Acceleration of bone repairation by BMSCs overexpressing NGF combined with NSA and allograft bone scaffolds | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Acceleration of bone repairation by BMSCs overexpressing NGF combined with NSA and allograft bone scaffolds Ying Ji, Yongkang Mao, Honghu Lin, Ye Wang, Peishuai Zhao, Yong Guo, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3911764/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Background Repairation of bone defects remains a major clinical problem. Constructing bone tissue engineering containing growth factors, stem cells, and material scaffolds to repair bone defects has recently become a hot research topic. Nerve growth factor (NGF) can promote osteogenesis of bone marrow mesenchymal stem cells (BMSCs), but the low survival rate of the BMSCs during transplantation remains an unresolved issue. In this study, we investigated the therapeutic effect of BMSCs overexpression of NGF on bone defect by inhibiting pyroptosis. Methods The relationship between the low survival rate and pyroptosis of BMSCs overexpressing NGF in localized inflammation of fractures was explored by detecting pyroptosis protein levels. Then, the NGF + /BMSCs-NSA-Sca bone tissue engineering was constructed by seeding BMSCs overexpressing NGF on the allograft bone scaffold and adding the pyroptosis inhibitor necrosulfonamide(NSA). The femoral condylar defect model in the Sprague-Dawley (SD) rat was studied by micro-CT, histological, WB and PCR analyses in vitro and in vivo to evaluate the regenerative effect of bone repair. Results The pyroptosis that occurs in BMSCs overexpressing NGF is associated with the nerve growth factor receptor (P75NTR) during osteogenic differentiation. Furthermore, NSA can block pyroptosis in BMSCs overexpression NGF. Notably, the analyses using the critical-size femoral condylar defect model indicated that the NGF + /BMSCs-NSA-Sca group inhibited pyroptosis significantly and had higher osteogenesis in defects. Conclusion NGF + /BMSCs-NSA had strong osteogenic properties in repairing bone defects. Moreover, NGF + /BMSCs-NSA-Sca mixture developed in this study opens new horizons for developing novel tissue engineering constructs. BMSCs NGF P75NTR Pyroptosis Bone tissue engineering Bone regeneration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Clinical bone defects caused by trauma, bone tumors, and osteomyelitis have become a challenging problem in orthopedics. Currently, clinical treatment of the above bone defects is usually regenerative bone tissue repair by transplanting autologous, allogeneic, xenograft, and inorganic bone at the site of the bone defect, and different bone tissue materials have been widely used for treating complex bone defects [ 1 – 4 ]. However, the potential risk of infection, poor osteoinductivity, and host inflammatory response induced by biomaterials may adversely affect the bone regenerative repair outcome [ 5 , 6 ]. Consequently, these issues limit their practical application. Numerous studies reveal that combining cells, growth factors, and biomaterials to construct bone tissue engineering facilitates bone defect repair and regeneration [ 7 – 9 ]. Therefore, developing a new bone tissue engineering material with anti-inflammatory and degradability functions, such as biocompatibility and strength, to promote bone defect repair has become a hot spot of research. Stem cells have strong self-renewal and multidirectional differentiation capabilities and have great potential for application in bone tissue engineering [ 10 , 11 ]. Bone marrow mesenchymal stem cells (BMSCs) are pluripotent stem cells in the bone marrow [ 12 ]. BMSCs maintain their multidirectional differentiation potential in vitro and differentiate into bone tissues when transplanted in vivo [ 13 ]. BMSCs are widely used in clinical research and therapy due to these biological properties and have become an important transplantation cell for tissue engineering [ 14 ]. Nerve growth factor (NGF) is a nerve cell growth regulator [ 15 ], nourishing and promoting nerve protrusion growth, and it can regulate and promote BMSCS osteogenesis [ 16 ]. Studies have been shown, NGF promotes the long bone development innervated by sensory nerves and plays an important role in fracture healing [ 17 , 18 ]. Therefore, NGF as a bone graft to construct bone tissue engineering materials holds great promise. Although NGF has the potential to provide cutting-edge solutions for bone tissue engineering, challenges remain in stabilizing its ability to promote osteogenesis of BMSCs. Our preliminary research shows that, although NGF has enhanced biological activity in its ability to regulate the BMSC osteogenesis, inflammatory factors around the grafted cells have high expression during the process of NGF as a bone graft to promote fracture healing, and the nerve growth factor receptor (P75NTR) content was persistently increased in tissues of fracture non-healing [ 19 ]. P75NTR is a low affinity transmembrane receptor for NGF. Studies have shown its association with cell and tumour migration and invasion [ 20 , 21 ]. We found that silencing the P75NTR gene enhances osteogenic differentiation of rat BMSCs [ 22 ]. A recent study has revealed that P75NTR can activate the NF-κB signaling pathway to aggravate cell damage [ 23 , 24 ]. The NF-κB signaling pathway is closely linked to the NLRP3-mediated inflammatory response, and increased NLRP3 induces pyroptosis. Therefore, We suspect that the reduced survival of BMSCs overexpressing NGF may be related to P75NTR-induced inflammation, which leads to pyroptosis via the NF-κB signaling pathway. Pyroptosis is a highly regulated programmed cell death process [ 25 ], manifested by activating NF-κB by pathogens or stressors [ 26 ]. This leads to activation of the NLRP3 inflammasome, and caspase-1, then releasing pro-inflammatory mediator IL-1β and aggregating GSDMD. Finally, the rapid dissolution of plasma membrane causes cell death [ 27 ]. Additionally, studies have shown that pharmacological or genetic interventions can inhibit cellular pyroptosis [ 28 , 29 ]. Therefore, improving the survival of BMSC overexpressing NGF and elucidating the related mechanism become the key research questions. Recently, necrosulfonamide was identified as a potent inhibitor of the pore-forming protein gasdermin D (GSDMD), and it can inhibit the release of pro-inflammatory mediators, such as IL-1β [ 30 ]. In this study, it was verified that the low survival rate of BMSCs overexpressing NGF in the local inflammatory response of fractures was closely related to pyroptosis. In vitro, we compared the effects of NGF + /BMSCs, BMSCs-NSA, and NGF + /BMSCs-NSA on pyroptosis of BMSCs. And the final analysis showed that the pyroptosis reaction of BMSCs overexpressing NGF could be blocked by NSA. In vivo, we implanted BMSCs containing NGF + /BMSCs, BMSCs-NSA, and NGF + /BMSCs-NSA on the allogeneic bone to construct bone tissue-engineered grafts. And we transplanted them into the rat femoral condylar defects, and monitored new bone formation in a distal femoral defect model. The underlying mechanism of osteogenic differentiation of BMSCs overexpressing NGF was further investigated. We demonstrated that osteoblastic differentiation of BMSCs overexpressing NGF in the inflammatory response of fractures is closely related to pyroptosis. At the same time, overexpression of NGF combined with NSA can inhibit this pyroptosis and improve the survival rate of BMSCs, and enhance the osteogenic ability of BMSCs overexpression of NGF. This study can provide guidance for the design of new bone tissue engineering materials. Materials and methods In Vitro Study Origin, culture and identification of BMSCs BMSCs were purchased from Cyagen (RASMX-01001; Guangzhou, China). Low glucose dulbecco’s modified Eagle medium (L-DMEM) (Gibco, Billings, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin solution (Gibco) was used as the medium. The medium was regularly changed after every 3 days. And the cells were cultured at 37°C in a humidified atmosphere consisting of 5% CO2 in incubator.When the cultures approached 70–80% confluence, the cells were serially subcultured through passaging. The purchased BMSCs identification quality test is qualified, and an additional file shows this in more detail [see supplementary Fig. 1]. In addition, the cell immunophenotyping of BMSCs was evaluated using flow cytometry. Briefly, the cells were suspended in phosphate-buffered saline (PBS; Solarbio, China) at a concentration of 10 6 cells/mL. Thereafter, the cells were incubated with antibodys, including CD 34-FITC (PA5-85917; eBioscience, San Diego, CA, USA), CD44-PE (103007; Biolegend, San Diego, CA, USA), CD90-PE (MA1-80650; eBioscience), anti-rat CD29-PE (102207; Biolegend). The expression level of the antigen markers was analyzed through a BD FACSCanto (BD Biosciences, San Jose, CA). Collected data were analyzed using flow cytometry software (FlowJo V10, Flowjo, LLC, Ashland, OR, USA). Lentiviral transduction and characterization The cells were transfected using an NGF overexpressed lentiviral vector, a P75NTR overexpressed lentiviral vector and a P75NTR knockdown lentiviral vector (GENECHEM, Shanghai, China). BMSCs were seeded into six-well plate at a density of 8.0 × 104 cells/well. When the cells were fused to 70–80%, the lentiviral vector infection solution was configured according to the manufacturer's instructions. There-after, the multiplicity of infection was set to 50, and BMSCs were transfected with NGF overexpressing lentiviral vector in the presence of HiTransG P infection enhancement solution. After culturing for 16 h, the infection solution was removed. Then, the fluorescent protein expression of the genes was observed using an inverted fluorescence microscope after three days. Determination of NSA optimal concentration The BMSCs were treated by necrosulfonamide (HY-100573; MCE, NJ, USA) with a concentration gradient of 0, 0.5, 1.0, 1.5, 2.0, and 3.0 µM, and normal L-DMEM medium was used as a control. Briefly, BMSCs were seeded in 96-well plates at a density of 5000 cells per well. After removing the medium from each well, MTT (5mg/ml, Sigma-Aldrich, St. Louis, MO, USA) was added to each well and cultured for 3h. There-after, the MTT was removed and 200 µL of DMSO (Sigma-Aldrich) were added to each well to dissolve the crystals. Then, the absorbance was measured at 490 nm using an enzyme marker (Synergy HT). Based on the above results, the optimal concentration of NSA that best promotes BMSC proliferation was prepared, and the following experiments were performed at this concentration. Alizarin Red S (ARS) Staining BMSCs were seeded into 0.1% gelatin-coated six-well plates. After culturing the cells to 70% fusion, the standard medium was replaced with Rat BMSC Osteogenic Induction and Differentiation Medium (RAXMX-90021; Cyagen, Guangzhou, China) and changed every three days, as described previously [ 31 ]. The kit included OriCell® Basal Medium For Cell Culture (177 mL; BLDM-03011), OriCell® Fetal Bovine Serum (Superior-Quality) (20 mL; FBSSR-01021), OriCell® Supplement For Rat BMSC Osteogenic Differentiation (3 mL; RAXMX-04021), Alizarin Red S (10 mL; ALIR-10001 and Gelatin (10mL; GLT-11301).After two and four weeks of osteogenic induction, the samples were fixed with a 4% paraformaldehyde for 30 min and stained with alizarin red for 5 min, respectively. Finally, calcium deposition images were taken using a microscope (Olympus Corporation). The cells were collected after osteogenic induction two weeks for Western blot experiments. Western blot assay BMSCs were seeded into six-well plates at a density of 80% and grouped according to the experimental design. The medium was discarded after treatment, and the wells were washed three times with cold PBS. The RIPA buffer (P0013B; Beyotime Biotechnology, China) containing a mixture of protease and phosphatase inhibitors was used to isolate the proteins. After that, centrifugation at 12,000 × g for 15 min at 4°C, and the supernatant was collected. The Protein was quantified using a BCA protein assay kit (P0010S; Beyotime). Proteins (20 µg/lane) were separated by SDS-PAGE (10% gel) and then transferred to polyvinylidene fluoride (PVDF) membranes (IPVH00010; Millipore, USA). Then the membranes were blocked with a sealing solution (P0023B-100ml; Beyotime) at 25°C for 1 h. The proteins were washed thrice with TBST for 10 min each and incubated with primary antibodies overnight at 4°C. Table 1 presents the list of the primary antibodies. The membranes were washed with TBST and incubated with the corresponding secondary antibody (1;5,000, Proteintech, Wuhan, China) for 1 h. After rinsing with TBST for three times, the signal was detected with an chemiluminescence reagent (WBKLS0100; Millipore) and used the ECL program (Bio-Rad, USA). Finally, the results were scanned and analyzed using a gel imaging system (ChemiDoc™ XRS + System, Bio-rad). Image J was used to analyze the gray level. The experiment was repeated three times. Table 1 The primary antibody information of this study Primary antibody Name Company and catalog dilution ratio Molecular weight (kDa) P75NTR Abcam, ab52987 1:2,000 75 GSDMD Abcam, ab219800 1:2,000 53 NLRP3 Abcam, ab263899 1:1,000 118 IL-1β Abcam, ab234437 1:1,000 31 OCN thermo Fisher Scientific, 33-5400 1:1,000 14 β-Actin Proteintech, 81115-1-RR 1;5,000 42 GAPDH Proteintech, 10494-1-AP 1;5,000 36 Physicochemical properties of the scaffolds Allogeneic bone scaffolds (Cojoing, beijing, China) with the three-dimensional mesh structure of natural bone tissue were prepared. The scaffold chemical structure was determined by Fourier transform infrared spectroscopy (FTIR; Nicolet IS10) and hydrogen proton nuclear magnetic resonance spectroscopy (1H NMR; Bruker AVANCE Ⅲ 600M). The scaffold morphological structure was observed using scanning electron microscopy (SEM; Zeiss Gemini SEM 300, Germany). Cell attachment study BMSCs were seeded on allogeneic bone scaffolds and co-cultured for three days. The surface morphology of cells grown on the scaffolds was assessed using SEM. After 72 h of cell inoculation, the cell scaffold constructs were washed thrice with PBS and fixed in a multi-step method. Initially, the constructs were fixed with 2.5 wt% (Solarbio) for 2 h. Then, the samples were dehydrated in ethanol with concentration gradients of 50%, 70%, 80%, 90%, 100% I, and 100% II. Finally, the scaffolds were vacuum dried, coated with gold sputtering (Quorum Technologies Ltd Desk sputtercoater, UK), and observed using a Zeiss Gemini SEM 300 at an accelerating voltage of 15 kV. In Vivo Study Animal Model Design and Surgical Implantation In this study, a rat model of critical-size femoral defects was made using 56 male SD rats aged 12 weeks. The animals were purchased from SJA Laboratory Animal Co., Ltd (Hunan, China) and individually housed in captivity in the Experimental Animal Center of Guilin Medical College with controlled temperature and light cycles (24°C and 12/12 light cycle). And the animals with free access to standard diet and drinking water. All animal experiments were conducted according to protocols approved by the Animal Ethics and Use Committee of Guilin Medical College (GLMC-IACUC-20241012), and the study protocols adhere to the ARRIVE guidelines. The fifty-six rats were randomly divided into four groups as follows (n = 14 per group): the BMSCs-Sca group, the BMSCs-NSA-Sca group, the NGF + /BMSCs-NSA-Sca group, the NGF + /BMSCs-Sca group. The rats were induced with 3% (w/v) pentobarbital salt solution (0.1 mL/100 g; Ceva, France) and de-haired, disinfected, and scarfed around the right femoral condyle. The subcutaneous tissues and muscles were incised layer-by-layer to expose the lower end of the right femur. A defect with a diameter of 4.5 mm and a depth of 5 mm was created by a dental microdrill (Thomas, France) to ensure a defined critical dimension. The incision did not penetrate the joint cavity to protect the articular cartilage. Then, allograft bone implanted with NGF + /BMSCs, NGF + /BMSCs-NSA, BMSCs-NSA, and BMSCs alone was filled into the defect, the incision was routinely sutured, and the rats were allowed to move freely after the operation. The defects filled with allograft bone containing BMSCs alone were considered control groups. The femoral condyles were collected from 28 rats at four and eight weeks aftre surgery. Notably, the animals were given 3% (w/v) pentobarbital salt solution in order to minimalize the stress and suffering of animals. 15 min after administration of anaesthetics, animals were euthanized by the disruption of the spinal cord. Qne part was used for Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot; the other part was fixed with 4% (w/v) paraformaldehyde at 4°C for 24 h. The samples were processed, analyzed by Micro-Computed Tomography (Micro-CT), and decalcified with EDTA decalcification solution (pH 7.2) for three months for histological studies. Micro-CT Analysis Micro-CT analysis was used to quantify the bone formation volume within the defect. Two and four weeks after surgery, the right femoral condyle was harvested and fixed with 4% paraformaldehyde. After processing, the samples were measured using a high-resolution 3D X-ray microscope (Zeiss Xradia 510 Versa) at 50 kV, 120 mA, and a pixel resolution of 9 µm. After scanning, a 3D image model was reconstructed using CTAN image analysis software. Based on a previous study [ 32 ], a hollow cylinder (ROI) with a diameter of 4.5 mm and a depth of 5 mm was selected to determine the percentage of bone volume/tissue volume (BV/TV %) to assess bone regeneration of the bone defect. Furthermore, the trabecular bone parameters analyzed and quantified to determine the trabecular number (Tb.N), trabecular separation (Tb.Sp), and trabecular thickness (Tb.Th). RNA extraction and qRT-PCR The pyroptosis and osteogenic gene expressions in animal tissues were analyzed by qRT-PCR. Fresh tissues were ground, and total RNA was extracted using the GeneJET™ RNA Purification Kit (K0732; Thermo Fisher Scientific, Warsaw, Poland, USA). Then, cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit-LBID (K16225; Thermo) according to the manufacturer's instructions. After that, using a real-time fluorescent PCR instrument (Thermo, 7900HT Fast Real-Time PCR System), PCR was performed by PowerUp™ SYBR™ Green Master Mix (A25742; Thermo). Finally, the relative expression of the associated factors was calculated by the Comparison 2-ΔΔCt method. The primer sequences used in this study are listed in Table 2 . Table 2 Primers for qRT-PCR of this study Gene name Forward primer(5’-3’) Reverse primer(5’-3’) GSDMD CCAGCATGGAAGCCTTAGAG CAGAGTCGAGCACCAGACAC IL-1β TGACTTCACCATGGAACCCG TCCTGGGGAAGGCATTAGGA GAPDH CTCATGACCACAGTCCATGC TTCAGCTCTGGGATGACCTT Western blot assay Pyroptosis and osteogenic gene expression in animal tissues were analyzed using Western blot. After grinding the fresh tissue, and tissue proteins were extracted as described in previous protocol 2.1.5. Finally, the samples were scanned and analyzed using a gel imaging system (Bio-rad, ChemiDoc™ XRS + System, USA) and quantified using ImageJ software. The experiment was repeated three times. Histology and immunohistochemistry Specimens with completed decalcification were dehydrated in increasing ethanol concentrations (50%, 70%, 90%, and 100%) and embedded in paraffin for histological evaluation. Then, the resulting samples were serially cut into 5 µm thick sections using a paraffin slicer. The sections were stained with hematoxylin & eosin (H&E) and Masson trichrome staining according to standard protocols to evaluate the recovery of bone defects and new bone formation. The paraffin sections were subjected to immunohistochemical (IHC) analysis to evaluate osteogenic differentiation and mineralization marker osteocalcin (OCN; 23418-1-AP; Proteintech, Group, Chicago, IL, USA). Firstly, the paraffin sections were baked, placed in xylene to deparaffinise, antigenically repaired using EDTA Antigen Repair Solution (pH 9.0; ZSGB-BIO, China), eliminated endogenous peroxidase, incubated with OCN antibody (Proteintech) overnight at 4°C, and then washed with PBS, incubated with enzyme-labeled goat-anti-rabbit IgG polymer (ZSGB-BIO) for 1 h and washed with PBS. Finally, the sections were stained with DAB chromogenic kit (ZSGB-BIO). Bone histomorphometric analyses were performed for all stained sections by the light microscope (Leica, Germany). Statistical Analysis All quantitative data were expressed as mean ± SD, and significant differences between multiple groups were analyzed using analysis of variance (ANOVA) method by GraphPad Prism 9.0 software. Differences were considered to be statistically significant when p < 0.05. *p < 0.05 and **p < 0.01. Results Characterization of BMSCs The morphological features and molecular markers of BMSCs were identified. When BMSCs from rat were cultured to the third generation, they exhibited a fusiform and flattened morphology with a vortex-like morphology (Fig. 1 A). Flow cytometry results showed that the surface of BMSCs positively expressed CD90, CD44 and CD29, but were negative for CD34. (Fig. 1 B) Low survival of BMSCs overexpressing NGF in response to fracture inflammation is strongly associated with P75NTR-mediated pyroptosis After three days of lentivirus transfection, fluorescence microscopy revealed green fluorescent expression in the NGF overexpression transfection group and the negative transfection, but no fluorescent expression in the blank groups (Fig. 2 A). Mineralized nodules are a hallmark of osteoblast maturation, and we assessed mineralized nodule formation by ARS staining. Figure 2 B depicts the formation of calcium deposits and nodules after two and four weeks of osteogenic induction, with more calcium deposits and nodules forming in the NGF overexpression group than in the control group. Meanwhile, we confirmed that the NGF overexpression group produced cellular markers of cellular pyroptosis while promoting osteogenic differentiation of BMSCs by examining the protein expression levels of specific pyroptosis markers. GSDMD and NLRP3 are specific proteins during cellular pyroptosis[ 33 , 34 ]. The Western blot results revealed that pyroptosis proteins GSDMD and NLRP3 were highly expressed in the NGF overexpression group (Fig. 2 C-E). P75NTR overexpression transfection group showed green fluorescence expression, P75NTR knockdown transfection group showed red fluorescence expression (Fig. 2 F). The fluorescence expression rate of the target gene could reach approximately 70%. In addition, we detected pyroptosis protein expression levels in BMSCs by overexpression and knockdown of P75NTR. The results showed that the relative expression of pyroptosis protein in the overexpression P75NTR transfection group was significantly higher than that in the negative transfection group and the blank group, and the relative expression of pyroptosis protein in the knockout P75NTR transfection group was significantly lower than that in the negative transfection group and the blank group (Fig. 2 G-J). These results suggest that the occurrence of inflammatory death in osteogenic differentiation of BMSCs overexpressing NGF may be associated with pyroptosis. Moreover, changes in P75NTR expression could regulate changes in the expression of proteins related to pyroptosis in BMSCs, and a positive correlation was observed. NSA can block pyroptosis in BMSCs overexpression NGF We evaluated the cell viability of BMSCs cultured under different NSA concentrations separately to explore the role of NSA in the growth and proliferation of BMSCs. The cell viability of BMSCs cultured under an NSA concentration of 1.5 µM was higher (Fig. 3 A). Three days after transfection, fluorescence microscopic presented green fluorescence expression in the NGF + /BMSCs and NGF + /BMSCs-NSA transfected groups, but no fluorescent expression was observed in the NSA and blank groups (Fig. 3 B). We confirmed the effect of NGF + /BMSCs, NGF + /BMSCs-NSA, or BMSCs-NSA on the gene expressions related to pyroptosis by examining the protein expression levels of the pyroptosis markers GSDMD and IL-1β. GSDMD and IL-1β were highly expressed in the NGF overexpression group. However, NGF + /BMSCs-NSA and BMSCs-NSA showed significant downregulation (Fig. 3 C-E). These results suggest that pyroptosis in the differentiation of BMSCs overexpression NGF can be blocked by NSA. Characteristics of scaffolds SEM micrographs exhibited the surface structure of the scaffolds to be a micron-sized porous structure ranging from 200 to 500 µm, with the distribution of the pores being quite homogeneous (Fig. 4 A). Figure 4 B showed the SEM image of cells adhering to the scaffold 3 days after inoculation with the filopodia extending into the scaffolds, and the results showed that the scaffold had good biocompatibility. Furthermore, FTIR spectrometer of scaffolds have been shown in Fig. 4 C. The telescopic vibrational peak at 3443 cm − 1 is caused by the N-H bonds of the amine group in the scaffolds, and the peaks at 1654 cm − 1 of the spectral band are attributed to the telescopic vibrational absorption peaks of the amides C = O. The peaks at 1031 cm − 1 and 561 cm − 1 have the phosphate P-O vibrational peak, and the 500–1200 cm − 1 segment primarily reacts to the scaffold’s phosphate component. Additionally, the chemical structure of the scaffolds was determined using NMR. Figure 4 D illustrates the NMR result with a peak of approximately 4.30 ppm. It suggests that the scaffold’s inorganic composition is primarily phosphate and carbonate. NGF + /BMSCs-NSA could promote early healing of SD rat bone defect To observe new bone formation within the femoral condylar defects in rats, we performed micro-CT analyses of defects implanted with NGF + /BMSCs, NGF + /BMSCs-NSA, BMSCs-NSA, and BMSCs-only allografts at four and eight weeks after surgery (Fig. 5 A-D). These results confirmed the new bone formation within the defects. At each time point after surgery, dense new bone tissue was visible around the grafts in the NGF + /BMSCs-NSA group, whereas only a small amount of new bone formation was observed in the control group. BV/TV% within ROI was measured to assess new bone formation around the grafts, as previously described (Fig. 5 E). At each postoperative time point, BV/TV was significantly higher in the NGF + /BMSCs-NSA group than in the control group (p < 0.01) and slightly higher than in the NGF + /BMSCs group. Additionally, trabecular structures were already visible at the edges of the defect in the NGF + /BMSCs-NSA group, whereas the middle portion of the graft had not yet completely degraded. Compared with the NGF + /BMSCs group, the number and thickness of bone trabeculae in the NGF + /BMSCs-NSA group increased, but the separation degree of bone trabeculae decreased (Fig. 5 F-H). This demonstrated the osteogenic capacity of NGF + /BMSCs-NSA allogeneic bone constructs. In addition, we used H&E, Masson's trichrome and immunohistochemistry to visualize the histological manifestations of bone regeneration in rat femoral condylar defects. The tissue section staining results were consistent with the imaging findings. H&E staining revealed a few osteoblasts. A small amount of neovascularization was visible at the edges of the NGF + /BMSCs-NSA group at 4 weeks after surgery. However, almost no new bone formation was detected in the controls. H&E staining exhibited that a small amount of new bone was visible in the control group at eight weeks after surgery. Specifically, the NGF + /BMSCs-NSA group displayed numerous new bones visible within the local connective tissue, few osteoblasts visible at the edge of the bone trabeculae, and the implant had a significant bone healing effect (Fig. 6 A). Similarly, Masson trichrome staining displayed that numerous neoplastic bones and collagenous tissues were visible in the NGF + /BMSCs-NSA group (Fig. 6 B). Immunohistochemical staining analysis presented that the immune response intensity to OCN was significantly higher in the group treated with NGF + /BMSCs-NSA scaffold constructs than in the control group after four and eight weeks after surgery (Fig. 7 ). In conclusion, these results demonstrate that combining NGF + /BMSCs-NSA on allogeneic bone scaffolds can improve the osteogenic capacity to repair bone defects. NGF + /BMSCs-NSA could involve bone regeneration via inhibiting cell pyroptosis We measured the GSDMD and IL-1β mRNA levels at the defects in rats at four and eight weeks after surgery, respectively, to examine the effects of NGF + /BMSCs-NSA and NGF + /BMSCs on the death-related gene expressions (Fig. 8 A, B and 9 A, B). Figure 8 A, B illustrate the results at four weeks after surgery. The pyroptosis-related signals GSDMD and IL-1β mRNA levels were significantly up-regulated in the NGF + /BMSCs group, whereas the GSDMD and IL-1β mRNA levels were significantly down-regulated in the NGF + /BMSCs-NSA group (p < 0.01). Similarly, the GSDMD and IL-1β mRNA levels were slightly down-regulated in the NGF + /BMSCs-NSA group than in the NGF + /BMSCs group at eight weeks after surgery (Fig. 9 A, B). These results demonstrated that NSA inhibited the pyroptosis-associated genes, GSDMD, and IL-1β mRNA levels and attenuated the pyroptosis effect from NGF overexpression. As previously described, we verified the effects of NGF + /BMSCs-NSA and NGF + BMSCs on pyroptosis-related protein expression using Western blotting. The results exhibited that the pyroptosis-related protein expression levels of GSDMD, IL-1β, and NLRP3 were enhanced in the NGF + /BMSCs group at four weeks after surgery, while pyroptosis protein levels were reduced in the NGF + /BMSCs-NSA group (Fig. 8 C-F). The osteoblastic protein expression levels of OCN were enhanced in the NGF + /BMSCs-NSA group (Fig. 8 G). Protein blotting exposed the same at eight weeks after surgery (Fig. 9 D-G). These results demonstrated that NSA inhibited the pyroptosis-related protein expression levels of GSDMD, IL-1β, and NLRP3 and promoted the osteogenic effects of NGF overexpression. The blocking effect of NSA mentioned above is verified again. Discussion In this study, we attempted to define the low survival of BMSCs overexpressing NGF in response to fracture inflammation and to improve it to promote regeneration of bone defect repair. Initially, we used lentiviral vectors loaded with overexpressed NGF genes to transfect BMSCs to determine their relationship with P75NTR and pyroptosis. Nerve Growth Factor induces osteogenic differentiation of various cells to promote fracture healing. For example, Yang et al. investigated the mechanism of action of NGF in the mouse embryonic osteogenic precursor cell line MC3T3-E, and the results showed that NGF promoted the proliferation and osteogenic differentiation of MC3T3-E while increasing the expression of BMP-2 [ 35 ]. Additionally, NGF promotes angiogenesis and trophic regeneration of skeletal sensory nerves. And vascular and nerve regeneration can significantly promote the process of bone repair. Recent studies have demonstrated that NGF stimulates the migration of skeletal cells during early bone repair and exerts various cell-specific functions [ 36 ]. Indeed, Our previous experiments indicated that cell survival was relatively low after NGF overexpression transfection of BMSCs, and P75NTR silencing combined with NGF overexpression double gene co-transfection of BMSCs demonstrated a good osteogenic capacity [ 37 ]. P75NTR is involved in various cell responses, such as apoptosis, survival, migration, and axonal growth. P75NTR has been reported to activate NF-κB signaling, up-regulate MMP-9 and VEGF expression, induce inflammation, and disrupt the blood-brain barrier in astrocytes [ 38 ]. Inhibition of P75NTR expression is known to improve the survival of neuro differentiated BMSCs [ 39 ] and enhance osteogenic differentiation of rat BMSCs [ 20 ]. Here, we found that overexpression of NGF can lead to the increase of P75NTR, and the change of P75NTR expression can regulate the expression of pyrogen related proteins in BMSCs with positive correlation. Consequently, these results support our suspect that the reduced survival of BMSCs overexpressing NGF in the fracture inflammatory response may be associated with P75NTR-induced pyroptosis. Combined with our previous studies, here our focus is to improve the pyroptosis response during the transplantation of BMSCs overexpressing NGF during the healing process of bone defects, in order to increase the survival rate of BMSCs for accelerated repair of bone defects. In order to clarify the low survival of BMSCs overexpressing NGF during the healing process of bone defects, we selected NLRP3, IL-1β and GSDMD, which are key factors in the process of pyroptosis. Activation of NLRP3 inflammatory vesicles is the key to pyroptosis. This was reported by Wang et al., they found that NLRP3 assembles into NLRP3 inflammatory vesicles upon sensing certain pathogens, and then cuts GSDMD, promotes the secretion of IL-1β and IL-18, and causes inflammatory cell death [ 40 ]. Moreover, GSDMD has been reported to be closely related to pyroptosis and inflammation, and GSDMD is cleaved to produce N-GSDMD fragments, forming pores that increase membrane permeability, leading to pyroptosis and IL-1β release [ 41 ]. Both classical and non-classical pathways of pyroptosis require activation of GSDMD to lead to the generation of pyroptosis. Therefore, in this study, NLRP3 and GSDMD were selected as entry points for the verification of pyroptosis. This provides a target selection scheme for inhibiting pyroptosis and solving the problem of low cell survival rate in bone defect healing. In addition, we also found that the pyroptosis of BMSCs overexpressing NGF during fracture inflammation can be blocked by NSA. During pyroptosis, NSA prevents pyroptosis by inhibiting the aggregation of long chains of GSDMD on the cell membrane. Furthermore, Zhang et al. showed that NSA could affect the mRNA and protein expression of pyroptosis related genes, inhibit the secretion of IL-6, TNF-α and IL-1β by osteoblasts, and they also found that NSA promoted the proliferation and differentiation of osteoblasts by inhibiting of NLRP3/caspase-1/GSDMD pyroptosis pathway [ 42 ]. Therefore, we selected NSA as a pyroptosis inhibitor. NSA can inhibit the pyroptosis reaction of BMSCs overexpressing NGF during the healing of bone defects in order to improve the survival rate of BMSCs. Our findings highlight the potential of NSA in inhibiting the pyroptosis of NGF + /BMSCs, making it a therapy to improve the low survival of BMSCs overexpressing NGF. Notably, the therapeutic NSA concentrations used in this study did not exhibit cytotoxic effects on cells. In vitro having demonstrated that NSA can inhibit the pyroptosis of NGF + /BMSCs in fracture inflammation, we proceeded to the final and most important aim of this study which focused on determining the ability of NGF + /BMSCs-NSA-Sca to promote bone regeneration and defect repair in vivo, especially in a rat model of femoral condylar defect. In this study, allograft bone was used as a scaffold to implant BMSCs loaded with overexpressed NGF. Allograft bone as a graft has strong mechanical strength, good biocompatibility, and bone conductivity, and making it a better choice for repairing bone defects [ 43 ]. Consistent with previous studies [ 44 ], allogeneic bone scaffolds could effectively support the BMSCs attachment and expansion in our experiments. We constructed novel grafts to repair rats bone defects by combining NGF-overexpressed BMSCs with allograft bone and adding pyroptosis inhibitors. Additionally, previous studies have used a rat femoral condylar defect model to assess bone regeneration and defect repair in vivo [ 45 ]. Another study revealed that the critical defect size that could not spontaneously be repaired was 3.5/5.0 mm [ 46 ]. Therefore, we evaluated the osteogenic capacity of NGF + /BMSCs-NSA combined with allograft bone scaffolds in a surgical model of bone defects in rats femoral condyles with a diameter of 4.5 mm and a depth of 5.0 mm. Micro-CT analysis and histological evaluation revealed that NGF + /BMSCS-NSA scaffolds significantly enhanced new bone formation compared to scaffolds with BMSCs alone. Furthermore, WB and PCR results showed that NGF + /BMSCs-NSA-Sca group had relatively low pyroptosis genes and relatively high osteogenic genes. This demonstrated that NGF + /BMSCs combined with NSA can increase the transplantation survival rate of BMSCs by inhibiting pyroptosis, and thus participate in bone regeneration to accelerate the repair of bone defects. Overall, the results suggest that the potential of the NGF + /BMSCs-NSA-Sca system as a novel therapy for bone defects. Through the above studies, we believe that NGF + /BMSCs-NSA-Sca is helpful to develop a new theoretical basis for the treatment of bone defects. However, the specific molecular mechanisms and pathway of pyroptosis in BMSCs overexpressing NGF are not yet clear, and whether it is related to the P75NTR-mediated NF-κB pathway. Therefore, specifically, our future work will focus on elucidate the relationship between pyroptosis in BMSCs overexpressing NGF and the NF-κB pathway in the inflammatory environment of fractures. Conclusion In conclusion, reduced survival of BMSCs overexpressing NGF in localised inflammation of fractures is closely related to P75NTR-induced pyroptosis, which can be inhibited by the use of NSA, and the use of BMSCs overexpressing NGF combined with allogeneic bone scaffolds and NSA as grafts accelerates bone defect repair and regeneration. Overall, we anticipate that the synergistic effect of BMSCs, scaffolds, and NGF during bone tissue regeneration contributes to bone tissue engineering material development with excellent properties. Abbreviations NGF: Nerve growth factor; BMSCs: Bone marrow mesenchymal stem cells; NSA: Necrosulfonamide; SD: Sprague-Dawley; P75NTR: Nerve growth factor receptor; GSDMD: Gasdermin D; IL-1β: Interleukin 1beta; OCN: Osteocalcin; NLRP3: NOD-like receptor thermal protein domain associated protein 3; L-DMEM: Low glucose dulbecco’s modified Eagle medium; PBS: Phosphate-buffered saline; ARS: Alizarin Red S; PVDF: Polyvinylidene fluoride; FTIR: Fourier transform infrared spectroscopy; 1H NMR: Hydrogen proton nuclear magnetic resonance spectroscopy; SEM: Scanning electron microscopy; PBS: Phosphate-buffered saline; qRT-PCR: Quantitative reverse transcription polymerase chain reaction; Micro-CT: Micro-Computed Tomography; BV/TV: Bone volume per tissue volume; Tb.N: Trabecular number; Tb.Th: Trabecular thickness; Tb.Sp: Trabecular separation; BCA: Bicinchoninic acid; H&E: Hematoxylin and eosin; MTT: Thiazolyl blue; IHC: immunohistochemical; BMP-2: Bone morphogenetic protein 2; MMP-9: matrix metalloprotein-9; VEGF: Vascular endothelial growth factor; NF-κB: nuclear transcription factor-κB; Declarations Ethics approval and consent to participate All animal experiments were approved by the Ethics Committee of the GuiLin Medical University (Approval No. GLMC-IACUC-20241012, Title of the approved project: The role and mechanism of P75NTR in regulating the pyroptosis of BMSCs in fracture non union, Date: January 17, 2024). Consent for publication All authors read and approved the final manuscript for publication. Availability of data and materials The data that support the findings of this study are available from the corresponding author on reasonable request. Competing interests The authors reported that they have no competing interests. Funding This work was supported by the National Natural Science Foundation of China (Grant number 82160416, 81660366 and 32071309), the Guangxi Science Technology Project (Grant number 2022GXNSFAA103025), Guangxi Medical and healthkey cultivation discipline construction project and Guangxi Medical and health key discipline construction project. Authors’ contributions Ying Ji conducted the in vivo experiments, data analysis, and manuscript writing. Yongkang Mao performed in vitro experiments. Honghu Lin and Ye Wang participated in acquisition of data. Yong Guo and Peishuai Zhao contributed to the pathological analysi. Lantao Gu, Can Fu and Ximiao Chen contributed to the design and experiments. Zheng Lv and Ning Wang analyzed the data. Qiang Li contributed to the interpretation of data; Chaoyong Bei conceived the idea, financed the study, and reviewed and edited the manuscript. The authors read and approved the final manuscript. Acknowledgements Not applicable. References Myeroff C, Archdeacon M. Autogenous bone graft: donor sites and techniques. J Bone Joint Surg Am. 2011;93(23):2227–36. Khare D, Basu B, Dubey AK. Electrical stimulation and piezoelectric biomaterials for bone tissue engineering applications. Biomaterials. 2020;258:120280. https://doi.org/10.1016/j.biomaterials.2020.120280 . Bose S, Roy M, Bandyopadhyay A. Recent advances in bone tissue engineering scaffolds. Trends Biotechnol. 2012;30(10):546–. https://doi.org/10.1016/j.tibtech.2012.07.005 . 54. Saravanan S, Vimalraj S, Thanikaivelan P, Banudevi S, Manivasagam G. A review on injectable chitosan/beta glycerophosphate hydrogels for bone tissue regeneration. Int J Biol Macromol. 2019;121:38–54. https://doi.org/10.1016/j.ijbiomac.2018.10.014 . Aghali A. Craniofacial Bone Tissue Engineering: Current Approaches and Potential Therapy. Cells. 2021;10(11):2993. https://doi.org/10.3390/cells10112993 . García-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone. 2015;81:112–21. https://doi.org/10.1016/j.bone.2015.07.007 . Cancedda R, Giannoni P, Mastrogiacomo M. A tissue engineering approach to bone repair in large animal models and in clinical practice. Biomaterials. 2007;28(29):4240–50. https://doi.org/10.1016/j.biomaterials.2007.06.023 . Kim HJ, You SJ, Yang DH, Eun J, Park HK, Kim MS, Chun HJ. Injectable hydrogels based on MPEG-PCL-RGD and BMSCs for bone tissue engineering. Biomater Sci. 2020;8(15):4334–45. https://doi.org/10.1039/D0BM00588F . Kim HD, Amirthalingam S, Kim SL, Lee SS, Rangasamy J, Hwang NS. Biomimetic Materials and Fabrication Approaches for Bone Tissue Engineering. Adv Healthc Mater. 2017;6(23):1700612. https://doi.org/10.1002/adhm.201700612 . Marolt D, Knezevic M, Novakovic GV. Bone tissue engineering with human stem cells. Stem Cell Res Ther. 2010;1(2):10. https://doi.org/10.1186/scrt10 . Kargozar S, Mozafari M, Hashemian SJ, Brouki Milan P, Hamzehlou S, Soleimani M, Joghataei MT, Gholipourmalekabadi M, Korourian A, Mousavizadeh K, Seifalian AM. Osteogenic potential of stem cells-seeded bioactive nanocomposite scaffolds: A comparative study between human mesenchymal stem cells derived from bone, umbilical cord Wharton's jelly, and adipose tissue. J Biomed Mater Res B Appl Biomater. 2018;106(1):61–72. https://doi.org/10.1002/jbm.b.33814 . Wang X, Wang Y, Gou W, Lu Q, Peng J, Lu S. Role of mesenchymal stem cells in bone regeneration and fracture repair: a review. Int Orthop. 2013;37(12):2491–8. https://doi.org/10.1007/s00264-013-2059-2 . Ouyang Z, Tan T, Zhang X, Wan J, Zhou Y, Jiang G, Yang D, Guo X, Liu T. CircRNA hsa_circ_0074834 promotes the osteogenesis-angiogenesis coupling process in bone mesenchymal stem cells (BMSCs) by acting as a ceRNA for miR-942-5p. Cell Death Dis. 2019;10(12):932. https://doi.org/10.1038/s41419-019-2161-5 . Mastrogiacomo M, Papadimitropoulos A, Cedola A, Peyrin F, Giannoni P, Pearce SG, Alini M, Giannini C, Guagliardi A, Cancedda R. Engineering of bone using bone marrow stromal cells and a silicon-stabilized tricalcium phosphate bioceramic: evidence for a coupling between bone formation and scaffold resorption. Biomaterials. 2007;28(7):1376–84. https://doi.org/10.1016/j.biomaterials.2006.10.001 . Indo Y. NGF-dependent neurons and neurobiology of emotions and feelings: Lessons from congenital insensitivity to pain with anhidrosis. Neurosci Biobehav Rev. 2018;87:1–16. https://doi.org/10.1016/j.neubiorev.2018.01.013 . Ye J, Gong P. NGF-CS/HA-coating composite titanium facilitates the differentiation of bone marrow mesenchymal stem cells into osteoblast and neural cells. Biochem Biophys Res Commun. 2020;531(3):290–6. https://doi.org/10.1016/j.bbrc.2020.06.158 . Tomlinson RE, Li Z, Zhang Q, Goh BC, Li Z, Thorek DLJ, Rajbhandari L, Brushart TM, Minichiello L, Zhou F, Venkatesan A, Clemens TL. NGF-TrkA Signaling by Sensory Nerves Coordinates the Vascularization and Ossification of Developing Endochondral Bone. Cell Rep. 2016;16(10):2723–35. https://doi.org/10.1016/j.celrep.2016.08.002 . Li Z, Meyers CA, Chang L, Lee S, Li Z, Tomlinson R, Hoke A, Clemens TL, James AW. Fracture repair requires TrkA signaling by skeletal sensory nerves. J Clin Invest. 2019;129(12):5137–50. https://doi.org/10.1172/JCI128428 . Li J, Wang M, Peng C, Bei C. Research progress of P75 neurotrophin receptor and new idea of nonunion treatment. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2017;31(1):105–109. Chinese. http://dx.doi.org/10.7507/1002-1892.201609008 . Berghoff J, Jaisimha AV, Duggan S, MacSharry J, McCarthy JV. Gamma-secretase-independent role for cadherin-11 in neurotrophin receptor p75 (p75(NTR)) mediated glioblastoma cell migration. Mol Cell Neurosci. 2015;69:41–53. https://doi.org/10.1016/j.mcn.2015.10.003 . Shonukan O, Bagayogo I, McCrea P, Chao M, Hempstead B. Neurotrophin-induced melanoma cell migration is mediated through the actin-bundling protein fascin. Oncogene. 2003;22(23):3616–23. https://doi.org/10.1038/sj.onc.1206561 . Wang N, Chen J, Chen X, Zhu L, Duan J, Wang Y, Bei C. Effect of lentivirus-mediated silencing of P75 neurotrophin receptor gene on osteogenic differentiation of bone marrow mesenchymal stem cells in rats. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2020;34(8):1052–8. http://dx.doi.org/10.7507/1002-1892.201912086 . Chinese. Schallner N, Ulbrich F, Engelstaedter H, Biermann J, Auwaerter V, Loop T, Goebel U. Isoflurane but not sevoflurane or desflurane aggravates injury to neurons in vitro and in vivo via p75NTR-NF-ĸB activation. Anesth Analg. 2014;119(6):1429–41. Wei Z, Yang C, Feng K, Guo S, Huang Z, Wang Y, Jian C. p75NTR enhances cognitive dysfunction in a mouse Alzheimer's disease model by inhibiting microRNA-210-3p-mediated PCYT2 through activation of NF-κB. Int J Biol Macromol. 2023;225:404–15. https://doi.org/10.1016/j.ijbiomac.2022.11.078 . Cookson BT, Brennan MA. Pro-inflammatory programmed cell death. Trends Microbiol. 2001;9(3):113–4. https://doi.org/10.1016/S0966-842X(00)01936-3 . Zhaolin Z, Guohua L, Shiyuan W, Zuo W. Role of pyroptosis in cardiovascular disease. Cell Prolif. 2019;52(2):e12563. https://doi.org/10.1111/cpr.12563 . Man SM, Karki R, Kanneganti TD. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev. 2017;277(1):61–75. https://doi.org/10.1111/imr.12534 . Zhou Y, Wen LL, Li YF, Wu KM, Duan RR, Yao YB, Jing LJ, Gong Z, Teng JF, Jia YJ. Exosomes derived from bone marrow mesenchymal stem cells protect the injured spinal cord by inhibiting pericyte pyroptosis. Neural Regen Res. 2022;17(1):194–202. Chen L, Yu C, Xu W, Xiong Y, Cheng P, Lin Z, Zhang Z, Knoedler L, Panayi AC, Knoedler S, Wang J, Mi B, Liu G. Dual-Targeted Nanodiscs Revealing the Cross-Talk between Osteogenic Differentiation of Mesenchymal Stem Cells and Macrophages. ACS Nano. 2023;17(3):3153–67. https://doi.org/10.1021/acsnano.2c12440 . Rathkey JK, Zhao J, Liu Z, Chen Y, Yang J, Kondolf HC, Benson BL, Chirieleison SM, Huang AY, Dubyak GR, Xiao TS, Li X, Abbott DW. Chemical disruption of the pyroptotic pore-forming protein gasdermin D inhibits inflammatory cell death and sepsis. Sci Immunol. 2018;3(26):eaat2738. https://doi.org/10.1126/sciimmunol.aat2738 . Chen SC, Jiang T, Liu QY, Liu ZT, Su YF, Su HT. Hsa_circ_0001485 promoted osteogenic differentiation by targeting BMPR2 to activate the TGFβ-BMP pathway. Stem Cell Res Ther. 2022;13(1):453. https://doi.org/10.1186/s13287-022-03150-1 . Tao ZS, Zhou WS, Xu HG, Yang M. Aspirin modified strontium-doped β-tricalcium phosphate can accelerate the healing of femoral metaphyseal defects in ovariectomized rats. Biomed Pharmacother. 2020;132:110911. https://doi.org/10.1016/j.biopha.2020.110911 . Shi J, Gao W, Shao F, Pyroptosis. Gasdermin-Mediated Programmed Necrotic Cell Death. Trends Biochem Sci. 2017;42(4):245–54. https://doi.org/10.1016/j.tibs.2016.10.004 . Huang Y, Xu W, Zhou R. NLRP3 inflammasome activation and cell death. Cell Mol Immunol. 2021;18(9):2114–27. https://doi.org/10.1038/s41423-021-00740-6 . Yang X, Mou D, Yu Q, Zhang J, Xiong Y, Zhang Z, Xing S. Nerve growth factor promotes osteogenic differentiation of MC3T3-E1 cells via BMP-2/Smads pathway. Ann Anat. 2022;239:151819. https://doi.org/10.1016/j.aanat.2021.151819 . Xu J, Li Z, Tower RJ, Negri S, Wang Y, Meyers CA, Sono T, Qin Q, Lu A, Xing X, McCarthy EF, Clemens TL, James AW. NGF-p75 signaling coordinates skeletal cell migration during bone repair. Sci Adv. 2022;8(11):eabl5716. https://doi.org/10.1126/sciadv.abl5716 . Chen J, Wang N, Zhang H, Zhang X, Zhao L, Zhu L, Li Z, Bei C. Lentivirus-mediated silencing of P75 neurotrophin receptor combined with nerve growth factor overexpression and transfection of bone marrow mesenchymal stem cells combined with demineralized bone matrix for heterotopic osteogenesis. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2020;34(11):1438–45. http://dx.doi.org/10.7507/1002-1892.202003166 . Chinese. Qin X, Wang J, Chen S, Liu G, Wu C, Lv Q, He X, Bai X, Huang W, Liao H. Astrocytic p75NTR expression provoked by ischemic stroke exacerbates the blood-brain barrier disruption. Glia. 2022;70(5):892–912. https://doi.org/10.1002/glia.24146 . Edalat H, Hajebrahimi Z, Movahedin M, Tavallaei M, Amiri S, Mowla SJ. p75NTR suppression in rat bone marrow stromal stem cells significantly reduced their rate of apoptosis during neural differentiation. Neurosci Lett. 2011;498(1):15–9. https://doi.org/10.1016/j.neulet.2011.04.050 . Wang C, Yang T, Xiao J, Xu C, Alippe Y, Sun K, Kanneganti TD, Monahan JB, Abu-Amer Y, Lieberman J, Mbalaviele G. NLRP3 inflammasome activation triggers gasdermin D-independent inflammation. Sci Immunol. 2021;6(64):eabj3859. https://doi.org/10.1126/sciimmunol.abj3859 . Karmakar M, Minns M, Greenberg EN, Diaz-Aponte J, Pestonjamasp K, Johnson JL, Rathkey JK, Abbott DW, Wang K, Shao F, Catz SD, Dubyak GR, Pearlman E. N-GSDMD trafficking to neutrophil organelles facilitates IL-1β release independently of plasma membrane pores and pyroptosis. Nat Commun. 2020;11(1):2212. https://doi.org/10.1038/s41467-020-16043-9 . Zhang J, Wei K. Necrosulfonamide reverses pyroptosis-induced inhibition of proliferation and differentiation of osteoblasts through the NLRP3/caspase-1/GSDMD pathway. Exp Cell Res. 2021;405(2):112648. https://doi.org/10.1016/j.yexcr.2021.112648 . Delloye C, Cornu O, Druez V, Barbier O. Bone allografts: What they can offer and what they cannot. J Bone Joint Surg Br. 2007;89(5):574–9. Xie C, Reynolds D, Awad H, Rubery PT, Pelled G, Gazit D, Guldberg RE, Schwarz EM, O'Keefe RJ, Zhang X. Structural bone allograft combined with genetically engineered mesenchymal stem cells as a novel platform for bone tissue engineering. Tissue Eng. 2007;13(3):435–45. https://doi.org/10.1089/ten.2006.0182 . Schlaubitz S, Derkaoui SM, Marosa L, Miraux S, Renard M, Catros S, Le Visage C, Letourneur D, Amédée J, Fricain JC. Pullulan/dextran/nHA macroporous composite beads for bone repair in a femoral condyle defect in rats. PLoS ONE. 2014;9(10):e110251. https://doi.org/10.1371/journal.pone.0110251 . Vasconcelos DM, Gonçalves RM, Almeida CR, Pereira IO, Oliveira MI, Neves N, Silva AM, Ribeiro AC, Cunha C, Almeida AR, Ribeiro CC, Gil AM, Seebach E, Kynast KL, Richter W, Lamghari M, Santos SG, Barbosa MA. Fibrinogen scaffolds with immunomodulatory properties promote in vivo bone regeneration. Biomaterials. 2016;111:163–78. https://doi.org/10.1016/j.biomaterials.2016.10.004 . Supplementary Files supplementaryfigure1.pdf supplementaryfigure2.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 15 Feb, 2024 Reviewers invited by journal 15 Feb, 2024 Editor assigned by journal 04 Feb, 2024 First submitted to journal 03 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3911764","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":273186269,"identity":"658eb5dc-eb0d-40c6-bdec-a485e85753fb","order_by":0,"name":"Ying Ji","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIie3PLwvCQBjH8WccnIZHVm8g+hZuCKaBb+VW1oTFBcNE2YL/qr4LwWKcHCzNvji7ZVhEDLpk8y4K3icevy93B2AYP8iaAWQADGlrU1cimmgnXtfGbMCrIte+LPCcrRg6lzlRb0mKrgwfEnkmgsiPKdjpQigehlzu1k2S5aV/7AIrznt10lm+k9M0Kf2CAmdj3UQSGvoJ0UzwHqCTUAqaCQ1lJ/bQRiRMFDkq/+Ju5OGGTzai/atV36NJz05XiiRuc7CSzwF+nTf60KoAnsqdYRjGP3sBsDhKm7a0aZoAAAAASUVORK5CYII=","orcid":"","institution":"Guilin Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ying","middleName":"","lastName":"Ji","suffix":""},{"id":273186270,"identity":"17f73edf-f3d9-4062-8f83-0aac2d15fbae","order_by":1,"name":"Yongkang Mao","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yongkang","middleName":"","lastName":"Mao","suffix":""},{"id":273186271,"identity":"2b6854e8-455c-45a3-8611-814a2240b924","order_by":2,"name":"Honghu Lin","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Honghu","middleName":"","lastName":"Lin","suffix":""},{"id":273186272,"identity":"f4d379c8-0297-463f-bd34-6f4449fdbe20","order_by":3,"name":"Ye Wang","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Wang","suffix":""},{"id":273186273,"identity":"53a2c957-5152-4a02-849a-848ec292bb70","order_by":4,"name":"Peishuai Zhao","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Peishuai","middleName":"","lastName":"Zhao","suffix":""},{"id":273186274,"identity":"729efcd0-c01a-41b8-a214-646810347743","order_by":5,"name":"Yong Guo","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Guo","suffix":""},{"id":273186275,"identity":"c6852b26-6482-46a9-9999-4dc8ddc2a0ea","order_by":6,"name":"L.T. Gu","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"L.T.","middleName":"","lastName":"Gu","suffix":""},{"id":273186276,"identity":"38409702-7b1c-4d9a-890e-5d1e80341b9f","order_by":7,"name":"Can Fu","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Can","middleName":"","lastName":"Fu","suffix":""},{"id":273186277,"identity":"07b1b4b2-174a-46f9-96ba-7672fd2005ac","order_by":8,"name":"Ximiao Chen","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ximiao","middleName":"","lastName":"Chen","suffix":""},{"id":273186278,"identity":"72bb1aca-d3e2-4d8a-a31d-f818c82cd4f6","order_by":9,"name":"Zheng Lv","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Lv","suffix":""},{"id":273186279,"identity":"909f3cdf-2158-47cc-9d21-ec6bf67c795d","order_by":10,"name":"Ning Wang","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Wang","suffix":""},{"id":273186280,"identity":"be69aa21-08b0-46f0-9076-606f786d9bbc","order_by":11,"name":"Qiang Li","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Li","suffix":""},{"id":273186281,"identity":"2b919c38-905b-4e29-9baf-6d43e1c1eaf7","order_by":12,"name":"Chaoyong Bei","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chaoyong","middleName":"","lastName":"Bei","suffix":""}],"badges":[],"createdAt":"2024-01-30 21:13:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3911764/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3911764/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51337284,"identity":"d1532d5c-4aff-492c-a488-b4b3b44554a8","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":322844,"visible":true,"origin":"","legend":"\u003cp\u003eCell morphology and identification of the BMSCs. \u003cstrong\u003eA\u003c/strong\u003e Inverted microscope image revealing the isolated BMSCs (Sale bar: 200/150 μm). \u003cstrong\u003eB\u003c/strong\u003e Flow cytometry analysis of BMSCs, and the results showed the following: CD90 (+), CD29 (+), CD44 (+), and CD34 (−).\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/ca4f7d51b4206c43f64159a7.jpg"},{"id":51337283,"identity":"22d22021-f0c3-42d3-a6fc-c93ce4db6bfa","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":594274,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of overexpressing NGF and P75NTR on BMSCs of mineralization and pyroptosis. \u003cstrong\u003eA\u003c/strong\u003eFluorescent microscope image of each group (Sale bar: 50 μm). \u003cstrong\u003eB\u003c/strong\u003eRepresentative image of Alizarin red staining of BMSCs induced in osteogenic medium for 2 and 4 wk (Sale bar: 50 μm). \u003cstrong\u003eC\u003c/strong\u003e Protein levels of the pyroptosis-related proteins GSDMD and NLRP3, as measured by Western blotting (Full-length blots are presented in Supplementary Figure 2, the samples derive from the same experiment and that blots were processed in parallel). \u003cstrong\u003eD\u003c/strong\u003eQuantitative analysis of protein expression levels of GSDMD. \u003cstrong\u003eE\u003c/strong\u003e Quantitative analysis of NLRP3. \u003cstrong\u003eF\u003c/strong\u003e Fluorescent microscope image of each group (Sale bar: 50 μm). \u003cstrong\u003eG\u003c/strong\u003e Protein levels as measured by Western blotting. \u003cstrong\u003eH\u003c/strong\u003eQuantitative analysis of protein expression levels of P75NTR. \u003cstrong\u003eI\u003c/strong\u003eQuantitative analysis of NLRP3. \u003cstrong\u003eJ\u003c/strong\u003e Quantitative analysis of GSDMD.\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/8020b0a1699ad2bbe7d9f4f0.jpg"},{"id":51337651,"identity":"324950d9-d0b3-47c0-bbbb-ec4de4b4537d","added_by":"auto","created_at":"2024-02-19 20:12:09","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":249841,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of NSA and overexpressing NGF on BMSCs of pyroptosis. \u003cstrong\u003eA\u003c/strong\u003e The cell viability of BMSCs after they were treated with different concentrations of NSA for 24h. \u003cstrong\u003eB\u003c/strong\u003eFluorescent microscope image of each group (Sale bar: 50 μm). \u003cstrong\u003eC\u003c/strong\u003e Protein levels of the pyroptosis-related proteins GSDMD and IL-1β, as measured by Western blotting (Full-length blots are presented in Supplementary Figure 2, the samples derive from the same experiment and that blots were processed in parallel). \u003cstrong\u003eD\u003c/strong\u003e Quantitative analysis of protein expression levels of GSDMD. \u003cstrong\u003eE\u003c/strong\u003e Quantitative analysis of protein expression levels of IL-1β.\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/ee22d21030d5aa309f9f9c5b.jpg"},{"id":51337286,"identity":"92da4bfa-a4e8-49a3-bb5c-b7943d1ba797","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":409186,"visible":true,"origin":"","legend":"\u003cp\u003eCharacteristics of the scaffolds. \u003cstrong\u003eA,B\u003c/strong\u003e SEM observation of the allogenic bone scaffolds (Sale bar: 500/10 μm). \u003cstrong\u003eC,D\u003c/strong\u003e SEM observation of the BMSCs cultured on the allogenic bone scaffolds (Sale bar: 10 μm). \u003cstrong\u003eE\u003c/strong\u003e FTIR spectra of the allogenic bone scaffolds. \u003cstrong\u003eF\u003c/strong\u003e 1H NMR spectra of the allogenic bone scaffolds.\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/959ab782f0ac7f05f23ed52c.jpg"},{"id":51337289,"identity":"48a7cb7e-a8d4-4c62-8787-c86873efcd17","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":502512,"visible":true,"origin":"","legend":"\u003cp\u003eMicro-CT image analysis of femoral condylar bone regeneration. \u003cstrong\u003eA\u003c/strong\u003e Reconstructed three-dimensional micro-CT images at 4 wk after surgery. \u003cstrong\u003eB\u003c/strong\u003e Reconstructed three-dimensional micro-CT images at 8 wk after surgery. \u003cstrong\u003eC\u003c/strong\u003e Comparison of BV/TV in the bone defect area at post-operative 4 and 8 wk. \u003cstrong\u003eD\u003c/strong\u003e Comparison of Tb.N in the bone defect area at post-operative 4 and 8 wk. \u003cstrong\u003eE\u003c/strong\u003eComparison of Tb.Th in the bone defect area at post-operative 4 and 8 wk. \u003cstrong\u003eF\u003c/strong\u003eComparison of Tb.Sp in the bone defect area at post-operative 4 and 8 wk.\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/d54946881c70846aafd7d729.jpg"},{"id":51337288,"identity":"db0c4802-1b4b-4bf3-bb02-4beba7009211","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":494057,"visible":true,"origin":"","legend":"\u003cp\u003eHistological section analysis. \u003cstrong\u003eA\u003c/strong\u003e new bone and osteocytes analysis by HE staining for each treatment group at 4 and 8 wk after after surgery. \u003cstrong\u003eB\u003c/strong\u003e Masson's trichrome staining at post-operative 4 and 8 wk. (NB: new bone, CT: connective tissue, S: scaffold, Sale bar: 50 μm).\u003c/p\u003e","description":"","filename":"figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/e657abf7d14c083344101b15.jpg"},{"id":51337652,"identity":"4964e6f1-8e9c-4063-9024-1577a68c2114","added_by":"auto","created_at":"2024-02-19 20:12:09","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":274274,"visible":true,"origin":"","legend":"\u003cp\u003eImmunohistochemical assessment of OCN at post-operative 4 and 8 wk. (black arrow represented the positive cells, Sale bar: 50 μm).\u003c/p\u003e","description":"","filename":"figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/8b68cac7fa1aea45c1dca829.jpg"},{"id":51337287,"identity":"9387976f-68d8-4f9e-93de-adbbb4a3c811","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":282239,"visible":true,"origin":"","legend":"\u003cp\u003eNSA and Over-expression of NGF regulated pyroptosis and Osteogenic related genes at 4w after surgery. \u003cstrong\u003eA, B\u003c/strong\u003e mRNA levels of the pyroptosis-related genes GSDMD and IL-1β at 4 weeks after surgery, as determined by real-time PCR. \u003cstrong\u003eC \u003c/strong\u003eProtein levels of the proteins GSDMD, NLRP3, IL-1β and OCN at 4 weeks after surgery, as measured by Western blotting (Full-length blots are presented in Supplementary Figure 2, the samples derive from the same experiment and that blots were processed in parallel). \u003cstrong\u003eD-F\u003c/strong\u003e Quantitative analysis of the pyroptosis-related protein expression levels of GSDMD, NLRP3 and IL-1β. \u003cstrong\u003eG\u003c/strong\u003e Quantitative analysis of the osteogenesis-related protein expression levels of OCN. (G1: BMSCs-Sca, G2: BMSCs-NSA-Sca, G3: NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca, G4: NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-Sca).\u003c/p\u003e","description":"","filename":"figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/72a3cb16ce462b8ee7c45f6a.jpg"},{"id":51337290,"identity":"8333a600-2b1b-4e27-bea2-77b098f3aac0","added_by":"auto","created_at":"2024-02-19 20:04:09","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":286111,"visible":true,"origin":"","legend":"\u003cp\u003eNSA and Over-expression of NGF regulated pyroptosis and Osteogenic related genes at 8w after surgery. \u003cstrong\u003eA, B\u003c/strong\u003e mRNA levels of the pyroptosis-related genes GSDMD and IL-1β at 8 weeks after surgery, as determined by real-time PCR. \u003cstrong\u003eC\u003c/strong\u003e Protein levels of the proteins GSDMD, NLRP3, IL-1β and OCN at 8 weeks after surgery, as measured by Western blotting (Full-length blots are presented in Supplementary Figure 2, the samples derive from the same experiment and that blots were processed in parallel). \u003cstrong\u003eD-F\u003c/strong\u003e Quantitative analysis of the pyroptosis-related protein expression levels of GSDMD, NLRP3 and IL-1β. \u003cstrong\u003eG\u003c/strong\u003e Quantitative analysis of the osteogenesis-related protein expression levels of OCN. (G1: BMSCs-Sca, G2: BMSCs-NSA-Sca, G3: NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca, G4: NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-Sca).\u003c/p\u003e","description":"","filename":"figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/6df1b405807d3bd3985f8b01.jpg"},{"id":51337939,"identity":"7f2baacc-d00a-4d0b-8ab5-ca1278bee550","added_by":"auto","created_at":"2024-02-19 20:20:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1084453,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/9835783f-a820-4dc2-815a-7ff1b69e08f5.pdf"},{"id":51337292,"identity":"329ef05f-ca7b-4239-b29d-381e279c68d7","added_by":"auto","created_at":"2024-02-19 20:04:10","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":1742823,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/8f1fb0ddbe12c54b6a4f2919.pdf"},{"id":51337293,"identity":"4013eb52-c387-4961-ae84-e815f18643c8","added_by":"auto","created_at":"2024-02-19 20:04:10","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":331673,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3911764/v1/b61f637c3830cb30fc9e23ab.pdf"}],"financialInterests":"","formattedTitle":"Acceleration of bone repairation by BMSCs overexpressing NGF combined with NSA and allograft bone scaffolds","fulltext":[{"header":"Introduction","content":"\u003cp\u003eClinical bone defects caused by trauma, bone tumors, and osteomyelitis have become a challenging problem in orthopedics. Currently, clinical treatment of the above bone defects is usually regenerative bone tissue repair by transplanting autologous, allogeneic, xenograft, and inorganic bone at the site of the bone defect, and different bone tissue materials have been widely used for treating complex bone defects [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the potential risk of infection, poor osteoinductivity, and host inflammatory response induced by biomaterials may adversely affect the bone regenerative repair outcome [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Consequently, these issues limit their practical application. Numerous studies reveal that combining cells, growth factors, and biomaterials to construct bone tissue engineering facilitates bone defect repair and regeneration [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, developing a new bone tissue engineering material with anti-inflammatory and degradability functions, such as biocompatibility and strength, to promote bone defect repair has become a hot spot of research.\u003c/p\u003e \u003cp\u003eStem cells have strong self-renewal and multidirectional differentiation capabilities and have great potential for application in bone tissue engineering [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Bone marrow mesenchymal stem cells (BMSCs) are pluripotent stem cells in the bone marrow [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. BMSCs maintain their multidirectional differentiation potential in vitro and differentiate into bone tissues when transplanted in vivo [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. BMSCs are widely used in clinical research and therapy due to these biological properties and have become an important transplantation cell for tissue engineering [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Nerve growth factor (NGF) is a nerve cell growth regulator [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], nourishing and promoting nerve protrusion growth, and it can regulate and promote BMSCS osteogenesis [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Studies have been shown, NGF promotes the long bone development innervated by sensory nerves and plays an important role in fracture healing [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, NGF as a bone graft to construct bone tissue engineering materials holds great promise.\u003c/p\u003e \u003cp\u003eAlthough NGF has the potential to provide cutting-edge solutions for bone tissue engineering, challenges remain in stabilizing its ability to promote osteogenesis of BMSCs. Our preliminary research shows that, although NGF has enhanced biological activity in its ability to regulate the BMSC osteogenesis, inflammatory factors around the grafted cells have high expression during the process of NGF as a bone graft to promote fracture healing, and the nerve growth factor receptor (P75NTR) content was persistently increased in tissues of fracture non-healing [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. P75NTR is a low affinity transmembrane receptor for NGF. Studies have shown its association with cell and tumour migration and invasion [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. We found that silencing the P75NTR gene enhances osteogenic differentiation of rat BMSCs [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. A recent study has revealed that P75NTR can activate the NF-κB signaling pathway to aggravate cell damage [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The NF-κB signaling pathway is closely linked to the NLRP3-mediated inflammatory response, and increased NLRP3 induces pyroptosis. Therefore, We suspect that the reduced survival of BMSCs overexpressing NGF may be related to P75NTR-induced inflammation, which leads to pyroptosis via the NF-κB signaling pathway. Pyroptosis is a highly regulated programmed cell death process [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], manifested by activating NF-κB by pathogens or stressors [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This leads to activation of the NLRP3 inflammasome, and caspase-1, then releasing pro-inflammatory mediator IL-1β and aggregating GSDMD. Finally, the rapid dissolution of plasma membrane causes cell death [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Additionally, studies have shown that pharmacological or genetic interventions can inhibit cellular pyroptosis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, improving the survival of BMSC overexpressing NGF and elucidating the related mechanism become the key research questions.\u003c/p\u003e \u003cp\u003eRecently, necrosulfonamide was identified as a potent inhibitor of the pore-forming protein gasdermin D (GSDMD), and it can inhibit the release of pro-inflammatory mediators, such as IL-1β [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In this study, it was verified that the low survival rate of BMSCs overexpressing NGF in the local inflammatory response of fractures was closely related to pyroptosis. In vitro, we compared the effects of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, BMSCs-NSA, and NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA on pyroptosis of BMSCs. And the final analysis showed that the pyroptosis reaction of BMSCs overexpressing NGF could be blocked by NSA. In vivo, we implanted BMSCs containing NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, BMSCs-NSA, and NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA on the allogeneic bone to construct bone tissue-engineered grafts. And we transplanted them into the rat femoral condylar defects, and monitored new bone formation in a distal femoral defect model. The underlying mechanism of osteogenic differentiation of BMSCs overexpressing NGF was further investigated. We demonstrated that osteoblastic differentiation of BMSCs overexpressing NGF in the inflammatory response of fractures is closely related to pyroptosis. At the same time, overexpression of NGF combined with NSA can inhibit this pyroptosis and improve the survival rate of BMSCs, and enhance the osteogenic ability of BMSCs overexpression of NGF. This study can provide guidance for the design of new bone tissue engineering materials.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIn Vitro Study\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003eOrigin, culture and identification of BMSCs\u003c/h2\u003e \u003cp\u003eBMSCs were purchased from Cyagen (RASMX-01001; Guangzhou, China). Low glucose dulbecco\u0026rsquo;s modified Eagle medium (L-DMEM) (Gibco, Billings, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin solution (Gibco) was used as the medium. The medium was regularly changed after every 3 days. And the cells were cultured at 37\u0026deg;C in a humidified atmosphere consisting of 5% CO2 in incubator.When the cultures approached 70\u0026ndash;80% confluence, the cells were serially subcultured through passaging.\u003c/p\u003e \u003cp\u003eThe purchased BMSCs identification quality test is qualified, and an additional file shows this in more detail [see supplementary Fig.\u0026nbsp;1]. In addition, the cell immunophenotyping of BMSCs was evaluated using flow cytometry. Briefly, the cells were suspended in phosphate-buffered saline (PBS; Solarbio, China) at a concentration of 10\u003csup\u003e6\u003c/sup\u003e cells/mL. Thereafter, the cells were incubated with antibodys, including CD 34-FITC (PA5-85917; eBioscience, San Diego, CA, USA), CD44-PE (103007; Biolegend, San Diego, CA, USA), CD90-PE (MA1-80650; eBioscience), anti-rat CD29-PE (102207; Biolegend). The expression level of the antigen markers was analyzed through a BD FACSCanto (BD Biosciences, San Jose, CA). Collected data were analyzed using flow cytometry software (FlowJo V10, Flowjo, LLC, Ashland, OR, USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eLentiviral transduction and characterization\u003c/h2\u003e \u003cp\u003eThe cells were transfected using an NGF overexpressed lentiviral vector, a P75NTR overexpressed lentiviral vector and a P75NTR knockdown lentiviral vector (GENECHEM, Shanghai, China). BMSCs were seeded into six-well plate at a density of 8.0 \u0026times; 104 cells/well. When the cells were fused to 70\u0026ndash;80%, the lentiviral vector infection solution was configured according to the manufacturer's instructions. There-after, the multiplicity of infection was set to 50, and BMSCs were transfected with NGF overexpressing lentiviral vector in the presence of HiTransG P infection enhancement solution. After culturing for 16 h, the infection solution was removed. Then, the fluorescent protein expression of the genes was observed using an inverted fluorescence microscope after three days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of NSA optimal concentration\u003c/h2\u003e \u003cp\u003eThe BMSCs were treated by necrosulfonamide (HY-100573; MCE, NJ, USA) with a concentration gradient of 0, 0.5, 1.0, 1.5, 2.0, and 3.0 \u0026micro;M, and normal L-DMEM medium was used as a control. Briefly, BMSCs were seeded in 96-well plates at a density of 5000 cells per well. After removing the medium from each well, MTT (5mg/ml, Sigma-Aldrich, St. Louis, MO, USA) was added to each well and cultured for 3h. There-after, the MTT was removed and 200 \u0026micro;L of DMSO (Sigma-Aldrich) were added to each well to dissolve the crystals. Then, the absorbance was measured at 490 nm using an enzyme marker (Synergy HT). Based on the above results, the optimal concentration of NSA that best promotes BMSC proliferation was prepared, and the following experiments were performed at this concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAlizarin Red S (ARS) Staining\u003c/h2\u003e \u003cp\u003eBMSCs were seeded into 0.1% gelatin-coated six-well plates. After culturing the cells to 70% fusion, the standard medium was replaced with Rat BMSC Osteogenic Induction and Differentiation Medium (RAXMX-90021; Cyagen, Guangzhou, China) and changed every three days, as described previously [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The kit included OriCell\u0026reg; Basal Medium For Cell Culture (177 mL; BLDM-03011), OriCell\u0026reg; Fetal Bovine Serum (Superior-Quality) (20 mL; FBSSR-01021), OriCell\u0026reg; Supplement For Rat BMSC Osteogenic Differentiation (3 mL; RAXMX-04021), Alizarin Red S (10 mL; ALIR-10001 and Gelatin (10mL; GLT-11301).After two and four weeks of osteogenic induction, the samples were fixed with a 4% paraformaldehyde for 30 min and stained with alizarin red for 5 min, respectively. Finally, calcium deposition images were taken using a microscope (Olympus Corporation). The cells were collected after osteogenic induction two weeks for Western blot experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot assay\u003c/h2\u003e \u003cp\u003eBMSCs were seeded into six-well plates at a density of 80% and grouped according to the experimental design. The medium was discarded after treatment, and the wells were washed three times with cold PBS. The RIPA buffer (P0013B; Beyotime Biotechnology, China) containing a mixture of protease and phosphatase inhibitors was used to isolate the proteins. After that, centrifugation at 12,000 \u0026times; g for 15 min at 4\u0026deg;C, and the supernatant was collected. The Protein was quantified using a BCA protein assay kit (P0010S; Beyotime).\u003c/p\u003e \u003cp\u003eProteins (20 \u0026micro;g/lane) were separated by SDS-PAGE (10% gel) and then transferred to polyvinylidene fluoride (PVDF) membranes (IPVH00010; Millipore, USA). Then the membranes were blocked with a sealing solution (P0023B-100ml; Beyotime) at 25\u0026deg;C for 1 h. The proteins were washed thrice with TBST for 10 min each and incubated with primary antibodies overnight at 4\u0026deg;C. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e presents the list of the primary antibodies. The membranes were washed with TBST and incubated with the corresponding secondary antibody (1;5,000, Proteintech, Wuhan, China) for 1 h. After rinsing with TBST for three times, the signal was detected with an chemiluminescence reagent (WBKLS0100; Millipore) and used the ECL program (Bio-Rad, USA). Finally, the results were scanned and analyzed using a gel imaging system (ChemiDoc\u0026trade; XRS\u0026thinsp;+\u0026thinsp;System, Bio-rad). Image J was used to analyze the gray level. The experiment was repeated three times.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primary antibody information of this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary\u003c/p\u003e \u003cp\u003eantibody\u003c/p\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCompany and catalog\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003edilution ratio\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMolecular\u003c/p\u003e \u003cp\u003eweight (kDa)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP75NTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, ab52987\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:2,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSDMD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, ab219800\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:2,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, ab263899\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, ab234437\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOCN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ethermo Fisher Scientific, 33-5400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech, 81115-1-RR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1;5,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech, 10494-1-AP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1;5,000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePhysicochemical properties of the scaffolds\u003c/h2\u003e \u003cp\u003eAllogeneic bone scaffolds (Cojoing, beijing, China) with the three-dimensional mesh structure of natural bone tissue were prepared. The scaffold chemical structure was determined by Fourier transform infrared spectroscopy (FTIR; Nicolet IS10) and hydrogen proton nuclear magnetic resonance spectroscopy (1H NMR; Bruker AVANCE Ⅲ 600M). The scaffold morphological structure was observed using scanning electron microscopy (SEM; Zeiss Gemini SEM 300, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell attachment study\u003c/h2\u003e \u003cp\u003eBMSCs were seeded on allogeneic bone scaffolds and co-cultured for three days. The surface morphology of cells grown on the scaffolds was assessed using SEM. After 72 h of cell inoculation, the cell scaffold constructs were washed thrice with PBS and fixed in a multi-step method. Initially, the constructs were fixed with 2.5 wt% (Solarbio) for 2 h. Then, the samples were dehydrated in ethanol with concentration gradients of 50%, 70%, 80%, 90%, 100% I, and 100% II. Finally, the scaffolds were vacuum dried, coated with gold sputtering (Quorum Technologies Ltd Desk sputtercoater, UK), and observed using a Zeiss Gemini SEM 300 at an accelerating voltage of 15 kV.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eIn Vivo Study\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003eAnimal Model Design and Surgical Implantation\u003c/h2\u003e \u003cp\u003eIn this study, a rat model of critical-size femoral defects was made using 56 male SD rats aged 12 weeks. The animals were purchased from SJA Laboratory Animal Co., Ltd (Hunan, China) and individually housed in captivity in the Experimental Animal Center of Guilin Medical College with controlled temperature and light cycles (24\u0026deg;C and 12/12 light cycle). And the animals with free access to standard diet and drinking water. All animal experiments were conducted according to protocols approved by the Animal Ethics and Use Committee of Guilin Medical College (GLMC-IACUC-20241012), and the study protocols adhere to the ARRIVE guidelines.\u003c/p\u003e \u003cp\u003eThe fifty-six rats were randomly divided into four groups as follows (n\u0026thinsp;=\u0026thinsp;14 per group): the BMSCs-Sca group, the BMSCs-NSA-Sca group, the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca group, the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-Sca group. The rats were induced with 3% (w/v) pentobarbital salt solution (0.1 mL/100 g; Ceva, France) and de-haired, disinfected, and scarfed around the right femoral condyle. The subcutaneous tissues and muscles were incised layer-by-layer to expose the lower end of the right femur. A defect with a diameter of 4.5 mm and a depth of 5 mm was created by a dental microdrill (Thomas, France) to ensure a defined critical dimension. The incision did not penetrate the joint cavity to protect the articular cartilage. Then, allograft bone implanted with NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA, BMSCs-NSA, and BMSCs alone was filled into the defect, the incision was routinely sutured, and the rats were allowed to move freely after the operation. The defects filled with allograft bone containing BMSCs alone were considered control groups. The femoral condyles were collected from 28 rats at four and eight weeks aftre surgery. Notably, the animals were given 3% (w/v) pentobarbital salt solution in order to minimalize the stress and suffering of animals. 15 min after administration of anaesthetics, animals were euthanized by the disruption of the spinal cord. Qne part was used for Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot; the other part was fixed with 4% (w/v) paraformaldehyde at 4\u0026deg;C for 24 h. The samples were processed, analyzed by Micro-Computed Tomography (Micro-CT), and decalcified with EDTA decalcification solution (pH 7.2) for three months for histological studies.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMicro-CT Analysis\u003c/h2\u003e \u003cp\u003eMicro-CT analysis was used to quantify the bone formation volume within the defect. Two and four weeks after surgery, the right femoral condyle was harvested and fixed with 4% paraformaldehyde. After processing, the samples were measured using a high-resolution 3D X-ray microscope (Zeiss Xradia 510 Versa) at 50 kV, 120 mA, and a pixel resolution of 9 \u0026micro;m. After scanning, a 3D image model was reconstructed using CTAN image analysis software. Based on a previous study [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], a hollow cylinder (ROI) with a diameter of 4.5 mm and a depth of 5 mm was selected to determine the percentage of bone volume/tissue volume (BV/TV %) to assess bone regeneration of the bone defect. Furthermore, the trabecular bone parameters analyzed and quantified to determine the trabecular number (Tb.N), trabecular separation (Tb.Sp), and trabecular thickness (Tb.Th).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and qRT-PCR\u003c/h2\u003e \u003cp\u003eThe pyroptosis and osteogenic gene expressions in animal tissues were analyzed by qRT-PCR. Fresh tissues were ground, and total RNA was extracted using the GeneJET\u0026trade; RNA Purification Kit (K0732; Thermo Fisher Scientific, Warsaw, Poland, USA). Then, cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit-LBID (K16225; Thermo) according to the manufacturer's instructions. After that, using a real-time fluorescent PCR instrument (Thermo, 7900HT Fast Real-Time PCR System), PCR was performed by PowerUp\u0026trade; SYBR\u0026trade; Green Master Mix (A25742; Thermo). Finally, the relative expression of the associated factors was calculated by the Comparison 2-ΔΔCt method. The primer sequences used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for qRT-PCR of this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSDMD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGCATGGAAGCCTTAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGAGTCGAGCACCAGACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACTTCACCATGGAACCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTGGGGAAGGCATTAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCATGACCACAGTCCATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCAGCTCTGGGATGACCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot assay\u003c/h2\u003e \u003cp\u003ePyroptosis and osteogenic gene expression in animal tissues were analyzed using Western blot. After grinding the fresh tissue, and tissue proteins were extracted as described in previous protocol 2.1.5. Finally, the samples were scanned and analyzed using a gel imaging system (Bio-rad, ChemiDoc\u0026trade; XRS\u0026thinsp;+\u0026thinsp;System, USA) and quantified using ImageJ software. The experiment was repeated three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eHistology and immunohistochemistry\u003c/h2\u003e \u003cp\u003eSpecimens with completed decalcification were dehydrated in increasing ethanol concentrations (50%, 70%, 90%, and 100%) and embedded in paraffin for histological evaluation. Then, the resulting samples were serially cut into 5 \u0026micro;m thick sections using a paraffin slicer. The sections were stained with hematoxylin \u0026amp; eosin (H\u0026amp;E) and Masson trichrome staining according to standard protocols to evaluate the recovery of bone defects and new bone formation. The paraffin sections were subjected to immunohistochemical (IHC) analysis to evaluate osteogenic differentiation and mineralization marker osteocalcin (OCN; 23418-1-AP; Proteintech, Group, Chicago, IL, USA). Firstly, the paraffin sections were baked, placed in xylene to deparaffinise, antigenically repaired using EDTA Antigen Repair Solution (pH 9.0; ZSGB-BIO, China), eliminated endogenous peroxidase, incubated with OCN antibody (Proteintech) overnight at 4\u0026deg;C, and then washed with PBS, incubated with enzyme-labeled goat-anti-rabbit IgG polymer (ZSGB-BIO) for 1 h and washed with PBS. Finally, the sections were stained with DAB chromogenic kit (ZSGB-BIO). Bone histomorphometric analyses were performed for all stained sections by the light microscope (Leica, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll quantitative data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, and significant differences between multiple groups were analyzed using analysis of variance (ANOVA) method by GraphPad Prism 9.0 software. Differences were considered to be statistically significant when p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of BMSCs\u003c/h2\u003e \u003cp\u003eThe morphological features and molecular markers of BMSCs were identified. When BMSCs from rat were cultured to the third generation, they exhibited a fusiform and flattened morphology with a vortex-like morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Flow cytometry results showed that the surface of BMSCs positively expressed CD90, CD44 and CD29, but were negative for CD34. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eLow survival of BMSCs overexpressing NGF in response to fracture inflammation is strongly associated with P75NTR-mediated pyroptosis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAfter three days of lentivirus transfection, fluorescence microscopy revealed green fluorescent expression in the NGF overexpression transfection group and the negative transfection, but no fluorescent expression in the blank groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Mineralized nodules are a hallmark of osteoblast maturation, and we assessed mineralized nodule formation by ARS staining. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB depicts the formation of calcium deposits and nodules after two and four weeks of osteogenic induction, with more calcium deposits and nodules forming in the NGF overexpression group than in the control group. Meanwhile, we confirmed that the NGF overexpression group produced cellular markers of cellular pyroptosis while promoting osteogenic differentiation of BMSCs by examining the protein expression levels of specific pyroptosis markers. GSDMD and NLRP3 are specific proteins during cellular pyroptosis[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The Western blot results revealed that pyroptosis proteins GSDMD and NLRP3 were highly expressed in the NGF overexpression group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eP75NTR overexpression transfection group showed green fluorescence expression, P75NTR knockdown transfection group showed red fluorescence expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). The fluorescence expression rate of the target gene could reach approximately 70%. In addition, we detected pyroptosis protein expression levels in BMSCs by overexpression and knockdown of P75NTR. The results showed that the relative expression of pyroptosis protein in the overexpression P75NTR transfection group was significantly higher than that in the negative transfection group and the blank group, and the relative expression of pyroptosis protein in the knockout P75NTR transfection group was significantly lower than that in the negative transfection group and the blank group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-J). These results suggest that the occurrence of inflammatory death in osteogenic differentiation of BMSCs overexpressing NGF may be associated with pyroptosis. Moreover, changes in P75NTR expression could regulate changes in the expression of proteins related to pyroptosis in BMSCs, and a positive correlation was observed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eNSA can block pyroptosis in BMSCs overexpression NGF\u003c/h2\u003e \u003cp\u003eWe evaluated the cell viability of BMSCs cultured under different NSA concentrations separately to explore the role of NSA in the growth and proliferation of BMSCs. The cell viability of BMSCs cultured under an NSA concentration of 1.5 \u0026micro;M was higher (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Three days after transfection, fluorescence microscopic presented green fluorescence expression in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs and NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA transfected groups, but no fluorescent expression was observed in the NSA and blank groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe confirmed the effect of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA, or BMSCs-NSA on the gene expressions related to pyroptosis by examining the protein expression levels of the pyroptosis markers GSDMD and IL-1β. GSDMD and IL-1β were highly expressed in the NGF overexpression group. However, NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA and BMSCs-NSA showed significant downregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-E). These results suggest that pyroptosis in the differentiation of BMSCs overexpression NGF can be blocked by NSA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of scaffolds\u003c/h2\u003e \u003cp\u003eSEM micrographs exhibited the surface structure of the scaffolds to be a micron-sized porous structure ranging from 200 to 500 \u0026micro;m, with the distribution of the pores being quite homogeneous (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB showed the SEM image of cells adhering to the scaffold 3 days after inoculation with the filopodia extending into the scaffolds, and the results showed that the scaffold had good biocompatibility. Furthermore, FTIR spectrometer of scaffolds have been shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC. The telescopic vibrational peak at 3443 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is caused by the N-H bonds of the amine group in the scaffolds, and the peaks at 1654 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of the spectral band are attributed to the telescopic vibrational absorption peaks of the amides C\u0026thinsp;=\u0026thinsp;O. The peaks at 1031 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 561 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e have the phosphate P-O vibrational peak, and the 500\u0026ndash;1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e segment primarily reacts to the scaffold\u0026rsquo;s phosphate component. Additionally, the chemical structure of the scaffolds was determined using NMR. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD illustrates the NMR result with a peak of approximately 4.30 ppm. It suggests that the scaffold\u0026rsquo;s inorganic composition is primarily phosphate and carbonate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eNGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA could promote early healing of SD rat bone defect\u003c/h2\u003e \u003cp\u003eTo observe new bone formation within the femoral condylar defects in rats, we performed micro-CT analyses of defects implanted with NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA, BMSCs-NSA, and BMSCs-only allografts at four and eight weeks after surgery (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-D). These results confirmed the new bone formation within the defects. At each time point after surgery, dense new bone tissue was visible around the grafts in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group, whereas only a small amount of new bone formation was observed in the control group. BV/TV% within ROI was measured to assess new bone formation around the grafts, as previously described (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). At each postoperative time point, BV/TV was significantly higher in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group than in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and slightly higher than in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs group. Additionally, trabecular structures were already visible at the edges of the defect in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group, whereas the middle portion of the graft had not yet completely degraded. Compared with the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs group, the number and thickness of bone trabeculae in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group increased, but the separation degree of bone trabeculae decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF-H). This demonstrated the osteogenic capacity of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA allogeneic bone constructs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, we used H\u0026amp;E, Masson's trichrome and immunohistochemistry to visualize the histological manifestations of bone regeneration in rat femoral condylar defects. The tissue section staining results were consistent with the imaging findings. H\u0026amp;E staining revealed a few osteoblasts. A small amount of neovascularization was visible at the edges of the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group at 4 weeks after surgery. However, almost no new bone formation was detected in the controls. H\u0026amp;E staining exhibited that a small amount of new bone was visible in the control group at eight weeks after surgery. Specifically, the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group displayed numerous new bones visible within the local connective tissue, few osteoblasts visible at the edge of the bone trabeculae, and the implant had a significant bone healing effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Similarly, Masson trichrome staining displayed that numerous neoplastic bones and collagenous tissues were visible in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Immunohistochemical staining analysis presented that the immune response intensity to OCN was significantly higher in the group treated with NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA scaffold constructs than in the control group after four and eight weeks after surgery (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). In conclusion, these results demonstrate that combining NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA on allogeneic bone scaffolds can improve the osteogenic capacity to repair bone defects.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eNGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA could involve bone regeneration via inhibiting cell pyroptosis\u003c/h2\u003e \u003cp\u003eWe measured the GSDMD and IL-1β mRNA levels at the defects in rats at four and eight weeks after surgery, respectively, to examine the effects of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA and NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs on the death-related gene expressions (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, B and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, B). Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, B illustrate the results at four weeks after surgery. The pyroptosis-related signals GSDMD and IL-1β mRNA levels were significantly up-regulated in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs group, whereas the GSDMD and IL-1β mRNA levels were significantly down-regulated in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Similarly, the GSDMD and IL-1β mRNA levels were slightly down-regulated in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group than in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs group at eight weeks after surgery (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, B). These results demonstrated that NSA inhibited the pyroptosis-associated genes, GSDMD, and IL-1β mRNA levels and attenuated the pyroptosis effect from NGF overexpression.\u003c/p\u003e \u003cp\u003eAs previously described, we verified the effects of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA and NGF\u003csup\u003e+\u003c/sup\u003eBMSCs on pyroptosis-related protein expression using Western blotting. The results exhibited that the pyroptosis-related protein expression levels of GSDMD, IL-1β, and NLRP3 were enhanced in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs group at four weeks after surgery, while pyroptosis protein levels were reduced in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC-F). The osteoblastic protein expression levels of OCN were enhanced in the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG). Protein blotting exposed the same at eight weeks after surgery (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD-G). These results demonstrated that NSA inhibited the pyroptosis-related protein expression levels of GSDMD, IL-1β, and NLRP3 and promoted the osteogenic effects of NGF overexpression. The blocking effect of NSA mentioned above is verified again.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we attempted to define the low survival of BMSCs overexpressing NGF in response to fracture inflammation and to improve it to promote regeneration of bone defect repair. Initially, we used lentiviral vectors loaded with overexpressed NGF genes to transfect BMSCs to determine their relationship with P75NTR and pyroptosis. Nerve Growth Factor induces osteogenic differentiation of various cells to promote fracture healing. For example, Yang et al. investigated the mechanism of action of NGF in the mouse embryonic osteogenic precursor cell line MC3T3-E, and the results showed that NGF promoted the proliferation and osteogenic differentiation of MC3T3-E while increasing the expression of BMP-2 [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, NGF promotes angiogenesis and trophic regeneration of skeletal sensory nerves. And vascular and nerve regeneration can significantly promote the process of bone repair. Recent studies have demonstrated that NGF stimulates the migration of skeletal cells during early bone repair and exerts various cell-specific functions [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. Indeed, Our previous experiments indicated that cell survival was relatively low after NGF overexpression transfection of BMSCs, and P75NTR silencing combined with NGF overexpression double gene co-transfection of BMSCs demonstrated a good osteogenic capacity [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eP75NTR is involved in various cell responses, such as apoptosis, survival, migration, and axonal growth. P75NTR has been reported to activate NF-\u0026kappa;B signaling, up-regulate MMP-9 and VEGF expression, induce inflammation, and disrupt the blood-brain barrier in astrocytes [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. Inhibition of P75NTR expression is known to improve the survival of neuro differentiated BMSCs [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e] and enhance osteogenic differentiation of rat BMSCs [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]. Here, we found that overexpression of NGF can lead to the increase of P75NTR, and the change of P75NTR expression can regulate the expression of pyrogen related proteins in BMSCs with positive correlation. Consequently, these results support our suspect that the reduced survival of BMSCs overexpressing NGF in the fracture inflammatory response may be associated with P75NTR-induced pyroptosis. Combined with our previous studies, here our focus is to improve the pyroptosis response during the transplantation of BMSCs overexpressing NGF during the healing process of bone defects, in order to increase the survival rate of BMSCs for accelerated repair of bone defects.\u003c/p\u003e\n\u003cp\u003eIn order to clarify the low survival of BMSCs overexpressing NGF during the healing process of bone defects, we selected NLRP3, IL-1\u0026beta; and GSDMD, which are key factors in the process of pyroptosis. Activation of NLRP3 inflammatory vesicles is the key to pyroptosis. This was reported by Wang et al., they found that NLRP3 assembles into NLRP3 inflammatory vesicles upon sensing certain pathogens, and then cuts GSDMD, promotes the secretion of IL-1\u0026beta; and IL-18, and causes inflammatory cell death [\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e]. Moreover, GSDMD has been reported to be closely related to pyroptosis and inflammation, and GSDMD is cleaved to produce N-GSDMD fragments, forming pores that increase membrane permeability, leading to pyroptosis and IL-1\u0026beta; release [\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e]. Both classical and non-classical pathways of pyroptosis require activation of GSDMD to lead to the generation of pyroptosis. Therefore, in this study, NLRP3 and GSDMD were selected as entry points for the verification of pyroptosis. This provides a target selection scheme for inhibiting pyroptosis and solving the problem of low cell survival rate in bone defect healing.\u003c/p\u003e\n\u003cp\u003eIn addition, we also found that the pyroptosis of BMSCs overexpressing NGF during fracture inflammation can be blocked by NSA. During pyroptosis, NSA prevents pyroptosis by inhibiting the aggregation of long chains of GSDMD on the cell membrane. Furthermore, Zhang et al. showed that NSA could affect the mRNA and protein expression of pyroptosis related genes, inhibit the secretion of IL-6, TNF-\u0026alpha; and IL-1\u0026beta; by osteoblasts, and they also found that NSA promoted the proliferation and differentiation of osteoblasts by inhibiting of NLRP3/caspase-1/GSDMD pyroptosis pathway [\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. Therefore, we selected NSA as a pyroptosis inhibitor. NSA can inhibit the pyroptosis reaction of BMSCs overexpressing NGF during the healing of bone defects in order to improve the survival rate of BMSCs. Our findings highlight the potential of NSA in inhibiting the pyroptosis of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs, making it a therapy to improve the low survival of BMSCs overexpressing NGF. Notably, the therapeutic NSA concentrations used in this study did not exhibit cytotoxic effects on cells.\u003c/p\u003e\n\u003cp\u003eIn vitro having demonstrated that NSA can inhibit the pyroptosis of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs in fracture inflammation, we proceeded to the final and most important aim of this study which focused on determining the ability of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca to promote bone regeneration and defect repair in vivo, especially in a rat model of femoral condylar defect. In this study, allograft bone was used as a scaffold to implant BMSCs loaded with overexpressed NGF. Allograft bone as a graft has strong mechanical strength, good biocompatibility, and bone conductivity, and making it a better choice for repairing bone defects [\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. Consistent with previous studies [\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e], allogeneic bone scaffolds could effectively support the BMSCs attachment and expansion in our experiments. We constructed novel grafts to repair rats bone defects by combining NGF-overexpressed BMSCs with allograft bone and adding pyroptosis inhibitors. Additionally, previous studies have used a rat femoral condylar defect model to assess bone regeneration and defect repair in vivo [\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e]. Another study revealed that the critical defect size that could not spontaneously be repaired was 3.5/5.0 mm [\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e]. Therefore, we evaluated the osteogenic capacity of NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA combined with allograft bone scaffolds in a surgical model of bone defects in rats femoral condyles with a diameter of 4.5 mm and a depth of 5.0 mm. Micro-CT analysis and histological evaluation revealed that NGF\u003csup\u003e+\u003c/sup\u003e/BMSCS-NSA scaffolds significantly enhanced new bone formation compared to scaffolds with BMSCs alone. Furthermore, WB and PCR results showed that NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca group had relatively low pyroptosis genes and relatively high osteogenic genes. This demonstrated that NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs combined with NSA can increase the transplantation survival rate of BMSCs by inhibiting pyroptosis, and thus participate in bone regeneration to accelerate the repair of bone defects. Overall, the results suggest that the potential of the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca system as a novel therapy for bone defects.\u003c/p\u003e\n\u003cp\u003eThrough the above studies, we believe that NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca is helpful to develop a new theoretical basis for the treatment of bone defects. However, the specific molecular mechanisms and pathway of pyroptosis in BMSCs overexpressing NGF are not yet clear, and whether it is related to the P75NTR-mediated NF-\u0026kappa;B pathway. Therefore, specifically, our future work will focus on elucidate the relationship between pyroptosis in BMSCs overexpressing NGF and the NF-\u0026kappa;B pathway in the inflammatory environment of fractures.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, reduced survival of BMSCs overexpressing NGF in localised inflammation of fractures is closely related to P75NTR-induced pyroptosis, which can be inhibited by the use of NSA, and the use of BMSCs overexpressing NGF combined with allogeneic bone scaffolds and NSA as grafts accelerates bone defect repair and regeneration. Overall, we anticipate that the synergistic effect of BMSCs, scaffolds, and NGF during bone tissue regeneration contributes to bone tissue engineering material development with excellent properties.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eNGF: Nerve growth factor; BMSCs: Bone marrow mesenchymal stem cells; NSA: Necrosulfonamide; SD: Sprague-Dawley; P75NTR: Nerve growth factor receptor; GSDMD: Gasdermin D; IL-1\u0026beta;: Interleukin 1beta; OCN: Osteocalcin; NLRP3: NOD-like receptor thermal protein domain associated protein 3; L-DMEM: Low glucose dulbecco\u0026rsquo;s modified Eagle medium; PBS: Phosphate-buffered saline; ARS: Alizarin Red S; PVDF: Polyvinylidene fluoride; FTIR: Fourier transform infrared spectroscopy; 1H NMR: Hydrogen proton nuclear magnetic resonance spectroscopy; SEM: Scanning electron microscopy; PBS: Phosphate-buffered saline; qRT-PCR: Quantitative reverse transcription polymerase chain reaction; Micro-CT: Micro-Computed Tomography; BV/TV: Bone volume per tissue volume; Tb.N: Trabecular number; Tb.Th: Trabecular thickness; Tb.Sp: Trabecular separation; BCA: Bicinchoninic acid; H\u0026amp;E: Hematoxylin and eosin; MTT: Thiazolyl blue; IHC: immunohistochemical; BMP-2: Bone morphogenetic protein 2; MMP-9: matrix metalloprotein-9; VEGF: Vascular endothelial growth factor; NF-\u0026kappa;B: nuclear transcription factor-\u0026kappa;B;\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Ethics Committee of the GuiLin Medical University (Approval No. GLMC-IACUC-20241012, Title of the approved project: The role and mechanism of P75NTR in regulating the pyroptosis of BMSCs in fracture non union, Date: January 17, 2024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the final manuscript for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors reported that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (Grant number 82160416, 81660366 and 32071309), the Guangxi Science Technology Project (Grant number 2022GXNSFAA103025), Guangxi Medical and healthkey cultivation discipline construction project and Guangxi Medical and health key discipline construction project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYing Ji conducted the in vivo experiments, data analysis, and manuscript writing. Yongkang Mao performed in vitro experiments. Honghu Lin and Ye Wang participated in acquisition of data. Yong Guo and Peishuai Zhao contributed to the pathological analysi. Lantao Gu, Can Fu and Ximiao Chen contributed to the design and experiments. Zheng Lv and Ning Wang analyzed the data. Qiang Li contributed to the interpretation of data; Chaoyong Bei conceived the idea, financed the study, and reviewed and edited the manuscript. The authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMyeroff C, Archdeacon M. Autogenous bone graft: donor sites and techniques. J Bone Joint Surg Am. 2011;93(23):2227\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhare D, Basu B, Dubey AK. Electrical stimulation and piezoelectric biomaterials for bone tissue engineering applications. Biomaterials. 2020;258:120280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2020.120280\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2020.120280\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBose S, Roy M, Bandyopadhyay A. Recent advances in bone tissue engineering scaffolds. Trends Biotechnol. 2012;30(10):546\u0026ndash;. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tibtech.2012.07.005\u003c/span\u003e\u003cspan address=\"10.1016/j.tibtech.2012.07.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. \u0026thinsp;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaravanan S, Vimalraj S, Thanikaivelan P, Banudevi S, Manivasagam G. A review on injectable chitosan/beta glycerophosphate hydrogels for bone tissue regeneration. Int J Biol Macromol. 2019;121:38\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijbiomac.2018.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ijbiomac.2018.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAghali A. Craniofacial Bone Tissue Engineering: Current Approaches and Potential Therapy. Cells. 2021;10(11):2993. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10112993\u003c/span\u003e\u003cspan address=\"10.3390/cells10112993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone. 2015;81:112\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bone.2015.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.bone.2015.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCancedda R, Giannoni P, Mastrogiacomo M. A tissue engineering approach to bone repair in large animal models and in clinical practice. Biomaterials. 2007;28(29):4240\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2007.06.023\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2007.06.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HJ, You SJ, Yang DH, Eun J, Park HK, Kim MS, Chun HJ. Injectable hydrogels based on MPEG-PCL-RGD and BMSCs for bone tissue engineering. Biomater Sci. 2020;8(15):4334\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/D0BM00588F\u003c/span\u003e\u003cspan address=\"10.1039/D0BM00588F\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HD, Amirthalingam S, Kim SL, Lee SS, Rangasamy J, Hwang NS. Biomimetic Materials and Fabrication Approaches for Bone Tissue Engineering. Adv Healthc Mater. 2017;6(23):1700612. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/adhm.201700612\u003c/span\u003e\u003cspan address=\"10.1002/adhm.201700612\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarolt D, Knezevic M, Novakovic GV. Bone tissue engineering with human stem cells. Stem Cell Res Ther. 2010;1(2):10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/scrt10\u003c/span\u003e\u003cspan address=\"10.1186/scrt10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKargozar S, Mozafari M, Hashemian SJ, Brouki Milan P, Hamzehlou S, Soleimani M, Joghataei MT, Gholipourmalekabadi M, Korourian A, Mousavizadeh K, Seifalian AM. Osteogenic potential of stem cells-seeded bioactive nanocomposite scaffolds: A comparative study between human mesenchymal stem cells derived from bone, umbilical cord Wharton's jelly, and adipose tissue. J Biomed Mater Res B Appl Biomater. 2018;106(1):61\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jbm.b.33814\u003c/span\u003e\u003cspan address=\"10.1002/jbm.b.33814\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Wang Y, Gou W, Lu Q, Peng J, Lu S. Role of mesenchymal stem cells in bone regeneration and fracture repair: a review. Int Orthop. 2013;37(12):2491\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00264-013-2059-2\u003c/span\u003e\u003cspan address=\"10.1007/s00264-013-2059-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang Z, Tan T, Zhang X, Wan J, Zhou Y, Jiang G, Yang D, Guo X, Liu T. CircRNA hsa_circ_0074834 promotes the osteogenesis-angiogenesis coupling process in bone mesenchymal stem cells (BMSCs) by acting as a ceRNA for miR-942-5p. Cell Death Dis. 2019;10(12):932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-019-2161-5\u003c/span\u003e\u003cspan address=\"10.1038/s41419-019-2161-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMastrogiacomo M, Papadimitropoulos A, Cedola A, Peyrin F, Giannoni P, Pearce SG, Alini M, Giannini C, Guagliardi A, Cancedda R. Engineering of bone using bone marrow stromal cells and a silicon-stabilized tricalcium phosphate bioceramic: evidence for a coupling between bone formation and scaffold resorption. Biomaterials. 2007;28(7):1376\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2006.10.001\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2006.10.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIndo Y. NGF-dependent neurons and neurobiology of emotions and feelings: Lessons from congenital insensitivity to pain with anhidrosis. Neurosci Biobehav Rev. 2018;87:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neubiorev.2018.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.neubiorev.2018.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe J, Gong P. NGF-CS/HA-coating composite titanium facilitates the differentiation of bone marrow mesenchymal stem cells into osteoblast and neural cells. Biochem Biophys Res Commun. 2020;531(3):290\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2020.06.158\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2020.06.158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTomlinson RE, Li Z, Zhang Q, Goh BC, Li Z, Thorek DLJ, Rajbhandari L, Brushart TM, Minichiello L, Zhou F, Venkatesan A, Clemens TL. NGF-TrkA Signaling by Sensory Nerves Coordinates the Vascularization and Ossification of Developing Endochondral Bone. Cell Rep. 2016;16(10):2723\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.celrep.2016.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Meyers CA, Chang L, Lee S, Li Z, Tomlinson R, Hoke A, Clemens TL, James AW. Fracture repair requires TrkA signaling by skeletal sensory nerves. J Clin Invest. 2019;129(12):5137\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI128428\u003c/span\u003e\u003cspan address=\"10.1172/JCI128428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Wang M, Peng C, Bei C. Research progress of P75 neurotrophin receptor and new idea of nonunion treatment. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2017;31(1):105\u0026ndash;109. Chinese. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.7507/1002-1892.201609008\u003c/span\u003e\u003cspan address=\"10.7507/1002-1892.201609008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerghoff J, Jaisimha AV, Duggan S, MacSharry J, McCarthy JV. Gamma-secretase-independent role for cadherin-11 in neurotrophin receptor p75 (p75(NTR)) mediated glioblastoma cell migration. Mol Cell Neurosci. 2015;69:41\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mcn.2015.10.003\u003c/span\u003e\u003cspan address=\"10.1016/j.mcn.2015.10.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShonukan O, Bagayogo I, McCrea P, Chao M, Hempstead B. Neurotrophin-induced melanoma cell migration is mediated through the actin-bundling protein fascin. Oncogene. 2003;22(23):3616\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.onc.1206561\u003c/span\u003e\u003cspan address=\"10.1038/sj.onc.1206561\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang N, Chen J, Chen X, Zhu L, Duan J, Wang Y, Bei C. Effect of lentivirus-mediated silencing of P75 neurotrophin receptor gene on osteogenic differentiation of bone marrow mesenchymal stem cells in rats. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2020;34(8):1052\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.7507/1002-1892.201912086\u003c/span\u003e\u003cspan address=\"10.7507/1002-1892.201912086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Chinese.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchallner N, Ulbrich F, Engelstaedter H, Biermann J, Auwaerter V, Loop T, Goebel U. Isoflurane but not sevoflurane or desflurane aggravates injury to neurons in vitro and in vivo via p75NTR-NF-ĸB activation. Anesth Analg. 2014;119(6):1429\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei Z, Yang C, Feng K, Guo S, Huang Z, Wang Y, Jian C. p75NTR enhances cognitive dysfunction in a mouse Alzheimer's disease model by inhibiting microRNA-210-3p-mediated PCYT2 through activation of NF-κB. Int J Biol Macromol. 2023;225:404\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijbiomac.2022.11.078\u003c/span\u003e\u003cspan address=\"10.1016/j.ijbiomac.2022.11.078\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCookson BT, Brennan MA. Pro-inflammatory programmed cell death. Trends Microbiol. 2001;9(3):113\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0966-842X(00)01936-3\u003c/span\u003e\u003cspan address=\"10.1016/S0966-842X(00)01936-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhaolin Z, Guohua L, Shiyuan W, Zuo W. Role of pyroptosis in cardiovascular disease. Cell Prolif. 2019;52(2):e12563. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cpr.12563\u003c/span\u003e\u003cspan address=\"10.1111/cpr.12563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMan SM, Karki R, Kanneganti TD. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev. 2017;277(1):61\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/imr.12534\u003c/span\u003e\u003cspan address=\"10.1111/imr.12534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Wen LL, Li YF, Wu KM, Duan RR, Yao YB, Jing LJ, Gong Z, Teng JF, Jia YJ. Exosomes derived from bone marrow mesenchymal stem cells protect the injured spinal cord by inhibiting pericyte pyroptosis. Neural Regen Res. 2022;17(1):194\u0026ndash;202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Yu C, Xu W, Xiong Y, Cheng P, Lin Z, Zhang Z, Knoedler L, Panayi AC, Knoedler S, Wang J, Mi B, Liu G. Dual-Targeted Nanodiscs Revealing the Cross-Talk between Osteogenic Differentiation of Mesenchymal Stem Cells and Macrophages. ACS Nano. 2023;17(3):3153\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acsnano.2c12440\u003c/span\u003e\u003cspan address=\"10.1021/acsnano.2c12440\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRathkey JK, Zhao J, Liu Z, Chen Y, Yang J, Kondolf HC, Benson BL, Chirieleison SM, Huang AY, Dubyak GR, Xiao TS, Li X, Abbott DW. Chemical disruption of the pyroptotic pore-forming protein gasdermin D inhibits inflammatory cell death and sepsis. Sci Immunol. 2018;3(26):eaat2738. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciimmunol.aat2738\u003c/span\u003e\u003cspan address=\"10.1126/sciimmunol.aat2738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen SC, Jiang T, Liu QY, Liu ZT, Su YF, Su HT. Hsa_circ_0001485 promoted osteogenic differentiation by targeting BMPR2 to activate the TGFβ-BMP pathway. Stem Cell Res Ther. 2022;13(1):453. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-022-03150-1\u003c/span\u003e\u003cspan address=\"10.1186/s13287-022-03150-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao ZS, Zhou WS, Xu HG, Yang M. Aspirin modified strontium-doped β-tricalcium phosphate can accelerate the healing of femoral metaphyseal defects in ovariectomized rats. Biomed Pharmacother. 2020;132:110911. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2020.110911\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.110911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi J, Gao W, Shao F, Pyroptosis. Gasdermin-Mediated Programmed Necrotic Cell Death. Trends Biochem Sci. 2017;42(4):245\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tibs.2016.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tibs.2016.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Y, Xu W, Zhou R. NLRP3 inflammasome activation and cell death. Cell Mol Immunol. 2021;18(9):2114\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-021-00740-6\u003c/span\u003e\u003cspan address=\"10.1038/s41423-021-00740-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Mou D, Yu Q, Zhang J, Xiong Y, Zhang Z, Xing S. Nerve growth factor promotes osteogenic differentiation of MC3T3-E1 cells via BMP-2/Smads pathway. Ann Anat. 2022;239:151819. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aanat.2021.151819\u003c/span\u003e\u003cspan address=\"10.1016/j.aanat.2021.151819\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu J, Li Z, Tower RJ, Negri S, Wang Y, Meyers CA, Sono T, Qin Q, Lu A, Xing X, McCarthy EF, Clemens TL, James AW. NGF-p75 signaling coordinates skeletal cell migration during bone repair. Sci Adv. 2022;8(11):eabl5716. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.abl5716\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.abl5716\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Wang N, Zhang H, Zhang X, Zhao L, Zhu L, Li Z, Bei C. Lentivirus-mediated silencing of P75 neurotrophin receptor combined with nerve growth factor overexpression and transfection of bone marrow mesenchymal stem cells combined with demineralized bone matrix for heterotopic osteogenesis. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2020;34(11):1438\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.7507/1002-1892.202003166\u003c/span\u003e\u003cspan address=\"10.7507/1002-1892.202003166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Chinese.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin X, Wang J, Chen S, Liu G, Wu C, Lv Q, He X, Bai X, Huang W, Liao H. Astrocytic p75NTR expression provoked by ischemic stroke exacerbates the blood-brain barrier disruption. Glia. 2022;70(5):892\u0026ndash;912. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/glia.24146\u003c/span\u003e\u003cspan address=\"10.1002/glia.24146\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdalat H, Hajebrahimi Z, Movahedin M, Tavallaei M, Amiri S, Mowla SJ. p75NTR suppression in rat bone marrow stromal stem cells significantly reduced their rate of apoptosis during neural differentiation. Neurosci Lett. 2011;498(1):15\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neulet.2011.04.050\u003c/span\u003e\u003cspan address=\"10.1016/j.neulet.2011.04.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Yang T, Xiao J, Xu C, Alippe Y, Sun K, Kanneganti TD, Monahan JB, Abu-Amer Y, Lieberman J, Mbalaviele G. NLRP3 inflammasome activation triggers gasdermin D-independent inflammation. Sci Immunol. 2021;6(64):eabj3859. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciimmunol.abj3859\u003c/span\u003e\u003cspan address=\"10.1126/sciimmunol.abj3859\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarmakar M, Minns M, Greenberg EN, Diaz-Aponte J, Pestonjamasp K, Johnson JL, Rathkey JK, Abbott DW, Wang K, Shao F, Catz SD, Dubyak GR, Pearlman E. N-GSDMD trafficking to neutrophil organelles facilitates IL-1β release independently of plasma membrane pores and pyroptosis. Nat Commun. 2020;11(1):2212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-16043-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-16043-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Wei K. Necrosulfonamide reverses pyroptosis-induced inhibition of proliferation and differentiation of osteoblasts through the NLRP3/caspase-1/GSDMD pathway. Exp Cell Res. 2021;405(2):112648. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.yexcr.2021.112648\u003c/span\u003e\u003cspan address=\"10.1016/j.yexcr.2021.112648\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelloye C, Cornu O, Druez V, Barbier O. Bone allografts: What they can offer and what they cannot. J Bone Joint Surg Br. 2007;89(5):574\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie C, Reynolds D, Awad H, Rubery PT, Pelled G, Gazit D, Guldberg RE, Schwarz EM, O'Keefe RJ, Zhang X. Structural bone allograft combined with genetically engineered mesenchymal stem cells as a novel platform for bone tissue engineering. Tissue Eng. 2007;13(3):435\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/ten.2006.0182\u003c/span\u003e\u003cspan address=\"10.1089/ten.2006.0182\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlaubitz S, Derkaoui SM, Marosa L, Miraux S, Renard M, Catros S, Le Visage C, Letourneur D, Am\u0026eacute;d\u0026eacute;e J, Fricain JC. Pullulan/dextran/nHA macroporous composite beads for bone repair in a femoral condyle defect in rats. PLoS ONE. 2014;9(10):e110251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0110251\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0110251\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVasconcelos DM, Gon\u0026ccedil;alves RM, Almeida CR, Pereira IO, Oliveira MI, Neves N, Silva AM, Ribeiro AC, Cunha C, Almeida AR, Ribeiro CC, Gil AM, Seebach E, Kynast KL, Richter W, Lamghari M, Santos SG, Barbosa MA. Fibrinogen scaffolds with immunomodulatory properties promote in vivo bone regeneration. Biomaterials. 2016;111:163\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2016.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2016.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"BMSCs, NGF, P75NTR, Pyroptosis, Bone tissue engineering, Bone regeneration","lastPublishedDoi":"10.21203/rs.3.rs-3911764/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3911764/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e Repairation of bone defects remains a major clinical problem. Constructing bone tissue engineering containing growth factors, stem cells, and material scaffolds to repair bone defects has recently become a hot research topic. Nerve growth factor (NGF) can promote osteogenesis of bone marrow mesenchymal stem cells (BMSCs), but the low survival rate of the BMSCs during transplantation remains an unresolved issue. In this study, we investigated the therapeutic effect of BMSCs overexpression of NGF on bone defect by inhibiting pyroptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eThe relationship between the low survival rate and pyroptosis of BMSCs overexpressing NGF in localized inflammation of fractures was explored by detecting pyroptosis protein levels. Then, the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca bone tissue engineering was constructed by seeding BMSCs overexpressing NGF on the allograft bone scaffold and adding the pyroptosis inhibitor necrosulfonamide(NSA). The femoral condylar defect model in the Sprague-Dawley (SD) rat was studied by micro-CT, histological, WB and PCR analyses in vitro and in vivo to evaluate the regenerative effect of bone repair.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eThe pyroptosis that occurs in BMSCs overexpressing NGF is associated with the nerve growth factor receptor (P75NTR) during osteogenic differentiation. Furthermore, NSA can block pyroptosis in BMSCs overexpression NGF. Notably, the analyses using the critical-size femoral condylar defect model indicated that the NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca group inhibited pyroptosis significantly and had higher osteogenesis in defects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion \u003c/strong\u003eNGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA had strong osteogenic properties in repairing bone defects. Moreover, NGF\u003csup\u003e+\u003c/sup\u003e/BMSCs-NSA-Sca mixture developed in this study opens new horizons for developing novel tissue engineering constructs.\u003c/p\u003e","manuscriptTitle":"Acceleration of bone repairation by BMSCs overexpressing NGF combined with NSA and allograft bone scaffolds","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-19 20:04:04","doi":"10.21203/rs.3.rs-3911764/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-02-15T08:29:53+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-15T08:04:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-05T00:51:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2024-02-03T11:08:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"51ce8e55-ed0b-4aac-9e3d-147e4f57e2ff","owner":[],"postedDate":"February 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-18T11:59:41+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-19 20:04:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3911764","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3911764","identity":"rs-3911764","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.