCR, we used a 20 µL reaction volume containing 2 µL of DNA template, 10 µL DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Inc., USA), 1 µL of each forward and reverse primer, and 6 µL of nuclease-free water (Thermo Fisher Scientific, Inc., USA). For this study, all the polymerase chain reaction amplification was performed at a Thermocycler machine (2720 Thermal cycler, Applied Biosystems, USA). Initial denaturation at 95°C for 2 minutes, 30 cycles of denaturation at 95°C for 1 minute, annealing at 54°C for 1 minute, Extension at 72°C for 1 minute, and final extension at 72 °C for 5 minutes, for the adk gene encoded DNA amplification. An isolate of E. coli from the previous study was used as a positive control (Gupta et al. 2016). PCR reaction mixtures without DNA and primers were applied as a negative control. Three virulent genes ( stx1, stx2, eae ) were identified among E. coli isolates by using Uniplex PCR. The primers’ sequence and cycle conditions for PCR amplification are described and referenced in Table 1. The PCR products were analyzed by electrophoresis using a 1.5% agarose gel (MP-Biomedicals, USA). The bands were visualized by staining with 8 µL MIDORI Green, a SYBR Safe DNA Gel Stain (Invitrogen, Thermo Fisher, USA), with the aid of a gel imaging system, GelDoc (Bio-Rad, USA). Table 1 Primer sequences used in polymerase chain reaction for housekeeping (adk) and virulence genes (stx1, stx2, and eae) of Escherichia coli isolates. Primer Primer Sequences Target gene Amplicon size ( bp ) Annealing Temperature References adk-F ATTCTGCTTGGCGCTCCGGG adk 590 54 °C (DesROSIERS et al., 2001) adk-R CCGTCAACTTTCGCGTATTT stx1-F ACACTGGATGATCTCAGTGG stx1 614 58 °C (Manna et al., 2006) stx1-R CTGAATCCCCCTCCATTATG stx2-F CCATGACAACGGACAGCAGTT stx2 779 58 °C (Konno et al., 2012) stx2-R CCTGTCAACTGAGCAGCACTT eae -F CAGGATCGCCTTTTTTATACG eae 479 55 °C eae -R CTCTGCAGATTAACCTCTGC F , forward primer sequence from 5`- 3`; R , reverse primer sequence from 3`- 5`; bp , base pair of amplicon size. Antimicrobial susceptibility profiling of virulent E. coli isolates The antimicrobial susceptibility profile of virulent E. coli isolates was determined using the disc diffusion method, as recommended by the Clinical and Laboratory Standards Institute (CLSI) (Bauer 1966; CLSI 2023). We interpreted the antimicrobial susceptibility test using breakpoints for E. coli . Molecularly identified virulent isolates carrying ( stx / eae /both) were phenotypically tested against 13 commercial antimicrobials discs (Oxoid, UK): amoxicillin-clavulanate (AMC; 30 µg); ampicillin (AMP; 10 µg); cefotaxime (CTX; 30 µg); cefoxitin (FOX; 30 µg); meropenem (MEM; 10 µg); streptomycin (S; 10 µg); gentamycin (CN; 10 µg); doxycycline (DO, 30 µg); tetracycline (TE; 30 µg); chloramphenicol (C; 30 µg); nitrofurantoin (F; 300 µg); ciprofloxacin (CIP; 5 µg); trimethoprim-sulfamethoxazole (SXT; 25 µg). Repeatability and reproducibility were assessed for this test. Multidrug-resistant (MDR) bacteria According to the CLSI guidelines, we have classified STEC/ eae -STEC/EPEC isolates as multidrug resistant (MDR) if they acquired non-susceptibility to at least one agent in three or more categories of antibiotics. ESBL and carbapenemase production All STEC, eae -STEC, and EPEC ( eae ) isolates were phenotypically screened for ESBL and carbapenemase production, according to the guidelines of CLSI. Combined disk method using cefotaxime (30 µg), cefotaxime/clavulanate (30/10 µg), ceftriaxone (30 µg), ceftriaxone/clavulanate (30/10 µg), ceftazidime (30 µg) and ceftazidime/clavulanate (30/10 µg) (Oxoid, UK) was determined in Mueller-Hinton agar (MHA). ESBL-producing isolates were recognized by ≥ 5 mm increase in zone diameter around cefotaxime/clavulanate, ceftriaxone/clavulanate, and ceftazidime/clavulanate in comparison with disks without clavulanic acid. A modified carbapenem inactivation method (mCIM) using 10 µg meropenem disk in carbapenemase production, and the positive isolates were interpreted by 6-15 mm zone diameter (Pierce et al. 2017). Molecular characterization of ESBL and carbapenemase genes among pathogenic MDR E. coli isolates Three common ESBL genes ( bla TEM group, bla CTX-M group, and bla SHV group) and two carbapenemase genes ( bla NDM group and bla KPC group) were tested, using a conventional PCR method using the primer pairs listed in Table 2. DNA extraction was performed using the FavorPrep Genomic DNA Extraction Mini Kit (Cat no. FATGK 001) (Favorgen Biotech Corp.). For the detection of ESBL genes, we performed one PCR reaction by multiplexing the above three ESBL genes in one PCR tube. However, detection of carbapenemase genes was performed in two separate uniplex PCR reactions with two separate reaction tubes. For both the ESBL and carbapenemase genes, 25 µL final volume containing 12.5 µL 2x Hot Star Taq multiplex PCR Master Mix (QIAGEN, Netherlands), 1 µL of each primer (2 µL), 2 µL of template DNA, and 8.5 µL of nuclease-free water, according to the previously published protocols (Seman et al. 2022). The PCR cycling protocols were: initial denaturation was 95°C for 15 minutes, followed by 35 cycles each of denaturation at 94°C for 30 seconds, annealing at 58°C for 90 seconds, extension at 72°C for 90 seconds, and final extension at 72°C for 10 minutes. The polymerase chain reaction products were analyzed by the electrophoresis technique using a 1.5% agarose gel (MP-Biomedicals, USA). The bands were visualized by staining with 10 µL MIDORI Green, a SYBR Safe DNA Gel Stain (Invitrogen, Thermo Fisher, USA), with the aid of a gel imaging system, GelDoc (Bio-Rad, USA). Table 2 Primer sequences used in polymerase chain reaction for ESBL genes (blaTEM group, blaCTX-M group, and blaSHV group), and carbapenemase genes (blaNDM group and blaKPC group) Targeted genes Forward primer sequences (5´- 3´) Reverse primer Sequences (3´- 5´) Amplicon size ( bp * ) References bla TEM TTTCGTGTCG CCCTTATTCC ATCGTTGTCAGA AGTAAGTTGG 403 (Mohammed et al. 2016) bla CTX-M CGCTGTTGTTA GGAAGTGTG GGCTGGGTGA AGTAAGTGAC 754 (Seman et al. 2022) bla SHV CGCCTGTGTATT ATCTCCCT CGAGTAGTCCA CCAGATCCT 293 (Mohammed et al. 2016) bla KPC CGTCTAGTTCT GCTGTCTTG CTTGTCATCCT TGTTAGGCG 798 (Poirel et al. 2011) bla NDM GGTTTGGCGAT CTGGTTTTC CGGAATGGCTC ATCACGATC 621 (Poirel et al. 2011) bp *, base pair of amplicon size Quality control in ESBL and carbapenemase gene detection A positive American Type Culture Collection (ATCC) was used to check the efficacy of each culture. The positive control included Klebsiella Pneumoniae ATCC 700603 for ESBL, and Klebsiella Pneumoniae ATCC 1705 for carbapenemase during PCR and phenotypic determination. Nuclease-free water containing Master Mix without DNA was used as a negative control. Statistical Analysis A ‘95% Confidence Interval for the proportion of virulent gene profile, by an Agresti-Coull method. Fisher’s exact test was performed by R (version 4.5.0) to correlate the virulence capacity of the genetic combination of pathogenic E. coli isolates with age, mortality, and clinical severity in calves. We used Python (version 3.9) with the Matplotlib and Seaborn libraries for data visualization. Results Prevalence of E. coli in diarrhoeic calves Out of 75 isolates, 60 isolates had 60 isolates were positive for the adk gene in the PCR reaction in Fig. 1 (A). Therefore, the prevalence of E. coli in diarrhoeic calves was 80% (60/75; 95% CI: 69.17–88.35). Molecular detection of virulence gene carriage in E. coli isolate Gel images of PCR products for stx1 , stx2 , and eae genes have been demonstrated in Fig. 1 (B, C, D). There were 10 isolates detected as virulence gene carriage pathogenic E. coli , with a proportion with 13.33% (10/75; 95% CI: 6.5–23.1). Molecular detection rates of STEC, eae -STEC, and EPEC ( eae ) among the isolates described in Fig. 2. The STEC isolates were detected in 12% (9/75, 95% CI: 5.64-21.56). Among the diarrhoeic calves, Shiga toxin gene stx1 was predominantly identified in 5.33% (4/75) (95% CI: 1.47-13.01), followed by stx2 in 1.33% (1/75) (95% CI: 0.03 – 7.21). Only one eae -encoded isolate was detected . Prevalence of intimin-producing STEC were genotypically detected in four isolates: two isolates carried both stx1 and eae gene ( stx1+eae) with a proportion of (2/75, 2.67%) (95% CI: 0.32 – 9.63), one isolate carried both stx2 and eae genes ( stx2+eae) , and one isolate had combination of stx1 , stx2 and eae genes ( stx1 + stx2 + eae ), with a similar proportion (1/75, 1.33%) (95% CI: 0.03 – 7.21), in three genetic amalgamates. Of these pathogenic isolates, both the stx genes, stx1 only, and stx2 only genotypes were identified in 40 (4/10) and 10% (1/10), respectively. Intimin-producing STEC ( eae -STEC) were identified in 40% (4/10), with the following genotypes: stx1+eae (2/10, 20%), stx2+eae (1/10, 10%), and stx1+stx2+eae (1/10, 10%). Overall, the stx1 (9.33%) was the most detected gene, followed by the eae gene (6.67%) and the stx2 gene (4%). Pathogenic severity of STEC, eae- STEC, and EPEC Genotypically identified STEC, eae -STEC, and EPEC isolates create a wide range of diarrhoea in calves, depicted in Table 3. Among the diarrhoea types, 50% (5/10) were watery diarrhea, 40% bloody diarrhoea, and 10% (1/10) were diarrhoea with mucus. Intimin-producing STEC ( eae -STEC) harboring calves had bloody diarrhoea. Among the eae- STEC ( stx1 + stx2 + eae , stx1+ eae, and stx2 + eae ) was associated with very severe to severe bloody diarrhoea. Table 3 Virulent genes of pathogenic E. coli isolates and their sequelae of age-associated different diarrhoea types and mortality in diarrhoeic calves Sample ID Age (days) Types of diarrhoea manifested with fever in calves Mortality Fisher’s exact test (p-value) stx1 stx2 eae BD MD WD AS010 + - - 3 - - + + c - AB003 - + + 6 + + + b - - + AG027 - - + 4 - + + c - - AX049 + + + 5 + + + + a - - + AQ019 - + - 7 - - + + + b - <0.05 AM068 + - + 8 + + + b - - + AK056 + - - 2 - - + d - AT041 + - + 12 + + + b - - + AJ032 + - - 10 - - + + c - AV019 + - - 11 - - + + c - Types of diarrhoea: BD, bloody diarrhoea; MD, mucus diarrhoea; WD, watery diarrhoea; + + + + a , very severe; + + + b , severe; + + c , moderate; + d , mild. PCR results: + , present; - , absent. Mortality: + , yes; - , no. The sequelae of these affected calves with intimin-producing STEC were death in (4/4) (100%) calves, due to intolerable bloody diarrhoea and fluid loss. The Bloody diarrhoea with death occurred equally (2:2) in the 1 st week and 2 nd week of age. No bloody diarrhoea was experienced in calves carrying only stx1 or stx2- encoded isolates. However, they were clinically responsible for mild to moderate watery diarrhoea, whereas only the eae -encoded non-STEC isolate (EPEC) was accountable for mucus diarrhoea (dysentery). Fisher’s exact test disclosed a significant association between virulent gene profiles of E. coli and clinical outcomes such as diarrhoeal severity, mortality, and age of affected calves, with a p-value < 0.05. ESBL and carbapenemase gene carriage pathogenic E. coli isolates A total of 10 phenotypically confirmed (3 ESBL, 5 carbapenemase-producing, and 2 both ESBL and carbapenemase-producing) isolates carrying virulence genes (n = 10) ( stx / eae /both) were tested for the presence of the three most common ESBL genes ( bla TEM group, bla CTX-M group, and bla SHV group) and two carbapenemase genes ( bla KPC group and bla NDM group). Gel image of PCR products demonstrates the genetic determination of both gene groups in (Fig. 3), and gene frequencies are described in Table 4. Of these ESBL-positive isolates, 5 (50%) were confirmed to carry ESBL genes. Four of these isolates possessed bla TEM , and one of them carried bla SHV . Solely carbapenemase-producing isolates were not genetically verified in any virulent isolates. However, there were four isolates genetically identified to be both ESBL and carbapenemase producers. One of them carried bla TEM and bla KPC , two of them had bla TEM , bla CTX-M , bla KPC , and only one isolate had bla TEM , bla CTX-M , bla KPC , and bla NDM genes, the only isolate that carried the bla NDM gene. One isolate had none of the genes of ESBL and carbapenemase. Table 4 STEC and eae-STEC isolates harboring ESBL and carbapenemase-encoded genes Gene Types Genes Tested Frequency Percentage ESBL a (n = 5) (STEC b isolates) bla TEM 4 80% bla CTX-M 0 0% bla SHV 1 20% bla TEM and bla CTX-M 0 0% bla TEM , bla CTX-M , and bla SHV 0 0% Carbapenemase (n=0) bla KPC 0 0% bla NDM 0 0% bla NDM and bla KPC 0 0% Both ESBL and Carbapenemase (n=4) ( eae- STEC c isolates) bla TEM and bla KPC 1 25% bla TEM , bla CTX-M , bla KPC 2 50% bla TEM , bla CTX-M , bla KPC , bla NDM 1 25% ESBL a , extended-spectrum β-lactamase; STEC b , Shiga toxin-producing E. coli ; eae- STEC c , intimin-producing gene ( eae )-encoded STEC Antimicrobial resistance profile among ESBL and/or carbapenemase-producing STEC, eae- STEC, and EPEC The presence of the ESBL or carbapenemase or both ESBL and carbapenemase-producing genes among the virulence gene carriage isolates (STEC/ eae -STEC/EPEC) with combined drug-level and gene-level antimicrobial resistance patterns is illustrated in Fig. 4. All tested isolates were identified as multidrug-resistant, according to CLSI guidelines. The intimin-producing STEC carriage isolates ( eae -STEC) co-harboring both ESBL ( bla TEM / bla CTX-M / bla SHV ) and carbapenemase ( bla KPC / bla NDM ) genes were prominently resistant to antimicrobials tested. The stx1 +s tx2 + eae -positive isolate co-harboring bla TEM , bla CTX-M , bla KPC , and bla NDM genes, whereas one stx1 + eae isolate carrying bla TEM , bla CTX-M , and bla KPC genes, one stx1 + eae isolate having bla TEM and bla KPC genes, and one stx2 + eae isolate possessed bla TEM , bla CTX-M , and bla KPC genes, showing a chronological resistance pattern with 100%, 84.61%, 84.61% and 76.92%, respectively. Conversely, only STEC isolates, such as the stx1 - bla TEM isolate, showed an overall 71.79% resistance rate, whereas the stx2 - bla TEM isolate had only 53.53% resistance rate. One stx1 -harboring isolate co-existed with the bla SHV gene, demonstrating 61.53% resistance. Interestingly, only eae -encoded isolates without any ESBL/carbapenemase genes had the maximum susceptibility pattern (38.46%) and minimum resistance (46.15%). ESBL and carbapenemase-producing eae -STEC isolates were more likely to be multidrug-resistant (MDR) than ESBL-STEC isolates and the non-STEC EPEC isolate . The highest antimicrobial resistance rates were found in ciprofloxacin and meropenem (100%), nitrofurantoin and cefoxitin (90%), ampicillin, streptomycin, and trimethoprim-sulfamethoxazole (80%), chloramphenicol (70%), doxycycline, tetracycline, and cefotaxime (60%). In contrast, the lowest resistance rates were found in gentamycin (20%) and amoxicillin-clavulanate (40%). Geographical distribution of virulence, ESBL, and carbapenemase genes in E. coli isolates The distribution of virulence and resistance genes in E. coli isolates from diarrhoeic calves at different sampling zones is depicted in Fig. 5. Virulence-resistance genetic combination, stx1 + eae and stx2 + eae isolates with bla TEM , bla CTX-M , bla KPC genes, stx1 and stx2 isolates with bla TEM gene were found from Chattogram district. Stx1 / bla TEM , stx1 / bla SHV, and stx1 + eae / bla TEM + bla KPC virulence-resistance genes co-carriage isolates were recovered from Cox’s Bazar. Most importantly, stx1 + stx2 + eae / bla TEM +bla CTX-M + bla KPC + bla NDM genetically amalgamated isolates were detected from Cox’s Bazar. Chattogram and Cox’s Bazar covered 80% of the gene distribution. The remaining 20% was contributed from Noakhali district, with eae virulence factor without ESBL or carbapenemase genes (10%) and stx1 / bla TEM mixed isolate (10%). Discussion This study investigated the extent of STEC, eae -STEC, and EPEC in diarrhoeic calves as well as the consequent isolates’ capacity to produce extended-spectrum β-lactamase and carbapenemases. Cattle and small ruminants are natural reservoirs of E. coli (Persad et al. 2015). In this study, STEC isolates were detected in 12% diarrhoeic calves. These findings were matched with a recent study on diarrheic cattle in Egypt (Elmonir et al. 2021). Shiga toxin-producing gene stx1 (9.33%) was the most detected gene, followed by the eae gene (6.67%) of enteropathogenic E. coli and the stx2 gene with 4% isolates. This observation was similar to the previous study, where the highest gene prevalence was stx1 in humans (Karamna et al. 2019). Isolates with only the stx1 or stx2 gene were 6.67%. These findings were higher than those of previously published reports (1.9-4.1%) in the USA (Lambertini et al. 2015) and lower than the reports having (10.7-29.7%) from other countries (Momtaz et al. 2013; Ranjbar et al. 2018). However, different outcomes were also reported, where all of the E. coli tested negative for stx1, stx2, and eae genes (Dela et al. 2022). This study did not have any evidence about combinations of stx1 / stx2 genes among the isolates. This observation was different from the findings of another study in Bangladesh, where promising stx1 / stx2 combined genetic isolates were identified from livestock (Johura et al. 2017). The combination of stx / eae genes was observed in (5.33%) of E. coli isolates. This is the most relevant finding because it indicates that eae -encoded STECs are disseminating from diarrheic calves. Yet only one isolate (1.33%) consists solely of the eae gene among the E. coli isolates. These outcomes are lower than previously reported in China, where 9.5% E. coli isolates carried this gene (Yang et. al. 2020). Variations in gene distribution among our studies and previous studies can be due to different geographical regions, hosts, environmental determinants, personal and personnel hygiene in farms, different methodologies of sampling, and study designs. The eae gene of enteropathogenic E. coli (EPEC) is necessary for the robust attachment to the intestinal epithelial cells (Donnenberg et al. 1993). Moreover, the eae gene is responsible for encoding an outer membrane that mediates adhesion ability in STEC/EPEC to enterocytes (Aidar-Ugrinovich et al. 2007; Montsu et al. 2019). This indicates the eae genes associated with STEC isolates are more virulent. It suggests high pathogenicity concern among calves and is relevant to the findings of this study, where four stx / eae combined isolates in calves had bloody diarrhoea with death. The stx1 + stx2 + eae isolate was responsible for higher pathogenic severity than stx1 + eae or stx2 + eae combined isolates in calves (Table 2). This is due to the evolution of mobile genetic materials in microbes like plasmids and bacteriophages (Ahmed et al. 2008; Habets et al. 2022a). A study conducted in Italy reported the mixed isolates ( stx1 + eae and stx2 + eae ), where stx2 / eae combined isolates were more prevalent than stx1 / eae , from swine feces (Ecroli et al. 2016). These findings create public health concerns because previous scientific reports in South Africa (Karama et al. 2019) and Sweden (Hua et al. 2020) have implicated eae- encoded STEC isolates in severe human diseases. A significant link was found between diarrhoeic calves and humans, where the stx1 / stx2 / eae genes are combined or individually responsible for different types of diarrhoea (Faikh et al. 2017; Belete et al. 2022; Habets et al. 2022b). These STEC, intimin-producing STEC ( eae -STEC), and EPEC ( eae ) isolates were recognized as 10/10 (100%) multidrug-resistant, showing 100% resistance to meropenem and ciprofloxacin when tested by disk diffusion according to CLSI guidelines. These results led the authors to further investigate the patterns of ESBL and carbapenemase production through phenotypic and genotypic verification. Five ESBL-producing STEC isolates were detected. Of these ESBL-positive isolates, three isolates possessed (30%) stx1 / bla TEM , one isolate had (10%) stx1 / bla SHV, and one isolate (10%) was detected as the stx2 / bla TEM genetic combination. These observations agree with the respective previous study conducted in Egypt and England, where the bla TEM gene was predominant among the STEC isolates (Krüger et al. 2015; Day et al. 2015). However, other studies with E. coli isolates reported in Ethiopia (Seman et al. 2022) and Portugal (Freire et al. 2023), where the bla CTX-M gene was predominant. The bla TEM genes encode for narrow-spectrum β-lactamases (NSBLs) to ESBLs to confer resistance against penicillin and sometimes cephalosporines. Conversely, bla CTX-M genes encode the enzymes that neutralize third-generation cephalosporines (Kim et al. 2005). The ESBL genes ( bla TEM , bla CTX-M , and bla SHV ) were detected in the USA, North America, Europe, Asia, and Africa from fecal samples of cattle (Palmeira and Ferreira 2020). The STEC containing bla TEM showed 100% phenotypic resistance to ampicillin, cefoxitin, meropenem, and ciprofloxacin, followed by 75% resistance to cefotaxime and 50% resistance to tetracycline, doxycycline, and sulfamethoxazole-trimethoprim. Comparable studies in Iran were previously reported (Momtaz et al. 2013; Ranjbar et al. 2018). The bla CTX-M and carbapenemase genes ( bla KPC , bla NDM ) were not detected in solely Shiga toxin-producing isolates. Interestingly, all intimin-producing STEC ( stx / eae ) isolates (4/4, 100%) coexisted with both ESBL and carbapenemase-producing genes, which is in agreement with the study conducted in South Africa (Codjoe et al. 2017). The stx1 + stx2 + eae virulence isolate (ID AX049) carried bla TEM , bla CTX-M , bla KPC, and bla NDM resistance genes and showed resistance to all antimicrobials (100%). In contrast, stx1 + eae / bla TEM + bla KPC (ID AT041), stx1 + eae / bla TEM + bla CTX-M + bla KPC (ID AM068) gene carriage isolates exhibited 84.61% drug-resistance rate, whereas the stx2 + eae / bla TEM + bla CTX-M + bla KPC isolate (ID AB003) displayed 79.6% resistance rate. Gentamycin is the only susceptible drug in the stx1 + eae / bla TEM + bla KPC isolate, among intimin-producing STEC isolates. However, these resistant genes were also identified from humans, where bla NDM was predominant in India (Manohar et al. 2017) and bla KPC in Egypt (El-Shaer et al. 2021). Different distribution rates of ESBL and carbapenemase genes have been documented across various studies, a phenomenon potentially attributable to disparities in management practices, host reservoirs, feeding habits, sanitation, and human migration (Bevan et al. 2017). Carbapenem drugs are not approved for veterinary treatment, so carbapenem resistance is not commonly tested in animal practices in Bangladesh. However, meropenem has been approved for use in human treatment (Taggar et al. 2020). This is a matter of concern that horizontal transfer of these ESBL and carbapenemase genes among the bacteria can be a high public health issue. Because a study previously reported that the IncX3 plasmid encodes bla CTX-M , bla TEM , bla SHV , bla KPC, and bla NDM in E. coli and is responsible for gene transfer (Ramírez-Castillo et al. 2023). Diarrheic calves are a significant potential source of Shiga toxin-producing E. coli (STEC) and intimin-producing STEC ( eae -STEC) isolates, and only eae -encoded EPEC isolates. This study underscores the zoonotic risk of virulence genes, which may also possess ESBL or both ESBL and carbapenemase-producing genes, hence significantly enhancing resistance against prevalent antimicrobials used in veterinary and human clinics. Combined virulence gene carriage isolates ( stx1 / stx2 / eae ), especially the stx1 + stx2 + eae genotypic isolate, were positive for all the ESBL and carbapenemase genes tested in this study and resistant to all the antimicrobials tested. These genes can be passed on to the next generation of bacteria, making them more resistant and resulting in the development of superbugs (Bevan et al. 2017; García et al. 2020). These will lead to prolonged admissions to hospitals, increased treatment costs, and death in some cases (Van Duin et al. 2016). Conclusion The combination of virulence and resistance genetic profiling among STEC and eae- STEC isolates co-existing ESBL and carbapenemase genes from diarrheic calves highlights the probable potential risk of intra or interspecies cross-transmission of these genes, pressing public health issues, as people are directly or indirectly in contact with calves and dairy farms through the One Health interface. There are two-fold public health risks: a) zoonotic transmission of virulence genes, poses an immediate source of severe diseases; b) dissemination of ESBL and carbapenemase genes, as virulence isolates may carry these antibiotic-neutralizing enzymes. Therefore, this study recommends a continuous surveillance system and preventive measures to reduce zoonotic transmission and spread of antibiotic resistance, as MDR-STEC was previously identified in sheep from Bangladesh (Gupta et al. 2022). Declarations Funding declaration : This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Declarations of interest: non Author Contribution Plabon Ketan Barua: Conceptualization, Methodology, Software, Formal analysis, Data curation, Writing-Original draft preparation, Visualization Uaye Mya: Methodology, Investigation, Writing—Original draft preparation. Partha Paul: Methodology, Investigation. Snigdha Das: Methodology, Investigation. Mukta Das Gupta: Conceptualization, Validation, Resources, Writing—Original Draft, Writing—Review & Editing, Supervision, Project administration. Ashutosh Das: Conceptualization, Software, Formal analysis, Data curation, Validation, Resources, Writing - Original Draft, Writing - Review & Editing, Visualization, Supervision, Project administration. References Ahmed N, Dobrindt U, Hacker J, Hasnain SE (2008) Genomic fluidity and pathogenic bacteria: applications in diagnostics, epidemiology, and intervention. Nat Rev Microbiol 6(5): 387–394. https://doi.org/10.1038/nr micro1889 Aidar-Ugrinovich L, Blanco J, Blanco M, Blanco JE, Leomil L, Dahbi G, Mora A, Onuma DL, Silveira WD, de Catro AP (2007) Serotypes, virulence genes, and intimin types of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) isolated from calves in São Paulo, Brazil. Int J Food Microbiol 115(3): 297–306. https://doi.org/10.1016/j.ijfoodmicro.2 006.10.046 Bauer AW, Kirby WM, Sherris JC, Turck M (1966) Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 45: 493–496. Belete MA, Demlie TB, Chekole WS, Tessema TS (2022) Molecular identification of diarrheagenic Escherichia coli pathotypes and their antibiotic resistance patterns among diarrheic children and in contact calves in Bahir Dar city, Northwest Ethiopia. PLoS One 17 (9): e0275229. https://doi.org/10.1371/journal.pone.0275229 Bevan ER, Jones AM, Hawkey PM (2017) Global epidemiology of CTX-M β-lactamases: temporal and geographical shifts in genotype. J Antimicrob Chemother 72(8): 2145–2155. https://doi.org/10.1093/jac/dkx146 Bhat MA, Nishikawa Y, Wani SA (2008) Prevalence and virulence gene profiles of Shiga toxin-producing Escheric hia coli and enteropathogenic Escherichia coli from diarrhoeic and healthy lambs in India. Small Ruminant Res 75: 65–70. https://doi.org/10.1016/j.smallrumres.2007.08.006 Caprioli A, Tozzoli R, Morabito S, Strockbine NA (2012) Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol 50(9): 2951–2963. https://doi.org/10.1128/jcm.00860-12 Chowdhury MSR, Hossain H, Rahman MN, Rahman A, Ghosh PK, Uddin MB, Nazmul Hoque M, Hossain MM, Rahman MM (2025) Emergence of highly virulent multidrug and extensively drug-resistant Escherichia coli and Klebsiella pneumoniae in buffalo subclinical mastitis cases. Sci Rep 15(1): 11704. https://doi.org/ 10.1038/s41598-025-95914-x Clinical and Laboratory Standards Institute (CLSI) (2023) Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed. CLSI supplement M100. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Codjoe FS, Donkor ES (2017) Carbapenem resistance: a review. Med Sci 6(1): https://doi.org/10.3390/medsci60100 01 Constable PD, Blood DC, Radostits OM (2017) Veterinary medicine: A textbook of the diseases of cattle, horses, sheep, pigs, and goats, 11th edn. Elsevier, St. Louis, pp 2045-2050. Day M, Doumith M, Jenkins C, Dallman TJ, Hopkins KL, Elson R, Godbole G, Woodford N (2016) Antimicrobial resistance in Shiga toxin-producing Escherichia coli serogroups O157 and O26 isolated from human cases of diarrhoeal disease in England. J Antimicrob Chemother 72(1): 145–152. https://doi.org/10.1093/jac/dkw 371 Dela H, Egyir B, Majekodunmi AO, Behene E, Yeboah C, Ackah D, Addo KK (2022) Diarrhoeagenic E. coli occurrence and antimicrobial resistance of extended-spectrum beta-lactamases isolated from diarrhoea patients attending health facilities in Accra, Ghana. PLoS One 17(5): e0268991. https://doi.org/10.1371/journal.pon e.0268991 Desrosiers A, Fairbrother JM, Johnson RP, Desautels C, Letellier A, Quessy S (2001) Phenotypic and genotypic characterization of Escherichia coli verotoxin-producing isolates from humans and pigs. J Food Prot 84(12): 1904–1911. https://doi.org/10.4315/0362-028X-64.12.1904 Donnenberg MS, Tacket CO, James SP, Losonsky G, Nataro JP, Wasserman SS, Kaper JB, Levine MM (1993) Role of the eaeA gene in experimental enteropathogenic Escherichia coli infection. J Clin Invest 92(3): 1412–1417. Elafify M, Khalifa HO, Al-Ashmawy M, Elsherbini M, El Latif AA, Okanda T, Matsumoto T, Koseki S, Abdelkhalek A (2020) Prevalence and antimicrobial resistance of Shiga toxin-producing Escherichia coli in milk and dairy products in Egypt. J Environ Sci Health B 55(3): 265–272. https://doi.org/10.1080/03601234.2019.1 686312 Elmonir W, Shalaan S, Tahoun A, Mahmoud SF, Remela EMA, Eissa R, El-Sharkawy H, Shukry M, Zahran RN (2021) Prevalence, antimicrobial resistance, and genotyping of Shiga toxin-producing Escherichia coli in foods of cattle origin, diarrheic cattle, and diarrheic humans in Egypt. Gut Pathogens 13(1): 8. https://doi.or g/10.1186/s13099-021-00402-y El-Shaer S, Abdel-Rhman SH, Barwa R, Hassan R (2021) Genetic characterization of extended spectrum β-lactamase and carbapenemase-producing Escherichia coli isolated from Egyptian hospitals and environments. PLoS One 16(7): e0255219. https://doi.org/10.1371/journal.pone.0255219 Ercoli L, Farneti S, Zicavo A, Mencaroni G, Blasi G, Striano G, Scuota S (2016) Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy. Int J Food Microbiol 232: 7–14. https://doi.org/10.1016/j.ijfoodmicro.2016.05.002 Fakih I, Thiry D, Duprez JN, Saulmont M, Iguchi A, Piérard D, Jouant L, Daube G, Ogura Y, Hayashi T, Taminiau B, Mainil JG (2017) Identification of Shiga toxin-producing (STEC) and enteropathogenic (EPEC) Escherichia coli in diarrhoeic calves and comparative genomics of O5 bovine and human STEC. Vet Microbiol 202: 16–22. https://doi.org/10.1016/j.vetmic.2016.02.017 Freire S, Grilo T, Rodrigues B, Oliveira R, Esteves C, Marques A, Poirel L, Aires-de-Sousa M (2023) ESBL and carbapenemase-producing Escherichia coli and Klebsiella pneumoniae among bivalves from Portuguese shellfish production areas. Microorganisms 11(2): 415. https://doi.org/10.3390/microorganisms11020415 García J, García-Galán MJ, Day JW, Boopathy R, White JR, Wallace S, Hunter RG (2020) A review of emerging organic contaminants (EOCs), antibiotic resistant bacteria (ARB), and antibiotic resistance genes (ARGs) in the environment: Increasing removal with wetlands and reducing environmental impacts. Bioresour Technol 307: 123228. https://do i.org/10.1016/j.biortech.2020.123228 Ghatak S, Singha A, Sen A, Guha C, Ahuja A, Bhattacharjee U, Das S, Pradhan NR, Puro K, Jana C, Dey TK (2013) Detection of New Delhi Metallo-beta-Lactamase and Extended-Spectrum beta-Lactamase Genes in Escherichia coli Isolated from Mastitic Milk Samples. Transbound Emerg Dis 60(5): 385–389. https://doi.org/10.1111/tbed.12119 Gupta MD, Das A, Islam MZ, Biswas PK (2016) Prevalence of sorbitol non-fermenting Shiga toxin-producing Esc herichia coli in Black Bengal goats on smallholdings. Epidemiol Infect 144(12): 2501–2508. https://doi.org/10.1017/S0950268816001047 Gupta MD, Sen A, Shaha M, Dutta A, Das A (2022) Occurrence of Shiga toxin-producing Escherichia coli carrying antimicrobial resistance genes in sheep on smallholdings in Bangladesh. Vet Med Sci 8: 2616–2622. https://doi.org/10.1002/vms3.935 Habets A, Antoine C, Wagemans J, Vermeersch M, Laforêt F, Diderich J, Lavigne R, Mainil J, Thiry D (2022a) Impact of Shiga-toxin encoding gene transduction from O80:H2 Shiga toxigenic Escherichia coli (STEC) on non-STEC strains. Sci Rep 12(1):21587. https://doi.org/10.1038/s41598-022-26198-8 Habets A, Touzain F, Lucas P, Huong NTT, Iguchi A, Crombé F, Korsak N, Piérard D, Saulmont M, Cox E, Engelen F, Mainil J, Thiry D (2022b) Identification of five serotypes of enteropathogenic Escherichia coli from diarrheic calves and healthy cattle in Belgium and comparative genomics with shigatoxigenic E. coli . Vet Sci 9(12): 692. https://doi.org/10.3390/vet sci9090492 Hua Y, Bai X, Zhang J, Jernberg C, Chromek M, Hansson S, Frykman A, Yang X, Xiong Y, Wan C, Matussek A (2020) Molecular characteristics of eae-positive clinical Shiga toxin-producing Escherichia coli in Sweden. Emerg Microbes Infect 9(1): 2562–70. https://doi.org/10.1080/22221751.2020.1850182 Islam MA, Heuvelink AE, De Boer E, Sturm PD, Beumer RR, Zwietering MH, Faruque ASG, Haque R, Sack DA, Talukder KA (2007) Shiga toxin-producing Escherichia coli isolated from patients with diarrhoea in Bangladesh. J Med Microbiol 56(3): 380–385. https://doi.org/10.1099/jmm.0.46916-0 Jerse AE, Yu J, Tall BD, Karper JB (1990) A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA 87: 7839–7843. https://doi.org/10.1073/pnas.87.20.7839 Johura FT, Parveen R, Islam A, Sadique A, Rahim MN, Monira S, Khan AR, Ahsan S, Ohnishi M, Watanabe H, Chakraborty S (2017) Occurrence of hybrid Escherichia coli strains carrying Shiga toxin and heat-stable toxin in livestock of Bangladesh. Front Public Health 4: 287. https:// doi.org/10.3389/fpubh.2016.00287 Kaper JB, O’Brien AD (2014) Overview and historical perspectives. In: Sperandio V, Hovde CJ (eds) Enterohemorrhagic Escherichia coli and other Shiga toxin-producing E. coli . ASM Press, Washington, pp 3–13. https://doi.org/10.1128/microbiolspec.ehec-0028-2014 Kaper JB, Elliott S, Sperandio V, Perna NT, Mayhew GF, Blattner FR (1998) Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In: Kaper JB, O'Brien AD (eds) Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, pp 163–182. Karama M, Mainga AO, Cenci-Goga BT, Malahlela M, El-Ashram S, Kalake A (2019) Molecular profiling and antimicrobial resistance of Shiga toxin-producing Escherichia coli O26, O45, O103, O121, O145, and O157 isolates from cattle on cow-calf operations in South Africa. Sci Rep 9(1): 11930. https://doi.org/10.1038/s41598-019-47948-1 Khan ER, Aung MS, Paul SK, Ahmed S, Haque N, Ahamed F, Sarkar SR, Roy S, Rahman MM, Mahmud MC, Hossain MA (2018) Prevalence and molecular epidemiology of clinical isolates of Escherichia coli and Klebsiella pneumoniae harboring extended-spectrum beta-lactamase and carbapenemase genes in Bangladesh. Microb Drug Resist 24(10): 1568–1579. https://doi.org/10.1089/mdr.2018.0063 Kim YR, Kim SI, Lee JY, Park YJ, Lee KY, Kang MW (2005) Nosocomial Transmission of CTX-M-15 and OXA30 β-lactamase-producing Escherichia coli in a neurosurgical intensive care unit. Ann Clin Lab Sci 35(3): 297–301. Köck R, Daniels-Haardt I, Becker K, Mellmann A, Friedrich AW, Mevius D, Schwarz S, Jurke A (2018) Carbapenem resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: a systematic review. Clin Microbiol Infect 24(12): 1241–1250. https://doi.or g/10.1016/j.cmi.2018.04.004 Konno T, Yatsuyanagi J, Takahashi S, Kumagai Y, Wada E, Chiba M, Saito S (2012) Isolation and identification of Escherichia albertii from a patient in an outbreak of gastroenteritis. Jpn J Infect Dis 65(3): 203–207. https://doi.org/10.7883/yoken.65.203 Krüger A, Lucchesi PM, Sanso AM, Etcheverría AI, Bustamante AV, Burgán J, Fernández L, Fernández D, Leotta G, Friedrich AW, Padola NL (2015) Genetic characterization of Shiga toxin-producing Escherichia coli O26:H11 strains isolated from animal, food, and clinical samples. Front Cell Infect Microbiol 5: 74. https://doi.org/10.3389/fcimb.2015.00074 Lambertini E, Karns JS, Van Kessel JAS, Cao H, Schukken YH, Wolfgang DR, Smith JM, Pradhan AK (2015) Dynamics of Escherichia coli virulence factors in dairy herds and farm environments in a longitudinal study in the United States. Appl Environ Microbiol 81(13): 4477–4488. https://doi.org/10.1128/AEM.00465-15 Manna S, Brahmane M, Das R, Chandana M, Batabyal S (2006) Detection of Escherichia coli O157 in foods of animal origin by culture and multiplex polymerase chain reaction. J Food Sci Tech 43(1): 77–79. https://cabidigitallibrary.org/doi/full/10.5555/20063012345 Manohar P, Shanthini T, Ayyanar R, Bozdogan B, Wilson A, Tamhankar AJ, Nachimuthu R, Lopes BS (2017) The - distribution of carbapenem-and colistin-resistance in Gram-negative bacteria from the Tamil Nadu region in India. J Med Microbiol 66(7): 874–883. https://doi.org/10.1099/jmm.0.000508 Melton-Celsa AR (2014) Shiga toxin (Stx) classification, structure and function. Microbiol Spectr 2(4): 10-128. https://doi.org/10.1128/microbiolspec.ehec-0024-2013 Mir RA, Kudva IT (2019) Antibiotic-resistant Shiga toxin-producing Escherichia coli : an overview of prevalence and intervention strategies. Zoonoses Public Health 66(1): 1–13. https://doi.org/10.1111/zph.12533 Mohammed Y, Gadzama GB, Zailani SB, Aboderin AO (2016) Characterization of extended-spectrum beta-lactamase from Escherichia coli and Klebsiella species from North Eastern Nigeria. J Clin Diagn Res 10(2): DC07. https://doi.org/10.7860/JCDR/2016/16330.7254 Momtaz H, Dehkordi FS, Rahimi E, Ezadi H, Arab R (2013) Incidence of Shiga toxin-producing Escherichia coli serogroups in ruminant's meat. Meat Sci 95(2): 381–388. https://doi. org/10.1016/j.meatsci.2013.04.051 Montso PK, Mlambo V, Ateba CN (2019) The first isolation and molecular characterization of Shiga toxin-producing virulent multidrug-resistant atypical enteropathogenic Escherichia coli O177 serogroup from South African Cattle. Front Cell Infect Microbiol 9: 333. https://doi.org/10.3389/fcimb.2019.00333 Moxley RA, Smith DR (2010) Attaching-effacing Escherichia coli infections in cattle. Vet Clin North Am Food Anim Pract 26(1): 29–56. https://doi.org/10.1016/j.cvfa.2009.10.011 Mughini Gras L, Van Pelt W, Van der Voort M, Heck M, Friesema I, Franz E (2018) Attribution of human infections with Shiga toxin-producing Escherichia coli (STEC) to livestock sources and identification of source-specific risk factors, The Netherlands (2010–2014). Zoonoses Public Health 65(1): e8–22. https://doi.org/10.1111/zph.12403 Murugan MS, Sinha DK, Kumar OV, Yadav AK, Pruthvishree BS, Vadhana P, Nirupama KR, Bhardwaj M, Singh B R (2019) Epidemiology of carbapenem-resistant Escherichia coli and first report of blaVIM carbapenemases gene in calves from India. Epidemiol Infect 147: e159. https://doi.org/10.1017/S0950268819000463 Nada HG, El-Tahan AS, El-Didamony G, Askora A (2023) Detection of multidrug-resistant Shiga toxin-producing Escherichia coli in some food products and cattle faeces in Al-Sharkia, Egypt: one health menace. BMC Microbiol 23(1): 127. https://doi.org/10.1186/s12866-023-02873-2 Nagel S, Spüler M (2019) World’s fastest brain–computer interface: combining EEG2Code with deep learning. PLoS One 14(9): e0221909. https://doi.org/10.1371/journal.pone.0221909 Nahar A, Islam AA, Islam MN, Khan MK, Khan MS, Rahman AA, Alam MM (2023) Molecular characterization and antibiotic resistance profile of ESBL-producing Escherichia coli isolated from healthy cow raw milk in smallholder dairy farms in Bangladesh. Vet World 16 (6): 1333. https://doi.org/10.14202/vetworld.2023. 1333-1339 Palmeira JD, Ferreira HMN (2020) Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in cattle production–a threat around the world. Heliyon 6 (1). https:// doi.org/10.1016/j.heliyon.2020.e03206 Paton JC, Paton AW (1998) Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev 11: 450–479. https://doi.org/10.1128/cmr.11.3.450 Persad AK, Lejeune JT (2015) Animal reservoirs of Shiga toxin-producing Escherichia coli . In: Hovde CJ, Sperandio V (eds) Enterohemorrhagic Escherichia coli and other Shiga toxin-producing E. coli . ASM Press, Washington, pp 211–230. https://doi.org/10.1128/9781555 818791.ch11 Pierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB, Bobenchik AM, Lockett ZC, Charnot-Katsikas A, Ferraro MJ, Thomson RB, Jenkins SG, Limbago BM, Das S (2017) Modified Carbapenem Inactivation Method for Phenotypic Detection of Carbapenemase Production among Enterobacteriaceae. J Clin Microbiol 55(8): 2321-33. https:// doi.org/10.1128/jcm.00193-17 Poirel L, Walsh TR, Cuvillier V, Nordmann P (2011) Multiplex PCR for the detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 70(1): 119–123. https://doi.org/10.1016/j.diag microbio.2010.12.002 Ranjbar R, Safarpoor Dehkordi F, Sakhaei Shahreza MH, Rahimi E (2018) Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products. Antimicrob Resist Infect Control 7(1): 53. https://doi. org/10.1186/s13756-018-0345-x Ramírez-Castillo FY, Guerrero-Barrera AL, Avelar-González FJ (2023) An overview of carbapenem-resistant organisms from food-producing animals, seafood, aquaculture, companion animals, and wildlife. Front Vet Sci 10: 1158588. https://doi.org/10.3389/fvets.2023.1158588 Seman A, Mihret A, Sebre S, Awoke T, Yeshitela B, Yitayew B, Aseffa A, Asrat D, Abebe T (2022) Prevalence and molecular characterization of extended spectrum β-Lactamase and carbapenemase-producing Enterobacteriaceae isolates from bloodstream infection suspected patients in Addis Ababa, Ethiopia. Infect Drug Resist 1: 1367–1382. https://doi.org/10.2147/IDR.S349566 Taggar G, Attiq Rheman M, Boerlin P, Diarra MS (2020) Molecular epidemiology of carbapenemases in Enterobacteriales from humans, animals, food, and the environment. Antibiotics 9(10): 693. https://doi.org/10.3390/anti biotics9100693 Van Duin D, Paterson DL (2016) Multidrug-resistant bacteria in the community: trends and lessons learned. Infect - Dis Clin 30(2): 377–390. https://doi.org/10.1016/j.idc.2016.02.004 Wani SA, Bhat MA, Samanta I, Nishikawa Y, Buchh AS (2003) Isolation and characterization of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) from calves and lambs with diarrhoea in India. Lett Appl Microbiol 37: 121–126. https:// doi.org/10.1046/j.1472-765X.2003.01364.x World Health Organization (2019) Shiga toxin-producing Escherichia coli (STEC) and food: attribution, characterization, and monitoring. World Health Organization, Geneva. Yang X, Bai X, Zhang J, Sun H, Fu S, Fan R, Xiong Y (2020) Escherichia coli strains producing a novel Shiga toxin 2 subtype circulates in China. Int J Med Microbiol 310(1): 151377. https://doi.org/10.1016/j.ijmm.2019.1 51377 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 30 Apr, 2026 Read the published version in Veterinary Research Communications → Version 1 posted Editorial decision: Revision requested 23 Jan, 2026 Reviews received at journal 23 Jan, 2026 Reviews received at journal 16 Jan, 2026 Reviews received at journal 14 Jan, 2026 Reviewers agreed at journal 13 Jan, 2026 Reviewers agreed at journal 12 Jan, 2026 Reviewers agreed at journal 08 Jan, 2026 Reviewers invited by journal 08 Jan, 2026 Editor assigned by journal 06 Jan, 2026 Submission checks completed at journal 06 Jan, 2026 First submitted to journal 03 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8510259","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":571746840,"identity":"e0cbdf8e-6f83-4212-810c-8b8aa0473f36","order_by":0,"name":"Plabon Ketan Barua","email":"","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":false,"prefix":"","firstName":"Plabon","middleName":"Ketan","lastName":"Barua","suffix":""},{"id":571746847,"identity":"44f34af2-af4a-432c-8bea-b43e0865c229","order_by":1,"name":"Uaye Mya","email":"","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":false,"prefix":"","firstName":"Uaye","middleName":"","lastName":"Mya","suffix":""},{"id":571746853,"identity":"62ec001e-92ee-4b2d-81cb-6aa530b7d5a7","order_by":2,"name":"Partha Paul","email":"","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":false,"prefix":"","firstName":"Partha","middleName":"","lastName":"Paul","suffix":""},{"id":571746860,"identity":"70782457-0a8f-405c-9e87-cecc0ebface4","order_by":3,"name":"Snigdha Das","email":"","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":false,"prefix":"","firstName":"Snigdha","middleName":"","lastName":"Das","suffix":""},{"id":571746863,"identity":"59471c56-2811-4f89-a6b2-47451d0df308","order_by":4,"name":"Mukta Das Gupta","email":"","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":false,"prefix":"","firstName":"Mukta","middleName":"Das","lastName":"Gupta","suffix":""},{"id":571746865,"identity":"201b64ce-e49f-4977-8c00-120fe6293a6e","order_by":5,"name":"Ashutosh Das","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYDCCAwwMzECKh429AcwgXosMH88BErXYyEkkEKmF7/bhx58L24AOk3xj+LmgwoaBv707Aa8WyXNpZtIzQVqkc4ylZ5xJY5A4c3YDXi0GZxjMmHkhWgykedsOMxhI5BLSwv75M1iL5Bnj30Rq4QEZDtQiwWNGnC2SZ3jKpHnOAbXwpJVZ85xJ4yHoF74z7Js/85Qx2Mu3H958m6fCRo6/vRe/Fij4D8QcBiAWDzHKYYD9ASmqR8EoGAWjYAQBAIhROx2qSleQAAAAAElFTkSuQmCC","orcid":"","institution":"Chittagong Veterinary and Animal Sciences University","correspondingAuthor":true,"prefix":"","firstName":"Ashutosh","middleName":"","lastName":"Das","suffix":""}],"badges":[],"createdAt":"2026-01-04 04:38:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8510259/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8510259/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11259-026-11203-6","type":"published","date":"2026-04-30T15:58:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":100022986,"identity":"6d924dfc-ea28-471b-b2b1-0a34282b1a7f","added_by":"auto","created_at":"2026-01-12 08:10:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1874270,"visible":true,"origin":"","legend":"","description":"","filename":"BaruaetalmanuscriptsubmittedbyAshutoshDas.docx","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/775b7009f7d4a1295a6ad316.docx"},{"id":100022908,"identity":"44bdaf37-96c7-4559-bf43-c956d67415e8","added_by":"auto","created_at":"2026-01-12 08:10:41","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9473,"visible":true,"origin":"","legend":"","description":"","filename":"abaa4ff6d3f54b94befd4d057e618554.json","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/85e1e26219528e0fe4af3900.json"},{"id":100362636,"identity":"1235d1a4-d886-4ec0-885c-9895ab4c9c85","added_by":"auto","created_at":"2026-01-16 07:47:47","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":218356,"visible":true,"origin":"","legend":"","description":"","filename":"abaa4ff6d3f54b94befd4d057e6185541enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/9e8e478d3fd08610342d1022.xml"},{"id":100022903,"identity":"b59da284-92b7-4e7d-b3ac-cd4e270afe4a","added_by":"auto","created_at":"2026-01-12 08:10:40","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1216748,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/a95cd898b393c4ab2c664f74.jpeg"},{"id":100022952,"identity":"312c9e75-5d2c-4aa3-b235-eddbfb927843","added_by":"auto","created_at":"2026-01-12 08:10:44","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48826,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/7785711b8de91ee2eae542d1.jpeg"},{"id":100022962,"identity":"15bb4db9-4b31-4576-a7b4-cebd47bf105d","added_by":"auto","created_at":"2026-01-12 08:10:47","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57162,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/3223ef6e1de68764e65c1752.jpeg"},{"id":100022910,"identity":"0c2269b4-8ea6-4f63-8653-ba081f66a63c","added_by":"auto","created_at":"2026-01-12 08:10:41","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114279,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/d454b02d0788d45094088b20.jpeg"},{"id":100022948,"identity":"c644cf20-376e-46dc-9870-7bcdf147eca5","added_by":"auto","created_at":"2026-01-12 08:10:43","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":63795,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/8c9455301f67f1ec54453cdf.jpeg"},{"id":100022894,"identity":"54afd732-868b-42c1-9b8f-881949a2e135","added_by":"auto","created_at":"2026-01-12 08:10:33","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":247127,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/5532f22ab7aa0e4118e6b7ff.png"},{"id":100022959,"identity":"5a53c6da-23e3-4d54-a64a-3d2db4b7a686","added_by":"auto","created_at":"2026-01-12 08:10:44","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19308,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/0d48dbe47b2221d1f095c7a2.png"},{"id":100022957,"identity":"c09b73b4-ab97-44bc-8271-45faeb2f7861","added_by":"auto","created_at":"2026-01-12 08:10:44","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41750,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/c87cc70e113872c975c29a05.png"},{"id":100022922,"identity":"13df6b52-b906-4b9d-b461-b03d9da75153","added_by":"auto","created_at":"2026-01-12 08:10:42","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69274,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/30cde48af86e791dacf7894c.png"},{"id":100022946,"identity":"2839fb37-5705-45ce-9ba5-bc066d34dabe","added_by":"auto","created_at":"2026-01-12 08:10:42","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32429,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/1fc477d43e90cbe280973305.png"},{"id":100022898,"identity":"b4946b02-5ea5-4ff8-a221-79ff75549b2e","added_by":"auto","created_at":"2026-01-12 08:10:39","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":209468,"visible":true,"origin":"","legend":"","description":"","filename":"abaa4ff6d3f54b94befd4d057e6185541structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/3b8d700e9c99b7cfdc2a2079.xml"},{"id":100022947,"identity":"0bd06976-5c9a-45ca-a224-a1dd97c3703a","added_by":"auto","created_at":"2026-01-12 08:10:43","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":242753,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/87a52798a73c5ecb4622397b.html"},{"id":100022960,"identity":"238312c6-bbce-465c-9dbd-539e17ac4287","added_by":"auto","created_at":"2026-01-12 08:10:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":580761,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of PCR assay for housekeeping (adk) gene and three virulent genes: stx1, stx2, and eae. (A) adk gene (590 bp) amplicon; lane M = 1 kb plus DNA ladder; P = positive control; N = negative control; L1 – L5, adk-positive isolates; (B) stx1 gene (614 bp) amplicon size: lane M = 1 kb plus DNA ladder; P = positive control; N = negative control; L1 – L7, stx1-positive isolates; (C) stx2 gene (779 bp) amplicon; M = 1 kb plus DNA ladder; P = positive control; N = negative control; L1 – L3, stx2-positive isolates; (D) eaegene (479 bp) amplicon; M = 1 kb plus DNA ladder; P = positive control; N = negative control; L1 – L5, eae-positive isolates.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/a33bfcf47429ea85c85a207b.png"},{"id":100022954,"identity":"4d897f6f-f984-4db2-b27c-017b86e8eaec","added_by":"auto","created_at":"2026-01-12 08:10:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":236384,"visible":true,"origin":"","legend":"\u003cp\u003eDepicts Agresti-Coull binomial proportion test with a 95% ‘Confidence Interval’ (CI) in a bar plot for \u003cem\u003eE. coli\u003c/em\u003e virulence genes combination in diarrheic claves. Specific color indicates specific virulent gene line, and the perpendicular black straight lines across each bar demonstrate the 95% CI.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/1711b215c01f3f5d4df80854.png"},{"id":100022956,"identity":"3e101050-5e9c-4c81-b03d-a2c38db17ef7","added_by":"auto","created_at":"2026-01-12 08:10:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":187037,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of ESBL and carbapenemase genes carriage virulent (stx/eae/both) isolates, (a) Gel image of ESBL gene PCR amplification; (b) Gel image of carbapenemase gene, bla\u003csub\u003eKPC\u003c/sub\u003e; (c) Gel image of carbapenemase gene, bla\u003csub\u003eNDM\u003c/sub\u003e; PC, positive control; NC, negative control; DNA ladder, 100 bp. The isolates’ id no: AX049, AB003, AT041, AJ032, AG027, AS010, AM068, AQ019, AV019, AK056 indicates different virulent isolates described in Table 3.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/0a54b0de89b8ae88d3c55578.png"},{"id":100022912,"identity":"e4d98946-812b-4b01-86d3-259518ba2389","added_by":"auto","created_at":"2026-01-12 08:10:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":408858,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap illustrating antimicrobial resistance patterns in STEC and eae-STEC isolates co-existing ESBL and/or carbapenemase-encoded genes. Drug level resistance and gene-level resistance are showing at X-axis and the right Y-axis, respectively.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/20f2881702d304828f1aeae0.png"},{"id":100362061,"identity":"aab16af3-e49d-4a1d-8794-dc372e33d1f4","added_by":"auto","created_at":"2026-01-16 07:46:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":239381,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of virulence and resistance gene (ESBL and carbapenemase) profiles in calf-originated Escherichia coli isolates in three different districts in Bangladesh\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/3556224131587c6239e1bcac.png"},{"id":108437947,"identity":"f6b8ad91-e71f-4b07-b9e1-e15f439ceee9","added_by":"auto","created_at":"2026-05-04 16:04:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2233556,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8510259/v1/fbbeec1d-ffd0-4e76-b113-6333514e20da.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genotypic Evidence of Extended-spectrum β-lactamase and Carbapenemase-producing Shigatoxigenic and Intimin-producing Shigatoxigenic Multidrug-resistant Escherichia coli from Diarrheic Calves: Hidden Zoonotic and Public Health Risk","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e strains mainly act as intestinal commensals in animals and humans; some strains can cause a wide range of self-limiting to life-threatening intestinal diseases in calves and humans (Faikh et al. 2017). \u003cem\u003eE. coli\u003c/em\u003e is an important pathogenic cause of calf diarrhoea in the early age of life (Moxley and Smith \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). It leads to significant economic losses due to high morbidity and mortality rates in neonatal calves (Constable et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Shiga toxin (\u003cem\u003eStx\u003c/em\u003e)-producing \u003cem\u003eE. coli\u003c/em\u003e is a major zoonotic foodborne organism causing gastrointestinal diseases in humans (Nada et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). STEC refers to a pathotype of \u003cem\u003eE. coli\u003c/em\u003e that can produce \u003cem\u003eStx1\u003c/em\u003e and/or \u003cem\u003eStx2\u003c/em\u003e (Etcheverria and Padol 2013; Nada et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Shiga toxins (\u003cem\u003eStx\u003c/em\u003e) are classified into two major families, \u003cem\u003eStx1\u003c/em\u003e and \u003cem\u003eStx2\u003c/em\u003e, which share 70% similar amino acid sequences (Caprioli et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Nada et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). \u003cem\u003eStx2\u003c/em\u003e is more likely to cause diseases like haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS), whereas \u003cem\u003estx1\u003c/em\u003e is less likely to produce diseases in humans (Melton-Celsa \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Additionally, the STEC can express a virulence factor called intimin protein, which is responsible for intricate attachment of STEC to the intestinal epithelium, resulting in attaching and effacing lesions to the intestinal mucosa (Jerse et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Intimin protein is produced by a chromosome-encoded gene (\u003cem\u003eeae\u003c/em\u003e), which is a segment of the pathogenicity island called the locus for enterocyte effacement (LEE) (Kaper et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Kaper and O\u0026prime;Brien 2014). So, severe diarrhoea with HC and HUS are closely associated with both STEC and intimin-producing STEC isolates (Kaper et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Paton and Paton \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Kaper and O\u0026prime;Brien 2014). Cattle and calves may disseminate these STEC isolates through fecal contamination in vegetables, beef, milk, and unpasteurized dairy products via direct or indirect contact with live animals (Mughini-Gras et al. 2018; Organization WH 2019; Elmonir et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAntimicrobial-resistant bacteria represent a significant public health threat, predicted to cause the death of 10\u0026nbsp;million people per year by 2050 (Mir and Kudva \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Genes that produce extended spectrum beta-lactamase (ESBL) confer resistance to a wide array of β-lactams, the most commonly used antimicrobials in medical and veterinary clinics. Global surveillance among human population indicates a concerning rise on carbapenemase-producing clinical \u003cem\u003eE. coli\u003c/em\u003e isolates (Codjoe and Donkor 2018; K\u0026ouml;ck et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Parallel to this trend, reports on ESBL-producing STEC isolates have emerged in human and cattle samples (Day et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Nagel and Sp\u0026uuml;ler \u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Elafy et al. 2020).\u003c/p\u003e \u003cp\u003eThis trend represents a critical threat to public health because carbapenemase neutralizes the carbapenems, that mainly used as a final recourse against the multidrug-resistant (MDR) bacteria. These implications are particularly severe for STEC infections because the carbapenem drugs (like meropenem and imipenem) are recommended for the staged STEC infections in humans to cure the HUS or kidney failure (Mir and Kudva \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Emergence of carbapenemase-producing STEC isolates indicates an impending therapeutic crisis with limited alternative treatments for life-threatening diseases. Though carbapenems are not used in veterinary practices, studies in India found carbapenemase-positive \u003cem\u003eE. coli\u003c/em\u003e in mastitic milk (Ghatak et al. 2013) and diarrhoeic calves (Murugan et al. 2019). ESBL-producing \u003cem\u003eE. coli\u003c/em\u003e isolates were reported in Bangladesh from clinical human samples (Khan et al. 2018), cow milk (Nahar et al. \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and subclinical mastitic buffalo milk (Chowdhury et al. 2025). The detection of carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e in livestock may be linked to anthropogenic contamination via intra or inter-species transmission, or conversely, the natural selection of resistant pathogens and their associated mobile genetic materials (K\u0026ouml;ck et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Murugan et al. 2019). Potential zoonotic transmission of these bacteria can enter the food chains, requiring rigorous and continuous monitoring of ESBL and carbapenemase-producing \u003cem\u003eE. coli\u003c/em\u003e at both the animal-human interface.\u003c/p\u003e \u003cp\u003eFurthermore, STEC isolates were recovered from diarrhoeic calves, including clinical cases in Bangladesh (Johura et al. 2017; Islam et al. 2007). Some of these isolates displayed a variety of patterns of antimicrobial resistance. However, there is no data on ESBL and carbapenemase-producing STEC isolates obtained from diarrhoeic calves in Bangladesh. Therefore, this study aimed to reveal things are followings: 1) investigate the STEC isolates among diarrhoeic calves, their diverse pathogenic severity, followed by death of calves according to STEC\u0026rsquo;s current genotypic combination, 2) phenotypic and genotypic identification of ESBL and carbapenemase production among the STECs, 3) multidrug-resistance patterns among the pathogenic STEC isolates in the study regions, and finally 4) distribution of virulence, ESBL and carbapenemase genes, which helps clarify the viability of transmission and may be a concern in the development of multi-species reservoirs for virulence and resistance genes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee at Chattogram Veterinary and Animal Sciences University (Approval Number\u003cstrong\u003e: CVASU/Dir(R\u0026amp;E) EC/2025/880/6)\u003c/strong\u003e provided the approval for this research. We followed all processes and procedures as outlined in the guidelines of the ethics committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSampling strategy and study design\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA cross-sectional study was conducted among diarrhoeic calves in three coastal areas of Bangladesh \u0026ndash; Chattogram, Cox\u0026rsquo;s Bazar, and Noakhali. We employed a multi-stage stratification and purposive sampling method to ensure a comprehensive representation of spatial distribution. Each district was stratified into four cardinal zones: east, west, north, south, and middle. Then, one far-end upazila (sub-district) from each geographical direction was selected, and in total, 15 upazila (5 per district) were selected for this study. Stratification of the subdistricts was conducted by dividing them into five internal directional subregions (east, west, north, south, and middle), resulting in a total of 75 subareas. Geographical stratification was performed using Google Maps. \u0026nbsp;From each of the 75 subareas, one farm was purposively selected where calves were aged \u003cstrong\u003e\u0026le;\u003c/strong\u003e 12 weeks, with manifested diarrhoea (watery or bloody, or mucus) with fever, and\u0026nbsp;before initiating antibiotic therapy\u0026nbsp;at the time of visit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRectal swabs were collected from 75 diarrhoeic calves. The swabs were placed in the test tubes containing 10 mL buffer peptone water (BPW, Oxoid, UK). Stuart Transport Media (STM, Oxoid, UK) was used during distant travel. The swabs were transported immediately to the Microbiology Laboratory at Chattogram Veterinary and Animal Sciences University (CVASU).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCultural isolation of \u003cem\u003eE. coli\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePre-enriched BPW culture was subcultured onto a selective medium (MacConkey Agar, Oxoid, UK) and incubated overnight at 37 \u0026deg;C. Isolates with reddish-pink colonies on MacConkey agar were subcultured to Eosin Methylene Blue (EMB \u0026ndash; Oxoid, UK) agar and incubated overnight at 37\u0026deg;C. A greenish metallic sheen in EMB agar was phenotypically identified as \u003cem\u003eE. coli\u003c/em\u003e. Furthermore, an indole test (a biochemical test) was performed to confirm the cultural identification. Lastly, we performed Gram staining to confirm the microscopic rod shape and its Gram-negative nature.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular detection of \u003cem\u003eEscherichia coli\u003c/em\u003e, STEC, \u003cem\u003eeae-\u003c/em\u003eSTEC and EPEC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DNA was extracted through the crude boiling method (Wani et al. 2003; Bhat et al. 2008). All isolates were tested for the \u003cem\u003eadk\u003c/em\u003e gene through uniplex PCR assays by using the primer sequences listed in the Table. 1. For PCR, we used a 20 \u0026micro;L reaction volume containing 2 \u0026micro;L of DNA template, 10 \u0026micro;L DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Inc., USA), 1 \u0026micro;L of each\u0026nbsp;forward and reverse primer, and 6 \u0026micro;L of nuclease-free water (Thermo Fisher Scientific, Inc., USA). For this study, all the polymerase chain reaction amplification was performed at a Thermocycler machine (2720 Thermal cycler, Applied Biosystems, USA). Initial denaturation at 95\u0026deg;C for 2 minutes, 30 cycles of denaturation at 95\u0026deg;C for 1 minute, annealing at 54\u0026deg;C for 1 minute, Extension at 72\u0026deg;C for 1 minute, and final extension at 72 \u0026deg;C for 5 minutes, for the \u003cem\u003eadk\u0026nbsp;\u003c/em\u003egene encoded DNA amplification. An isolate of \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003efrom the previous study was used as a positive control (Gupta et al. 2016). PCR reaction mixtures without DNA and primers were applied as a negative control. Three virulent genes (\u003cem\u003estx1, stx2, eae\u003c/em\u003e) were identified among \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates by using Uniplex PCR. \u0026nbsp;The primers\u0026rsquo; sequence and cycle conditions for PCR amplification are described and referenced in Table 1. The PCR products were analyzed by electrophoresis using a 1.5% agarose gel (MP-Biomedicals, USA). The bands were visualized by staining with 8 \u0026micro;L MIDORI Green, a SYBR Safe DNA Gel Stain (Invitrogen, Thermo Fisher, USA), with the aid of a gel imaging system, GelDoc (Bio-Rad, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e Primer sequences used in polymerase chain reaction for housekeeping (adk) and virulence genes (stx1, stx2, and eae) of Escherichia coli isolates.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"620\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003e\u003cstrong\u003ePrimer Sequences\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\u003cstrong\u003eTarget gene\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\u003cstrong\u003eAmplicon size (\u003cem\u003ebp\u003c/em\u003e)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\u003cstrong\u003eAnnealing Temperature\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003eadk-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eATTCTGCTTGGCGCTCCGGG\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 55px;\"\u003e\u003cem\u003eadk\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 74px;\"\u003e590\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 94px;\"\u003e54 \u0026deg;C\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 100px;\"\u003e(DesROSIERS et al., 2001)\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003eadk-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCCGTCAACTTTCGCGTATTT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003estx1-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eACACTGGATGATCTCAGTGG\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 55px;\"\u003e\u003cem\u003estx1\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 74px;\"\u003e614\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 94px;\"\u003e58 \u0026deg;C\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 100px;\"\u003e(Manna et al., 2006)\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003estx1-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCTGAATCCCCCTCCATTATG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003estx2-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCCATGACAACGGACAGCAGTT\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 55px;\"\u003e\u003cem\u003estx2\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 74px;\"\u003e779\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 94px;\"\u003e58 \u0026deg;C\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 100px;\"\u003e\u0026nbsp;\u003cbr\u003e(Konno et al., 2012)\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003estx2-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCCTGTCAACTGAGCAGCACTT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003eeae -F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCAGGATCGCCTTTTTTATACG\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 55px;\"\u003e\u003cem\u003eeae\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 74px;\"\u003e479\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 94px;\"\u003e55 \u0026deg;C\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 58px;\"\u003e\u003cem\u003eeae -R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 239px;\"\u003eCTCTGCAGATTAACCTCTGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eF\u003c/em\u003e, forward primer sequence from 5`- 3`; \u003cem\u003eR\u003c/em\u003e, reverse primer sequence from 3`- 5`; \u003cem\u003ebp\u003c/em\u003e, base pair of amplicon size.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial susceptibility profiling of virulent \u003cem\u003eE. coli\u003c/em\u003e isolates\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe antimicrobial susceptibility profile of virulent \u003cem\u003eE. coli\u003c/em\u003e isolates was determined using the disc diffusion method, as recommended by the Clinical and Laboratory Standards Institute (CLSI) (Bauer 1966; CLSI 2023). We interpreted the antimicrobial susceptibility test using breakpoints for \u003cem\u003eE. coli\u003c/em\u003e. Molecularly identified virulent isolates carrying (\u003cem\u003estx\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e/both) were phenotypically tested against 13 commercial antimicrobials discs (Oxoid, UK): amoxicillin-clavulanate (AMC; 30 \u0026micro;g); ampicillin (AMP; 10 \u0026micro;g); cefotaxime (CTX; 30 \u0026micro;g); cefoxitin (FOX; 30 \u0026micro;g); meropenem (MEM; 10 \u0026micro;g); streptomycin (S; 10 \u0026micro;g); gentamycin (CN; 10 \u0026micro;g); doxycycline (DO, 30 \u0026micro;g); tetracycline (TE; 30 \u0026micro;g); chloramphenicol (C; 30 \u0026micro;g); nitrofurantoin (F; 300 \u0026micro;g); ciprofloxacin (CIP; 5 \u0026micro;g); trimethoprim-sulfamethoxazole (SXT; 25 \u0026micro;g). Repeatability and reproducibility were assessed for this test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMultidrug-resistant (MDR) bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the CLSI guidelines, we have classified STEC/\u003cem\u003eeae\u003c/em\u003e-STEC/EPEC isolates as multidrug resistant (MDR) if they acquired non-susceptibility to at least one agent in three or more categories of antibiotics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eESBL and carbapenemase production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll STEC, \u003cem\u003eeae\u003c/em\u003e-STEC, and EPEC (\u003cem\u003eeae\u003c/em\u003e) isolates were phenotypically screened for ESBL and carbapenemase production, according to the guidelines of CLSI. Combined disk method using cefotaxime (30 \u0026micro;g), cefotaxime/clavulanate (30/10 \u0026micro;g), ceftriaxone (30 \u0026micro;g), ceftriaxone/clavulanate (30/10 \u0026micro;g), ceftazidime (30 \u0026micro;g) and ceftazidime/clavulanate (30/10 \u0026micro;g) (Oxoid, UK) was determined in Mueller-Hinton agar (MHA). ESBL-producing isolates were recognized by \u0026ge; 5 mm increase in zone diameter around cefotaxime/clavulanate, ceftriaxone/clavulanate, and ceftazidime/clavulanate in comparison with disks without clavulanic acid. A modified carbapenem inactivation method (mCIM) using 10 \u0026micro;g meropenem disk in carbapenemase production, and the positive isolates were interpreted by 6-15 mm zone diameter (Pierce et al. 2017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular characterization of ESBL and carbapenemase genes among pathogenic MDR \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThree common ESBL genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003egroup, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e group, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e group)\u003cem\u003e\u0026nbsp;\u003c/em\u003eand two carbapenemase genes\u003cem\u003e\u0026nbsp;\u003c/em\u003e(\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e group and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e group) were tested, using a conventional PCR method using the primer pairs listed in Table 2.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eDNA extraction was performed using the FavorPrep Genomic DNA Extraction Mini Kit (Cat no. FATGK 001) (Favorgen Biotech Corp.). For the detection of ESBL genes, we performed one PCR reaction by multiplexing the above three ESBL genes in one PCR tube. However, detection of carbapenemase genes was performed in two separate uniplex PCR reactions with two separate reaction tubes. For both the ESBL and carbapenemase genes, 25 \u0026micro;L final volume containing 12.5 \u0026micro;L 2x Hot Star Taq multiplex PCR Master Mix (QIAGEN, Netherlands), 1 \u0026micro;L of each primer (2 \u0026micro;L), 2 \u0026micro;L of template DNA, and 8.5 \u0026micro;L of nuclease-free water, according to the previously published protocols (Seman et al. 2022). The PCR cycling protocols were: initial denaturation was 95\u0026deg;C for 15 minutes, followed by 35 cycles each of denaturation at 94\u0026deg;C for 30 seconds, annealing at 58\u0026deg;C for 90 seconds, extension at 72\u0026deg;C for 90 seconds, and final extension at 72\u0026deg;C for 10 minutes. The polymerase chain reaction products were analyzed by the electrophoresis technique using a 1.5% agarose gel (MP-Biomedicals, USA). The bands were visualized by staining with 10 \u0026micro;L MIDORI Green, a SYBR Safe DNA Gel Stain (Invitrogen, Thermo Fisher, USA), with the aid of a gel imaging system, GelDoc (Bio-Rad, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e Primer sequences used in polymerase chain reaction for ESBL genes (blaTEM group, blaCTX-M group, and blaSHV group), and carbapenemase genes (blaNDM group and blaKPC group)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"618\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cstrong\u003eTargeted\u0026nbsp;\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003egenes\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\u003cstrong\u003eForward primer\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003esequences (5\u0026acute;- 3\u0026acute;)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\u003cstrong\u003eReverse primer\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003eSequences (3\u0026acute;- 5\u0026acute;)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\u003cstrong\u003eAmplicon\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003esize (\u003cem\u003ebp\u003c/em\u003e\u003c/strong\u003e\u003csup\u003e*\u003c/sup\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003eTTTCGTGTCG CCCTTATTCC\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003eATCGTTGTCAGA AGTAAGTTGG\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e403\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e(Mohammed et al. 2016)\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003eCGCTGTTGTTA GGAAGTGTG\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003eGGCTGGGTGA AGTAAGTGAC\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e754\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e(Seman et al. 2022)\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003eCGCCTGTGTATT ATCTCCCT\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003eCGAGTAGTCCA CCAGATCCT\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e293\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e(Mohammed et al. 2016)\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003eCGTCTAGTTCT GCTGTCTTG\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003eCTTGTCATCCT TGTTAGGCG\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e798\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e(Poirel et al. 2011)\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 127px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003eGGTTTGGCGAT CTGGTTTTC\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003eCGGAATGGCTC ATCACGATC\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e621\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e(Poirel et al. 2011)\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003ebp\u003c/em\u003e*, base pair of amplicon size\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuality control in ESBL and carbapenemase gene detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA positive American Type Culture Collection (ATCC) was used to check the efficacy of each culture. The positive control included \u003cem\u003eKlebsiella Pneumoniae\u0026nbsp;\u003c/em\u003eATCC 700603 for ESBL, and \u003cem\u003eKlebsiella Pneumoniae\u0026nbsp;\u003c/em\u003eATCC 1705 for carbapenemase during PCR and phenotypic determination. Nuclease-free water containing Master Mix without DNA was used as a negative control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA \u0026lsquo;95% Confidence Interval for the proportion of \u0026nbsp;virulent gene profile, by an Agresti-Coull method. Fisher\u0026rsquo;s exact test was performed by R (version 4.5.0) to correlate the virulence capacity of the genetic combination of pathogenic \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates with age, mortality, and clinical severity in calves. We used Python (version 3.9) with the Matplotlib and Seaborn libraries for data visualization. \u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePrevalence of \u003cem\u003eE. coli\u003c/em\u003e in diarrhoeic calves\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOut of 75 isolates, 60 isolates had 60 isolates were positive for the \u003cem\u003eadk\u0026nbsp;\u003c/em\u003egene in the PCR reaction in Fig. 1 (A).\u003cem\u003e\u0026nbsp;\u003c/em\u003eTherefore, the prevalence of \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003ein diarrhoeic calves was 80% (60/75; 95% CI: 69.17\u0026ndash;88.35).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular detection of virulence gene carriage in \u003cem\u003eE. coli\u003c/em\u003e isolate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGel images of PCR products for \u003cem\u003estx1\u003c/em\u003e, \u003cem\u003estx2\u003c/em\u003e, and\u003cem\u003e\u0026nbsp;eae\u0026nbsp;\u003c/em\u003egenes have been demonstrated in Fig. 1 (B, C, D). There were 10 isolates detected as virulence gene carriage pathogenic \u003cem\u003eE. coli\u003c/em\u003e, with a proportion with 13.33% (10/75; 95% CI: 6.5\u0026ndash;23.1).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eMolecular detection rates of STEC, \u003cem\u003eeae\u003c/em\u003e-STEC, and EPEC (\u003cem\u003eeae\u003c/em\u003e) among the isolates described in Fig. 2. The STEC isolates were detected in 12% (9/75, 95% CI: 5.64-21.56). Among the diarrhoeic calves, Shiga toxin gene \u003cem\u003estx1\u003c/em\u003e was predominantly identified in 5.33% (4/75) (95% CI: 1.47-13.01), followed by \u003cem\u003estx2\u0026nbsp;\u003c/em\u003ein 1.33% (1/75) (95% CI: 0.03 \u0026ndash; 7.21). Only one \u003cem\u003eeae\u003c/em\u003e-encoded isolate was detected\u003cem\u003e.\u003c/em\u003e Prevalence of intimin-producing STEC were genotypically detected in four isolates: two isolates carried both \u003cem\u003estx1 and eae\u0026nbsp;\u003c/em\u003egene (\u003cem\u003estx1+eae)\u003c/em\u003e with a proportion of (2/75, 2.67%) (95% CI: 0.32 \u0026ndash; 9.63), one isolate carried both \u003cem\u003estx2 and eae\u0026nbsp;\u003c/em\u003egenes (\u003cem\u003estx2+eae)\u003c/em\u003e, and one isolate had combination of \u003cem\u003estx1\u003c/em\u003e, \u003cem\u003estx2\u003c/em\u003e and \u003cem\u003eeae\u003c/em\u003e genes (\u003cem\u003estx1\u0026nbsp;\u003c/em\u003e+ \u003cem\u003estx2\u003c/em\u003e + \u003cem\u003eeae\u003c/em\u003e), with a similar proportion (1/75, 1.33%) (95% CI: 0.03 \u0026ndash; 7.21), in three genetic amalgamates.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eOf these pathogenic isolates, both the \u003cem\u003estx\u0026nbsp;\u003c/em\u003egenes, \u003cem\u003estx1\u003c/em\u003e only, and \u003cem\u003estx2\u003c/em\u003e only genotypes were identified in 40 (4/10) and 10% (1/10), respectively. Intimin-producing STEC (\u003cem\u003eeae\u003c/em\u003e-STEC) were identified in 40% (4/10), with the following genotypes: \u003cem\u003estx1+eae\u003c/em\u003e (2/10, 20%), \u003cem\u003estx2+eae\u003c/em\u003e (1/10, 10%), \u003cem\u003eand stx1+stx2+eae\u003c/em\u003e (1/10, 10%). Overall, the \u003cem\u003estx1\u0026nbsp;\u003c/em\u003e(9.33%) was the most detected gene, followed by the \u003cem\u003eeae\u003c/em\u003e gene (6.67%) and the \u003cem\u003estx2\u0026nbsp;\u003c/em\u003egene (4%).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathogenic severity of STEC, \u003cem\u003eeae-\u003c/em\u003eSTEC, and EPEC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypically identified STEC, \u003cem\u003eeae\u003c/em\u003e-STEC, and EPEC isolates create a wide range of diarrhoea in calves, depicted in Table 3. Among the diarrhoea types, 50% (5/10) were watery diarrhea, 40% bloody diarrhoea, and 10% (1/10) were diarrhoea with mucus. Intimin-producing STEC (\u003cem\u003eeae\u003c/em\u003e-STEC) harboring calves had bloody diarrhoea. Among the \u003cem\u003eeae-\u003c/em\u003eSTEC (\u003cem\u003estx1 + stx2 + eae\u003c/em\u003e, \u003cem\u003estx1+ eae,\u0026nbsp;\u003c/em\u003eand \u003cem\u003estx2 + eae\u003c/em\u003e) \u003cem\u003ewas\u003c/em\u003e associated with very severe to severe bloody diarrhoea.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e Virulent genes of pathogenic E. coli isolates and their sequelae of age-associated different diarrhoea types and mortality in diarrhoeic calves\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 78px;\"\u003e\u003cstrong\u003eSample\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003eID\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 123px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 55px;\"\u003e\u003cstrong\u003eAge (days)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 184px;\"\u003e\u003cstrong\u003eTypes of diarrhoea manifested with fever in calves\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003eMortality\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003eFisher\u0026rsquo;s exact\u003c/strong\u003e\u003cbr\u003e\u003cstrong\u003etest (p-value)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003estx1\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003estx2\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003eeae\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003eBD\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003eMD\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003eWD\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAS010\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e3\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ +\u003csup\u003ec\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAB003\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e6\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ + +\u003csup\u003eb\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAG027\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e4\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ +\u003csup\u003ec\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAX049\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e5\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ + + +\u003csup\u003ea\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u0026nbsp;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAQ019\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e7\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ + +\u003csup\u003eb\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u0026lt;0.05\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAM068\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e8\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ + +\u003csup\u003eb\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAK056\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e2\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003csup\u003ed\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAT041\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e12\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ + +\u003csup\u003eb\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAJ032\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e10\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ +\u003csup\u003ec\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003eAV019\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e+\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e11\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 59px;\"\u003e\u003cstrong\u003e\u003cem\u003e+ +\u003csup\u003ec\u003c/sup\u003e\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003e\u003cem\u003e-\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTypes of diarrhoea: BD,\u0026nbsp;\u003c/strong\u003ebloody diarrhoea; \u003cstrong\u003eMD,\u0026nbsp;\u003c/strong\u003emucus diarrhoea; \u003cstrong\u003eWD,\u0026nbsp;\u003c/strong\u003ewatery diarrhoea; \u003cstrong\u003e+ + + +\u003csup\u003ea\u003c/sup\u003e\u003c/strong\u003e, very severe; \u003cstrong\u003e+ + +\u003csup\u003eb\u003c/sup\u003e\u003c/strong\u003e, severe; \u003cstrong\u003e+ +\u003csup\u003ec\u003c/sup\u003e\u003c/strong\u003e, moderate; \u003cstrong\u003e+\u003csup\u003ed\u003c/sup\u003e\u003c/strong\u003e, mild. \u003cstrong\u003ePCR results: +\u003c/strong\u003e, present; \u003cstrong\u003e-\u003c/strong\u003e, absent. \u003cstrong\u003eMortality: +\u003c/strong\u003e, yes; \u003cstrong\u003e-\u003c/strong\u003e, no.\u003c/p\u003e\n\u003cp\u003eThe sequelae of these affected calves with intimin-producing STEC were death in (4/4) (100%) calves, due to intolerable bloody diarrhoea and fluid loss. \u0026nbsp; The Bloody diarrhoea with death occurred equally (2:2) in the 1\u003csup\u003est\u003c/sup\u003e week and 2\u003csup\u003end\u003c/sup\u003e week of age. No bloody diarrhoea was experienced in calves carrying only \u003cem\u003estx1\u0026nbsp;\u003c/em\u003eor\u003cem\u003e\u0026nbsp;stx2-\u003c/em\u003eencoded isolates. However, they were clinically responsible for mild to moderate watery diarrhoea, whereas only the \u003cem\u003eeae\u003c/em\u003e-encoded non-STEC isolate (EPEC) was accountable for mucus diarrhoea (dysentery). Fisher\u0026rsquo;s exact test disclosed a significant association between virulent gene profiles of \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eand clinical outcomes such as diarrhoeal severity, mortality, and age of affected calves, with a p-value \u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eESBL and carbapenemase gene carriage pathogenic \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 10 phenotypically confirmed (3 ESBL, 5 carbapenemase-producing, and 2 both ESBL and carbapenemase-producing) isolates carrying virulence genes (n = 10) (\u003cem\u003estx\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e/both) were tested for the presence of the three most common ESBL genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003egroup, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e group, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e group) and two carbapenemase genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e group and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e group).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eGel image of PCR products demonstrates the genetic determination of both gene groups in (Fig. 3), and gene frequencies are described in Table 4. Of these ESBL-positive isolates, 5 (50%) were confirmed to carry ESBL genes. Four of these isolates possessed \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, and one of them carried\u003csub\u003e\u0026nbsp;\u003c/sub\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e. Solely carbapenemase-producing isolates were not genetically verified in any virulent isolates. However, there were four isolates genetically identified to be both ESBL and carbapenemase producers. One of them carried \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003eand\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, two of them had \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, and only one isolate had \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e genes, the only isolate that carried the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e gene. One isolate had none of the genes of ESBL and carbapenemase.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e STEC and eae-STEC isolates harboring ESBL and carbapenemase-encoded genes\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"622\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 245px;\"\u003e\u003cstrong\u003eGene Types\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cstrong\u003eGenes Tested\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\u003cstrong\u003eFrequency\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\u003cstrong\u003ePercentage\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"5\" valign=\"top\" style=\"width: 245px;\"\u003eESBL\u003csup\u003ea\u003c/sup\u003e (n = 5)\u003cbr\u003e\u0026nbsp;\u003cbr\u003e(STEC\u003csup\u003eb\u003c/sup\u003e isolates)\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e4\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e80%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e1\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e20%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003eand \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u003csub\u003e\u0026nbsp;\u003c/sub\u003eand\u003csub\u003e\u0026nbsp;\u003c/sub\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\" style=\"width: 245px;\"\u003eCarbapenemase (n=0)\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003eand\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e0\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e0%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\" style=\"width: 245px;\"\u003eBoth ESBL and Carbapenemase (n=4)\u003cbr\u003e\u0026nbsp;\u003cbr\u003e(\u003cem\u003eeae-\u003c/em\u003eSTEC\u003csup\u003ec\u003c/sup\u003e isolates)\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/sub\u003eand\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e1\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e25%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e2\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e50%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 207px;\"\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e1\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e25%\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eESBL\u003csup\u003ea\u003c/sup\u003e, extended-spectrum \u0026beta;-lactamase; STEC\u003csup\u003eb\u003c/sup\u003e, Shiga toxin-producing \u003cem\u003eE. coli\u003c/em\u003e; \u003cem\u003eeae-\u003c/em\u003eSTEC\u003csup\u003ec\u003c/sup\u003e, intimin-producing gene (\u003cem\u003eeae\u003c/em\u003e)-encoded\u003cem\u003e\u0026nbsp;\u003c/em\u003eSTEC\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial resistance profile among ESBL and/or carbapenemase-producing STEC, \u003cem\u003eeae-\u003c/em\u003eSTEC, and EPEC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe presence of the ESBL or carbapenemase or both ESBL and carbapenemase-producing genes among the virulence gene carriage isolates (STEC/\u003cem\u003eeae\u003c/em\u003e-STEC/EPEC) with combined drug-level and gene-level antimicrobial resistance patterns is illustrated in Fig. 4. All tested isolates were identified as multidrug-resistant, according to CLSI guidelines. The intimin-producing STEC carriage isolates (\u003cem\u003eeae\u003c/em\u003e-STEC) co-harboring both ESBL (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e/\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e) and carbapenemase (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e) genes were prominently resistant to antimicrobials tested.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003estx1\u003c/em\u003e+s\u003cem\u003etx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e-positive isolate co-harboring \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e genes, whereas one \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u0026nbsp;\u003c/em\u003eisolate carrying \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, and\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e genes, one \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e isolate having \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e and\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u0026nbsp;\u003c/sub\u003egenes, and one \u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e isolate possessed \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, and\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e genes, showing a chronological resistance pattern with 100%, 84.61%, 84.61% and 76.92%, respectively. Conversely, only STEC isolates, such as the \u003cem\u003estx1\u003c/em\u003e-\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e isolate, showed an overall 71.79% resistance rate, whereas the \u003cem\u003estx2\u003c/em\u003e-\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e isolate had only 53.53% resistance rate. One \u003cem\u003estx1\u003c/em\u003e-harboring isolate co-existed with the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e gene, demonstrating 61.53% resistance. Interestingly, only \u003cem\u003eeae\u003c/em\u003e-encoded isolates without any ESBL/carbapenemase genes had the maximum susceptibility pattern (38.46%) and minimum resistance (46.15%). ESBL and carbapenemase-producing \u003cem\u003eeae\u003c/em\u003e-STEC isolates were more likely to be multidrug-resistant (MDR) than ESBL-STEC isolates and the non-STEC EPEC isolate\u003cem\u003e.\u0026nbsp;\u003c/em\u003eThe highest antimicrobial resistance rates were found in ciprofloxacin and meropenem (100%), nitrofurantoin and cefoxitin (90%), ampicillin, streptomycin, and trimethoprim-sulfamethoxazole (80%), chloramphenicol (70%), doxycycline, tetracycline, and cefotaxime (60%). In contrast, the lowest resistance rates were found in gentamycin (20%) and amoxicillin-clavulanate (40%).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeographical distribution of virulence, ESBL, and carbapenemase genes in \u003cem\u003eE. coli\u003c/em\u003e isolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe distribution of virulence and resistance genes in \u003cem\u003eE. coli\u003c/em\u003e isolates from diarrhoeic calves at different sampling zones is depicted in Fig. 5. Virulence-resistance genetic combination, \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;stx2\u003c/em\u003e+\u003cem\u003eeae\u0026nbsp;\u003c/em\u003eisolates with\u003cem\u003e\u0026nbsp;bla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e,\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e genes, \u003cem\u003estx1 and stx2 isolates with bla\u003c/em\u003e\u003csub\u003eTEM\u0026nbsp;\u003c/sub\u003egene were found from Chattogram district. \u003cem\u003eStx1\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV,\u003c/sub\u003e and \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e virulence-resistance genes co-carriage isolates were recovered from Cox\u0026rsquo;s Bazar. Most importantly, \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e\u003cem\u003e+bla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026nbsp;\u003c/sub\u003egenetically amalgamated isolates were detected from Cox\u0026rsquo;s Bazar. Chattogram and Cox\u0026rsquo;s Bazar covered 80% of the gene distribution. The remaining 20% was contributed from Noakhali district, with \u003cem\u003eeae\u003c/em\u003e virulence factor without ESBL or carbapenemase genes (10%) and \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u0026nbsp;\u003c/sub\u003emixed isolate (10%).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study investigated the extent of STEC, \u003cem\u003eeae\u003c/em\u003e-STEC, and EPEC in diarrhoeic calves as well as the consequent isolates\u0026rsquo; capacity to produce extended-spectrum \u0026beta;-lactamase and carbapenemases.\u0026nbsp;Cattle and small ruminants are natural reservoirs of\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003e(Persad et al. 2015).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, STEC isolates were detected in 12% diarrhoeic calves. These findings were matched with a recent study on diarrheic cattle in Egypt (Elmonir et al. 2021). Shiga toxin-producing gene \u003cem\u003estx1\u0026nbsp;\u003c/em\u003e(9.33%) was the most detected gene, followed by the \u003cem\u003eeae\u003c/em\u003e gene (6.67%) of enteropathogenic \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eand the \u003cem\u003estx2\u0026nbsp;\u003c/em\u003egene with 4% isolates. This observation was similar to the previous study, where the highest gene prevalence was \u003cem\u003estx1\u003c/em\u003e in humans (Karamna et al. 2019). Isolates with only the \u003cem\u003estx1\u0026nbsp;\u003c/em\u003eor \u003cem\u003estx2\u0026nbsp;\u003c/em\u003egene were 6.67%. These findings were higher than those of previously published reports (1.9-4.1%) in the USA (Lambertini et al. 2015) and lower than the reports having (10.7-29.7%) from other countries (Momtaz et al. 2013; Ranjbar et al. 2018). However, different outcomes were also reported, where all of the \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003etested negative for \u003cem\u003estx1, stx2,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;eae\u0026nbsp;\u003c/em\u003egenes (Dela et al. 2022). This study did not have any evidence about combinations of \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003estx2\u003c/em\u003e genes among the isolates. This observation was different from the findings of another study in Bangladesh, where promising \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003estx2\u003c/em\u003e combined genetic isolates were identified from livestock (Johura et al. 2017). The combination of \u003cem\u003estx\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e genes was observed in (5.33%) of \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates. This is the most relevant finding because it indicates that \u003cem\u003eeae\u003c/em\u003e-encoded STECs are disseminating from diarrheic calves. Yet only one\u003cem\u003e\u0026nbsp;\u003c/em\u003eisolate\u003cem\u003e\u0026nbsp;\u003c/em\u003e(1.33%) consists solely of the \u003cem\u003eeae\u0026nbsp;\u003c/em\u003egene among the \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates. These outcomes are lower than previously reported in China, where 9.5% \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates carried this gene (Yang et. al. 2020). Variations in gene distribution among our studies and previous studies can be due to different geographical regions, hosts, environmental determinants, personal and personnel hygiene in farms, different methodologies of sampling, and study designs. The \u003cem\u003eeae\u0026nbsp;\u003c/em\u003egene of enteropathogenic \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003e(EPEC) is necessary for the robust attachment to the intestinal epithelial cells (Donnenberg et al. 1993). Moreover, the \u003cem\u003eeae\u003c/em\u003e gene is responsible for encoding an outer membrane that mediates adhesion ability in STEC/EPEC to enterocytes (Aidar-Ugrinovich et al. 2007; Montsu et al. 2019). This indicates the \u003cem\u003eeae\u0026nbsp;\u003c/em\u003egenes associated with STEC isolates are more virulent. It suggests high pathogenicity concern among calves and is relevant to the findings of this study, where four \u003cem\u003estx\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e combined isolates in calves had bloody diarrhoea with death. The \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e isolate was responsible for higher pathogenic severity than \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e or \u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u0026nbsp;\u003c/em\u003ecombined isolates in calves (Table 2). This is due to the evolution of mobile genetic materials in microbes like plasmids and bacteriophages (Ahmed et al. 2008; Habets et al. 2022a). A study conducted in Italy reported the mixed isolates (\u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e and \u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e), where\u003cem\u003e\u0026nbsp;stx2\u003c/em\u003e/\u003cem\u003eeae\u0026nbsp;\u003c/em\u003ecombined isolates were more prevalent than \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e, from swine feces (Ecroli et al. 2016). These findings create public health concerns because previous scientific reports in South Africa (Karama et al. 2019) and Sweden (Hua et al. 2020) have implicated \u003cem\u003eeae-\u003c/em\u003eencoded STEC isolates in severe human diseases. A significant link was found between diarrhoeic calves and humans, where the \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003estx2\u003c/em\u003e/\u003cem\u003eeae\u0026nbsp;\u003c/em\u003egenes are combined or individually responsible for different types of diarrhoea (Faikh et al. 2017; Belete et al. 2022;\u0026nbsp;Habets et al. 2022b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThese STEC, intimin-producing STEC (\u003cem\u003eeae\u003c/em\u003e-STEC), and EPEC (\u003cem\u003eeae\u003c/em\u003e) isolates were recognized as 10/10 (100%) multidrug-resistant, showing 100% resistance to meropenem and ciprofloxacin when tested by disk diffusion according to CLSI guidelines. These results led the authors to further investigate the patterns of ESBL and carbapenemase production through phenotypic and genotypic verification. Five ESBL-producing STEC isolates were detected. Of these ESBL-positive isolates, three isolates possessed (30%) \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, one isolate had (10%) \u003cem\u003estx1\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV,\u003c/sub\u003e and one isolate (10%) was detected as the \u003cem\u003estx2\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e genetic combination. These observations agree with the respective previous study conducted in Egypt and England, where the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u0026nbsp;\u003c/sub\u003egene was predominant among the STEC isolates (Kr\u0026uuml;ger et al. 2015; Day et al. 2015). However, other studies with \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eisolates reported in Ethiopia\u0026nbsp;(Seman et al. 2022) and Portugal (Freire et al. 2023), where the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u0026nbsp;\u003c/sub\u003egene was predominant. The \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u0026nbsp;\u003c/sub\u003egenes encode for narrow-spectrum \u0026beta;-lactamases (NSBLs) to ESBLs to confer resistance against penicillin and sometimes cephalosporines. Conversely, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u0026nbsp;\u003c/sub\u003egenes encode the enzymes that neutralize third-generation cephalosporines (Kim et al. 2005). The ESBL genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e) were detected in the USA, North America, Europe, Asia, and Africa from fecal samples of cattle (Palmeira and Ferreira 2020). The STEC containing \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u0026nbsp;\u003c/sub\u003eshowed 100% phenotypic resistance to ampicillin, cefoxitin, meropenem, and ciprofloxacin, followed by 75% resistance to cefotaxime and 50% resistance to tetracycline, doxycycline, and sulfamethoxazole-trimethoprim. Comparable studies in Iran were previously reported (Momtaz et al. 2013; Ranjbar et al. 2018). The \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e and carbapenemase genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e) were not detected in solely Shiga toxin-producing isolates. Interestingly, all intimin-producing STEC (\u003cem\u003estx\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e) isolates (4/4, 100%) coexisted with both ESBL and carbapenemase-producing genes, which is in agreement with the study conducted in South Africa (Codjoe et al. 2017). The \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e virulence isolate (ID AX049) carried \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC,\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026nbsp;\u003c/sub\u003eresistance genes and showed resistance to all antimicrobials (100%). In contrast, \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e (ID AT041), \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u0026nbsp;\u003c/sub\u003e(ID AM068) gene carriage isolates exhibited 84.61% drug-resistance rate, whereas the \u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u0026nbsp;\u003c/sub\u003eisolate (ID AB003) displayed 79.6% resistance rate. Gentamycin is the only susceptible drug in the \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e/\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u0026nbsp;\u003c/sub\u003eisolate,\u003csub\u003e\u0026nbsp;\u003c/sub\u003eamong intimin-producing STEC isolates. However, these resistant genes were also identified from humans, where \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026nbsp;\u003c/sub\u003ewas predominant in India (Manohar et al. 2017) and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e in Egypt (El-Shaer et al. 2021). Different distribution rates of ESBL and carbapenemase genes have been documented across various studies, a phenomenon potentially attributable to disparities\u0026nbsp;in management practices, host reservoirs, feeding habits, sanitation, and human migration (Bevan et al. 2017). Carbapenem drugs are not approved for veterinary treatment, so carbapenem resistance is not commonly tested in animal practices in Bangladesh. However, meropenem has been approved for use in human treatment (Taggar et al. 2020). This is a matter of concern that horizontal transfer of these ESBL and carbapenemase genes among the bacteria can be a high public health issue. Because a study previously reported that the IncX3 plasmid encodes \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC,\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026nbsp;\u003c/sub\u003ein \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003eand is responsible for gene transfer (Ram\u0026iacute;rez-Castillo\u0026nbsp;et al. 2023).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDiarrheic calves are a significant potential source of Shiga toxin-producing \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003e(STEC) and intimin-producing STEC (\u003cem\u003eeae\u003c/em\u003e-STEC) isolates, and only \u003cem\u003eeae\u003c/em\u003e-encoded EPEC isolates. This study underscores the zoonotic risk of virulence genes, which may also possess ESBL or both ESBL and carbapenemase-producing genes, hence significantly enhancing resistance against prevalent antimicrobials used in veterinary and human clinics.\u0026nbsp;Combined virulence gene carriage isolates (\u003cem\u003estx1\u003c/em\u003e/\u003cem\u003estx2\u003c/em\u003e/\u003cem\u003eeae\u003c/em\u003e), especially the \u003cem\u003estx1\u003c/em\u003e+\u003cem\u003estx2\u003c/em\u003e+\u003cem\u003eeae\u003c/em\u003e genotypic isolate, were positive for all the ESBL and carbapenemase genes tested in this study and resistant to all the antimicrobials tested. These genes can be passed on to the next generation of bacteria, making them more resistant and resulting in the development of superbugs (Bevan et al. 2017; Garc\u0026iacute;a et al. 2020). These will lead to prolonged admissions to hospitals, increased treatment costs, and death in some cases (Van Duin et al. 2016).\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe combination of virulence and resistance genetic profiling among STEC and \u003cem\u003eeae-\u003c/em\u003eSTEC isolates co-existing ESBL and carbapenemase genes from diarrheic calves highlights the probable potential risk of intra or interspecies cross-transmission of these genes, pressing public health issues, as people are directly or indirectly in contact with calves and dairy farms through the One Health interface. There are two-fold public health risks: a) zoonotic transmission of virulence genes, poses an immediate source of severe diseases; b) dissemination of \u0026nbsp;ESBL and carbapenemase genes, as virulence isolates \u0026nbsp;may carry these antibiotic-neutralizing enzymes. Therefore, this study recommends a continuous surveillance system and preventive measures to reduce zoonotic transmission and spread of antibiotic resistance, as MDR-STEC was previously identified in sheep from Bangladesh (Gupta et al. 2022).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding declaration\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations of interest:\u0026nbsp;\u003c/strong\u003enon\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlabon Ketan Barua: Conceptualization, Methodology, Software, Formal analysis, Data curation, Writing-Original draft preparation, Visualization Uaye Mya: Methodology, Investigation, Writing\u0026mdash;Original draft preparation. Partha Paul: Methodology, Investigation. Snigdha Das: Methodology, Investigation. Mukta Das Gupta: Conceptualization, Validation, Resources, Writing\u0026mdash;Original Draft, Writing\u0026mdash;Review \u0026amp; Editing, Supervision, Project administration. Ashutosh Das: Conceptualization, Software, Formal analysis, Data curation, Validation, Resources, Writing - Original Draft, Writing - Review \u0026amp; Editing, Visualization, Supervision, Project administration.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAhmed N, Dobrindt U, Hacker J, Hasnain SE (2008) Genomic fluidity and pathogenic bacteria: applications in diagnostics, epidemiology, and intervention. Nat Rev Microbiol 6(5): 387\u0026ndash;394. https://doi.org/10.1038/nr micro1889 \u003c/li\u003e\n\u003cli\u003eAidar-Ugrinovich L, Blanco J, Blanco M, Blanco JE, Leomil L, Dahbi G, Mora A, Onuma DL, Silveira WD, de Catro AP (2007) Serotypes, virulence genes, and intimin types of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) and enteropathogenic \u003cem\u003eE. coli\u003c/em\u003e (EPEC) isolated from calves in S\u0026atilde;o Paulo, Brazil. Int J Food Microbiol 115(3): 297\u0026ndash;306. https://doi.org/10.1016/j.ijfoodmicro.2 006.10.046 \u003c/li\u003e\n\u003cli\u003eBauer AW, Kirby WM, Sherris JC, Turck M (1966) Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 45: 493\u0026ndash;496.\u003c/li\u003e\n\u003cli\u003eBelete MA, Demlie TB, Chekole WS, Tessema TS (2022) Molecular identification of diarrheagenic \u003cem\u003eEscherichia coli\u003c/em\u003e pathotypes and their antibiotic resistance patterns among diarrheic children and in contact calves in Bahir Dar city, Northwest Ethiopia. PLoS One 17 (9): e0275229. https://doi.org/10.1371/journal.pone.0275229 \u003c/li\u003e\n\u003cli\u003eBevan ER, Jones AM, Hawkey PM (2017) Global epidemiology of CTX-M \u0026beta;-lactamases: temporal and geographical shifts in genotype. J Antimicrob Chemother 72(8): 2145\u0026ndash;2155. https://doi.org/10.1093/jac/dkx146 \u003c/li\u003e\n\u003cli\u003eBhat MA, Nishikawa Y, Wani SA (2008) Prevalence and virulence gene profiles of Shiga toxin-producing \u003cem\u003eEscheric\u003c/em\u003e\u003cem\u003ehia coli\u003c/em\u003e and enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e from diarrhoeic and healthy lambs in India. Small Ruminant Res 75: 65\u0026ndash;70. https://doi.org/10.1016/j.smallrumres.2007.08.006 \u003c/li\u003e\n\u003cli\u003eCaprioli A, Tozzoli R, Morabito S, Strockbine NA (2012) Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol 50(9): 2951\u0026ndash;2963. https://doi.org/10.1128/jcm.00860-12 \u003c/li\u003e\n\u003cli\u003eChowdhury MSR, Hossain H, Rahman MN, Rahman A, Ghosh PK, Uddin MB, Nazmul Hoque M, Hossain MM, Rahman MM (2025) Emergence of highly virulent multidrug and extensively drug-resistant \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e in buffalo subclinical mastitis cases. Sci Rep 15(1): 11704. https://doi.org/ 10.1038/s41598-025-95914-x \u003c/li\u003e\n\u003cli\u003eClinical and Laboratory Standards Institute (CLSI) (2023) Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed. CLSI supplement M100. Clinical and Laboratory Standards Institute, Wayne, PA, USA.\u003c/li\u003e\n\u003cli\u003eCodjoe FS, Donkor ES (2017) Carbapenem resistance: a review. Med Sci 6(1): https://doi.org/10.3390/medsci60100 01 \u003c/li\u003e\n\u003cli\u003eConstable PD, Blood DC, Radostits OM (2017) Veterinary medicine: A textbook of the diseases of cattle, horses, sheep, pigs, and goats, 11th edn. Elsevier, St. Louis, pp 2045-2050.\u003c/li\u003e\n\u003cli\u003eDay M, Doumith M, Jenkins C, Dallman TJ, Hopkins KL, Elson R, Godbole G, Woodford N (2016) Antimicrobial resistance in Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e serogroups O157 and O26 isolated from human cases of diarrhoeal disease in England. J Antimicrob Chemother 72(1): 145\u0026ndash;152. https://doi.org/10.1093/jac/dkw 371 \u003c/li\u003e\n\u003cli\u003eDela H, Egyir B, Majekodunmi AO, Behene E, Yeboah C, Ackah D, Addo KK (2022) Diarrhoeagenic \u003cem\u003eE. coli\u003c/em\u003e occurrence and antimicrobial resistance of extended-spectrum beta-lactamases isolated from diarrhoea patients attending health facilities in Accra, Ghana. PLoS One 17(5): e0268991. https://doi.org/10.1371/journal.pon e.0268991 \u003c/li\u003e\n\u003cli\u003eDesrosiers A, Fairbrother JM, Johnson RP, Desautels C, Letellier A, Quessy S (2001) Phenotypic and genotypic characterization of \u003cem\u003eEscherichia coli\u003c/em\u003e verotoxin-producing isolates from humans and pigs. J Food Prot 84(12): 1904\u0026ndash;1911. https://doi.org/10.4315/0362-028X-64.12.1904 \u003c/li\u003e\n\u003cli\u003eDonnenberg MS, Tacket CO, James SP, Losonsky G, Nataro JP, Wasserman SS, Kaper JB, Levine MM (1993) Role of the eaeA gene in experimental enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e infection. J Clin Invest 92(3): 1412\u0026ndash;1417. \u003c/li\u003e\n\u003cli\u003eElafify M, Khalifa HO, Al-Ashmawy M, Elsherbini M, El Latif AA, Okanda T, Matsumoto T, Koseki S, Abdelkhalek A (2020) Prevalence and antimicrobial resistance of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e in milk and dairy products in Egypt. J Environ Sci Health B 55(3): 265\u0026ndash;272. https://doi.org/10.1080/03601234.2019.1 686312 \u003c/li\u003e\n\u003cli\u003eElmonir W, Shalaan S, Tahoun A, Mahmoud SF, Remela EMA, Eissa R, El-Sharkawy H, Shukry M, Zahran RN (2021) Prevalence, antimicrobial resistance, and genotyping of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e in foods of cattle origin, diarrheic cattle, and diarrheic humans in Egypt. Gut Pathogens 13(1): 8. https://doi.or g/10.1186/s13099-021-00402-y \u003c/li\u003e\n\u003cli\u003eEl-Shaer S, Abdel-Rhman SH, Barwa R, Hassan R (2021) Genetic characterization of extended spectrum \u0026beta;-lactamase and carbapenemase-producing \u003cem\u003eEscherichia coli\u003c/em\u003e isolated from Egyptian hospitals and environments. PLoS One 16(7): e0255219. https://doi.org/10.1371/journal.pone.0255219 \u003c/li\u003e\n\u003cli\u003eErcoli L, Farneti S, Zicavo A, Mencaroni G, Blasi G, Striano G, Scuota S (2016) Prevalence and characteristics of verotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e strains isolated from pigs and pork products in Umbria and Marche regions of Italy. Int J Food Microbiol 232: 7\u0026ndash;14. https://doi.org/10.1016/j.ijfoodmicro.2016.05.002\u003c/li\u003e\n\u003cli\u003eFakih I, Thiry D, Duprez JN, Saulmont M, Iguchi A, Pi\u0026eacute;rard D, Jouant L, Daube G, Ogura Y, Hayashi T, Taminiau B, Mainil JG (2017) Identification of Shiga toxin-producing (STEC) and enteropathogenic (EPEC) \u003cem\u003eEscherichia coli\u003c/em\u003e in diarrhoeic calves and comparative genomics of O5 bovine and human STEC. Vet Microbiol 202: 16\u0026ndash;22. https://doi.org/10.1016/j.vetmic.2016.02.017\u003c/li\u003e\n\u003cli\u003eFreire S, Grilo T, Rodrigues B, Oliveira R, Esteves C, Marques A, Poirel L, Aires-de-Sousa M (2023) ESBL and carbapenemase-producing \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e among bivalves from Portuguese shellfish production areas. Microorganisms 11(2): 415. https://doi.org/10.3390/microorganisms11020415 \u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a J, Garc\u0026iacute;a-Gal\u0026aacute;n MJ, Day JW, Boopathy R, White JR, Wallace S, Hunter RG (2020) A review of emerging organic contaminants (EOCs), antibiotic resistant bacteria (ARB), and antibiotic resistance genes (ARGs) in the environment: Increasing removal with wetlands and reducing environmental impacts. Bioresour Technol 307: 123228. https://do i.org/10.1016/j.biortech.2020.123228\u003c/li\u003e\n\u003cli\u003eGhatak S, Singha A, Sen A, Guha C, Ahuja A, Bhattacharjee U, Das S, Pradhan NR, Puro K, Jana C, Dey TK (2013) Detection of New Delhi Metallo-beta-Lactamase and Extended-Spectrum beta-Lactamase Genes in \u003cem\u003eEscherichia coli\u003c/em\u003e Isolated from Mastitic Milk Samples. Transbound Emerg Dis 60(5): 385\u0026ndash;389. https://doi.org/10.1111/tbed.12119 \u003c/li\u003e\n\u003cli\u003eGupta MD, Das A, Islam MZ, Biswas PK (2016) Prevalence of sorbitol non-fermenting Shiga toxin-producing \u003cem\u003eEsc\u003c/em\u003e\u003cem\u003eherichia coli\u003c/em\u003e in Black Bengal goats on smallholdings. Epidemiol Infect 144(12): 2501\u0026ndash;2508. https://doi.org/10.1017/S0950268816001047 \u003c/li\u003e\n\u003cli\u003eGupta MD, Sen A, Shaha M, Dutta A, Das A (2022) Occurrence of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e carrying antimicrobial resistance genes in sheep on smallholdings in Bangladesh. Vet Med Sci 8: 2616\u0026ndash;2622. https://doi.org/10.1002/vms3.935 \u003c/li\u003e\n\u003cli\u003eHabets A, Antoine C, Wagemans J, Vermeersch M, Lafor\u0026ecirc;t F, Diderich J, Lavigne R, Mainil J, Thiry D (2022a) Impact of Shiga-toxin encoding gene transduction from O80:H2 Shiga toxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) on non-STEC strains. Sci Rep 12(1):21587. https://doi.org/10.1038/s41598-022-26198-8 \u003c/li\u003e\n\u003cli\u003eHabets A, Touzain F, Lucas P, Huong NTT, Iguchi A, Cromb\u0026eacute; F, Korsak N, Pi\u0026eacute;rard D, Saulmont M, Cox E, Engelen F, Mainil J, Thiry D (2022b) Identification of five serotypes of enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e from diarrheic calves and healthy cattle in Belgium and comparative genomics with shigatoxigenic \u003cem\u003eE. coli\u003c/em\u003e. Vet Sci 9(12): 692. https://doi.org/10.3390/vet sci9090492\u003c/li\u003e\n\u003cli\u003eHua Y, Bai X, Zhang J, Jernberg C, Chromek M, Hansson S, Frykman A, Yang X, Xiong Y, Wan C, Matussek A (2020) Molecular characteristics of eae-positive clinical Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e in Sweden. Emerg Microbes Infect 9(1): 2562\u0026ndash;70. https://doi.org/10.1080/22221751.2020.1850182\u003c/li\u003e\n\u003cli\u003eIslam MA, Heuvelink AE, De Boer E, Sturm PD, Beumer RR, Zwietering MH, Faruque ASG, Haque R, Sack DA, Talukder KA (2007) Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e isolated from patients with diarrhoea in Bangladesh. J Med Microbiol 56(3): 380\u0026ndash;385. https://doi.org/10.1099/jmm.0.46916-0 \u003c/li\u003e\n\u003cli\u003eJerse AE, Yu J, Tall BD, Karper JB (1990) A genetic locus of enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA 87: 7839\u0026ndash;7843. https://doi.org/10.1073/pnas.87.20.7839 \u003c/li\u003e\n\u003cli\u003eJohura FT, Parveen R, Islam A, Sadique A, Rahim MN, Monira S, Khan AR, Ahsan S, Ohnishi M, Watanabe H, Chakraborty S (2017) Occurrence of hybrid \u003cem\u003eEscherichia coli\u003c/em\u003e strains carrying Shiga toxin and heat-stable toxin in livestock of Bangladesh. Front Public Health 4: 287. https:// doi.org/10.3389/fpubh.2016.00287 \u003c/li\u003e\n\u003cli\u003eKaper JB, O\u0026rsquo;Brien AD (2014) Overview and historical perspectives. In: Sperandio V, Hovde CJ (eds) Enterohemorrhagic\u003cem\u003e Escherichia coli\u003c/em\u003e and other Shiga toxin-producing \u003cem\u003eE. coli\u003c/em\u003e. ASM Press, Washington, pp 3\u0026ndash;13. https://doi.org/10.1128/microbiolspec.ehec-0028-2014 \u003c/li\u003e\n\u003cli\u003eKaper JB, Elliott S, Sperandio V, Perna NT, Mayhew GF, Blattner FR (1998) Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In: Kaper JB, O\u0026apos;Brien AD (eds) \u003cem\u003eEscherichia coli\u003c/em\u003e O157:H7 and other Shiga toxin-producing \u003cem\u003eE. coli\u003c/em\u003e strains. ASM Press, Washington, pp 163\u0026ndash;182.\u003c/li\u003e\n\u003cli\u003eKarama M, Mainga AO, Cenci-Goga BT, Malahlela M, El-Ashram S, Kalake A (2019) Molecular profiling and antimicrobial resistance of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e O26, O45, O103, O121, O145, and O157 isolates from cattle on cow-calf operations in South Africa. Sci Rep 9(1): 11930. https://doi.org/10.1038/s41598-019-47948-1 \u003c/li\u003e\n\u003cli\u003eKhan ER, Aung MS, Paul SK, Ahmed S, Haque N, Ahamed F, Sarkar SR, Roy S, Rahman MM, Mahmud MC, Hossain MA (2018) Prevalence and molecular epidemiology of clinical isolates of \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e harboring extended-spectrum beta-lactamase and carbapenemase genes in Bangladesh. Microb Drug Resist 24(10): 1568\u0026ndash;1579. https://doi.org/10.1089/mdr.2018.0063 \u003c/li\u003e\n\u003cli\u003eKim YR, Kim SI, Lee JY, Park YJ, Lee KY, Kang MW (2005) Nosocomial Transmission of CTX-M-15 and OXA30 \u0026beta;-lactamase-producing \u003cem\u003eEscherichia coli\u003c/em\u003e in a neurosurgical intensive care unit. Ann Clin Lab Sci 35(3): 297\u0026ndash;301. \u003c/li\u003e\n\u003cli\u003eK\u0026ouml;ck R, Daniels-Haardt I, Becker K, Mellmann A, Friedrich AW, Mevius D, Schwarz S, Jurke A (2018) Carbapenem resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: a systematic review. Clin Microbiol Infect 24(12): 1241\u0026ndash;1250. https://doi.or g/10.1016/j.cmi.2018.04.004 \u003c/li\u003e\n\u003cli\u003eKonno T, Yatsuyanagi J, Takahashi S, Kumagai Y, Wada E, Chiba M, Saito S (2012) Isolation and identification of \u003cem\u003eEscherichia albertii\u003c/em\u003e from a patient in an outbreak of gastroenteritis. Jpn J Infect Dis 65(3): 203\u0026ndash;207. https://doi.org/10.7883/yoken.65.203 \u003c/li\u003e\n\u003cli\u003eKr\u0026uuml;ger A, Lucchesi PM, Sanso AM, Etcheverr\u0026iacute;a AI, Bustamante AV, Burg\u0026aacute;n J, Fern\u0026aacute;ndez L, Fern\u0026aacute;ndez D, Leotta G, Friedrich AW, Padola NL (2015) Genetic characterization of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e O26:H11 strains isolated from animal, food, and clinical samples. Front Cell Infect Microbiol 5: 74. https://doi.org/10.3389/fcimb.2015.00074 \u003c/li\u003e\n\u003cli\u003eLambertini E, Karns JS, Van Kessel JAS, Cao H, Schukken YH, Wolfgang DR, Smith JM, Pradhan AK (2015) Dynamics of \u003cem\u003eEscherichia coli\u003c/em\u003e virulence factors in dairy herds and farm environments in a longitudinal study in the United States. Appl Environ Microbiol 81(13): 4477\u0026ndash;4488. https://doi.org/10.1128/AEM.00465-15 \u003c/li\u003e\n\u003cli\u003eManna S, Brahmane M, Das R, Chandana M, Batabyal S (2006) Detection of \u003cem\u003eEscherichia coli\u003c/em\u003e O157 in foods of animal origin by culture and multiplex polymerase chain reaction. J Food Sci Tech 43(1): 77\u0026ndash;79. https://cabidigitallibrary.org/doi/full/10.5555/20063012345 \u003c/li\u003e\n\u003cli\u003eManohar P, Shanthini T, Ayyanar R, Bozdogan B, Wilson A, Tamhankar AJ, Nachimuthu R, Lopes BS (2017) The - distribution of carbapenem-and colistin-resistance in Gram-negative bacteria from the Tamil Nadu region in India. J Med Microbiol 66(7): 874\u0026ndash;883. https://doi.org/10.1099/jmm.0.000508 \u003c/li\u003e\n\u003cli\u003eMelton-Celsa AR (2014) Shiga toxin (Stx) classification, structure and function. Microbiol Spectr 2(4): 10-128. https://doi.org/10.1128/microbiolspec.ehec-0024-2013 \u003c/li\u003e\n\u003cli\u003eMir RA, Kudva IT (2019) Antibiotic-resistant Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e: an overview of prevalence and intervention strategies. Zoonoses Public Health 66(1): 1\u0026ndash;13. https://doi.org/10.1111/zph.12533 \u003c/li\u003e\n\u003cli\u003eMohammed Y, Gadzama GB, Zailani SB, Aboderin AO (2016) Characterization of extended-spectrum beta-lactamase from \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella\u003c/em\u003e species from North Eastern Nigeria. J Clin Diagn Res 10(2): DC07. https://doi.org/10.7860/JCDR/2016/16330.7254 \u003c/li\u003e\n\u003cli\u003eMomtaz H, Dehkordi FS, Rahimi E, Ezadi H, Arab R (2013) Incidence of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e serogroups in ruminant\u0026apos;s meat. Meat Sci 95(2): 381\u0026ndash;388. https://doi. org/10.1016/j.meatsci.2013.04.051\u003c/li\u003e\n\u003cli\u003eMontso PK, Mlambo V, Ateba CN (2019) The first isolation and molecular characterization of Shiga toxin-producing virulent multidrug-resistant atypical enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e O177 serogroup from South African Cattle. Front Cell Infect Microbiol 9: 333. https://doi.org/10.3389/fcimb.2019.00333 \u003c/li\u003e\n\u003cli\u003eMoxley RA, Smith DR (2010) Attaching-effacing \u003cem\u003eEscherichia coli\u003c/em\u003e infections in cattle. Vet Clin North Am Food Anim Pract 26(1): 29\u0026ndash;56. https://doi.org/10.1016/j.cvfa.2009.10.011 \u003c/li\u003e\n\u003cli\u003eMughini Gras L, Van Pelt W, Van der Voort M, Heck M, Friesema I, Franz E (2018) Attribution of human infections with Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) to livestock sources and identification of source-specific risk factors, The Netherlands (2010\u0026ndash;2014). Zoonoses Public Health 65(1): e8\u0026ndash;22. https://doi.org/10.1111/zph.12403 \u003c/li\u003e\n\u003cli\u003eMurugan MS, Sinha DK, Kumar OV, Yadav AK, Pruthvishree BS, Vadhana P, Nirupama KR, Bhardwaj M, Singh B R (2019) Epidemiology of carbapenem-resistant \u003cem\u003eEscherichia coli\u003c/em\u003e and first report of blaVIM carbapenemases gene in calves from India. Epidemiol Infect 147: e159. https://doi.org/10.1017/S0950268819000463 \u003c/li\u003e\n\u003cli\u003eNada HG, El-Tahan AS, El-Didamony G, Askora A (2023) Detection of multidrug-resistant Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e in some food products and cattle faeces in Al-Sharkia, Egypt: one health menace. BMC Microbiol 23(1): 127. https://doi.org/10.1186/s12866-023-02873-2 \u003c/li\u003e\n\u003cli\u003eNagel S, Sp\u0026uuml;ler M (2019) World\u0026rsquo;s fastest brain\u0026ndash;computer interface: combining EEG2Code with deep learning. PLoS One 14(9): e0221909. https://doi.org/10.1371/journal.pone.0221909 \u003c/li\u003e\n\u003cli\u003eNahar A, Islam AA, Islam MN, Khan MK, Khan MS, Rahman AA, Alam MM (2023) Molecular characterization and antibiotic resistance profile of ESBL-producing \u003cem\u003eEscherichia coli\u003c/em\u003e isolated from healthy cow raw milk in smallholder dairy farms in Bangladesh. Vet World 16 (6): 1333. https://doi.org/10.14202/vetworld.2023. 1333-1339 \u003c/li\u003e\n\u003cli\u003ePalmeira JD, Ferreira HMN (2020) Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in cattle production\u0026ndash;a threat around the world. Heliyon 6 (1). https:// doi.org/10.1016/j.heliyon.2020.e03206 \u003c/li\u003e\n\u003cli\u003ePaton JC, Paton AW (1998) Pathogenesis and diagnosis of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e infections. Clin\u003cem\u003e \u003c/em\u003eMicrobiol Rev 11: 450\u0026ndash;479. https://doi.org/10.1128/cmr.11.3.450 \u003c/li\u003e\n\u003cli\u003ePersad AK, Lejeune JT (2015) Animal reservoirs of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e. In: Hovde CJ, Sperandio V (eds) Enterohemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e and other Shiga toxin-producing \u003cem\u003eE. coli\u003c/em\u003e. ASM Press, Washington, pp 211\u0026ndash;230. https://doi.org/10.1128/9781555 818791.ch11 \u003c/li\u003e\n\u003cli\u003ePierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB, Bobenchik AM, Lockett ZC, Charnot-Katsikas A, Ferraro MJ, Thomson RB, Jenkins SG, Limbago BM, Das S (2017) Modified Carbapenem Inactivation Method for Phenotypic Detection of Carbapenemase Production among Enterobacteriaceae. J Clin Microbiol 55(8): 2321-33. https:// doi.org/10.1128/jcm.00193-17 \u003c/li\u003e\n\u003cli\u003ePoirel L, Walsh TR, Cuvillier V, Nordmann P (2011) Multiplex PCR for the detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 70(1): 119\u0026ndash;123. https://doi.org/10.1016/j.diag microbio.2010.12.002 \u003c/li\u003e\n\u003cli\u003eRanjbar R, Safarpoor Dehkordi F, Sakhaei Shahreza MH, Rahimi E (2018) Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing \u003cem\u003eEscherichia coli\u003c/em\u003e strains isolated from raw milk and traditional dairy products. Antimicrob Resist Infect Control 7(1): 53. https://doi. org/10.1186/s13756-018-0345-x \u003c/li\u003e\n\u003cli\u003eRam\u0026iacute;rez-Castillo FY, Guerrero-Barrera AL, Avelar-Gonz\u0026aacute;lez FJ (2023) An overview of carbapenem-resistant organisms from food-producing animals, seafood, aquaculture, companion animals, and wildlife. Front Vet Sci 10: 1158588. https://doi.org/10.3389/fvets.2023.1158588\u003c/li\u003e\n\u003cli\u003eSeman A, Mihret A, Sebre S, Awoke T, Yeshitela B, Yitayew B, Aseffa A, Asrat D, Abebe T (2022) Prevalence and molecular characterization of extended spectrum \u0026beta;-Lactamase and carbapenemase-producing Enterobacteriaceae isolates from bloodstream infection suspected patients in Addis Ababa, Ethiopia. Infect Drug Resist 1: 1367\u0026ndash;1382. https://doi.org/10.2147/IDR.S349566 \u003c/li\u003e\n\u003cli\u003eTaggar G, Attiq Rheman M, Boerlin P, Diarra MS (2020) Molecular epidemiology of carbapenemases in Enterobacteriales from humans, animals, food, and the environment. Antibiotics 9(10): 693. https://doi.org/10.3390/anti biotics9100693 \u003c/li\u003e\n\u003cli\u003eVan Duin D, Paterson DL (2016) Multidrug-resistant bacteria in the community: trends and lessons learned. Infect - Dis Clin 30(2): 377\u0026ndash;390. https://doi.org/10.1016/j.idc.2016.02.004 \u003c/li\u003e\n\u003cli\u003eWani SA, Bhat MA, Samanta I, Nishikawa Y, Buchh AS (2003) Isolation and characterization of Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) and enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (EPEC) from calves and lambs with diarrhoea in India. Lett Appl Microbiol 37: 121\u0026ndash;126. https:// doi.org/10.1046/j.1472-765X.2003.01364.x \u003c/li\u003e\n\u003cli\u003eWorld Health Organization (2019) Shiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) and food: attribution, characterization, and monitoring. World Health Organization, Geneva. \u003c/li\u003e\n\u003cli\u003eYang X, Bai X, Zhang J, Sun H, Fu S, Fan R, Xiong Y (2020) \u003cem\u003eEscherichia coli\u003c/em\u003e strains producing a novel Shiga toxin 2 subtype circulates in China. Int J Med Microbiol 310(1): 151377. https://doi.org/10.1016/j.ijmm.2019.1 51377 \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Shiga toxin-producing Escherichia coli, Intimin-producing STEC, Extended-spectrum β-lactamase genes, Carbapenemase genes, Diarrhoeic calves, Multidrug resistance, Public health risk","lastPublishedDoi":"10.21203/rs.3.rs-8510259/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8510259/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eShiga toxin-producing \u003cem\u003eEscherichia coli\u003c/em\u003e (STEC) is a pathotype of \u003cem\u003eE\u003c/em\u003e. \u003cem\u003ecoli\u003c/em\u003e associated with a wide variety of diarrhoea in neonatal calves, causing a global economic loss in the dairy industry with significant zoonotic risks via STEC and intimin-producing STEC, resulting in enteric and systemic illness, including diarrhoea, haemorrhagic colitis (HC), and haemolytic uremic syndrome (HUS) in humans. The prominence of multidrug-resistant (MDR) STEC from neonatal diarrhoeic calves is increasing public health risks and restricted treatment alternatives. The prevalence of STEC was investigated in 75 rectal swabs from diarrhoeic calves aged\u0026thinsp;\u0026le;\u0026thinsp;12 weeks, collected before initiating antibiotic treatment. The \u003cem\u003eE. coli\u003c/em\u003e isolation rate among diarrhoeic calves was 80% (60/75; 95% CI: 69.17\u0026ndash;88.35). The presence of \u003cem\u003estx\u003c/em\u003e genes (\u003cem\u003estx1\u003c/em\u003e, \u003cem\u003estx2\u003c/em\u003e), intimin-producing \u003cem\u003eeae\u003c/em\u003e gene, carbapenemase-producing genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e group and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e group), and extended-spectrum β-lactamase genes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e group, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e group, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e group) was screened by polymerase chain reaction (PCR). The prevalence of pathogenic \u003cem\u003eE. coli\u003c/em\u003e was 13.33% (10/75; 95% CI: 6.5\u0026ndash;23.1). The STEC isolates were detected in 12% (9/75, 95% CI: 5.64\u0026ndash;21.56). Of these pathogenic \u003cem\u003eE. coli\u003c/em\u003e isolates, the STEC with both \u003cem\u003estx\u003c/em\u003e genes, \u003cem\u003estx1\u003c/em\u003e only, and \u003cem\u003estx2\u003c/em\u003e only genotypes were present in 40% (4/10) and 10% (1/10), respectively. Intimin-producing STEC isolates (\u003cem\u003eeae\u003c/em\u003e-STEC) were identified in 40% (4/10) among the pathogenic isolates, with the following genotypes: \u003cem\u003estx1\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e (2/10, 20%), \u003cem\u003estx2\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e (1/10, 10%), \u003cem\u003eand stx1\u0026thinsp;+\u0026thinsp;stx2\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e (1/10, 10%). Only one (1/10, 10%) \u003cem\u003eeae-\u003c/em\u003eencoded non-STEC isolate was found, called enteropathogenic \u003cem\u003eE. coli\u003c/em\u003e (EPEC). All STEC (100%) isolates were tested positive for either ESBL or carbapenemase or both ESBL and carbapenemase in the phenotypic assays. ESBL-producing STEC isolates were genetically identified in 6.67% (5/75) with the following combinations: three isolates coharbored \u003cem\u003estx1\u003c/em\u003e-\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, two had \u003cem\u003estx1\u003c/em\u003e-\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSHV\u003c/sub\u003e, and \u003cem\u003estx2\u003c/em\u003e-\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e, respectively. All intimin-producing STEC (\u003cem\u003eeae-\u003c/em\u003eSTEC) isolates were both ESBL and carbapenemase producers, which were identified in 5.33% (4/75), with followings genotypic expression: \u003cem\u003estx1\u0026thinsp;+\u0026thinsp;stx2\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e\u003cb\u003e/\u003c/b\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e in 1.33% (1/75), \u003cem\u003estx1\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e\u003cb\u003e/\u003c/b\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e+\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e in 1.33% (1/75), \u003cem\u003estx1\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e\u003cb\u003e/\u003c/b\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e +\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e \u003cem\u003e+bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e in 1.33% (1/75), and \u003cem\u003estx1\u0026thinsp;+\u0026thinsp;eae\u003c/em\u003e\u003cb\u003e/\u003c/b\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u003c/sub\u003e +\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e \u003cem\u003e+bla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e in 1.33% (1/75). ESBL and carbapenemase-producing \u003cem\u003eeae\u003c/em\u003e-STEC isolates were more likely to be multidrug-resistant (MDR) than ESBL-STEC and EPEC isolates. The highest antimicrobial resistance rates were observed in ciprofloxacin and meropenem (100%), nitrofurantoin and cefoxitin (90%), ampicillin, streptomycin, and trimethoprim-sulfamethoxazole (80%), chloramphenicol (70%), and doxycycline, tetracycline, and cefotaxime (60%). In contrast, the lowest resistance rates were found in gentamycin (20%) and amoxicillin-clavulanate (40%). In terms of pathogenicity, only STEC isolates induced mild to moderate non-bloody diarrhoea, whereas intimin-producing STEC caused severe bloody diarrhoea with 100% mortality (4/4) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in neonatal calves. To the best of our knowledge, this is the first report on ESBL and carbapenemase-producing MDR STEC from diarrhoeic calves in Bangladesh.\u003c/p\u003e","manuscriptTitle":"Genotypic Evidence of Extended-spectrum β-lactamase and Carbapenemase-producing Shigatoxigenic and Intimin-producing Shigatoxigenic Multidrug-resistant Escherichia coli from Diarrheic Calves: Hidden Zoonotic and Public Health Risk","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-12 08:09:44","doi":"10.21203/rs.3.rs-8510259/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-23T10:06:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-23T09:42:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-16T07:51:21+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-15T02:29:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"291206114456882752221437476373824374959","date":"2026-01-13T08:07:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81314145838117295470104611374721591236","date":"2026-01-12T08:36:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"249784692842732334933927896912049138882","date":"2026-01-08T10:40:15+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-08T10:33:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-06T23:35:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-06T23:34:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Veterinary Research Communications","date":"2026-01-04T04:24:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c5c3c6ac-b1fa-48a7-a0bd-302830a515a9","owner":[],"postedDate":"January 12th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T16:04:26+00:00","versionOfRecord":{"articleIdentity":"rs-8510259","link":"https://doi.org/10.1007/s11259-026-11203-6","journal":{"identity":"veterinary-research-communications","isVorOnly":false,"title":"Veterinary Research Communications"},"publishedOn":"2026-04-30 15:58:11","publishedOnDateReadable":"April 30th, 2026"},"versionCreatedAt":"2026-01-12 08:09:44","video":"","vorDoi":"10.1007/s11259-026-11203-6","vorDoiUrl":"https://doi.org/10.1007/s11259-026-11203-6","workflowStages":[]},"version":"v1","identity":"rs-8510259","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8510259","identity":"rs-8510259","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.