Sirt1 Protects Against Hippocampal Atrophy and its Induced Cognitive Impairment in Middle-aged Mice

Sirt1 Protects Against Hippocampal Atrophy and its Induced Cognitive Impairment in Middle-aged Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sirt1 Protects Against Hippocampal Atrophy and its Induced Cognitive Impairment in Middle-aged Mice Zuhao Sun, Shuang Zhao, Xinjun Suo, Yan Dou This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1126398/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background: Sirtuin 1 ( Sirt1 ) is a recognized longevity gene and has been shown to be associated with aging and its related diseases. Hippocampal volume is considered to be the most sensitive brain imaging phenotype for cognition, but the effect of Sirt1 on hippocampal morphology during aging has not been reported. Results: Herein, we investigated the effect of conditional Sirt1 knockdown on hippocampal volume in middle-aged mice, as well as its cognitive function and the underlying molecular mechanisms. Brain structural magnetic resonance imaging (MRI) showed that adeno-associated virus (AAV) mediated hippocampal Sirt1 knockdown caused hippocampal atrophy in 8-month-old mice. Open field test (OFT) and Morris Water Maze (MWM) test revealed that hippocampal Sirt1 knockdown significantly weakened spatial learning and memory of mice without effect on anxiety and exploratory behavior. Western blotting analysis showed that p-tau levels were significantly increased while PSD95 levels were obviously reduced, indicating that hippocampal Sirt1 knockdown could activate tau pathology and synaptic damage. Conclusions: This work revealed that Sirt1 is an important protective gene against hippocampal atrophy and its induced cognitive impairment during aging, providing potential therapeutic targets for the prevention and intervention of aging-related neuropsychic diseases. Cognitive Neuroscience Sirt1 Aging Hippocampal atrophy Brain structural MRI Learning and memory Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Background Aging is an important social problem facing all countries in the world today. One of the neurodegenerative diseases highly related to aging is Alzheimer’s disease (AD), whose incidence increases with age [ 1 , 2 ]. The main clinical manifestations of AD are cognitive and memory impairment, accompanied by atrophy in hippocampus and other related brain areas [ 3 – 6 ] Its recognized pathological features mainly include β-amyloid plaques, neurofibrillary tangles and neuronal death [ 4 ]. The 2020 world AD report suggested that brain volume atrophy occur much earlier than clinically observed symptoms of cognitive dysfunction [ 7 ]. Moreover, synaptic loss has been confirmed to be closely associated with the progression of cognitive impairment, often preceding neurodegenerative changes in above-described pathological features [ 8 – 10 ]. Therefore, it is of great significance to find effective neuroprotective intervention targets for delaying hippocampal atrophy and synaptic damage during aging and preventing AD. Epigenetic regulation, such as histone post-translational modification and DNA methylation, has recently been revealed to play an important role in maintaining normal brain function, which can stabilize gene expression patterns in the brain and be crucial for long-term memory storage of information [ 11 – 13 ]. Histone deacetylation is a common type of histone post-translational modification [ 14 ]. One of the key factors affecting histone deacetylation is histone deacetyltransferase (HDACs), which consists of four classes (Class I, II, III and IV), and Class III HDAC is the sirtuin family [ 15 ]. The sirtuin family is a highly conserved class of HDACs that plays multiple functions in aging, chromatin integrity, metabolic regulation and longevity [ 16 ]. Sirtuin 1 (SIRT1), the most widely studied gene, is mainly expressed in neurons and has been reported to play a key role in regulating nerve progenitor cell fate, axonal dendritic differentiation and synaptic plasticity [ 17 ]. Changes in Sirt1 expression have been proved to be closely related to the progression of cognitive impairment and AD pathology. Studies have shown that Sirt1 overexpression in the hippocampus can induce cognitive enhancement in both 3xTg-AD model mice and healthy non-transgenic mice [ 18 ]. Furthermore, Sirt1 overexpression in Tauopathy mouse models can enhance the activation of ubiquitin-proteasome system (UPS) and effective cleared phosphorylated tau protein (p-tau) [ 19 , 20 ]. In Sirt1 knockout mice, the brain morphology and dendritic spine structure were similar to those of healthy mice, but the complexity of synaptic network was reduced and synaptic plasticity was weakened [ 21 , 22 ]. In conclusion, Sirt1 gene has an obvious neuroprotective effect, and exploring its protective effect on cognitive function of healthy aged mice is of great significance for the prevention of cognitive disorders such as AD. Herein, we studied the neuroprotective effect of Sirt1 gene on hippocampal volume and cognitive function in middle-aged mice. First, Sirt1 interference plasmid was constructed and packaged with lentivirus to verify its knockdown efficiency in mouse glioma cells. Then, the plasmid with the best knockdown efficiency was packaged as adeno-associated virus (AAV) and injected into the dorsal hippocampal CA1 region of 8-month-old C57/BL mice, compared with no-load AAV injection. After three weeks, 3T brain structural magnetic resonance imaging (MRI) was used to detect the hippocampal volume, and then open field test (OFT) and Morris water maze (MWM) test were performed to assess the learning and memory ability of mice. Finally, hippocampal tissues were taken out for western blotting to evaluate the changes of AD pathological marker p-tau as well as synaptic marker PSD95 and synaptophysin. This work revealed that Sirt1 is an important protective gene in maintaining hippocampal volume and cognitive function during aging, providing potential therapeutic targets for the prevention and intervention of aging-related diseases such as AD. 2. Results 3.1 Sirt1 shRNA knockdown efficiency in vitro and in vivo In order to select the shRNA against Sirt1 with significant knockdown efficiency, two Sirt1 -interfering plasmids (sh-Sirt1A, sh-Sirt1B) were constructed and packaged by lentivirus. Then GL261 cells were transfected with these Sirt1 -interfering lentiviruses, and real-time quantitative polymerase chain reaction (RT-qPCR) was performed to detect knockdown efficiency of sh-Sirt1A and sh-Sirt1B. The results showed that Sirt1 mRNA expression levels of both sh-Sirt1A (t 2 = 10.29, p = 0.0005) and sh-Sirt1B (t 2 = 4.234, p = 0.0133) were much lower than those of the sh-SCR group, and the sh-Sirt1A group had the lowest expression level (Figure 1 A). Therefore, the Sirt1 -interfering plasmid with sh-Sirt1A sequence was used in subsequent experiments. For in vivo transfection, the sh-Sirt1A plasmid containing the EGFP reporter gene was used for AAV packaging, and AAV packaging the plasmid only expressing EGFP was used for sham operation (Figure 1 B). In this study, 8-month-old C57/BL mice were randomly divided into three groups (control, sham, shSirt1) [ 23 ]. Hippocampal Sirt1 knockdown in the shSirt1 group was conducted by stereotactic injection of AAV-CMV-shSirt1-EGFP into the dorsal hippocampal CA1 region (Figure 1 C), a brain region closely related to cognition [ 24 ]. Mice in the sham group were injected with AAV-CMV-EGFP and the mice in the control group suffered none treatment. Three weeks after injection, fluorescence imaging based on frozen sections of the whole brain showed the obvious green fluorescence of EGFP along the CA1 region (Figure 1 D), indicating the successful AAV transfection. Hippocampus plays a vital role in cognition and many factors can cause its morphological changes and functional impairment, such as AD and aging [ 25 ]. So, we would like to explore the impact of Sirt1 knockdown on hippocampal volume. Therefore, we designed to measure the hippocampal volume of mice by 3T MR brain structural imaging. Then, we evaluated spatial learning and memory of mice by OFT and MWM test. Finally, western blotting was used to detect changes in protein levels of AD pathological marker p-tau as well as synaptic marker PSD95 and synaptophysin in the hippocampus after Sirt1 knockdown (Figure 1 E). 3.2 Sirt1 knockdown reduced hippocampal volume in middle-aged mice 3T brain structural MRI was performed on mice in three groups to detect hippocampal volume. According to TMBTA, the mice brains were segmented to measure the total intracranial volume (TIV), the volume of hippocampal formation, the total hippocampal volume, and the volumes of hippocampal subregions including dentate gyrus (DG) region, CA1 region, CA2 region and CA3 region (Figure 2 A). Results showed that there was no statistical difference in the TIV among the three groups (Figure 2 B). In the case of regression of the TIV, we performed two-sample t-test on above volumes of mice between groups. The volume of hippocampal formation in the shSirt1 group was slightly smaller compared with the control group and the sham group without statistical significance (Figure 2 C). Surprisingly, the total hippocampal volume in the shSirt1 group was significantly lower (t 2 = 2.578, p = 0.0172) than that in the control group (Figure 2 D). Further analysis of the various structures of the hippocampus revealed that the most obvious region of atrophy caused by hippocampal Sirt1 knockdown was the DG region compared to the control group (t 2 = 3.312, p = 0.0032) (Figure 2 E), followed by CA1 region (t 2 = 2.192, p = 0.0392) (Figure 2 F), and there was no statistical difference in the volume of other regions (Figure 2 G,H). Compared with the control group, the total hippocampal volume and each subregion volume in the sham group showed a decreasing trend, but there was no statistical difference, which might be a slight effect caused by stereotactic injection. The reduction of hippocampal volume, also defined as hippocampal atrophy, is a well-established and validated biomarker for cognitive impairment [ 26 , 27 ]. Based on our MRI results, we reasonably speculate that AAV-mediated hippocampal knockdown of Sirt1 would cause the burden to the cognitive functions such as learning and memory in middle-aged mice. 2.3 Sirt1 knockdown caused cognitive impairment in middle-aged mice To verify the adverse effects of hippocampal Sirt1 knockdown on cognitive function, we implemented proper behavioral paradigms including OFT and MWM test. First, OFT was conducted as one of the most popular behavioral tests to assess the loco-motor activity and exploratory behavior in rodents [ 28 ]. Mice were allowed to freely explore in the experimental chamber for 15 min without any visual, auditory and olfactory disturbance, and their movements were analyzed. It was found that mice behaved similarly among three groups and preferred to spend little time (14% - 17%) exploring the center zone (Figure 3 A). The trajectory maps showed that mice in three groups moved mainly in the peripheral zone and occasionally moved into the center zone (Figure 3 B). Our OFT results consisted with previously reported study [ 23 ], indicating that hippocampal Sirt1 knockdown had no effect on anxiety and exploratory behavior in middle-aged mice. Then, MWM test was performed to assess spatial learning and memory of mice in three groups [ 29 ]. It was found that there was no statistical difference on swimming speed among three groups, indicating that all mice had normal vision and locomotor ability (Figure 3 C). During the 5-day learning phase, the escape latency of mice in the shSirt1 group was gradually prolonged, and the difference was significant from the 4th day, compared with the control group (day4: t 2 = 3.228, p = 0.0032; day5: t 2 = 3.504, p = 0.0016) and the sham group (day4: t 2 = 2.096, p = 0.0468; day5: t 2 = 2.313, p = 0.0296) (Figure 3 E). After removing the platform on the sixth day, mice in the shSirt1 group showed more chaotic swimming paths, while mice in the other two groups were more concentrated in the target zone where the platform was located (Figure 3 D). Mice in the shSirt1 group exhibited shorter time in target zones, compared to the control group (t 2 = 2.614, p = 0.0142) and the sham group (t 2 =2.171, p = 0.0396) (Figure 3 F). Less number of crossings over the platform region was also found in the shSirt1 group than that in the control group (t 2 = 2.697, p = 0.0121) and the sham group (t 2 = 2.238, p = 0.0352) (Figure 3 G). These results revealed that conditional Sirt1 downregulation in the hippocampus causes impairment to spatial learning and memory of middle-aged mice without effect on exploratory behavior. 2.4 Sirt1 knockdown can activate tau pathology and induce synaptic damage To further analyze underlying biological mechanisms of hippocampal Sirt1 knockdown, the hippocampi of mice in three groups were manually dissected out and western blotting was performed to detect molecular changes. As mentioned above, Sirt1 can contribute to p-tau clearance in AD model mice [ 30 ] and maintenance of synaptic plasticity [ 22 ]. So, the protein expressions of p-tau as well as PSD95 and synaptophysin were detected in the shSirt1 group compared to the control group and the sham group. First, the significant deceased levels of Sirt1 in the shSirt1 group (control group: t 2 = 13.32, p = 0.0002; sham group: t 2 =4.37, p = 0.012) confirmed the successful downregulation of Sirt1 in the hippocampus (Figure 4 A). As expected, the levels of p-tau, as one of the important pathological features and biomarkers of AD [ 31 ], were significantly upregulated in the shSirt1 group compared to the control group (t 2 = 4.068, p = 0.0152) and the sham group (t 2 = 11.29, p = 0.0004) (Figure 4 B). The levels of PSD95, a postsynaptic protein regulating maturation of synapses and maintaining normal synaptic functions [ 32 , 33 ], was significantly reduced in the shSirt1 group compared to the control group (t 2 = 10.19, p = 0.0005) and the sham group (t 2 = 6.572, p = 0.0028) (Figure 4 C). Another important synaptic protein, synaptophysin, the most abundant membrane protein of synaptic vesicles involved in exo-endocytosis of synaptic vesicles [ 34 , 35 ], showed a very slight downregulation and no significant difference was found among the three groups (Figure 4 D). These results revealed that hippocampal Sirt1 knockdown can activate tau pathology and induce synaptic damage in the hippocampus of middle-aged mice. 3. Discussion Sirt1 is the first identified nicotinamide-adenine dinucleotide (NAD+)-dependent HDAC [ 36 ], and it regulates various biological processes such as cellular senescence [ 37 ], AD [ 38 ], cancer [ 39 ] and neuroinflammation [ 40 ]. Studies have shown that Sirt1 knockout ( Sirt1 -KO) would cause cognitive impairment and defects in synaptic plasticity, but the brains of Sirt1 -KO mice exhibited normal morphology [ 22 ]. Since the hippocampus is the main brain area for cognition and its volume is an important neuroimaging phenotype for clinical evaluation of AD [ 25 , 41 ], assessing hippocampal volume is more convincing for cognition evaluation than assessing changes in whole brain structure. Furthermore, the protective effect of Sirt1 on hippocampal volume in aged mice has not been reported. Therefore, we performed 3T brain structural MRI to investigate the volume changes of hippocampus and its subregions caused by AAV-mediated hippocampal Sirt1 knockdown in middle-aged mice. Combined with OFT, MWM test and western blotting, we found that Sirt1 knockdown induced hippocampal atrophy was also accompanied by cognitive impairment, activation of hippocampal tau pathology and synaptic damage. shRNA is a widely used tool for gene knockdown with high specificity and selectivity [ 42 ]. Firstly, two Sirt1 -shRNA plasmids were designed and packaged as lentiviruses respectively to transfect G1261 cells. RT-qPCR based on the extracted RNA was used to detect the knockdown efficiency and the Sirt1 -shRNA plasmid with relatively highest knockdown efficiency was selected for subsequent AAV packaging. For in vivo studies, 8-month-old mice were used because they are widely considered to represent a healthy middle-aged mouse model. AAV expressing Sirt1 -shRNA was injected into bilateral CA1 of dorsal hippocampus by stereotactic injection, and 3T brain structural MRI was performed on the mice three weeks later. The results showed that in the case of regression of the TIV, the volumes of total hippocampus, DG and CA1 regions were significantly reduced in the shSirt1 group compared to the control group, while the volumes of hippocampal formation (hippocampus and parahippocampal area [ 43 ]), CA2 and CA3 regions were not significantly changed. The volumes of hippocampus and its subregions were slightly decreased in the sham group compared to the control group, which might be caused by stereotactic injection itself. These MRI results showed that Sirt1 knockdown resulted in a significant decrease in hippocampal volume. To assess hippocampus-mediated cognitive function, the classical behavioral paradigms, OFT and MWM test, were used to evaluate anxiety, exploratory activity and spatial learning and memory of mice. In 15-minute OFT, there were no statistical difference in trajectory map and time spent in the center zone among the three groups. Besides, time mice spent in the center zone in our study consisted with previously reported studies [ 23 , 44 ]. OFT results indicated that Sirt1 knockdown in the hippocampus had no effect on anxiety and exploratory activity in middle-aged mice. However, in the MWM test, the control group and the sham group showed similar purposeful swimming, while the shSirt1 group performed very poorly. MWM results indicated that Sirt1 knockdown in the hippocampus prolonged escape latency, reduced time spent in target zone and number of platform crossing, and seriously impaired the spatial learning and memory ability in middle-aged mice. Finally, hippocampal tissues of the three groups were isolated for western blotting to examine the potential mechanisms of Sirt1 knockdown in regulating hippocampal atrophy and cognitive impairment. The significant decrease of Sirt1 levels confirmed the successful Sirt1 knockdown in mouse hippocampus. The significant increase of p-tau levels suggested that Sirt1 knockdown could activate tau pathology in mouse hippocampus. The obvious downregulation of PSD95 levels with the slight reduced levels of synaptophysin in the shSirt1 group showed the vital role of Sirt1 in maintaining synaptic integrity and function. 4. Conclusions Taken together, hippocampal Sirt1 knockdown could lead to hippocampal atrophy and its induced cognitive impairment in middle-aged mice, along with activation of tau pathology and synaptic damage. This work revealed the key role of Sirt1 in maintaining hippocampal volume to prevent cognitive impairment during aging, and provides important targets for the prevention and therapy of AD. 5. Materials And Methods 5.1 Construction and packaging of Sirt1 interference plasmid According to the design principles of shRNA and the nucleotide sequence of Sirt1 gene in GenBank (NM_019812.3), two Sirt1 shRNA sequences were designed. Forwardoligo and reverseoligo of sh-Sirt1A as follows: CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG;AATTCAAAAACGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCG; Forwardoligo and reverseoligo of sh-Sirt1B as follows: CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG;AATTCAAAAAGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGC. The synthesized single-stranded oligonucleotides were annealed to form double-stranded DNA, and then ligated with plko.1 by restriction enzyme BshTⅠ/EcoRⅠ. Then the competent bacterium DH5a was transformed and a single colony was selected and sequenced. The colonies with correct sequencing results were amplified to extract the target plasmids. We transfected the target plasmids, together with lentivirus vectors PAX8 and VSVG, into HEK293T cells for lentivirus packaging. The knockdown efficiency of obtained Sirt1 interference lentivirus were verified by Quantitative PCR in Mouse glioma cells Gl261. Briefly, we first transfected G1261 cells with lentivirus for 1 week. Then, total RNA was extracted from cells with a TRIzol reagent (Gibco, 15596018) according to the manufacturer’s instructions. Then RNA was reverse transcribed into cDNA with an RT-PCR kit (Accurate Biology, AG11705). Quantitative real-time RT-PCR (RT-qPCR) was carried out on a Mx3005p real-time polymerase chain-reaction system (Agilent Technologies, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q311-02) and the temperature was set as follows: initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 s at 95°C, 20 s at 58°C, and 45 s at 72°C. The PCR primers were designed as follows: forward, 5-GTGGCAGTAACAGTGACAGTGG-3; reverse, 5-TCCAGATCCTCCAGCACATTCG-3. The Sirt1 mRNA expression was normalized comparing to rpo. For transfection in vivo , the target plasmids were packaged with AAV by Lianyungang ChuangRui Biological Product Trading Company Ltd. (Jiangsu, China). The final titer of Sirt1 knockdown AAV (AAV-CMV-shSirt1-EGFP) and the no-load control AAV (AAV-CMV-EGFP) was 7.1×10 12 vp/mL and 3.5×10 12 vp/mL, respectively. 5.2 Animals C57BL/6J mice (8 months old, male, 35-40 g) were purchased from Beijing HFK Bioscience Co. Ltd. (Beijing, China). The mice were used for experiments at least 14 days after acclimatization to laboratory conditions. The mice were placed in polycarbonate cages with 3-5 mice per cage at a controlled temperature (22 ± 1°C) for 12-h light-dark cycle and ad libitum access to food and water. All animal experiments were performed in accordance to Animal Research: Reporting of In Vivo Experiments (ARRIVE guidelines)[ 45 ] and the guidelines of Institutional Animal Care and Use Committee at Tianjin Medical University (IACUC number E2015093) and following reported protocols[ 46 , 47 ]. 5.3 Hippocampal Sirt1 knockdown in aged mice The mice were randomly divided into three groups, each consisting of 14-16 mice: the untreated mice (control), the mice injected with AAV-CMV-EGFP (sham), and the mice injected with AAV-CMV-shSirt1-EGFP (shSirt1). The mice were anesthetized with inhalation of 2% isoflurane throughout the process by a small animal anesthesia machine (R510-22, RWD Life Science Co., Ltd., China). Then the mice were fixed on a stereotactic apparatus (G1124701, RWD Life Science Co., Ltd., China). Both AAV-CMV-EGFP and AAV-shSirt1-EGFP were diluted to 3.5 × 10 12 vp/mL. Bilateral injection with 1 µL of above AAV was performed into the dorsal hippocampal CA1 region, and stereotaxic coordinates were shown as follows: AP -2.00mm, ± ML 1.5mm, DV -1.0mm from bregma. The injection rate was controlled at 100 nL/min. The needle syringe was left in place for about 10 min before being withdrawn. The scalp was sutured, disinfected with iodophor, and the mice were kept warm. After awakening from anesthesia, they were put back into the cage. After three weeks, the construction of Sirt1 knockdown in mouse hippocampus was considered successful [ 48 ]. 5.4 Fluorescence staining of frozen mouse brain sections Mice were anesthetized with 3% isoflurane and executed by cervical dislocation. Then, mice were perfused with 20 mL 4% paraformaldehyde (Biosharp, China). Next, the whole brains were isolated properly and fixed in paraformaldehyde overnight. After dehydration in 10% sucrose solution (10% m/v sucrose in PBS) for 2 days, the brains were embedded into optimal cutting temperature compound (OCT) (Sakura, Japan) and frozen in -80°C for 1 day. The brains were sectioned into 20 µm slices at -22°C. The slices were collected on adhesion microscope slides (CITOTEST Scientific, China) and stained with DAPI. Finally, processed slices were observed and filmed by an Olympus IX73 inverted microscope (Japan). 5.5 3T brain structural MRI The mice were anesthetized 15 min MRI scanning by intraperitoneal injection with 4% chloral hydrate at 0.2 mL/10g. Then the mice were fixed on a semi-circular small animal scanning frame, their limbs were fixed with medical tape, and their heads were fixed by hanging a thin wire through the incisors. MRI was performed on a 3T MRI scanner (DISCOVERY MR750, General Electric, USA) with a mouse brain coil. The parameters for 3D T 1 -weighted fast acquisition of the whole mouse brain were as follows: repetition time (TR) = 12.6 ms, echo time (TE) = 6.0 ms, field of view (FOV) = 3.0×1.0 mm, slice thickness = 0.3 mm, number of slices = 1746, frequency = 180, phase = 150, prep time = 500 ms, flip angle = 12°, bandwidth = 15.63, locs per slab = 128, number of excitations = 4, and scan time = 20 min 9 s. For voxel-based morphometry (VBM) analysis, obtained MR DICOM files were subjected to conversion to NIFTI files using dcm2niix, augmentation of the voxel size 14 times using DPABI [ 49 ], automatic segmentation of hippocampus based on Turone Mouse Brain Atlas and Template (TMBTA) using SPM12 software [ 50 ]. In the case of regression of the total intracranial volume, the two-sample t-test was used to analyze the difference in gray matter volume between the three groups within the hippocampus. 5.6 Open field test Open field test (OFT) is a common animal behavior experiment to detect the loco-motor activity and exploratory behavior of mice. The open field apparatus (RWD Life Science Co., Ltd., China) consisted of a square arena (50 × 50 cm) with walls 45 cm high. The arena was divided into the center area (30 cm × 30 cm square) and the peripheral area. The mice arrived at the test site 24 h in advance to ensure that they were acclimated to the environment, and the mice were stroked for 1-2 min to reduce non-specific stress stimulation. Each mouse was gently and quickly placed in the central area with their backs to the experimenter, and the experimenter immediately left. The SMART3.0 digital tracking system (Panlab, USA) automatically recorded the movements of mice in the arena. The exploring time of each mouse was 15 min, and the proportion of time spent in the central area was measured. 5.7 Morris water maze test The Morris Water Maze (MWM) test is a classical behavioral task to test hippocampal-dependent learning and memory of mice, consisting of 5 days of learning phase and 1 day of probe phase. Room and water temperature were maintained at 22°C. A circular tank (120 cm diameter, 50 cm height) was divided into four quadrants with distinctive landmarks as visual cues, and equipped with a hidden platform (8 cm diameter, -1cm below the water surface). Before the test, the platform was lifted 1cm above the water surface, and the mouse was released to swim freely at the furthest site from the platform. The swimming speeds were recorded by the equipped SMART 3.0 Video Tracking System (Panlab, USA). Every day during learning phase, the mouse was released from each quadrant and swam for 60 s. Once the mouse found the platform within 60 s and stayed on it for 3 s, the system automatically recorded this period as escape latency. If the mouse did not find the platform within the 60 s, the system recorded escape latency as 60 s. The experimenter guided the mouse to the platform and allowed it to stay there for 10 s. On the sixth day, the platform was removed, the mouse was released at the furthest site from the platform and allowed to freely explore for 60 s. During probe phase, the swimming paths, the time spent in target quadrant, and the numbers of mice crossing the platform location were also recorded. 5.8 Western blotting Mouse hippocampal tissues were harvested, cut with ophthalmic scissors, and lysed with RIPA lysis buffer and Phenylmethylsulphonyl fluoride (PMSF) (Solarbio LIFE SCIENCES, P0100). The proteins were separated by 10-12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane (Merck, Ireland). Then, the membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated with primary antibodies overnight at 4°C. The primary antibodies included SIRT1 Polyclonal antibody (Proteintech, 13161-1-AP), Phospho-Tau (Ser396) Recombinant Polyclonal Antibody (5HCLC) (Invitrogen, 710298), PSD95-Specific, DLG4 Polyclonal Antibody (Proteintech, 20665) and Recombinant Anti-Synaptophysin antibody (Abcam, ab32127). After washing three times with PBST, the membranes were incubated with Goat Anti-Rabbit IgG H&L (HRP) (Abcam, ab205718) for 1 h at room temperature. β-Tubulin and GAPDH were used as internal controls. After washing three times with PBST, immunoreactive bands were visualized using enhanced chemi-luminescence (ECL) (NCM Biotech, P10300) detection regent, and the film was taken by a ChemiDoc XRS+ System (Biorad, USA). The densitometric analysis of band intensities was carried out using the Image J software (National Institutes of Health, Bethesda, MD, USA). 5.9 Statistical analysis All data were analyzed with SPSS R23.0.0.0 software. Data were expressed as mean ± standard error (SEM). Statistical comparisons between experimental group and control group or sham group were performed by using two-tailed unpaired Student's test. p < 0.05 was considered statistically significant. Declarations Ethics approval and consent to participate All animal experiments were approved by the Animal Ethics Committee of Tianjin Medical University (Number IACUC E2015093). Consent for publication Not applicable. Availability of data and materials All data generated during this study are included in this published article and its supplementary information files. Competing interests The authors declare no competing interests. Funding This work was supported by the National Key Research and Development Program of China (2018YFC1314300), and National Natural Science Foundation of China (82030053, 81971599, and 81771818). Authors' contributions Z.H.S., S.Z., X.J.S., and Y.D. designed research; Z.H.S., S.Z., and X.J.S. performed research; Z.H.S. and S.Z. analyzed data; Z.H.S., S.Z., and Y.D. wrote the paper. Acknowledgements Not applicable References Trevisan K, Cristina-Pereira R, Silva-Amaral D, Aversi-Ferreira TA: Theories of Aging and the Prevalence of Alzheimer's Disease . Biomed Res Int 2019, 2019 :9171424. Jiang L, Wang J, Wang Z, Huang W, Yang Y, Cai Z, Li K: Role of the Glyoxalase System in Alzheimer's Disease . J Alzheimers Dis 2018, 66 (3):887–899. Scheltens P, Blennow K, Breteler MM, de Strooper B, Frisoni GB, Salloway S, Van der Flier WM: Alzheimer's disease . Lancet 2016, 388 (10043):505–517. Tiwari S, Atluri V, Kaushik A, Yndart A, Nair M: Alzheimer's disease: pathogenesis, diagnostics, and therapeutics . Int J Nanomedicine 2019, 14 :5541–5554. Prasad K: AGE-RAGE stress: a changing landscape in pathology and treatment of Alzheimer's disease . Mol Cell Biochem 2019, 459 (1-2):95–112. Pini L, Pievani M, Bocchetta M, Altomare D, Bosco P, Cavedo E, Galluzzi S, Marizzoni M, Frisoni GB: Brain atrophy in Alzheimer's Disease and aging . Ageing Res Rev 2016, 30 :25–48. 2020 Alzheimer ' s disease facts and figures . Alzheimers Dement 2020. Dejanovic B, Huntley MA, De Maziere A, Meilandt WJ, Wu T, Srinivasan K, Jiang Z, Gandham V, Friedman BA, Ngu H et al : Changes in the Synaptic Proteome in Tauopathy and Rescue of Tau-Induced Synapse Loss by C1q Antibodies . Neuron 2018, 100 (6):1322-1336 e1327. Rabin LA, Smart CM, Amariglio RE: Subjective Cognitive Decline in Preclinical Alzheimer's Disease . Annu Rev Clin Psychol 2017, 13 :369–396. Anderson ND: State of the science on mild cognitive impairment (MCI) . CNS Spectr 2019, 24 (1):78–87. Berson A, Nativio R, Berger SL, Bonini NM: Epigenetic Regulation in Neurodegenerative Diseases . Trends Neurosci 2018, 41 (9):587–598. Berger SL, Kouzarides T, Shiekhattar R, Shilatifard A: An operational definition of epigenetics . Genes Dev 2009, 23 (7):781–783. Hwang JY, Aromolaran KA, Zukin RS: The emerging field of epigenetics in neurodegeneration and neuroprotection . Nat Rev Neurosci 2017, 18 (6):347–361. Watts BR, Wittmann S, Wery M, Gautier C, Kus K, Birot A, Heo DH, Kilchert C, Morillon A, Vasiljeva L: Histone deacetylation promotes transcriptional silencing at facultative heterochromatin . Nucleic Acids Res 2018, 46 (11):5426–5440. Wang J, Yu JT, Tan MS, Jiang T, Tan L: Epigenetic mechanisms in Alzheimer's disease: implications for pathogenesis and therapy . Ageing Res Rev 2013, 12 (4):1024–1041. Lee J, Kim Y, Liu T, Hwang YJ, Hyeon SJ, Im H, Lee K, Alvarez VE, McKee AC, Um SJ et al : SIRT3 deregulation is linked to mitochondrial dysfunction in Alzheimer's disease . Aging Cell 2018, 17 (1). Yan Y, Yang H, Xie Y, Ding Y, Kong D, Yu H: Research Progress on Alzheimer's Disease and Resveratrol . Neurochem Res 2020, 45 (5):989–1006. Corpas R, Revilla S, Ursulet S, Castro-Freire M, Kaliman P, Petegnief V, Gimenez-Llort L, Sarkis C, Pallas M, Sanfeliu C: SIRT1 Overexpression in Mouse Hippocampus Induces Cognitive Enhancement Through Proteostatic and Neurotrophic Mechanisms . Mol Neurobiol 2017, 54 (7):5604–5619. Bao J, Zheng L, Zhang Q, Li X, Zhang X, Li Z, Bai X, Zhang Z, Huo W, Zhao X et al : Deacetylation of TFEB promotes fibrillar Abeta degradation by upregulating lysosomal biogenesis in microglia . Protein Cell 2016, 7 (6):417–433. Min SW, Cho SH, Zhou Y, Schroeder S, Haroutunian V, Seeley WW, Huang EJ, Shen Y, Masliah E, Mukherjee C et al : Acetylation of tau inhibits its degradation and contributes to tauopathy . Neuron 2010, 67 (6):953–966. Min SW, Sohn PD, Li Y, Devidze N, Johnson JR, Krogan NJ, Masliah E, Mok SA, Gestwicki JE, Gan L: SIRT1 Deacetylates Tau and Reduces Pathogenic Tau Spread in a Mouse Model of Tauopathy . J Neurosci 2018, 38 (15):3680–3688. Michan S, Li Y, Chou MM, Parrella E, Ge H, Long JM, Allard JS, Lewis K, Miller M, Xu W et al : SIRT1 is essential for normal cognitive function and synaptic plasticity . J Neurosci 2010, 30 (29):9695–9707. Shoji H, Takao K, Hattori S, Miyakawa T: Age-related changes in behavior in C57BL/6J mice from young adulthood to middle age . Molecular brain 2016, 9 :11. Eichenbaum H: On the Integration of Space, Time, and Memory . Neuron 2017, 95 (5):1007–1018. Pini L, Pievani M, Bocchetta M, Altomare D, Bosco P, Cavedo E, Galluzzi S, Marizzoni M, Frisoni GB: Brain atrophy in Alzheimer's Disease and aging . Ageing research reviews 2016, 30 :25–48. Jack CR, Barkhof F, Bernstein MA, Cantillon M, Cole PE, Decarli C, Dubois B, Duchesne S, Fox NC, Frisoni GB et al : Steps to standardization and validation of hippocampal volumetry as a biomarker in clinical trials and diagnostic criterion for Alzheimer's disease . Alzheimer's & dementia: the journal of the Alzheimer's Association 2011, 7 (4). Byers AL, Yaffe K: Depression and risk of developing dementia . Nature reviews Neurology 2011, 7 (6):323–331. Fonio E, Golani I, Benjamini Y: Measuring behavior of animal models: faults and remedies . Nat Methods 2012, 9 (12):1167–1170. Morris RG, Garrud P, Rawlins JN, O'Keefe J: Place navigation impaired in rats with hippocampal lesions . Nature 1982, 297 (5868):681–683. Tang BL, Chua CEL: SIRT1 and neuronal diseases . Mol Aspects Med 2008, 29 (3):187–200. Molinuevo JL, Ayton S, Batrla R, Bednar MM, Bittner T, Cummings J, Fagan AM, Hampel H, Mielke MM, Mikulskis A et al : Current state of Alzheimer's fluid biomarkers . Acta neuropathologica 2018, 136 (6):821–853. El-Husseini AE, Schnell E, Chetkovich DM, Nicoll RA, Bredt DS: PSD-95 involvement in maturation of excitatory synapses . Science 2000, 290 (5495):1364–1368. Bustos FJ, Ampuero E, Jury N, Aguilar R, Falahi F, Toledo J, Ahumada J, Lata J, Cubillos P, Henriquez B et al : Epigenetic editing of the Dlg4/PSD95 gene improves cognition in aged and Alzheimer's disease mice . Brain 2017, 140 (12):3252–3268. Thiel G: Synapsin I, synapsin II, and synaptophysin: marker proteins of synaptic vesicles . Brain Pathol 1993, 3 (1):87–95. Valtorta F, Pennuto M, Bonanomi D, Benfenati F: Synaptophysin: leading actor or walk-on role in synaptic vesicle exocytosis? Bioessays 2004, 26 (4):445–453. Kaeberlein M, McVey M, Guarente L: The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms . Genes Dev 1999, 13 (19):2570–2580. Chen C, Zhou M, Ge Y, Wang X: SIRT1 and aging related signaling pathways . Mech Ageing Dev 2020, 187 :111215. Bonda DJ, Lee H-G, Camins A, Pallàs M, Casadesus G, Smith MA, Zhu X: The sirtuin pathway in ageing and Alzheimer disease: mechanistic and therapeutic considerations . The Lancet Neurology 2011, 10 (3):275–279. Alves-Fernandes DK, Jasiulionis MG: The Role of SIRT1 on DNA Damage Response and Epigenetic Alterations in Cancer . Int J Mol Sci 2019, 20 (13). Jiao F, Gong Z: The Beneficial Roles of SIRT1 in Neuroinflammation-Related Diseases . Oxid Med Cell Longev 2020, 2020 :6782872. Lisman J, Buzsáki G, Eichenbaum H, Nadel L, Ranganath C, Redish AD: Viewpoints: how the hippocampus contributes to memory, navigation and cognition . Nat Neurosci 2017, 20 (11):1434–1447. Rao DD, Vorhies JS, Senzer N, Nemunaitis J: siRNA vs. shRNA: similarities and differences . Adv Drug Deliv Rev 2009, 61 (9):746–759. Amaral DG, Witter MP: The three-dimensional organization of the hippocampal formation: a review of anatomical data . Neuroscience 1989, 31 (3):571–591. Yanai S, Endo S: Functional Aging in Male C57BL/6J Mice Across the Life-Span: A Systematic Behavioral Analysis of Motor, Emotional, and Memory Function to Define an Aging Phenotype . Front Aging Neurosci 2021, 13 :697621. Percie du Sert N, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M et al : Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0 . PLoS Biol 2020, 18 (7):e3000411. Vorhees CV, Williams MT: Morris water maze: procedures for assessing spatial and related forms of learning and memory . Nat Protoc 2006, 1 (2):848–858. Barbash S, Hanin G, Soreq H: Stereotactic injection of microRNA-expressing lentiviruses to the mouse hippocampus ca1 region and assessment of the behavioral outcome . J Vis Exp 2013(76):e50170. Liu M, Pi H, Xi Y, Wang L, Tian L, Chen M, Xie J, Deng P, Zhang T, Zhou C et al : KIF5A-dependent axonal transport deficiency disrupts autophagic flux in trimethyltin chloride-induced neurotoxicity . Autophagy 2021, 17 (4):903–924. Yan CG, Wang XD, Zuo XN, Zang YF: DPABI: Data Processing & Analysis for (Resting-State) Brain Imaging . Neuroinformatics 2016, 14 (3):339–351. Barriere DA, Ella A, Szeremeta F, Adriaensen H, Meme W, Chaillou E, Migaud M, Meme S, Levy F, Keller M: Brain orchestration of pregnancy and maternal behavior in mice: A longitudinal morphometric study . Neuroimage 2021, 230 :117776. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif SupplementaryInformation.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 10 Jan, 2022 Reviews received at journal 04 Jan, 2022 Reviewers agreed at journal 28 Dec, 2021 Reviewers invited by journal 26 Dec, 2021 Editor assigned by journal 23 Dec, 2021 Editor invited by journal 23 Dec, 2021 Submission checks completed at journal 23 Dec, 2021 First submitted to journal 30 Nov, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1126398","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":72159248,"identity":"2c108db6-13cd-4baa-b515-c81936dcd42d","order_by":0,"name":"Zuhao Sun","email":"","orcid":"","institution":"Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University General Hospital, Tianjin, China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zuhao","middleName":"","lastName":"Sun","suffix":""},{"id":72159249,"identity":"ae837fc8-e540-45a1-8187-9fd6761db5d4","order_by":1,"name":"Shuang Zhao","email":"","orcid":"","institution":"Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University General Hospital, Tianjin, China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Zhao","suffix":""},{"id":72159250,"identity":"1899990a-ccca-4b0a-be46-d544c49b13d0","order_by":2,"name":"Xinjun Suo","email":"","orcid":"","institution":"Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University General Hospital, Tianjin, China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xinjun","middleName":"","lastName":"Suo","suffix":""},{"id":72159251,"identity":"e7ffd9fb-746e-4698-ac4e-14919926331d","order_by":3,"name":"Yan Dou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDCCA2DSBsLhIUFLmgTJWg6ToIXveI+ZxM8d5+t0ZyQwPnjbxiBvTkiL5JkzZpK9Z25LmN1IYDac28ZguLOBgBaDGzlmErxtYC1s0rxtDAkGB4jQIvm37RxIC/tvorUADT8AtoWZKC2SZ44VW8u2JUtuO/OwWXLOOQnDDYS08B1v3njzbZsdv9nx5IMf3pTZyBO0BQhYIHHCwNgAJCQIqwcC5g9EKRsFo2AUjIKRCwCBg0BW6Os4UgAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University General Hospital, Tianjin, China","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Dou","suffix":""}],"badges":[],"createdAt":"2021-11-30 06:29:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1126398/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1126398/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":16808887,"identity":"448b76dc-7cb2-4821-9a90-7fbce64d53ad","added_by":"auto","created_at":"2021-12-28 18:46:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":391885,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDesign of shRNA\u003cem\u003e \u003c/em\u003etargeting\u003cem\u003e Sirt1\u003c/em\u003e for AAV packaging and hippocampal \u003cem\u003eSirt1 \u003c/em\u003eknockdown by stereotactic injection.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Validation of knockdown efficiency of \u003cem\u003eSirt1\u003c/em\u003e-shRNAs in G1261 cells by RT-qPCR. Abbreviations: sh-SCR (scrambled shRNA), sh-\u003cem\u003eSirt1\u003c/em\u003eA (the first shRNA sequence targeting \u003cem\u003eSirt1\u003c/em\u003e), sh-\u003cem\u003eSirt1\u003c/em\u003eB (the second shRNA sequence targeting \u003cem\u003eSirt1\u003c/em\u003e). n = 3. \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 represents comparison between the sh-SCR and sh-\u003cem\u003eSirt1\u003c/em\u003eA. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 represents comparison between the sh-SCR and sh-\u003cem\u003eSirt1\u003c/em\u003eB. \u003cstrong\u003e(B) \u003c/strong\u003eIllustration of plasmid construction for AAV packaging. Abbreviations: inverted terminal repeats (ITR), cytomegalovirus promoter (CMV), \u003cem\u003eSirt1\u003c/em\u003e shRNA (shSirt1), and enhanced green fluorescent protein (EGFP) reporter gene. \u003cstrong\u003e(C) \u003c/strong\u003eGraphical illustration of stereotactic injection of AAV into bilateral CA1 regions of hippocampus. \u003cstrong\u003e(D) \u003c/strong\u003eRepresentative fluorescence image of frozen brain section. \u003cstrong\u003e(E) \u003c/strong\u003eWork flow of \u003cem\u003ein vivo \u003c/em\u003eexperiments performed on the control group, the sham group and the shSirt1 group. Abbreviations: Open Field test (OFT), Morris Water Maze (MWM), magnetic resonance imaging (MRI), and western blotting (WB).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/ac4e5884456b7f65e7450ec8.png"},{"id":16809159,"identity":"5bba5e52-4f48-4dcd-89fc-190ded127a5e","added_by":"auto","created_at":"2021-12-28 18:49:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":500529,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVolume analysis of hippocampus and its subregions based on 3T MR brain structural imaging\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e(A) \u003c/strong\u003eIllustrative schemes for hippocampal segmentation based on Turone Mouse Brain Atlas and Template (TMBTA). \u003cstrong\u003e(B-G) \u003c/strong\u003eStatistical analysis of (\u003cstrong\u003eB\u003c/strong\u003e) total intracranial volume (TIV), (\u003cstrong\u003eC\u003c/strong\u003e) the volume of hippocampal formation region, (\u003cstrong\u003eD\u003c/strong\u003e) total hippocampal volume, and the volumes of hippocampal subregions including (\u003cstrong\u003eE\u003c/strong\u003e) dentate gyrus region, (\u003cstrong\u003eF\u003c/strong\u003e) CA1 region, (\u003cstrong\u003eG\u003c/strong\u003e) CA2 region, and (\u003cstrong\u003eH\u003c/strong\u003e) CA3 region. n = 9.\u003csup\u003e *\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 represent comparison between the control group and the shSirt1 group.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/cf7c1269d1d5f6af91613375.png"},{"id":16809308,"identity":"14caa1a4-338b-435e-b3d7-e1ab8fb630b1","added_by":"auto","created_at":"2021-12-28 18:52:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":944860,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHippocampal Sirt1 knockdown caused\u003c/strong\u003e \u003cstrong\u003ecognitive impairment in middle-aged mice. (A) \u003c/strong\u003ePercentage of time spent by mice in the center zone during the OFT. \u003cstrong\u003e(B) \u003c/strong\u003eRepresentative autonomous trajectory maps of mice in OFT. Green color indicates the defined center zone and the rest is defined peripheral zone. \u003cstrong\u003e(C) \u003c/strong\u003eThe swimming speed of mice in MWM with visual platform before the learning phase. \u003cstrong\u003e(D) \u003c/strong\u003eRepresentative swimming paths of mice in the probe phase. \u003cstrong\u003e(E) \u003c/strong\u003eEscape latency of mice during the learning phase. \u003cstrong\u003e(F) \u003c/strong\u003eTime spent in target zone and \u003cstrong\u003e(G) \u003c/strong\u003ethe number of platform crossings of mice in the probe phase. n = 12. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 represent comparison between the control group and the shSirt1 group. \u003csup\u003e# \u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 represents comparison between the sham group and the shSirt1 group.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/ffebec5606cd476c51207fd5.png"},{"id":16808888,"identity":"72be40ef-900b-49d3-be34-1dd8780e79fd","added_by":"auto","created_at":"2021-12-28 18:46:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":564616,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWestern blotting analysis of related protein levels after hippocampal \u003cem\u003eSirt1 \u003c/em\u003eknockdown. (A) \u003c/strong\u003eRepresentative immunoblots and qualified density value of \u003cem\u003eSirt1.\u003c/em\u003e\u003cstrong\u003e (B) \u003c/strong\u003eRepresentative immunoblots and qualified density value of p-tau\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003e(C) \u003c/strong\u003eRepresentative immunoblots and qualified density value of PSD95\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003e(D) \u003c/strong\u003eRepresentative immunoblots and qualified density value of synaptophysin. n = 3. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 represent comparisons between the control group and the shSirt1 group. \u003csup\u003e# \u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e## \u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 and \u003csup\u003e### \u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 represent comparisons between the sham group and the shSirt1 group. Full-length blots are presented in Supplementary information (\u003cstrong\u003eFigure S1\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/ee7c6d578e212519557a2726.png"},{"id":16809309,"identity":"f2358563-0a23-418b-b15f-07297f50e0a9","added_by":"auto","created_at":"2021-12-28 18:53:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1278635,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/f89909bc-4677-474d-9212-5fa2a2c1ff0a.pdf"},{"id":16809161,"identity":"6b40740e-e4a1-42c6-a22c-af8df0e0f110","added_by":"auto","created_at":"2021-12-28 18:49:57","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":566520,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/8bde7711068649a4c671df12.tif"},{"id":16808884,"identity":"94723756-1adb-431d-abd4-00bcfbb37931","added_by":"auto","created_at":"2021-12-28 18:46:56","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":233419,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-1126398/v1/3bf62a1d5008b154050361d4.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eSirt1 Protects Against Hippocampal Atrophy and its Induced Cognitive Impairment in Middle-aged Mice\u003c/p\u003e","fulltext":[{"header":"1. Background","content":"\u003cp\u003eAging is an important social problem facing all countries in the world today. One of the neurodegenerative diseases highly related to aging is Alzheimer\u0026rsquo;s disease (AD), whose incidence increases with age [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The main clinical manifestations of AD are cognitive and memory impairment, accompanied by atrophy in hippocampus and other related brain areas [\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] Its recognized pathological features mainly include β-amyloid plaques, neurofibrillary tangles and neuronal death [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The 2020 world AD report suggested that brain volume atrophy occur much earlier than clinically observed symptoms of cognitive dysfunction [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Moreover, synaptic loss has been confirmed to be closely associated with the progression of cognitive impairment, often preceding neurodegenerative changes in above-described pathological features [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, it is of great significance to find effective neuroprotective intervention targets for delaying hippocampal atrophy and synaptic damage during aging and preventing AD.\u003c/p\u003e \u003cp\u003eEpigenetic regulation, such as histone post-translational modification and DNA methylation, has recently been revealed to play an important role in maintaining normal brain function, which can stabilize gene expression patterns in the brain and be crucial for long-term memory storage of information [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Histone deacetylation is a common type of histone post-translational modification [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. One of the key factors affecting histone deacetylation is histone deacetyltransferase (HDACs), which consists of four classes (Class I, II, III and IV), and Class III HDAC is the sirtuin family [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The sirtuin family is a highly conserved class of HDACs that plays multiple functions in aging, chromatin integrity, metabolic regulation and longevity [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Sirtuin 1 (SIRT1), the most widely studied gene, is mainly expressed in neurons and has been reported to play a key role in regulating nerve progenitor cell fate, axonal dendritic differentiation and synaptic plasticity [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eChanges in \u003cem\u003eSirt1\u003c/em\u003e expression have been proved to be closely related to the progression of cognitive impairment and AD pathology. Studies have shown that \u003cem\u003eSirt1\u003c/em\u003e overexpression in the hippocampus can induce cognitive enhancement in both 3xTg-AD model mice and healthy non-transgenic mice [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Furthermore, \u003cem\u003eSirt1\u003c/em\u003e overexpression in Tauopathy mouse models can enhance the activation of ubiquitin-proteasome system (UPS) and effective cleared phosphorylated tau protein (p-tau) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In \u003cem\u003eSirt1\u003c/em\u003e knockout mice, the brain morphology and dendritic spine structure were similar to those of healthy mice, but the complexity of synaptic network was reduced and synaptic plasticity was weakened [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In conclusion, \u003cem\u003eSirt1\u003c/em\u003e gene has an obvious neuroprotective effect, and exploring its protective effect on cognitive function of healthy aged mice is of great significance for the prevention of cognitive disorders such as AD.\u003c/p\u003e \u003cp\u003eHerein, we studied the neuroprotective effect of \u003cem\u003eSirt1\u003c/em\u003e gene on hippocampal volume and cognitive function in middle-aged mice. First, \u003cem\u003eSirt1\u003c/em\u003e interference plasmid was constructed and packaged with lentivirus to verify its knockdown efficiency in mouse glioma cells. Then, the plasmid with the best knockdown efficiency was packaged as adeno-associated virus (AAV) and injected into the dorsal hippocampal CA1 region of 8-month-old C57/BL mice, compared with no-load AAV injection. After three weeks, 3T brain structural magnetic resonance imaging (MRI) was used to detect the hippocampal volume, and then open field test (OFT) and Morris water maze (MWM) test were performed to assess the learning and memory ability of mice. Finally, hippocampal tissues were taken out for western blotting to evaluate the changes of AD pathological marker p-tau as well as synaptic marker PSD95 and synaptophysin. This work revealed that \u003cem\u003eSirt1\u003c/em\u003e is an important protective gene in maintaining hippocampal volume and cognitive function during aging, providing potential therapeutic targets for the prevention and intervention of aging-related diseases such as AD.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e3.1 \u003cem\u003eSirt1\u003c/em\u003e shRNA knockdown efficiency \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to select the shRNA against \u003cem\u003eSirt1\u003c/em\u003e with significant knockdown efficiency, two \u003cem\u003eSirt1\u003c/em\u003e-interfering plasmids (sh-Sirt1A, sh-Sirt1B) were constructed and packaged by lentivirus. Then GL261 cells were transfected with these \u003cem\u003eSirt1\u003c/em\u003e-interfering lentiviruses, and real-time quantitative polymerase chain reaction (RT-qPCR) was performed to detect knockdown efficiency of sh-Sirt1A and sh-Sirt1B. The results showed that \u003cem\u003eSirt1\u003c/em\u003e mRNA expression levels of both sh-Sirt1A (t\u003csub\u003e2\u003c/sub\u003e = 10.29, \u003cem\u003ep\u003c/em\u003e = 0.0005) and sh-Sirt1B (t\u003csub\u003e2\u003c/sub\u003e = 4.234, \u003cem\u003ep\u003c/em\u003e = 0.0133) were much lower than those of the sh-SCR group, and the sh-Sirt1A group had the lowest expression level (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Therefore, the \u003cem\u003eSirt1\u003c/em\u003e-interfering plasmid with sh-Sirt1A sequence was used in subsequent experiments. For \u003cem\u003ein vivo\u003c/em\u003e transfection, the sh-Sirt1A plasmid containing the EGFP reporter gene was used for AAV packaging, and AAV packaging the plasmid only expressing EGFP was used for sham operation (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eIn this study, 8-month-old C57/BL mice were randomly divided into three groups (control, sham, shSirt1) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown in the shSirt1 group was conducted by stereotactic injection of AAV-CMV-shSirt1-EGFP into the dorsal hippocampal CA1 region (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), a brain region closely related to cognition [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Mice in the sham group were injected with AAV-CMV-EGFP and the mice in the control group suffered none treatment. Three weeks after injection, fluorescence imaging based on frozen sections of the whole brain showed the obvious green fluorescence of EGFP along the CA1 region (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), indicating the successful AAV transfection.\u003c/p\u003e \u003cp\u003eHippocampus plays a vital role in cognition and many factors can cause its morphological changes and functional impairment, such as AD and aging [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. So, we would like to explore the impact of \u003cem\u003eSirt1\u003c/em\u003e knockdown on hippocampal volume. Therefore, we designed to measure the hippocampal volume of mice by 3T MR brain structural imaging. Then, we evaluated spatial learning and memory of mice by OFT and MWM test. Finally, western blotting was used to detect changes in protein levels of AD pathological marker p-tau as well as synaptic marker PSD95 and synaptophysin in the hippocampus after \u003cem\u003eSirt1\u003c/em\u003e knockdown (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e3.2 \u003cem\u003eSirt1\u003c/em\u003e knockdown reduced hippocampal volume in middle-aged mice\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3T brain structural MRI was performed on mice in three groups to detect hippocampal volume. According to TMBTA, the mice brains were segmented to measure the total intracranial volume (TIV), the volume of hippocampal formation, the total hippocampal volume, and the volumes of hippocampal subregions including dentate gyrus (DG) region, CA1 region, CA2 region and CA3 region (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Results showed that there was no statistical difference in the TIV among the three groups (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In the case of regression of the TIV, we performed two-sample t-test on above volumes of mice between groups. The volume of hippocampal formation in the shSirt1 group was slightly smaller compared with the control group and the sham group without statistical significance (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Surprisingly, the total hippocampal volume in the shSirt1 group was significantly lower (t\u003csub\u003e2\u003c/sub\u003e = 2.578, \u003cem\u003ep\u003c/em\u003e = 0.0172) than that in the control group (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eFurther analysis of the various structures of the hippocampus revealed that the most obvious region of atrophy caused by hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown was the DG region compared to the control group (t\u003csub\u003e2\u003c/sub\u003e = 3.312, \u003cem\u003ep\u003c/em\u003e = 0.0032) (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), followed by CA1 region (t\u003csub\u003e2\u003c/sub\u003e = 2.192, \u003cem\u003ep\u003c/em\u003e = 0.0392) (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), and there was no statistical difference in the volume of other regions (Figure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG,H). Compared with the control group, the total hippocampal volume and each subregion volume in the sham group showed a decreasing trend, but there was no statistical difference, which might be a slight effect caused by stereotactic injection. The reduction of hippocampal volume, also defined as hippocampal atrophy, is a well-established and validated biomarker for cognitive impairment [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Based on our MRI results, we reasonably speculate that AAV-mediated hippocampal knockdown of \u003cem\u003eSirt1\u003c/em\u003e would cause the burden to the cognitive functions such as learning and memory in middle-aged mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 \u003cem\u003eSirt1\u003c/em\u003e knockdown caused cognitive impairment in middle-aged mice\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo verify the adverse effects of hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown on cognitive function, we implemented proper behavioral paradigms including OFT and MWM test. First, OFT was conducted as one of the most popular behavioral tests to assess the loco-motor activity and exploratory behavior in rodents [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Mice were allowed to freely explore in the experimental chamber for 15 min without any visual, auditory and olfactory disturbance, and their movements were analyzed. It was found that mice behaved similarly among three groups and preferred to spend little time (14% - 17%) exploring the center zone (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The trajectory maps showed that mice in three groups moved mainly in the peripheral zone and occasionally moved into the center zone (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Our OFT results consisted with previously reported study [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], indicating that hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown had no effect on anxiety and exploratory behavior in middle-aged mice.\u003c/p\u003e \u003cp\u003eThen, MWM test was performed to assess spatial learning and memory of mice in three groups [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It was found that there was no statistical difference on swimming speed among three groups, indicating that all mice had normal vision and locomotor ability (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). During the 5-day learning phase, the escape latency of mice in the shSirt1 group was gradually prolonged, and the difference was significant from the 4th day, compared with the control group (day4: t\u003csub\u003e2\u003c/sub\u003e = 3.228, \u003cem\u003ep\u003c/em\u003e = 0.0032; day5: t\u003csub\u003e2\u003c/sub\u003e = 3.504, \u003cem\u003ep\u003c/em\u003e = 0.0016) and the sham group (day4: t\u003csub\u003e2\u003c/sub\u003e = 2.096, \u003cem\u003ep\u003c/em\u003e = 0.0468; day5: t\u003csub\u003e2\u003c/sub\u003e = 2.313, \u003cem\u003ep\u003c/em\u003e = 0.0296) (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). After removing the platform on the sixth day, mice in the shSirt1 group showed more chaotic swimming paths, while mice in the other two groups were more concentrated in the target zone where the platform was located (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Mice in the shSirt1 group exhibited shorter time in target zones, compared to the control group (t\u003csub\u003e2\u003c/sub\u003e = 2.614, \u003cem\u003ep\u003c/em\u003e = 0.0142) and the sham group (t\u003csub\u003e2\u003c/sub\u003e =2.171, \u003cem\u003ep\u003c/em\u003e = 0.0396) (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Less number of crossings over the platform region was also found in the shSirt1 group than that in the control group (t\u003csub\u003e2\u003c/sub\u003e = 2.697, \u003cem\u003ep\u003c/em\u003e = 0.0121) and the sham group (t\u003csub\u003e2\u003c/sub\u003e = 2.238, \u003cem\u003ep\u003c/em\u003e = 0.0352) (Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These results revealed that conditional \u003cem\u003eSirt1\u003c/em\u003e downregulation in the hippocampus causes impairment to spatial learning and memory of middle-aged mice without effect on exploratory behavior.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 \u003cem\u003eSirt1\u003c/em\u003e knockdown can activate tau pathology and induce synaptic damage\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further analyze underlying biological mechanisms of hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown, the hippocampi of mice in three groups were manually dissected out and western blotting was performed to detect molecular changes. As mentioned above, \u003cem\u003eSirt1\u003c/em\u003e can contribute to p-tau clearance in AD model mice [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and maintenance of synaptic plasticity [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. So, the protein expressions of p-tau as well as PSD95 and synaptophysin were detected in the shSirt1 group compared to the control group and the sham group. First, the significant deceased levels of \u003cem\u003eSirt1\u003c/em\u003e in the shSirt1 group (control group: t\u003csub\u003e2\u003c/sub\u003e = 13.32, \u003cem\u003ep\u003c/em\u003e = 0.0002; sham group: t\u003csub\u003e2\u003c/sub\u003e =4.37, \u003cem\u003ep\u003c/em\u003e = 0.012) confirmed the successful downregulation of \u003cem\u003eSirt1\u003c/em\u003e in the hippocampus (Figure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). As expected, the levels of p-tau, as one of the important pathological features and biomarkers of AD [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], were significantly upregulated in the shSirt1 group compared to the control group (t\u003csub\u003e2\u003c/sub\u003e = 4.068, \u003cem\u003ep\u003c/em\u003e = 0.0152) and the sham group (t\u003csub\u003e2\u003c/sub\u003e = 11.29, \u003cem\u003ep\u003c/em\u003e = 0.0004) (Figure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The levels of PSD95, a postsynaptic protein regulating maturation of synapses and maintaining normal synaptic functions [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], was significantly reduced in the shSirt1 group compared to the control group (t\u003csub\u003e2\u003c/sub\u003e = 10.19, \u003cem\u003ep\u003c/em\u003e = 0.0005) and the sham group (t\u003csub\u003e2\u003c/sub\u003e = 6.572, \u003cem\u003ep\u003c/em\u003e = 0.0028) (Figure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Another important synaptic protein, synaptophysin, the most abundant membrane protein of synaptic vesicles involved in exo-endocytosis of synaptic vesicles [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], showed a very slight downregulation and no significant difference was found among the three groups (Figure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results revealed that hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown can activate tau pathology and induce synaptic damage in the hippocampus of middle-aged mice.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003e \u003cem\u003eSirt1\u003c/em\u003e is the first identified nicotinamide-adenine dinucleotide (NAD+)-dependent HDAC [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], and it regulates various biological processes such as cellular senescence [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], AD [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], cancer [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] and neuroinflammation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Studies have shown that \u003cem\u003eSirt1\u003c/em\u003e knockout (\u003cem\u003eSirt1\u003c/em\u003e-KO) would cause cognitive impairment and defects in synaptic plasticity, but the brains of \u003cem\u003eSirt1\u003c/em\u003e-KO mice exhibited normal morphology [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Since the hippocampus is the main brain area for cognition and its volume is an important neuroimaging phenotype for clinical evaluation of AD [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], assessing hippocampal volume is more convincing for cognition evaluation than assessing changes in whole brain structure. Furthermore, the protective effect of \u003cem\u003eSirt1\u003c/em\u003e on hippocampal volume in aged mice has not been reported. Therefore, we performed 3T brain structural MRI to investigate the volume changes of hippocampus and its subregions caused by AAV-mediated hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown in middle-aged mice. Combined with OFT, MWM test and western blotting, we found that \u003cem\u003eSirt1\u003c/em\u003e knockdown induced hippocampal atrophy was also accompanied by cognitive impairment, activation of hippocampal tau pathology and synaptic damage.\u003c/p\u003e \u003cp\u003eshRNA is a widely used tool for gene knockdown with high specificity and selectivity [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Firstly, two \u003cem\u003eSirt1\u003c/em\u003e-shRNA plasmids were designed and packaged as lentiviruses respectively to transfect G1261 cells. RT-qPCR based on the extracted RNA was used to detect the knockdown efficiency and the \u003cem\u003eSirt1\u003c/em\u003e-shRNA plasmid with relatively highest knockdown efficiency was selected for subsequent AAV packaging. For \u003cem\u003ein vivo\u003c/em\u003e studies, 8-month-old mice were used because they are widely considered to represent a healthy middle-aged mouse model. AAV expressing \u003cem\u003eSirt1\u003c/em\u003e-shRNA was injected into bilateral CA1 of dorsal hippocampus by stereotactic injection, and 3T brain structural MRI was performed on the mice three weeks later. The results showed that in the case of regression of the TIV, the volumes of total hippocampus, DG and CA1 regions were significantly reduced in the shSirt1 group compared to the control group, while the volumes of hippocampal formation (hippocampus and parahippocampal area [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]), CA2 and CA3 regions were not significantly changed. The volumes of hippocampus and its subregions were slightly decreased in the sham group compared to the control group, which might be caused by stereotactic injection itself. These MRI results showed that \u003cem\u003eSirt1\u003c/em\u003e knockdown resulted in a significant decrease in hippocampal volume.\u003c/p\u003e \u003cp\u003eTo assess hippocampus-mediated cognitive function, the classical behavioral paradigms, OFT and MWM test, were used to evaluate anxiety, exploratory activity and spatial learning and memory of mice. In 15-minute OFT, there were no statistical difference in trajectory map and time spent in the center zone among the three groups. Besides, time mice spent in the center zone in our study consisted with previously reported studies [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. OFT results indicated that \u003cem\u003eSirt1\u003c/em\u003e knockdown in the hippocampus had no effect on anxiety and exploratory activity in middle-aged mice. However, in the MWM test, the control group and the sham group showed similar purposeful swimming, while the shSirt1 group performed very poorly. MWM results indicated that \u003cem\u003eSirt1\u003c/em\u003e knockdown in the hippocampus prolonged escape latency, reduced time spent in target zone and number of platform crossing, and seriously impaired the spatial learning and memory ability in middle-aged mice.\u003c/p\u003e \u003cp\u003eFinally, hippocampal tissues of the three groups were isolated for western blotting to examine the potential mechanisms of \u003cem\u003eSirt1\u003c/em\u003e knockdown in regulating hippocampal atrophy and cognitive impairment. The significant decrease of \u003cem\u003eSirt1\u003c/em\u003e levels confirmed the successful \u003cem\u003eSirt1\u003c/em\u003e knockdown in mouse hippocampus. The significant increase of p-tau levels suggested that \u003cem\u003eSirt1\u003c/em\u003e knockdown could activate tau pathology in mouse hippocampus. The obvious downregulation of PSD95 levels with the slight reduced levels of synaptophysin in the shSirt1 group showed the vital role of \u003cem\u003eSirt1\u003c/em\u003e in maintaining synaptic integrity and function.\u003c/p\u003e"},{"header":"4. Conclusions","content":"\u003cp\u003eTaken together, hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown could lead to hippocampal atrophy and its induced cognitive impairment in middle-aged mice, along with activation of tau pathology and synaptic damage. This work revealed the key role of \u003cem\u003eSirt1\u003c/em\u003e in maintaining hippocampal volume to prevent cognitive impairment during aging, and provides important targets for the prevention and therapy of AD.\u003c/p\u003e"},{"header":"5. Materials And Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e5.1 Construction and packaging of \u003cem\u003eSirt1\u003c/em\u003e interference plasmid\u003c/h2\u003e \u003cp\u003eAccording to the design principles of shRNA and the nucleotide sequence of \u003cem\u003eSirt1\u003c/em\u003e gene in GenBank (NM_019812.3), two \u003cem\u003eSirt1\u003c/em\u003e shRNA sequences were designed. Forwardoligo and reverseoligo of sh-Sirt1A as follows: CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG;AATTCAAAAACGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCG; Forwardoligo and reverseoligo of sh-Sirt1B as follows: CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG;AATTCAAAAAGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGC. The synthesized single-stranded oligonucleotides were annealed to form double-stranded DNA, and then ligated with plko.1 by restriction enzyme BshTⅠ/EcoRⅠ. Then the competent bacterium DH5a was transformed and a single colony was selected and sequenced. The colonies with correct sequencing results were amplified to extract the target plasmids.\u003c/p\u003e \u003cp\u003eWe transfected the target plasmids, together with lentivirus vectors PAX8 and VSVG, into HEK293T cells for lentivirus packaging. The knockdown efficiency of obtained \u003cem\u003eSirt1\u003c/em\u003e interference lentivirus were verified by Quantitative PCR in Mouse glioma cells Gl261. Briefly, we first transfected G1261 cells with lentivirus for 1 week. Then, total RNA was extracted from cells with a TRIzol reagent (Gibco, 15596018) according to the manufacturer\u0026rsquo;s instructions. Then RNA was reverse transcribed into cDNA with an RT-PCR kit (Accurate Biology, AG11705). Quantitative real-time RT-PCR (RT-qPCR) was carried out on a Mx3005p real-time polymerase chain-reaction system (Agilent Technologies, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q311-02) and the temperature was set as follows: initial denaturation for 1 min at 95\u0026deg;C, followed by 40 cycles of 15 s at 95\u0026deg;C, 20 s at 58\u0026deg;C, and 45 s at 72\u0026deg;C. The PCR primers were designed as follows: forward, 5-GTGGCAGTAACAGTGACAGTGG-3; reverse, 5-TCCAGATCCTCCAGCACATTCG-3. The Sirt1 mRNA expression was normalized comparing to rpo. For transfection \u003cem\u003ein vivo\u003c/em\u003e, the target plasmids were packaged with AAV by Lianyungang ChuangRui Biological Product Trading Company Ltd. (Jiangsu, China). The final titer of \u003cem\u003eSirt1\u003c/em\u003e knockdown AAV (AAV-CMV-shSirt1-EGFP) and the no-load control AAV (AAV-CMV-EGFP) was 7.1\u0026times;10\u003csup\u003e12\u003c/sup\u003e vp/mL and 3.5\u0026times;10\u003csup\u003e12\u003c/sup\u003e vp/mL, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e5.2 Animals\u003c/h2\u003e \u003cp\u003eC57BL/6J mice (8 months old, male, 35-40 g) were purchased from Beijing HFK Bioscience Co. Ltd. (Beijing, China). The mice were used for experiments at least 14 days after acclimatization to laboratory conditions. The mice were placed in polycarbonate cages with 3-5 mice per cage at a controlled temperature (22 \u0026plusmn; 1\u0026deg;C) for 12-h light-dark cycle and \u003cem\u003ead libitum\u003c/em\u003e access to food and water. All animal experiments were performed in accordance to \u003cem\u003eAnimal Research: Reporting of In Vivo Experiments\u003c/em\u003e (ARRIVE guidelines)[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and the guidelines of Institutional Animal Care and Use Committee at Tianjin Medical University (IACUC number E2015093) and following reported protocols[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e5.3 Hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown in aged mice\u003c/h2\u003e \u003cp\u003eThe mice were randomly divided into three groups, each consisting of 14-16 mice: the untreated mice (control), the mice injected with AAV-CMV-EGFP (sham), and the mice injected with AAV-CMV-shSirt1-EGFP (shSirt1). The mice were anesthetized with inhalation of 2% isoflurane throughout the process by a small animal anesthesia machine (R510-22, RWD Life Science Co., Ltd., China). Then the mice were fixed on a stereotactic apparatus (G1124701, RWD Life Science Co., Ltd., China). Both AAV-CMV-EGFP and AAV-shSirt1-EGFP were diluted to 3.5 \u0026times; 10\u003csup\u003e12\u003c/sup\u003e vp/mL. Bilateral injection with 1 \u0026micro;L of above AAV was performed into the dorsal hippocampal CA1 region, and stereotaxic coordinates were shown as follows: AP -2.00mm, \u0026plusmn; ML 1.5mm, DV -1.0mm from bregma. The injection rate was controlled at 100 nL/min. The needle syringe was left in place for about 10 min before being withdrawn. The scalp was sutured, disinfected with iodophor, and the mice were kept warm. After awakening from anesthesia, they were put back into the cage. After three weeks, the construction of \u003cem\u003eSirt1\u003c/em\u003e knockdown in mouse hippocampus was considered successful [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e5.4 Fluorescence staining of frozen mouse brain sections\u003c/h2\u003e \u003cp\u003eMice were anesthetized with 3% isoflurane and executed by cervical dislocation. Then, mice were perfused with 20 mL 4% paraformaldehyde (Biosharp, China). Next, the whole brains were isolated properly and fixed in paraformaldehyde overnight. After dehydration in 10% sucrose solution (10% m/v sucrose in PBS) for 2 days, the brains were embedded into optimal cutting temperature compound (OCT) (Sakura, Japan) and frozen in -80\u0026deg;C for 1 day. The brains were sectioned into 20 \u0026micro;m slices at -22\u0026deg;C. The slices were collected on adhesion microscope slides (CITOTEST Scientific, China) and stained with DAPI. Finally, processed slices were observed and filmed by an Olympus IX73 inverted microscope (Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e5.5 3T brain structural MRI\u003c/h2\u003e \u003cp\u003eThe mice were anesthetized 15 min MRI scanning by intraperitoneal injection with 4% chloral hydrate at 0.2 mL/10g. Then the mice were fixed on a semi-circular small animal scanning frame, their limbs were fixed with medical tape, and their heads were fixed by hanging a thin wire through the incisors. MRI was performed on a 3T MRI scanner (DISCOVERY MR750, General Electric, USA) with a mouse brain coil. The parameters for 3D T\u003csub\u003e1\u003c/sub\u003e-weighted fast acquisition of the whole mouse brain were as follows: repetition time (TR) = 12.6 ms, echo time (TE) = 6.0 ms, field of view (FOV) = 3.0\u0026times;1.0 mm, slice thickness = 0.3 mm, number of slices = 1746, frequency = 180, phase = 150, prep time = 500 ms, flip angle = 12\u0026deg;, bandwidth = 15.63, locs per slab = 128, number of excitations = 4, and scan time = 20 min 9 s. For voxel-based morphometry (VBM) analysis, obtained MR DICOM files were subjected to conversion to NIFTI files using dcm2niix, augmentation of the voxel size 14 times using DPABI [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], automatic segmentation of hippocampus based on Turone Mouse Brain Atlas and Template (TMBTA) using SPM12 software [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. In the case of regression of the total intracranial volume, the two-sample t-test was used to analyze the difference in gray matter volume between the three groups within the hippocampus.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e5.6 Open field test\u003c/h2\u003e \u003cp\u003eOpen field test (OFT) is a common animal behavior experiment to detect the loco-motor activity and exploratory behavior of mice. The open field apparatus (RWD Life Science Co., Ltd., China) consisted of a square arena (50 \u0026times; 50 cm) with walls 45 cm high. The arena was divided into the center area (30 cm \u0026times; 30 cm square) and the peripheral area. The mice arrived at the test site 24 h in advance to ensure that they were acclimated to the environment, and the mice were stroked for 1-2 min to reduce non-specific stress stimulation. Each mouse was gently and quickly placed in the central area with their backs to the experimenter, and the experimenter immediately left. The SMART3.0 digital tracking system (Panlab, USA) automatically recorded the movements of mice in the arena. The exploring time of each mouse was 15 min, and the proportion of time spent in the central area was measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e5.7 Morris water maze test\u003c/h2\u003e \u003cp\u003eThe Morris Water Maze (MWM) test is a classical behavioral task to test hippocampal-dependent learning and memory of mice, consisting of 5 days of learning phase and 1 day of probe phase. Room and water temperature were maintained at 22\u0026deg;C. A circular tank (120 cm diameter, 50 cm height) was divided into four quadrants with distinctive landmarks as visual cues, and equipped with a hidden platform (8 cm diameter, -1cm below the water surface). Before the test, the platform was lifted 1cm above the water surface, and the mouse was released to swim freely at the furthest site from the platform. The swimming speeds were recorded by the equipped SMART 3.0 Video Tracking System (Panlab, USA). Every day during learning phase, the mouse was released from each quadrant and swam for 60 s. Once the mouse found the platform within 60 s and stayed on it for 3 s, the system automatically recorded this period as escape latency. If the mouse did not find the platform within the 60 s, the system recorded escape latency as 60 s. The experimenter guided the mouse to the platform and allowed it to stay there for 10 s. On the sixth day, the platform was removed, the mouse was released at the furthest site from the platform and allowed to freely explore for 60 s. During probe phase, the swimming paths, the time spent in target quadrant, and the numbers of mice crossing the platform location were also recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e5.8 Western blotting\u003c/h2\u003e \u003cp\u003eMouse hippocampal tissues were harvested, cut with ophthalmic scissors, and lysed with RIPA lysis buffer and Phenylmethylsulphonyl fluoride (PMSF) (Solarbio LIFE SCIENCES, P0100). The proteins were separated by 10-12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane (Merck, Ireland). Then, the membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated with primary antibodies overnight at 4\u0026deg;C. The primary antibodies included SIRT1 Polyclonal antibody (Proteintech, 13161-1-AP), Phospho-Tau (Ser396) Recombinant Polyclonal Antibody (5HCLC) (Invitrogen, 710298), PSD95-Specific, DLG4 Polyclonal Antibody (Proteintech, 20665) and Recombinant Anti-Synaptophysin antibody (Abcam, ab32127). After washing three times with PBST, the membranes were incubated with Goat Anti-Rabbit IgG H\u0026amp;L (HRP) (Abcam, ab205718) for 1 h at room temperature. β-Tubulin and GAPDH were used as internal controls. After washing three times with PBST, immunoreactive bands were visualized using enhanced chemi-luminescence (ECL) (NCM Biotech, P10300) detection regent, and the film was taken by a ChemiDoc XRS+ System (Biorad, USA). The densitometric analysis of band intensities was carried out using the Image J software (National Institutes of Health, Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e5.9 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll data were analyzed with SPSS R23.0.0.0 software. Data were expressed as mean \u0026plusmn; standard error (SEM). Statistical comparisons between experimental group and control group or sham group were performed by using two-tailed unpaired Student's test. \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were approved by the Animal Ethics Committee of Tianjin Medical University (Number IACUC E2015093).\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\n\u003cp\u003eAll data generated during this study are included in this published article and its supplementary information files.\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis work was supported by the National Key Research and Development Program of China (2018YFC1314300), and National Natural Science Foundation of China (82030053, 81971599, and 81771818).\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026apos; contributions\u003c/h2\u003e\n\u003cp\u003eZ.H.S., S.Z., X.J.S., and Y.D. designed research; Z.H.S., S.Z., and X.J.S. performed research; Z.H.S. and S.Z. analyzed data; Z.H.S., S.Z., and Y.D. wrote the paper.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTrevisan K, Cristina-Pereira R, Silva-Amaral D, Aversi-Ferreira TA: \u003cb\u003eTheories of Aging and the Prevalence of Alzheimer's Disease\u003c/b\u003e. \u003cem\u003eBiomed Res Int\u003c/em\u003e 2019, \u003cb\u003e2019\u003c/b\u003e:9171424.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang L, Wang J, Wang Z, Huang W, Yang Y, Cai Z, Li K: \u003cb\u003eRole of the Glyoxalase System in Alzheimer's Disease\u003c/b\u003e. \u003cem\u003eJ Alzheimers Dis\u003c/em\u003e 2018, \u003cb\u003e66\u003c/b\u003e(3):887\u0026ndash;899.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheltens P, Blennow K, Breteler MM, de Strooper B, Frisoni GB, Salloway S, Van der Flier WM: \u003cb\u003eAlzheimer's disease\u003c/b\u003e. \u003cem\u003eLancet\u003c/em\u003e 2016, \u003cb\u003e388\u003c/b\u003e(10043):505\u0026ndash;517.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiwari S, Atluri V, Kaushik A, Yndart A, Nair M: \u003cb\u003eAlzheimer's disease: pathogenesis, diagnostics, and therapeutics\u003c/b\u003e. \u003cem\u003eInt J Nanomedicine\u003c/em\u003e 2019, \u003cb\u003e14\u003c/b\u003e:5541\u0026ndash;5554.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrasad K: \u003cb\u003eAGE-RAGE stress: a changing landscape in pathology and treatment of Alzheimer's disease\u003c/b\u003e. \u003cem\u003eMol Cell Biochem\u003c/em\u003e 2019, \u003cb\u003e459\u003c/b\u003e(1-2):95\u0026ndash;112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePini L, Pievani M, Bocchetta M, Altomare D, Bosco P, Cavedo E, Galluzzi S, Marizzoni M, Frisoni GB: \u003cb\u003eBrain atrophy in Alzheimer's Disease and aging\u003c/b\u003e. \u003cem\u003eAgeing Res Rev\u003c/em\u003e 2016, \u003cb\u003e30\u003c/b\u003e:25\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cb\u003e2020 Alzheimer\u003c/b\u003e'\u003cb\u003es disease facts and figures\u003c/b\u003e. \u003cem\u003eAlzheimers Dement\u003c/em\u003e 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDejanovic B, Huntley MA, De Maziere A, Meilandt WJ, Wu T, Srinivasan K, Jiang Z, Gandham V, Friedman BA, Ngu H \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eChanges in the Synaptic Proteome in Tauopathy and Rescue of Tau-Induced Synapse Loss by C1q Antibodies\u003c/b\u003e. \u003cem\u003eNeuron\u003c/em\u003e 2018, \u003cb\u003e100\u003c/b\u003e(6):1322-1336 e1327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabin LA, Smart CM, Amariglio RE: \u003cb\u003eSubjective Cognitive Decline in Preclinical Alzheimer's Disease\u003c/b\u003e. \u003cem\u003eAnnu Rev Clin Psychol\u003c/em\u003e 2017, \u003cb\u003e13\u003c/b\u003e:369\u0026ndash;396.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson ND: \u003cb\u003eState of the science on mild cognitive impairment (MCI)\u003c/b\u003e. \u003cem\u003eCNS Spectr\u003c/em\u003e 2019, \u003cb\u003e24\u003c/b\u003e(1):78\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerson A, Nativio R, Berger SL, Bonini NM: \u003cb\u003eEpigenetic Regulation in Neurodegenerative Diseases\u003c/b\u003e. \u003cem\u003eTrends Neurosci\u003c/em\u003e 2018, \u003cb\u003e41\u003c/b\u003e(9):587\u0026ndash;598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerger SL, Kouzarides T, Shiekhattar R, Shilatifard A: \u003cb\u003eAn operational definition of epigenetics\u003c/b\u003e. \u003cem\u003eGenes Dev\u003c/em\u003e 2009, \u003cb\u003e23\u003c/b\u003e(7):781\u0026ndash;783.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang JY, Aromolaran KA, Zukin RS: \u003cb\u003eThe emerging field of epigenetics in neurodegeneration and neuroprotection\u003c/b\u003e. \u003cem\u003eNat Rev Neurosci\u003c/em\u003e 2017, \u003cb\u003e18\u003c/b\u003e(6):347\u0026ndash;361.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatts BR, Wittmann S, Wery M, Gautier C, Kus K, Birot A, Heo DH, Kilchert C, Morillon A, Vasiljeva L: \u003cb\u003eHistone deacetylation promotes transcriptional silencing at facultative heterochromatin\u003c/b\u003e. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 2018, \u003cb\u003e46\u003c/b\u003e(11):5426\u0026ndash;5440.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Yu JT, Tan MS, Jiang T, Tan L: \u003cb\u003eEpigenetic mechanisms in Alzheimer's disease: implications for pathogenesis and therapy\u003c/b\u003e. \u003cem\u003eAgeing Res Rev\u003c/em\u003e 2013, \u003cb\u003e12\u003c/b\u003e(4):1024\u0026ndash;1041.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Kim Y, Liu T, Hwang YJ, Hyeon SJ, Im H, Lee K, Alvarez VE, McKee AC, Um SJ \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eSIRT3 deregulation is linked to mitochondrial dysfunction in Alzheimer's disease\u003c/b\u003e. \u003cem\u003eAging Cell\u003c/em\u003e 2018, \u003cb\u003e17\u003c/b\u003e(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Y, Yang H, Xie Y, Ding Y, Kong D, Yu H: \u003cb\u003eResearch Progress on Alzheimer's Disease and Resveratrol\u003c/b\u003e. \u003cem\u003eNeurochem Res\u003c/em\u003e 2020, \u003cb\u003e45\u003c/b\u003e(5):989\u0026ndash;1006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorpas R, Revilla S, Ursulet S, Castro-Freire M, Kaliman P, Petegnief V, Gimenez-Llort L, Sarkis C, Pallas M, Sanfeliu C: \u003cb\u003eSIRT1 Overexpression in Mouse Hippocampus Induces Cognitive Enhancement Through Proteostatic and Neurotrophic Mechanisms\u003c/b\u003e. \u003cem\u003eMol Neurobiol\u003c/em\u003e 2017, \u003cb\u003e54\u003c/b\u003e(7):5604\u0026ndash;5619.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao J, Zheng L, Zhang Q, Li X, Zhang X, Li Z, Bai X, Zhang Z, Huo W, Zhao X \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eDeacetylation of TFEB promotes fibrillar Abeta degradation by upregulating lysosomal biogenesis in microglia\u003c/b\u003e. \u003cem\u003eProtein Cell\u003c/em\u003e 2016, \u003cb\u003e7\u003c/b\u003e(6):417\u0026ndash;433.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMin SW, Cho SH, Zhou Y, Schroeder S, Haroutunian V, Seeley WW, Huang EJ, Shen Y, Masliah E, Mukherjee C \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eAcetylation of tau inhibits its degradation and contributes to tauopathy\u003c/b\u003e. \u003cem\u003eNeuron\u003c/em\u003e 2010, \u003cb\u003e67\u003c/b\u003e(6):953\u0026ndash;966.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMin SW, Sohn PD, Li Y, Devidze N, Johnson JR, Krogan NJ, Masliah E, Mok SA, Gestwicki JE, Gan L: \u003cb\u003eSIRT1 Deacetylates Tau and Reduces Pathogenic Tau Spread in a Mouse Model of Tauopathy\u003c/b\u003e. \u003cem\u003eJ Neurosci\u003c/em\u003e 2018, \u003cb\u003e38\u003c/b\u003e(15):3680\u0026ndash;3688.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichan S, Li Y, Chou MM, Parrella E, Ge H, Long JM, Allard JS, Lewis K, Miller M, Xu W \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eSIRT1 is essential for normal cognitive function and synaptic plasticity\u003c/b\u003e. \u003cem\u003eJ Neurosci\u003c/em\u003e 2010, \u003cb\u003e30\u003c/b\u003e(29):9695\u0026ndash;9707.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShoji H, Takao K, Hattori S, Miyakawa T: \u003cb\u003eAge-related changes in behavior in C57BL/6J mice from young adulthood to middle age\u003c/b\u003e. \u003cem\u003eMolecular brain\u003c/em\u003e 2016, \u003cb\u003e9\u003c/b\u003e:11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEichenbaum H: \u003cb\u003eOn the Integration of Space, Time, and Memory\u003c/b\u003e. \u003cem\u003eNeuron\u003c/em\u003e 2017, \u003cb\u003e95\u003c/b\u003e(5):1007\u0026ndash;1018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePini L, Pievani M, Bocchetta M, Altomare D, Bosco P, Cavedo E, Galluzzi S, Marizzoni M, Frisoni GB: \u003cb\u003eBrain atrophy in Alzheimer's Disease and aging\u003c/b\u003e. \u003cem\u003eAgeing research reviews\u003c/em\u003e 2016, \u003cb\u003e30\u003c/b\u003e:25\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJack CR, Barkhof F, Bernstein MA, Cantillon M, Cole PE, Decarli C, Dubois B, Duchesne S, Fox NC, Frisoni GB \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eSteps to standardization and validation of hippocampal volumetry as a biomarker in clinical trials and diagnostic criterion for Alzheimer's disease\u003c/b\u003e. \u003cem\u003eAlzheimer's \u0026amp; dementia: the journal of the Alzheimer's Association\u003c/em\u003e 2011, \u003cb\u003e7\u003c/b\u003e(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eByers AL, Yaffe K: \u003cb\u003eDepression and risk of developing dementia\u003c/b\u003e. \u003cem\u003eNature reviews Neurology\u003c/em\u003e 2011, \u003cb\u003e7\u003c/b\u003e(6):323\u0026ndash;331.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFonio E, Golani I, Benjamini Y: \u003cb\u003eMeasuring behavior of animal models: faults and remedies\u003c/b\u003e. \u003cem\u003eNat Methods\u003c/em\u003e 2012, \u003cb\u003e9\u003c/b\u003e(12):1167\u0026ndash;1170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorris RG, Garrud P, Rawlins JN, O'Keefe J: \u003cb\u003ePlace navigation impaired in rats with hippocampal lesions\u003c/b\u003e. \u003cem\u003eNature\u003c/em\u003e 1982, \u003cb\u003e297\u003c/b\u003e(5868):681\u0026ndash;683.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang BL, Chua CEL: \u003cb\u003eSIRT1 and neuronal diseases\u003c/b\u003e. \u003cem\u003eMol Aspects Med\u003c/em\u003e 2008, \u003cb\u003e29\u003c/b\u003e(3):187\u0026ndash;200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolinuevo JL, Ayton S, Batrla R, Bednar MM, Bittner T, Cummings J, Fagan AM, Hampel H, Mielke MM, Mikulskis A \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eCurrent state of Alzheimer's fluid biomarkers\u003c/b\u003e. \u003cem\u003eActa neuropathologica\u003c/em\u003e 2018, \u003cb\u003e136\u003c/b\u003e(6):821\u0026ndash;853.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Husseini AE, Schnell E, Chetkovich DM, Nicoll RA, Bredt DS: \u003cb\u003ePSD-95 involvement in maturation of excitatory synapses\u003c/b\u003e. \u003cem\u003eScience\u003c/em\u003e 2000, \u003cb\u003e290\u003c/b\u003e(5495):1364\u0026ndash;1368.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBustos FJ, Ampuero E, Jury N, Aguilar R, Falahi F, Toledo J, Ahumada J, Lata J, Cubillos P, Henriquez B \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eEpigenetic editing of the Dlg4/PSD95 gene improves cognition in aged and Alzheimer's disease mice\u003c/b\u003e. \u003cem\u003eBrain\u003c/em\u003e 2017, \u003cb\u003e140\u003c/b\u003e(12):3252\u0026ndash;3268.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThiel G: \u003cb\u003eSynapsin I, synapsin II, and synaptophysin: marker proteins of synaptic vesicles\u003c/b\u003e. \u003cem\u003eBrain Pathol\u003c/em\u003e 1993, \u003cb\u003e3\u003c/b\u003e(1):87\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValtorta F, Pennuto M, Bonanomi D, Benfenati F: \u003cb\u003eSynaptophysin: leading actor or walk-on role in synaptic vesicle exocytosis?\u003c/b\u003e \u003cem\u003eBioessays\u003c/em\u003e 2004, \u003cb\u003e26\u003c/b\u003e(4):445\u0026ndash;453.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaeberlein M, McVey M, Guarente L: \u003cb\u003eThe SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms\u003c/b\u003e. \u003cem\u003eGenes Dev\u003c/em\u003e 1999, \u003cb\u003e13\u003c/b\u003e(19):2570\u0026ndash;2580.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C, Zhou M, Ge Y, Wang X: \u003cb\u003eSIRT1 and aging related signaling pathways\u003c/b\u003e. \u003cem\u003eMech Ageing Dev\u003c/em\u003e 2020, \u003cb\u003e187\u003c/b\u003e:111215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonda DJ, Lee H-G, Camins A, Pall\u0026agrave;s M, Casadesus G, Smith MA, Zhu X: \u003cb\u003eThe sirtuin pathway in ageing and Alzheimer disease: mechanistic and therapeutic considerations\u003c/b\u003e. \u003cem\u003eThe Lancet Neurology\u003c/em\u003e 2011, \u003cb\u003e10\u003c/b\u003e(3):275\u0026ndash;279.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlves-Fernandes DK, Jasiulionis MG: \u003cb\u003eThe Role of SIRT1 on DNA Damage Response and Epigenetic Alterations in Cancer\u003c/b\u003e. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2019, \u003cb\u003e20\u003c/b\u003e(13).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao F, Gong Z: \u003cb\u003eThe Beneficial Roles of SIRT1 in Neuroinflammation-Related Diseases\u003c/b\u003e. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e 2020, \u003cb\u003e2020\u003c/b\u003e:6782872.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLisman J, Buzs\u0026aacute;ki G, Eichenbaum H, Nadel L, Ranganath C, Redish AD: \u003cb\u003eViewpoints: how the hippocampus contributes to memory, navigation and cognition\u003c/b\u003e. \u003cem\u003eNat Neurosci\u003c/em\u003e 2017, \u003cb\u003e20\u003c/b\u003e(11):1434\u0026ndash;1447.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao DD, Vorhies JS, Senzer N, Nemunaitis J: \u003cb\u003esiRNA vs. shRNA: similarities and differences\u003c/b\u003e. \u003cem\u003eAdv Drug Deliv Rev\u003c/em\u003e 2009, \u003cb\u003e61\u003c/b\u003e(9):746\u0026ndash;759.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmaral DG, Witter MP: \u003cb\u003eThe three-dimensional organization of the hippocampal formation: a review of anatomical data\u003c/b\u003e. \u003cem\u003eNeuroscience\u003c/em\u003e 1989, \u003cb\u003e31\u003c/b\u003e(3):571\u0026ndash;591.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanai S, Endo S: \u003cb\u003eFunctional Aging in Male C57BL/6J Mice Across the Life-Span: A Systematic Behavioral Analysis of Motor, Emotional, and Memory Function to Define an Aging Phenotype\u003c/b\u003e. \u003cem\u003eFront Aging Neurosci\u003c/em\u003e 2021, \u003cb\u003e13\u003c/b\u003e:697621.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePercie du Sert N, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eReporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0\u003c/b\u003e. \u003cem\u003ePLoS Biol\u003c/em\u003e 2020, \u003cb\u003e18\u003c/b\u003e(7):e3000411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVorhees CV, Williams MT: \u003cb\u003eMorris water maze: procedures for assessing spatial and related forms of learning and memory\u003c/b\u003e. \u003cem\u003eNat Protoc\u003c/em\u003e 2006, \u003cb\u003e1\u003c/b\u003e(2):848\u0026ndash;858.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarbash S, Hanin G, Soreq H: \u003cb\u003eStereotactic injection of microRNA-expressing lentiviruses to the mouse hippocampus ca1 region and assessment of the behavioral outcome\u003c/b\u003e. \u003cem\u003eJ Vis Exp\u003c/em\u003e 2013(76):e50170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Pi H, Xi Y, Wang L, Tian L, Chen M, Xie J, Deng P, Zhang T, Zhou C \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eKIF5A-dependent axonal transport deficiency disrupts autophagic flux in trimethyltin chloride-induced neurotoxicity\u003c/b\u003e. \u003cem\u003eAutophagy\u003c/em\u003e 2021, \u003cb\u003e17\u003c/b\u003e(4):903\u0026ndash;924.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan CG, Wang XD, Zuo XN, Zang YF: \u003cb\u003eDPABI: Data Processing \u0026amp; Analysis for (Resting-State) Brain Imaging\u003c/b\u003e. \u003cem\u003eNeuroinformatics\u003c/em\u003e 2016, \u003cb\u003e14\u003c/b\u003e(3):339\u0026ndash;351.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarriere DA, Ella A, Szeremeta F, Adriaensen H, Meme W, Chaillou E, Migaud M, Meme S, Levy F, Keller M: \u003cb\u003eBrain orchestration of pregnancy and maternal behavior in mice: A longitudinal morphometric study\u003c/b\u003e. \u003cem\u003eNeuroimage\u003c/em\u003e 2021, \u003cb\u003e230\u003c/b\u003e:117776.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nros","sideBox":"Learn more about [BMC Neuroscience](http://bmcneurosci.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/nros/default.aspx","title":"BMC Neuroscience","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Sirt1, Aging, Hippocampal atrophy, Brain structural MRI, Learning and memory ","lastPublishedDoi":"10.21203/rs.3.rs-1126398/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1126398/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eBackground:\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e Sirtuin 1 \u003c/em\u003e(\u003cem\u003eSirt1\u003c/em\u003e) is a recognized longevity gene and has been shown to be associated with aging and its related diseases. Hippocampal volume is considered to be the most sensitive brain imaging phenotype for cognition, but the effect of \u003cem\u003eSirt1\u003c/em\u003e on hippocampal morphology during aging has not been reported. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003e\u003cem\u003eResults:\u003c/em\u003e\u003c/strong\u003e Herein, we investigated the effect of conditional \u003cem\u003eSirt1\u003c/em\u003e knockdown on hippocampal volume in middle-aged mice, as well as its cognitive function and the underlying molecular mechanisms. Brain structural magnetic resonance imaging (MRI) showed that adeno-associated virus (AAV) mediated hippocampal\u003cem\u003e Sirt1\u003c/em\u003e knockdown caused hippocampal atrophy in 8-month-old mice. Open field test (OFT) and Morris Water Maze (MWM) test revealed that hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown significantly weakened spatial learning and memory of mice without effect on anxiety and exploratory behavior. Western blotting analysis showed that p-tau levels were significantly increased while PSD95 levels were obviously reduced, indicating that hippocampal \u003cem\u003eSirt1\u003c/em\u003e knockdown could activate tau pathology and synaptic damage.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConclusions:\u003c/em\u003e\u003c/strong\u003e This work revealed that \u003cem\u003eSirt1\u003c/em\u003e is an important protective gene against hippocampal atrophy and its induced cognitive impairment during aging, providing potential therapeutic targets for the prevention and intervention of aging-related neuropsychic diseases.\u003c/p\u003e","manuscriptTitle":"Sirt1 Protects Against Hippocampal Atrophy and its Induced Cognitive Impairment in Middle-aged Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-12-28 18:46:54","doi":"10.21203/rs.3.rs-1126398/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-01-10T13:16:30+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-01-04T16:34:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"cdd77ede-582f-4dc7-aed6-a0f58016eb72","date":"2021-12-28T16:34:07+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-12-26T11:51:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-12-23T10:57:43+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2021-12-23T10:28:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-12-23T10:25:45+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Neuroscience","date":"2021-11-30T06:15:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nros","sideBox":"Learn more about [BMC Neuroscience](http://bmcneurosci.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/nros/default.aspx","title":"BMC Neuroscience","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"41907858-7929-4c24-8be5-553d60612d91","owner":[],"postedDate":"December 28th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":9399480,"name":"Cognitive Neuroscience"}],"tags":[],"updatedAt":"2022-05-23T05:44:18+00:00","versionOfRecord":[],"versionCreatedAt":"2021-12-28 18:46:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1126398","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1126398","identity":"rs-1126398","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}