LGG  Promotes Activation of Intestinal ILC3 through TLR2 Receptor and Inhibits Salmonella Infection in Mice

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-21 · read from full text

This preprint studied how oral administration of the probiotic Lacticaseibacillus rhamnosus GG (LGG) affects mouse intestinal immunity and protection during Salmonella Typhimurium infection, using in vivo mouse models, histology/immunofluorescence, flow cytometry, and in vitro assays, with mechanistic testing in TLR2−/− mice. Salmonella infection reduced intestinal Lacticaseibacillus abundance while increasing ILC3-derived IL-22, and LGG feeding alleviated Salmonella infection in the intestines. Mechanistically, LGG required TLR2 on dendritic cells, and heat-killed LGG promoted DC secretion of IL-23 that enhanced ILC3 activation and IL-22 release; IL-22 then strengthened the intestinal mucosal barrier and inhibited Salmonella in organoid experiments. A major caveat is that the work is presented as a preprint that has not been peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 112,341 characters · extracted from preprint-html · click to expand
LGG Promotes Activation of Intestinal ILC3 through TLR2 Receptor and Inhibits Salmonella Infection in Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LGG Promotes Activation of Intestinal ILC3 through TLR2 Receptor and Inhibits Salmonella Infection in Mice Junhong Wang, Ming Gao, Jiarui Wang, Yan Zeng, Chunfeng Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4230746/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Salmonella is a foodborne pathogen that causes disruption of intestinal mucosal immunity, leading to acute gastroenteritis in the host. In this study, it was discovered that infection with Salmonella Typhimurium ( STM ) results in a significant decrease in the abundance of Lacticaseibacillus in the intestines of mice, while the secretion of IL-22 by ILC3 is significantly increased. Feeding Lacticaseibacillus rhamnosus GG ( LGG ) effectively alleviated the infection of STM in the mouse intestines. Experiments using TLR2 −/− mice revealed that TLR2-expressing dendritic cells (DCs) are crucial for LGG 's activation of ILC3. Subsequent in vitro experiments showed that heat-killed LGG (HK -LGG ) could promote DCs to secrete IL-23, which in turn further promotes the activation of ILC3 and the secretion of IL-22. Finally, organoid experiments further verified that IL-22 secreted by ILC3 can enhance the intestinal mucosal immune barrier and inhibit STM infection. This study demonstrates that oral administration of LGG is a potential method for preventing STM infection, providing a theoretical basis for the development of new intestinal health modulating products and treatment strategies. STM LGG ILC3 IL-22 DCs Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The symbiotic relationship between intestinal probiotics and the host contributes to the maturation of intestinal function and the development of the immune system. Among probiotics, Lacticaseibacillus rhamnosus GG ( LGG ) is one of the most extensively studied. LGG is a Gram-positive beneficial bacterium present in the human gut, exhibiting strong adhesion to intestinal cells [ 1 ]. Studies have shown that LGG can enhance the proliferation and differentiation of mouse intestinal epithelial cells, thereby strengthening the intestinal immune barrier [ 2 ]. Moreover, LGG can resist pathogen infection by reducing intestinal pH, competing with pathogens for nutrients, and producing antimicrobial substances [ 3 , 4 ]. LGG can also activate macrophage activation by releasing lipoteichoic acid, promote the migration of mesenchymal stem cells, and ultimately protect the intestinal epithelium from radiation damage [ 5 ]. These findings highlight the significant role of LGG in promoting intestinal immune development and disease prevention. Salmonella Typhimurium ( STM ) is one of the primary pathogens responsible for acute gastroenteritis in hosts, capable of infecting various poultry and mammals, as well as humans [ 6 ]. STM infections can afflict the ileum and colon, and even the entire gastrointestinal tract of humans, posing serious health risks. In the early stages of STM infection, it can induce intestinal inflammation through direct infection of the intestinal barrier and destruction of intestinal epithelial cells [ 7 ]. Our research, which involves feeding LGG to regulate intestinal flora and enhance mucosal immunity of the gut, found that feeding LGG holds promise as a novel strategy for preventing Salmonella infection. Innate Lymphoid Cells (ILCs) are a newly discovered class of lymphocytes involved in innate immunity, playing a crucial role in protecting tissue health and combating infections. Among them, ILC3 plays a key role in maintaining homeostasis within the intestine. They respond to various dietary components and microbes both inside and outside the body, can sense changes in the gut microbiome, thereby regulating intestinal immune responses and maintaining the stability of the gut flora [ 8 , 9 ]. ILC3s can secrete cytokines such as IL-22 and IL-17 to regulate intestinal mucosal immunity, not only interacting with intestinal stem cells to regulate their differentiation and function but also playing a crucial role in tissue repair processes [ 10 – 12 ]. A study elucidated the mechanism behind ILC3-driven intestinal tissue repair, revealing that ILC3 can stimulate epithelial cell proliferation and tissue regeneration by activating the Yap1 signaling pathway in intestinal crypt cells [ 13 ]. ILC3s can regulate epithelial cells through IL-22 signaling, including the expression of tight junction proteins, the expression of Major Histocompatibility Complex II (MHC-II), and the production of antimicrobial peptides [ 14 , 15 ]. ILC3s are also capable of inhibiting intestinal epithelial cell death and maintaining barrier integrity under the regulation of chemokine CCL3 and T cells [ 16 ]. Recent research findings have clarified that innate immune cells, such as dendritic cells (DCs) and macrophages, can regulate ILC3 through the production of IL-1β and IL-23 [ 17 ]. Toll-like receptors (TLRs) are a class of pattern recognition receptors (PRRs) in the innate immune system responsible for the early detection of invading pathogens. Among them, TLR2 is expressed on a variety of cell types, including immune cells, endothelial cells, and epithelial cells [ 18 ]. The expression of TLR2 on DCs can regulate T cells' response to Th2, induce the proliferation of CD4 + CD25 + Foxp3 + T cells, and promote the production of IL-10 and TGF-β by T cells [ 19 ]. TLR2 has been shown to play a protective role during infections by triggering a strong pro-inflammatory response [ 20 ]. Studies have demonstrated that in a mouse model of Mycobacterium tuberculosis infection, activation of TLR2 on CD4 + T cells leads to an increase in the protective IFN-γ secretion by T cells [ 21 ]. Moreover, administering TLR2 agonists can enhance the phagocytic action and bactericidal activity of neutrophils, thereby protecting mice from infection with Methicillin-resistant Staphylococcus aureus ( MRSA ) [ 22 ]. In summary, the activation of TLR2 can further enhance the host's ability to clear pathogens, making the elucidation of the mechanisms by which TLR2 regulates immunity of significant importance for research into TLR2-related vaccines or targeted therapies. In this study, we found that feeding mice with LGG significantly prevented infection by STM . Subsequent experiments with TLR2 −/− mice and in vitro cell studies revealed that heat-killed LGG (HK- LGG ) activates ILC3 through DCs. It is conjectured that IL-22 secreted by ILC3 plays a crucial role in maintaining intestinal antibacterial functions and development, which can enhance the intestinal mucosal immune barrier and promote organoid development. Materials and methods Animals, and Ethical Statement Wildtype mice used in this experiment were purchased from HFK Bioscience Co., Beijing, China. TLR2-/- mice purchased from Cyagen Biotechnology Co., Suzhou, China. The entire animal experiment complied with the requirements of the Animal Management and Ethics Committee of Jilin Agricultural University and followed the National Guiding Principles for the Welfare of Laboratory Animals strictly. If the animal developed dyspnea, hemorrhagic diarrhea, or showed signs of mortality, they were euthanized immediately by CO2 inhalation. Bacterial strains STM was provided by Jilin Agricultural University. For the STM used to infect mice, it was first cultured overnight in LB medium, then passaged in fresh LB medium containing 0.3M sodium chloride until the OD600 value reached, followed by two washes with PBS buffer. The bacterial sediment was resuspended in PBS, and the final concentration of the STM suspension was adjusted to 1×10 7 CFU/mL and stored for later use. LGG (ATCC 53103) was grown in De Man, Rogosa, and Sharpe (MRS) broth for 12 h at 37°C. After culturing overnight, the bacteria were inoculated 1:100 in fresh MRS broth and grown under anaerobic conditions until reaching the mid-log phase. Then, the colonies were counted, and the cell density was adjusted to 1×10 8 colony-forming units (CFU)/mL. STM Infection Experiment and Sample Collection Six-week-old mice were randomly divided into two groups, each consisting of 10 mice. The STM group was fed 100µL (1×10 7 CFU/mL) of STM suspension daily for eight consecutive days, with mouse body weight changes and survival rates recorded. Following this, an STM infection experiment was repeated with another 20 six-week-old mice, and the mice were euthanized four days later. The small intestine and colon were collected for length measurements and formalin fixation. Pathological Sections and Indirect immunofluorescence Histopathological analysis was carried out on small intestine, colon, and spleen samples collected after infection. All samples were fixed with 4% paraformaldehyde, and sections were stained with hematoxylin and eosin to examine pathological changes. For immunofluorescence, diluted primary antibodies VILLIN, EpCAM, LGR5 were added and incubated overnight at 4°C in the dark, followed by washing. Secondary antibodies AF594 anti-rabbit was incubated for 1 hour at 4°C in the dark. After washing, nuclear staining was performed using PBS diluted DAPI at 1:5000 at room temperature in the dark for 10 minutes, allowing for nuclear staining. Following another wash, slides were mounted for microscope examination. Cell separation Cell samples obtained from the the mouse intestine were subjected to subsequent flow assay and in vitro cell culture and qPCR experiment. Firstly, after euthanasia of mice, the small intestine and Colon were dissected longitudinally, rinsed with PBS and divided into 1 cm sized intestinal fragments, which were then transferred to the separation solution (15 mL of RPMI-1640, 1% penicillin and streptomycin, 1% HEPES, 2.5 mM EDTA, 1 mM DTT, and 1% heat-inactivated FBS) and incubated for 28 minutes in a shaking incubator at 37°C and 200 rpm, and then removed. After incubation for 18 minutes in a shaking incubator at 37°C and 180 rpm, the intestinal fragments were obtained rinsed and continued into the enzyme digestion solution (8 mL RPMI-1640 medium, 1% penicillin and streptomycin, 1% HEPES, 20 mg collagenase IV, 0.5 mg DNase I, and 1% FBS), and incubated for 25 minutes in a shaking incubator at 37°C and 220 rpm before being removed, and then filtered through a 70-µm cell strainer to get the LPL cells in the mouse intestine. Finally, percoll was used for density gradient centrifugation to obtain lymphocytes for subsequent experiments. Flow cytometry First, antibodies were added to tubes containing 1×10 6 cells, mixed thoroughly and stained for 30 min at 4°C under dark conditions. Then, add 1 mL of PBS, centrifuge at 2000 r pm and 4°C for 5 min and discard the supernatant. The cells can then optionally be fixed and permeabilized, and after permeabilization the antibody can be used to continue the staining. The staining is completed and detected using a flow cytometric analyzer (BD). Antibody and reagent information BD Pharmingen: Fixable Viability Stain 780 (L/D) (565388), purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block) (553142), γδ T (Biotin) (553176), CD19 (Biotin) (553784), CD11b (Biotin) (557395), TCRβ (Biotin) (553168), Ly6G/C (Biotin) (553124), TER-119 (Biotin) (553672), streptavidin protein (APC-cy7) (554063), CD45 (FITC) (551874), CD127 (PE-cy7) (560733), RORγt (PE) (562607), and GATA3 (BV421) (563349), IL-22 (Alexa Fluor 647) (567160), MHCII (PE) (558593), CD11c (FITC) (553801), IL-23 (Alexa Fluor 647) (565317). Abcam: AF594 anti-rabbit (ab150080), VILLIN (ab130751), EpCAM (ab213500), LGR5 (ab75850). Solarbio: D-PBS (D1040), PBS (P1010). GE Healthcare: Percoll (17089101). Sigma: Penicillin And Streptomycin (V900929), Collagenase IV (V900893-1G), Ionomycin (56092-81-0), DNase I (10104159001), DTT (3483-12-3), HEPES ( H3375), EDTA (E8008), FBS (F8318). LGG resistance to STM infection experiments We divided the 5 Weeks old mice into two groups of 10 animals each. Then the PBS + STM group was first fed PBS for 7 days, 100µL/day, followed by STM infection. The LGG + STM group continued to be fed with LGG for 7 days, each mouse is fed 100µL (1×10 7 CFU) LGG per day, and then received STM infection. All mice were orally fed with STM at 6 Weeks old, then Mouse weight change and survival within 8 days of infection were counted. The above experiment was repeated once more, and on the fourth day post STM infection, mice were euthanized to collect intestinal tissues and cells for subsequent experiments. ELISA and qPCR experiments Cytokine protein and total RNA were extracted from the mouse intestine and secretion of IL-22 was detected using the ELISA kit (MEIMIAN, MM-0892M2). Next, total RNA was extracted, and 1 mg of RNA was reversed into cDNA by reverse transcriptase (Promega) which reverse transcribed Moloney mouse leukemia virus (M-MLV). In the real-time qPCR system of Biological System 7500, qPCR was performed using SYBR green mixture (Takara). The average mRNA fold changes were calculated by 2-ΔΔCT method and compared with the control group. Primer design: IL-22 (NM_016971.2), FORWARD: CCTGCTTCTCATTGCCCTGTGG, REVERSE: AAGGTGCGGTTGACGATGTATGG. IL-23 (NM_031252.2), FORWARD: AGCCAACTCCTCCAGCCAGAG, REVERSE: CGCTGCCACTGCTGACTAGAAC. 16S rRNA-seq experiment 16S rRNA amplicon sequencing data in PRJNAxxxxxx. Novogene Co., for providing technical services such as detecting and analyzing of scRNA-seq raw data, and 16S rDNA sequencing. Flow Sorting of ILC3 and DC Single-cell suspensions were incubated with antibodies including Lin (γδ T, CD19, CD11b, TCR-β, Ly6G/C, TER-119), L/D, MHC-II, CD11c, CD45, etc. DCs were sorted as L/D − CD11c + MHCII + cells, and ILC3 were obtained through Lin − L/D − CD45 + sorting, noting that Lin − L/D − CD45 ++ indicates ILC2. In Vitro Stimulation Culture of Primary Cells ILC3s were seeded in a 24-well plate at a density of 5×10 6 cells per well. HK- LGG (50µL), LGG supernatant (50µL), and DCs (5×10 5 ) were added to the culture medium with ILC3 and incubated for 8 hours before being analyzed by flow cytometry and qPCR. Organoid Extraction and Culture 1. After euthanizing the mouse, the small intestine was removed, mesentery and fat were discarded, and the intestinal segment was longitudinally opened and washed with cold PBS until the supernatant was clear. The intestinal segments were cut into 2mm pieces and gently washed with cold PBS, then added to 15mL of crypt isolation solution (1 mM EDTA in PBS). Incubated at room temperature for 30 minutes. 2. The crypt isolation solution was discarded, and 10mL of DPBS was added to repeatedly pipette the fragments. After the fragments settled, the supernatant was collected through a 70µm cell strainer into a 50mL centrifuge tube, labeled as 1, and this step was repeated four times. The 3rd and 4th filtrates were centrifuged at 300xg for 5 minutes, and the supernatant was discarded. The pellet was resuspended in 1mL of DME/F12 + 1% P/S and transferred to a 1.5mL centrifuge tube, then centrifuged at 200xg for 3 minutes, and the supernatant was discarded. 3. The pellet was mixed with 250µL of complete medium and 250µL of Matrigel (operation on ice), mixed well by pipetting. 50µL was pipetted into the center of a well in a 24-well plate and incubated in a culture incubator for 30 minutes. Then, 500µL of complete culture medium (STEMCELL #6000) was added to each well, and 500µL of PBS was added to the remaining wells. 4. When organoids begin to bud, they should be passaged. First, the old culture medium is removed, and 2 mL of DME/F12 is added for pipetting up and down before collection into a centrifuge tube. After centrifugation, the supernatant is discarded, and the pellet is resuspended in complete culture medium and Matrigel for further cultivation. Co-culture Model of ILC3 and Intestinal Organoids HK- LGG , DCs, and ILC3 are added to the organoid culture medium to observe their effects on the growth and development of organoids. Medium 1 is the organoid culture medium. Medium 2 consists of RPMI-1640 (1% penicillin and streptomycin, 1% HEPES, 10% FBS). HK- LGG , DCs, and ILC3 can be added to Medium 2. Statistical analysis of data Flow cytometry results were analyzed using FlowJo version 10.8.1. Graphs were plotted using GraphPad Prism version 8.0.2 software. Data analysis was carried out using one-way ANOVA to compare differences between control and experimental groups. (P < 0.05 is denoted by *; P < 0.01 by **; P < 0.001 by ***). Results STM Infection Causes Mortality and Intestinal Lesions in Mice This study found that mice infected with STM exhibited weight loss and even death. The body weight of mice in the PBS group increased, while that of mice in the STM group significantly decreased, with mortality observed on the third day and a survival rate of only 25% by the eighth day (Fig. 1 A/B). STM infection also led to the atrophy of the small intestine and colon in mice. The length of the small intestine in the PBS group was about 33 cm, and the colon was about 8 cm. In contrast, the small intestine in the STM group was about 26 cm, and the colon was about 6 cm (Fig. 1 C). To explore the immunological changes occurring in the mouse intestine during this process, mice were euthanized on the third day for further examination. Pathological sections revealed tissue damage in the small intestine and colon of mice in the STM group, including villi fracture, thinning of the intestinal wall, and extensive infiltration of red blood cells and lymphocytes (Fig. 1 D). Immunofluorescence experiments identified significant expression of intestinal villin protein, stem cell differentiation protein LGR5, and epithelial cell marker protein EpCAM in the intestines of STM -infected mice (Fig. 1 E). ELISA and qPCR analyses showed that the secretion of IL-22 and the transcription level of the mIL-22 gene in the intestines of mice in the STM group were significantly higher than in the PBS group (Fig. 1 F). The experimental results indicate that STM infection in the mouse intestine causes severe intestinal damage and endangers the lives of the mice, with higher levels of IL-22 being secreted in the intestine. Further investigation into the cause of this phenomenon is warranted. STM Infection Leads to Significant Changes in Mouse Intestinal Microflora and IL-22 Secretion by ILC3 16s-RNA analysis of mouse intestinal contents revealed an increased proportion of Lacticaseibacillus genus in the intestine post- STM infection (Fig. 2 A). Box plots of α-diversity analysis indicated that the abundance and diversity of intestinal microbiota significantly decreased after STM infection (Fig. 2 B). β-diversity analysis and PCA analysis both showed significant differences in species diversity between the PBS and STM groups (Fig. 2 C/D). Flow cytometry detection revealed that IL-22 expression mainly originated from CD45 + immune cells (Fig. 2 E), with gating strategy shown in Fig. s1 A. Lymphocytes known to secrete IL-22 primarily include ILC3 and CD4 + T cells. To determine the source of IL-22, we separately measured the levels of IL-22 secreted by ILC3 and CD4 + T cells. Results showed a significant increase in both the number of ILC3 cells and the IL-22 they secreted (Fig. 2 F), with gating strategy shown in Fig. s1 B. In every million lymphocytes, the absolute number of ILC3 in the PBS group was 47,800, compared to 25,600 in the STM group. Meanwhile, the secretion of IL-22 by CD4 + T cells showed almost no change (Fig. 2 G), with gating strategy shown in Fig. s1 C. Given the significant increase in Lacticaseibacillus at the early stages of STM infection, along with an increase in the number of ILC3 and the IL-22 they secreted, does Lacticaseibacillus play a crucial role in resisting STM infection? Feeding Mice with LGG Prevents STM Infection To explore the specific role of Lacticaseibacillus in the intestinal STM infection, we orally administered the standard strain of Lacticaseibacillus , LGG , to mice and then infected them with STM after 7 days. By analyzing the mortality and body weight changes of the mice, it was found that compared to the LGG - STM group, mice in the PBS- STM group experienced more severe weight loss (Fig. 3 A) and had a lower survival rate (Fig. 3 B). The lengths of the small intestine and colon in the LGG - STM group were also found to be closer to those of the PBS group (Fig. 3 C). Analysis of the Salmonella load in feces revealed a significantly lower number of Salmonella in the feces of mice in the LGG - STM group compared to the PBS- STM group (Fig. s2 A). The degree of pathological changes in the intestines of mice in the LGG - STM group was also significantly lower than that in the PBS- STM group, with the villi in the jejunum of the LGG + STM group mice showing shortening and atrophy, and epithelial cells showing mild lesions. The villi in the jejunum of PBS + STM group mice exhibited shortening, fragmentation, and breaking, with vacuolization, necrosis, and shedding of the intestinal epithelial cells, among other histopathological changes (Fig. 3 D). Immunofluorescence experiments further revealed that the expression levels of VILLIN and LGR5 proteins in the small intestine of mice in the LGG + STM group were lower than in the PBS- STM group (Fig. 3 E). These results suggest that feeding LGG can significantly reduce the mortality and intestinal lesions caused by STM infection in mice. Feeding LGG Promotes the Development of ILC3 and Secretion of IL-22 in the Mouse Intestine We further investigated the effect of feeding LGG on the activation of intestinal ILC3 in mice and used TLR2 knockout mice to verify the importance of TLR2 in this process. Flow cytometry results showed that feeding LGG increased the number of ILC3 in the mouse intestine and promoted the secretion of IL-22. However, after feeding LGG to TLR2 −/− mice, the activation effect of LGG on ILC3 was absent (Fig. 4 A/B), indicating a key role of TLR2 in the activation of ILC3 by LGG . It is known that TLRs are mainly expressed on the surface of DCs in the mouse intestine. We also conducted flow cytometry analysis on DCs (gating strategy shown in Fig. s2 B), and results showed significant differences in the expression of IL-23 by DCs in the lamina propria of TLR2 −/− mice and wild-type mice after feeding LGG (Fig. 4 C). In summary, feeding LGG to wild-type mice significantly promoted the secretion of IL-23 by DCs in the lamina propria, and concurrently, the number of ILC3 and the secretion of IL-22 were also significantly increased, while feeding LGG to TLR2 knockout mice did not induce these changes. These results suggest that LGG may interact with DCs and promote the secretion of IL-23. Therefore, we conducted in vitro experiments to verify whether IL-23 secreted by DCs stimulated by LGG could promote the activation of ILC3 and the secretion of IL-22. HK- LGG Promotes IL-22 Secretion by ILC3 through DCs Initially, we obtained DCs and ILC3, with the flow cytometry sorting strategy for DCs shown in Fig. s3A and for ILC3 cells shown in Fig. s3B. Subsequently, an in vitro co-culture model was constructed (Fig. s3C), followed by control experiments using LGG culture supernatant and HK- LGG . In vitro studies found that without DCs, neither HK- LGG nor LGG supernatant could promote IL-22 secretion by ILC3. However, when DCs were added, the HK- LGG group could promote IL-22 secretion by ILC3 (Fig. 5 A). Next, we measured the transcription levels of mIL-22 in co-cultured ILC3 cells and mIL-23 in DCs via qPCR experiments. It was found that the transcription of mIL-22 in the culture medium of the HK- LGG + DC group was significantly higher than in other groups (Fig. 5 B), while the transcription level of mIL-23 in the LGG supernatant + DC group was significantly lower than in the HK- LGG + DC group (Fig. 5 C). These results indicate that HK- LGG can promote the secretion of IL-23 by DCs, and the IL-23 secreted by DCs can further promote the secretion of IL-22 by ILC3. To explore whether IL-22 could further enhance the function of the intestinal mucosal immune barrier in this process, we conducted further experimental studies using organoids. IL-22 Regulates the Immune Barrier Function of Intestinal Epithelium Firstly, we successfully established an in vitro culture model of mouse intestinal organoids (Fig. s3D), with isolated intestinal crypts approximately 10 µm in size, cultured in a matrix gel. Budding began in large numbers on day 3, and by day 7, they had grown into mature entities approximately 100µm in diameter (Fig. 6 A). Next, we co-cultured HK- LGG , DCs, ILC3, and organoids. The results showed no significant developmental changes in the organoids in the Ctrl group, HK- LGG group, HK- LGG + DC group, and HK- LGG + ILC3 group; however, the organoids in the HK- LGG + DC + ILC3 group developed faster. On days 3 and 5, we assessed the volume and budding of the organoids, finding that budding and growth in the HK- LGG + DC + ILC3 group were significantly higher than in the other groups (Fig. 6 B). Immunofluorescence experiments revealed that the expression of villin, epithelial protein, and LGR5 protein in the organoids of the HK- LGG + DC + ILC3 group was also higher than in the ILC3 group and the DC + ILC group (Fig. 6 C). These results demonstrate that HK- LGG can promote DCs to secrete IL-23, which then encourages ILC3 to secrete IL-22, and IL-22 ultimately promotes the development of organoids. Studies have reported that components of the LGG cell wall can be recognized by TLR2, stimulating DCs to secrete IL-23[ 5 ]. Based on existing research reports and our experimental results, a regulatory pathway diagram was created: LTA and LAM from HK- LGG can be recognized by TLR2-expressing DCs leading to the secretion of IL-23, which acts on ILC3 to promote the secretion of IL-22. IL-22 can perform multiple functions, including promoting the development of organoids and activating epithelial cells and Paneth cells (Fig. 7 ). Discussion STM is a pathogenic bacterium that triggers a series of physiological and immune responses upon infection in mice, significantly impacting the host's health status. Through pathogenicity experiments and 16S sequencing analysis, we have gained a deeper understanding of the impact of STM infection on the mouse intestinal microbiota and the host immune system. This study found that mice infected with STM experienced a reduction in the abundance of Lacticaseibacillus in the intestine and intestinal lesions, while there was a significant increase in ILC3 and the secretion of IL-22 in the intestinal lamina propria. These results suggest that Lacticaseibacillus in the mouse intestine may play an important role during STM infection, potentially regulating ILC3 to secrete IL-22. Thus, the regulatory relationship between the microbiota and ILC3—whether it is a positive or negative feedback mechanism—warrants further exploration. Intestinal microbiota play a crucial role in the development and maintenance of the host's immune system, especially in regulating the development and differentiation of lymphocytes within the intestinal lamina propria [ 23 , 24 ]. To explore the role of Lacticaseibacillus in STM infection, we first orally administered the model probiotic LGG to mice before subjecting them to STM infection. The results showed that feeding LGG significantly alleviated the symptoms of STM infection in mice. Research has reported that DCs expressing TLR2 play an important role in the regulation of intestinal microbiota[ 25 ], particularly lipoarabinomannan (LAM) and lipoteichoic acid (LTA) from LGG , which can activate DCs to secrete IL-23 through TLR2 [ 26 , 27 ]. Subsequently, ILC3 can produce the cytokine interleukin IL-22 in response to IL-23 signaling [ 28 ]. To further explore the activating effect of LGG on the intestinal immune barrier, we constructed an in vitro cell co-culture model for validation. Our results found that HK- LGG can activate DCs via TLR2 and promote the secretion of IL-23, which in turn can enhance the proliferation of ILC3 cells and the secretion of IL-22. In the mouse intestine, research has documented the crucial role of the IL-22-IL-22R signaling axis in immune responses and mucosal surface barrier functions [ 29 ]. Studies also report that IL-22 can promote epithelial cell activation and the expression of antimicrobial peptides through the activation of the STAT3 signaling pathway [ 30 ]. Multiple studies have underscored the importance of IL-22 produced by ILC3 in maintaining intestinal homeostasis [ 31 ]. We constructed a mouse intestinal organoid model to further validate the impact of IL-22 on organoid development, showing that IL-22 can also act on Paneth cells, stem cells, and epithelial cells in organoids to promote their growth and development. In this study, we discovered that LAM and LTA from LGG can activate DCs and secrete IL-23 through TLR2, and IL-23 can further activate ILC3 to secrete IL-22, maintaining intestinal immune homeostasis. While this work provides a theoretical basis and experimental foundation for the development of new intestinal health regulatory products and treatment strategies, the complexity of the microbial species in the intestine leaves unanswered whether LAM and LTA from other microbial sources can also exert similar immunomodulatory effects. In recent years, research into the interactions between microbiota and the immune system has garnered considerable attention. On one hand, the immune system can regulate and shape the microbial flora. On the other hand, the colonized microbial flora can promote the development of the host's immune system and provide signals for subsequent immune responses. However, to date, our understanding of the interactions between microbiota and the immune system remains significantly limited, and unraveling these mysteries requires coordinated innovation across multiple disciplines. Our work is just the beginning, and in the future, we will delve deeper into exploring the mechanisms of interaction between LGG and intestinal immune cells. Declarations Acknowledgments We thank Novogene Co., for providing technical services such as detecting and analyzing of 16S rDNA sequencing. Data availability statement The raw data for this article were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database. 16S rRNA amplicon sequencing data in PRJNAXXXXXX. Author contributions Cell isolation, J.H.W.; data analysis, M.G.; manuscript preparation and writing, J.H.W.; Information collection, J.R.W.; supervision and project administration, C.F.W., Y.Z., and X.C. Preparation of experimental reagent materials, J.H.W., M.G. All authors contributed to the article and approved the submitted version. Ethics declarations Consent to publish All authors have approved the content of this manuscript and provided consent for publication. Conflict of Interest The authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest. Ethics approval All experiments in this study were conducted according to the regulations of the Administration of Affairs Concerning Experimental Animals in China. The animal management procedures and all laboratory procedures abided by the regulations of the Animal Care and Ethics Committees of Jilin Agriculture University. The ethical review acceptance number is 20220302006. Funding This work was supported by the National Natural Science Foundation of China (32273043, 32202890, U21A20261), the Science and Technology Development Program of Changchun City (21ZY42), the Science and Technology Development Program of Jilin Province (20200402041NC), and China Agriculture Research System of MOF and MARA (CARS-35). This paper does not report the original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. References C F., C D.C., C V., B J., Probiotic activities of Lactobacillus casei rhamnosus: in vitro adherence to intestinal cells and antimicrobial properties, Res Microbiol. (2001) 152. Ravi M P., Loren S M., Ashish R K., Akhil M., Asma N., Patricia W L., Probiotic bacteria induce maturation of intestinal claudin 3 expression and barrier function, Am J Pathol. (2011) 180. Seria Masole S., Bo F., Wentao Y., Guilian Y., Chunfeng W., The regulatory effect of Lactobacillus rhamnosus GG on T lymphocyte and the development of intestinal villi in piglets of different periods, AMB Express. (2020) 10. Yongsong B., Kaidi M., Jibo L., Jianping L., Chongpeng B., Anshan S., Deoxynivalenol exposure induces liver damage in mice: Inflammation and immune responses, oxidative stress, and protective effects of Lactobacillus rhamnosus GG, Food Chem Toxicol. (2021) 156. Terrence E R., David A., Xueping E., Aaron Z., Lynn F., Vaishali K., Dinesh T., Matthew A C., William F S., Lactobacillus rhamnosus GG protects the intestinal epithelium from radiation injury through release of lipoteichoic acid, macrophage activation and the migration of mesenchymal stem cells, Gut. (2018) 68. S U., D J B., T W., S R., G L., S B., J C., D J P., J E O., Host adapted serotypes of Salmonella enterica, Epidemiol Infect. (2000) 125. Shannon E M., Jennie M., Elaine S., Frederick J A., Martyn K., Sarah J O.B., Timothy F J., Aamir F., Robert M H., The global burden of nontyphoidal Salmonella gastroenteritis, Clin Infect Dis. (2010) 50. Michael H S., Nobuhiko K., Yun-Gi K., Gabriel N., Microbiota-induced IL-1β, but not IL-6, is critical for the development of steady-state TH17 cells in the intestine, J Exp Med. (2012) 209. Gregory F S., Laurel A M., Theresa A., Thomas C F., Natalie A H., Jun K., Naoko S., Stephanie G., Rohini S., Adam M Z., Mélanie R T., Taheri S., Masaru K., Donna L F., Ronald G C., Abraham S., Lynette A F., David B W., Philippe A T., Joshua R F., Hiroshi K., Frederic D B., Kyong-Mi C., David A., Innate lymphoid cells promote anatomical containment of lymphoid-resident commensal bacteria, Science. (2012) 336. Naoko S.-T., Christian A J V., Sarah L.-P., Shinichiro S., Matthias L., Frederique R., Jean-Jacques M., Kader T., Nadine C.-B., Ofer M., Gerard E., James P D.S., Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense, Immunity. (2008) 29. Maarten C., Anna R., Stefanie Katharina G., Daniel U., Ulrik L., Birgitta A., Jenny M., Peter B., Innate lymphoid cell type 3-derived interleukin-22 boosts lipocalin-2 production in intestinal epithelial cells via synergy between STAT3 and NF-κB, J Biol Chem. (2019) 294. Carlene L Z., Steven J W., Vincent A L., Min G., Zongliang Y., Karen M J., Baiyi C., Blake F F., Daniel J S., Stacey N H., Jeffrey R S., Henrietta T., Frances E L., Bruce A V., Alexander F R., Trenton R S., Jake Y C., Robin D H., Casey T W., A nonredundant role for T cell-derived interleukin 22 in antibacterial defense of colonic crypts, Immunity. (2022) 55. Mónica R.-H., Patricia A.-D., Natalie P., Julien J K., Ferry C., Remco M H., Janneke N S., Tom C., Yap1-Driven Intestinal Repair Is Controlled by Group 3 Innate Lymphoid Cells, Cell Rep. (2020) 30. Xiaohuan G., Ju Q., Tony T., Xuanming Y., Liufu D., Robert A A., Liang Z., Yang-Xin F., Induction of innate lymphoid cell-derived interleukin-22 by the transcription factor STAT3 mediates protection against intestinal infection, Immunity. (2014) 40. Matthew R H., Thomas C F., Samuel H M., Judith R K., Fiona M M., Juan D., David R W., Stephanie H., Michael A F., Walter R., Gérard E., Robert N B., Terri M L., Charles O E., Gregory F S., Immune tolerance. Group 3 innate lymphoid cells mediate intestinal selection of commensal bacteria-specific CD4⁺ T cells, Science. (2015) 348. Angélique J., Zacarias G., Solenne M., Abdi D., Immo P., Philippe B., James P D.S., Nicolas S., Inflammation triggers ILC3 patrolling of the intestinal barrier, Nature immunology. (2022) 23. Baomei W., Jong-Hyung L., Tetsuhiro K., Xiaofei L., Bruce A V., Niki M M., Triantafyllos C., George H., Macrophage β2-Integrins Regulate IL-22 by ILC3s and Protect from Lethal Citrobacter rodentium-Induced Colitis, Cell Rep. (2019) 26. Laura O.-N., Paola M., Lee M W., The Role of TLR2 in Infection and Immunity, Front Immunol. (2012) 3. Jelena C., Nataša I., Alisa G.-M., Sergej T., Ninoslav M., Elena P., Ljiljana S.-M., DC-SIGN signalling induced by Trichinella spiralis products contributes to the tolerogenic signatures of human dendritic cells, Sci Rep. (2020) 10. Anna T., Evelyn G., Esther J., Pere-Joan C., Carmen F., Determinant role for Toll-like receptor signalling in acute mycobacterial infection in the respiratory tract, Microbes Infect. (2006) 8. Scott M R., Qing L., Sophia O., Xuedong D., Ahmad F K., Yeritza H., Scott A F., Clifford V H., Christina L L., Nancy N., Myriam E R., Pamela A W., Roxana E R., TLR2 engagement on CD4(+) T cells enhances effector functions and protective responses to Mycobacterium tuberculosis, Eur J Immunol. (2014) 44. Yi-Guo C., Yong Z., Lin-Qiang D., Hui C., Yu-Juan Z., Nan-Jin Z., Keng Y., Li-Zhi Y., Zhang-Hua X., Xiao-Mei G., Yan-Rong Y., Xiao-Mu W., Wei-Ping M., Control of Methicillin-Resistant Staphylococcus aureus Pneumonia Utilizing TLR2 Agonist Pam3CSK4, PLoS One. (2016) 11. Daniel F Z.-R., Dasom V K., Kendra N., Myunghoo K., Wan-Jung H W., Fatima B S.-M., Andrea A H., Shubhabrata M., Stephanie O., Rickesha B., June L R., Randy S L., Takeshi E., Matthew L B., Gretchen E D., Thymic development of gut-microbiota-specific T cells, Nature. (2021) 594. Michelle G R., Wendy S G., Gut microbiota, metabolites and host immunity, Nat Rev Immunol. (2016) 16. Chenfeng J., Ziyi Z., Jinrui C., Dongxue S., Bing L., Jun L., Rongyu L., Junbo N., Di W., Na L., Zheng Q., Wenlan L., Immune-Enhancing Effects of a Novel Glucan from Purple Sweet Potato Ipomoea batatas (L.) Lam on RAW264.7 Macrophage Cells via TLR2- and TLR4-Mediated Pathways, J Agric Food Chem. (2021) 69. Margarida C.-N., Jérôme N., Zaynab M., Christopher S., Gunilla K., Immunological hyporesponsiveness in tuberculosis: The role of mycobacterial glycolipids, Front Immunol. (2022) 13. Donald J Jr W., Edimara S R., Manoj K P., Gabriele K., Nathaniel H., Craig G., Jörg K., C5a receptor-deficient dendritic cells promote induction of Treg and Th17 cells, Eur J Immunol. (2009) 40. Piotr B., Samantha J R., Jan-Christian H., Elena T.T., Monika S K., Roberto R R.-G., Mi L., Maria C A.V., Lina K., Hao X., Michal S., Christoph M., Leif S L., Elena C., Liming T., Amanda J K., Holly R S., Autumn G Y., Mathias H S., Parastou Y., Danielle D., Abigail J., Heather M M., Caroline B M P., Paula L.-L., Will B., Ruaidhrí J., Nicola G., Georg G., Richard M L., Aviv R., Richard A F., Skin-resident innate lymphoid cells converge on a pathogenic effector state, Nature. (2021) 592. Makowski L., Chaib M., Rathmell J., Immunometabolism: From basic mechanisms to translation, Immunological reviews. (2020) 295:5-14. Hou Q., Ye L., Liu H., Huang L., Yang Q., Turner J., Yu Q., Lactobacillus accelerates ISCs regeneration to protect the integrity of intestinal mucosa through activation of STAT3 signaling pathway induced by LPLs secretion of IL-22, Cell death and differentiation. (2018) 25:1657-1670. Zenewicz L., Yancopoulos G., Valenzuela D., Murphy A., Stevens S., Flavell R., Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease, Immunity. (2008) 29:947-957. Supplementary Files Fig.s123legends.docx Fig.s.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 02 Jul, 2024 Reviewers invited by journal 11 Jun, 2024 Editor invited by journal 15 Apr, 2024 First submitted to journal 14 Apr, 2024 Editor assigned by journal 09 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4230746","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":312941078,"identity":"a803a31c-27ff-4acf-af5c-014a7aeaae0c","order_by":0,"name":"Junhong Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Junhong","middleName":"","lastName":"Wang","suffix":""},{"id":312941079,"identity":"c4ce5841-b3f2-4a93-9171-09d59e646fc7","order_by":1,"name":"Ming Gao","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Gao","suffix":""},{"id":312941080,"identity":"7ba0a636-b035-4e6b-aa4f-0ef69a629e8d","order_by":2,"name":"Jiarui Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiarui","middleName":"","lastName":"Wang","suffix":""},{"id":312941081,"identity":"5f705c1a-c894-4621-ba03-68d16365d9d3","order_by":3,"name":"Yan Zeng","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Zeng","suffix":""},{"id":312941082,"identity":"d1dfdb73-2264-4b17-9b98-cf907ec98b51","order_by":4,"name":"Chunfeng Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chunfeng","middleName":"","lastName":"Wang","suffix":""},{"id":312941083,"identity":"bcaa837e-6a75-4e83-9bad-28984c8f100b","order_by":5,"name":"Xin Cao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYDACZiD+wGMBZksQrYVxBo8EKVpAungYSNFicJz34GcbGQl5gwPMB2/zMNjlEdQi2cyXLJ3DI2G44QBbsjUPQ3IxQS38zDxmzEAtjBsO8JhJ8zAcSGwgpIUNpMWCR8J+wwH+b8RpAdvCwCORCLSFjTgtks08xpI9PBLJMw+zGVvOMUgmrMXg/BnDDz97bGz7jjc/vPGmwo6wFjBg7GGAJAMGA6LUg8APolWOglEwCkbBSAQA0XkuHZ2f14oAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-3459-7207","institution":"Jilin Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Cao","suffix":""}],"badges":[],"createdAt":"2024-04-07 09:56:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4230746/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4230746/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59094179,"identity":"7c6c162b-8c7e-410d-9fb0-b064c02c87f7","added_by":"auto","created_at":"2024-06-26 09:34:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1942771,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSTM \u003c/em\u003einfection caused death and intestinal lesions in the mice\u003c/p\u003e\n\u003cp\u003eA: \u003cem\u003eSTM\u003c/em\u003e infection leads to decreased host weight in mice (n=5). B: \u003cem\u003eSTM\u003c/em\u003e infection results in mortality of mice (n=5). C: \u003cem\u003eSTM\u003c/em\u003e infection causes the shrinking of the small intestine and colon in mice. D: \u003cem\u003eSTM\u003c/em\u003e infection induces pathological changes in the small intestine and colon of mice. E: After \u003cem\u003eSTM\u003c/em\u003einfection, mice exhibit elevated expression of VILLIN, LGR5, and EpCAM proteins in the small intestine. F: Following \u003cem\u003eSTM\u003c/em\u003einfection, there is a significant increase in the secretion of IL-22 protein and transcription of mIL-22 in the intestinal tract of mice.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/07f4dbe72870ef6727d7c41b.png"},{"id":59094964,"identity":"698282fb-943c-493d-89dc-bc19730959e2","added_by":"auto","created_at":"2024-06-26 09:42:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":799153,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSTM\u003c/em\u003e infection leads to significant changes in the gut microbiota and IL-22 secretion by ILC3 in mice.\u003c/p\u003e\n\u003cp\u003eA: Changes in \u003cem\u003eLactobacillus\u003c/em\u003e Genus in the intestinal tract of piglets (n=5). B: Box plot of alpha diversity analysis (Chao1, Simpson index). C: Heatmap of beta diversity analysis. D: Inter-group PCA analysis. E: Differences in IL-22 secretion by CD45\u003csup\u003e+\u003c/sup\u003e immune cells between the PBS and \u003cem\u003eSTM\u003c/em\u003e groups. F: Flow cytometry analysis of the number of ILC3 cells and the level of IL-22 secretion in the lamina propria of the mouse small intestine. G: Flow cytometry analysis of the number of TH17 cells and the level of IL-22 secretion in the lamina propria of the mouse small intestine.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/e1278b6bf15259a8b3ad0946.png"},{"id":59094175,"identity":"d5594215-eb70-447f-85d4-fa69c7c8b3ef","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2322182,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eLGG \u003c/em\u003ecan help mice resist \u003cem\u003eSTM\u003c/em\u003e infection\u003c/p\u003e\n\u003cp\u003eA: Feeding \u003cem\u003eLGG\u003c/em\u003e significantly alleviates weight loss in mice after \u003cem\u003eSTM\u003c/em\u003e infection. B: Feeding \u003cem\u003eLGG\u003c/em\u003e significantly reduces mortality in mice after \u003cem\u003eSTM\u003c/em\u003einfection. C: Feeding \u003cem\u003eLGG\u003c/em\u003esignificantly alleviates the shrinking of the small intestine and colon in mice after \u003cem\u003eSTM\u003c/em\u003e infection. D: Feeding \u003cem\u003eLGG\u003c/em\u003e can significantly alleviate the pathological changes in the small intestine and colon in mice after \u003cem\u003eSTM\u003c/em\u003e infection. E: Feeding \u003cem\u003eLGG\u003c/em\u003e significantly reduces the expression of VILLIN, LGR5, and EpCAM proteins in the small intestine of mice after \u003cem\u003eSTM\u003c/em\u003e infection.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/e6da394345cb0b119b7214ce.png"},{"id":59094176,"identity":"6dfe970d-9a67-47ca-ab0b-8d35e7984a32","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":704711,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eLGG \u003c/em\u003epromotes activation of ILC3 cells and is associated with IL-23 expression by TLR2 and DCs\u003c/p\u003e\n\u003cp\u003eA: Flow cytometry analysis of changes in ILC3 in the lamina propria of WT and KO mice after \u003cem\u003eLGG\u003c/em\u003e feeding. B: Flow cytometry analysis of the level of IL-22 secretion by ILC3 in the lamina propria of WT and KO mice after \u003cem\u003eLGG\u003c/em\u003e feeding. C: Flow cytometry analysis of the level of IL-23 expression by DCs in the lamina propria of WT and KO mice after \u003cem\u003eLGG\u003c/em\u003e feeding.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/2cceecc382d97e55f3517bd9.png"},{"id":59094172,"identity":"c131fc9c-2f2f-4f84-b93a-b7938861037c","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":266306,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eHK-LGG \u003c/em\u003eactivates ILC3 by promoting IL-23 secretion from DCs\u003c/p\u003e\n\u003cp\u003eA: Flow cytometry analysis of the activating effect of HK-\u003cem\u003eLGG\u003c/em\u003e, \u003cem\u003eLGG\u003c/em\u003e supernatant, and DCs on IL-22 secretion by mouse ILC3. B: Transcription levels of the IL-22 gene in ILC3 under stimulation by different groups. C: Differential levels of IL-23 secretion promoted by HK-\u003cem\u003eLGG\u003c/em\u003e and \u003cem\u003eLGG\u003c/em\u003e supernatant from DCs.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/2611d615f1ce976629ae7781.png"},{"id":59095556,"identity":"7bd3472d-ee83-4950-bc84-4b37bc828a15","added_by":"auto","created_at":"2024-06-26 09:50:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1311217,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eHK-LGG \u003c/em\u003ecan promote the development of mice intestinal organoids through activating ILC3s to secrete IL-22.\u003c/p\u003e\n\u003cp\u003eA: Crypts isolated from mice intestines were cultured in vitro, and the images depict the changes in organoid size over an 7-day period. B: Effects of HK-\u003cem\u003eLGG\u003c/em\u003e; HK-\u003cem\u003eLGG+\u003c/em\u003eDC; HK-\u003cem\u003eLGG+\u003c/em\u003eILC3 and HK-\u003cem\u003eLGG+\u003c/em\u003eDC+ILC3 on the growth of intestinal organoids. Measure the size (surface area) and budding rate (building organoids) of the organs on the third and fifth days respectively. C: Immunofluorescence experiment demonstrating the expression of proteins such as Villin, EpCAM, LGR5 between different groups.\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/d07e043d839dfa9c9485d954.png"},{"id":59094173,"identity":"8aa49632-b7f6-4b90-a8f1-738a8c84124f","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":257195,"visible":true,"origin":"","legend":"\u003cp\u003eThe pathway of HK-\u003cem\u003eLGG\u003c/em\u003e enhances the intestinal mucosal immune barrier in mice.\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/ca5612091c5d04fd115ea0a3.png"},{"id":59096189,"identity":"0dd6e215-fb1e-4e0e-a7bd-6ab5010d1aa5","added_by":"auto","created_at":"2024-06-26 09:58:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8308627,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/6ec3cab1-c7dd-4219-b110-1fc837ebccef.pdf"},{"id":59094171,"identity":"c02ddd9d-63c1-4f90-ab97-368b803b7cc9","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":20826,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.s123legends.docx","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/844e3acc33758e92732b0e2d.docx"},{"id":59094174,"identity":"d37356ad-9fac-4138-b976-ff7e7430d323","added_by":"auto","created_at":"2024-06-26 09:34:56","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1568446,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.s.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4230746/v1/4fbfd7829853cf043a9dc184.pdf"}],"financialInterests":"","formattedTitle":"LGG Promotes Activation of Intestinal ILC3 through TLR2 Receptor and Inhibits Salmonella Infection in Mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe symbiotic relationship between intestinal probiotics and the host contributes to the maturation of intestinal function and the development of the immune system. Among probiotics, \u003cem\u003eLacticaseibacillus rhamnosus GG\u003c/em\u003e (\u003cem\u003eLGG\u003c/em\u003e) is one of the most extensively studied. \u003cem\u003eLGG\u003c/em\u003e is a Gram-positive beneficial bacterium present in the human gut, exhibiting strong adhesion to intestinal cells [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Studies have shown that \u003cem\u003eLGG\u003c/em\u003e can enhance the proliferation and differentiation of mouse intestinal epithelial cells, thereby strengthening the intestinal immune barrier [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Moreover, \u003cem\u003eLGG\u003c/em\u003e can resist pathogen infection by reducing intestinal pH, competing with pathogens for nutrients, and producing antimicrobial substances [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. \u003cem\u003eLGG\u003c/em\u003e can also activate macrophage activation by releasing lipoteichoic acid, promote the migration of mesenchymal stem cells, and ultimately protect the intestinal epithelium from radiation damage [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. These findings highlight the significant role of \u003cem\u003eLGG\u003c/em\u003e in promoting intestinal immune development and disease prevention.\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e (\u003cem\u003eSTM\u003c/em\u003e) is one of the primary pathogens responsible for acute gastroenteritis in hosts, capable of infecting various poultry and mammals, as well as humans [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eSTM\u003c/em\u003e infections can afflict the ileum and colon, and even the entire gastrointestinal tract of humans, posing serious health risks. In the early stages of \u003cem\u003eSTM\u003c/em\u003e infection, it can induce intestinal inflammation through direct infection of the intestinal barrier and destruction of intestinal epithelial cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Our research, which involves feeding \u003cem\u003eLGG\u003c/em\u003e to regulate intestinal flora and enhance mucosal immunity of the gut, found that feeding \u003cem\u003eLGG\u003c/em\u003e holds promise as a novel strategy for preventing Salmonella infection.\u003c/p\u003e \u003cp\u003eInnate Lymphoid Cells (ILCs) are a newly discovered class of lymphocytes involved in innate immunity, playing a crucial role in protecting tissue health and combating infections. Among them, ILC3 plays a key role in maintaining homeostasis within the intestine. They respond to various dietary components and microbes both inside and outside the body, can sense changes in the gut microbiome, thereby regulating intestinal immune responses and maintaining the stability of the gut flora [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. ILC3s can secrete cytokines such as IL-22 and IL-17 to regulate intestinal mucosal immunity, not only interacting with intestinal stem cells to regulate their differentiation and function but also playing a crucial role in tissue repair processes [\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. A study elucidated the mechanism behind ILC3-driven intestinal tissue repair, revealing that ILC3 can stimulate epithelial cell proliferation and tissue regeneration by activating the Yap1 signaling pathway in intestinal crypt cells [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. ILC3s can regulate epithelial cells through IL-22 signaling, including the expression of tight junction proteins, the expression of Major Histocompatibility Complex II (MHC-II), and the production of antimicrobial peptides [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. ILC3s are also capable of inhibiting intestinal epithelial cell death and maintaining barrier integrity under the regulation of chemokine CCL3 and T cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recent research findings have clarified that innate immune cells, such as dendritic cells (DCs) and macrophages, can regulate ILC3 through the production of IL-1β and IL-23 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eToll-like receptors (TLRs) are a class of pattern recognition receptors (PRRs) in the innate immune system responsible for the early detection of invading pathogens. Among them, TLR2 is expressed on a variety of cell types, including immune cells, endothelial cells, and epithelial cells [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The expression of TLR2 on DCs can regulate T cells' response to Th2, induce the proliferation of CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e T cells, and promote the production of IL-10 and TGF-β by T cells [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. TLR2 has been shown to play a protective role during infections by triggering a strong pro-inflammatory response [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Studies have demonstrated that in a mouse model of Mycobacterium tuberculosis infection, activation of TLR2 on CD4\u003csup\u003e+\u003c/sup\u003e T cells leads to an increase in the protective IFN-γ secretion by T cells [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Moreover, administering TLR2 agonists can enhance the phagocytic action and bactericidal activity of neutrophils, thereby protecting mice from infection with \u003cem\u003eMethicillin-resistant Staphylococcus aureus\u003c/em\u003e (\u003cem\u003eMRSA\u003c/em\u003e) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In summary, the activation of TLR2 can further enhance the host's ability to clear pathogens, making the elucidation of the mechanisms by which TLR2 regulates immunity of significant importance for research into TLR2-related vaccines or targeted therapies.\u003c/p\u003e \u003cp\u003eIn this study, we found that feeding mice with \u003cem\u003eLGG\u003c/em\u003e significantly prevented infection by \u003cem\u003eSTM\u003c/em\u003e. Subsequent experiments with TLR2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice and in vitro cell studies revealed that heat-killed \u003cem\u003eLGG\u003c/em\u003e (HK-\u003cem\u003eLGG\u003c/em\u003e) activates ILC3 through DCs. It is conjectured that IL-22 secreted by ILC3 plays a crucial role in maintaining intestinal antibacterial functions and development, which can enhance the intestinal mucosal immune barrier and promote organoid development.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eAnimals, and Ethical Statement\u003c/h2\u003e\n \u003cp\u003eWildtype mice used in this experiment were purchased from HFK Bioscience Co., Beijing, China. TLR2-/- mice purchased from Cyagen Biotechnology Co., Suzhou, China. The entire animal experiment complied with the requirements of the Animal Management and Ethics Committee of Jilin Agricultural University and followed the National Guiding Principles for the Welfare of Laboratory Animals strictly. If the animal developed dyspnea, hemorrhagic diarrhea, or showed signs of mortality, they were euthanized immediately by CO2 inhalation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eBacterial strains\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eSTM\u003c/em\u003e was provided by Jilin Agricultural University. For the \u003cem\u003eSTM\u003c/em\u003e used to infect mice, it was first cultured overnight in LB medium, then passaged in fresh LB medium containing 0.3M sodium chloride until the OD600 value reached, followed by two washes with PBS buffer. The bacterial sediment was resuspended in PBS, and the final concentration of the \u003cem\u003eSTM\u003c/em\u003e suspension was adjusted to 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mL and stored for later use.\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eLGG\u003c/em\u003e (ATCC 53103) was grown in De Man, Rogosa, and Sharpe (MRS) broth for 12 h at 37\u0026deg;C. After culturing overnight, the bacteria were inoculated 1:100 in fresh MRS broth and grown under anaerobic conditions until reaching the mid-log phase. Then, the colonies were counted, and the cell density was adjusted to 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e colony-forming units (CFU)/mL.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSTM\u003c/strong\u003e \u003cstrong\u003eInfection Experiment and Sample Collection\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eSix-week-old mice were randomly divided into two groups, each consisting of 10 mice. The \u003cem\u003eSTM\u003c/em\u003e group was fed 100\u0026micro;L (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mL) of \u003cem\u003eSTM\u003c/em\u003e suspension daily for eight consecutive days, with mouse body weight changes and survival rates recorded. Following this, an \u003cem\u003eSTM\u003c/em\u003e infection experiment was repeated with another 20 six-week-old mice, and the mice were euthanized four days later. The small intestine and colon were collected for length measurements and formalin fixation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003ePathological Sections and Indirect immunofluorescence\u003c/h2\u003e\n \u003cp\u003eHistopathological analysis was carried out on small intestine, colon, and spleen samples collected after infection. All samples were fixed with 4% paraformaldehyde, and sections were stained with hematoxylin and eosin to examine pathological changes. For immunofluorescence, diluted primary antibodies VILLIN, EpCAM, LGR5 were added and incubated overnight at 4\u0026deg;C in the dark, followed by washing. Secondary antibodies AF594 anti-rabbit was incubated for 1 hour at 4\u0026deg;C in the dark. After washing, nuclear staining was performed using PBS diluted DAPI at 1:5000 at room temperature in the dark for 10 minutes, allowing for nuclear staining. Following another wash, slides were mounted for microscope examination.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eCell separation\u003c/h2\u003e\n \u003cp\u003eCell samples obtained from the the mouse intestine were subjected to subsequent flow assay and in vitro cell culture and qPCR experiment. Firstly, after euthanasia of mice, the small intestine and Colon were dissected longitudinally, rinsed with PBS and divided into 1 cm sized intestinal fragments, which were then transferred to the separation solution (15 mL of RPMI-1640, 1% penicillin and streptomycin, 1% HEPES, 2.5 mM EDTA, 1 mM DTT, and 1% heat-inactivated FBS) and incubated for 28 minutes in a shaking incubator at 37\u0026deg;C and 200 rpm, and then removed. After incubation for 18 minutes in a shaking incubator at 37\u0026deg;C and 180 rpm, the intestinal fragments were obtained rinsed and continued into the enzyme digestion solution (8 mL RPMI-1640 medium, 1% penicillin and streptomycin, 1% HEPES, 20 mg collagenase IV, 0.5 mg DNase I, and 1% FBS), and incubated for 25 minutes in a shaking incubator at 37\u0026deg;C and 220 rpm before being removed, and then filtered through a 70-\u0026micro;m cell strainer to get the LPL cells in the mouse intestine. Finally, percoll was used for density gradient centrifugation to obtain lymphocytes for subsequent experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow cytometry\u003c/h2\u003e\n \u003cp\u003eFirst, antibodies were added to tubes containing 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells, mixed thoroughly and stained for 30 min at 4\u0026deg;C under dark conditions. Then, add 1 mL of PBS, centrifuge at 2000 r pm and 4\u0026deg;C for 5 min and discard the supernatant. The cells can then optionally be fixed and permeabilized, and after permeabilization the antibody can be used to continue the staining. The staining is completed and detected using a flow cytometric analyzer (BD).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eAntibody and reagent information\u003c/h2\u003e\n \u003cp\u003eBD Pharmingen: Fixable Viability Stain 780 (L/D) (565388), purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block) (553142), \u0026gamma;\u0026delta; T (Biotin) (553176), CD19 (Biotin) (553784), CD11b (Biotin) (557395), TCR\u0026beta; (Biotin) (553168), Ly6G/C (Biotin) (553124), TER-119 (Biotin) (553672), streptavidin protein (APC-cy7) (554063), CD45 (FITC) (551874), CD127 (PE-cy7) (560733), ROR\u0026gamma;t (PE) (562607), and GATA3 (BV421) (563349), IL-22 (Alexa Fluor 647) (567160), MHCII (PE) (558593), CD11c (FITC) (553801), IL-23 (Alexa Fluor 647) (565317).\u003c/p\u003e\n \u003cp\u003eAbcam: AF594 anti-rabbit (ab150080), VILLIN (ab130751), EpCAM (ab213500), LGR5 (ab75850).\u003c/p\u003e\n \u003cp\u003eSolarbio: D-PBS (D1040), PBS (P1010).\u003c/p\u003e\n \u003cp\u003eGE Healthcare: Percoll (17089101).\u003c/p\u003e\n \u003cp\u003eSigma: Penicillin And Streptomycin (V900929), Collagenase IV (V900893-1G), Ionomycin (56092-81-0), DNase I (10104159001), DTT (3483-12-3), HEPES ( H3375), EDTA (E8008), FBS (F8318).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eLGG resistance to \u003cem\u003eSTM\u003c/em\u003e infection experiments\u003c/h2\u003e\n \u003cp\u003eWe divided the 5 Weeks old mice into two groups of 10 animals each. Then the PBS\u0026thinsp;+\u0026thinsp;STM group was first fed PBS for 7 days, 100\u0026micro;L/day, followed by STM infection. The LGG\u0026thinsp;+\u0026thinsp;STM group continued to be fed with LGG for 7 days, each mouse is fed 100\u0026micro;L (1\u0026times;10\u003csup\u003e7\u003c/sup\u003eCFU) LGG per day, and then received STM infection. All mice were orally fed with STM at 6 Weeks old, then Mouse weight change and survival within 8 days of infection were counted. The above experiment was repeated once more, and on the fourth day post \u003cem\u003eSTM\u003c/em\u003e infection, mice were euthanized to collect intestinal tissues and cells for subsequent experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eELISA and qPCR experiments\u003c/h2\u003e\n \u003cp\u003eCytokine protein and total RNA were extracted from the mouse intestine and secretion of IL-22 was detected using the ELISA kit (MEIMIAN, MM-0892M2). Next, total RNA was extracted, and 1 mg of RNA was reversed into cDNA by reverse transcriptase (Promega) which reverse transcribed Moloney mouse leukemia virus (M-MLV). In the real-time qPCR system of Biological System 7500, qPCR was performed using SYBR green mixture (Takara). The average mRNA fold changes were calculated by 2-\u0026Delta;\u0026Delta;CT method and compared with the control group.\u003c/p\u003e\n \u003cp\u003ePrimer design: IL-22 (NM_016971.2),\u003c/p\u003e\n \u003cp\u003eFORWARD: CCTGCTTCTCATTGCCCTGTGG,\u003c/p\u003e\n \u003cp\u003eREVERSE: AAGGTGCGGTTGACGATGTATGG.\u003c/p\u003e\n \u003cp\u003eIL-23 (NM_031252.2),\u003c/p\u003e\n \u003cp\u003eFORWARD: AGCCAACTCCTCCAGCCAGAG,\u003c/p\u003e\n \u003cp\u003eREVERSE: CGCTGCCACTGCTGACTAGAAC.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e16S rRNA-seq experiment\u003c/h2\u003e\n \u003cp\u003e16S rRNA amplicon sequencing data in PRJNAxxxxxx. Novogene Co., for providing technical services such as detecting and analyzing of scRNA-seq raw data, and 16S rDNA sequencing.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow Sorting of ILC3 and DC\u003c/h2\u003e\n \u003cp\u003eSingle-cell suspensions were incubated with antibodies including Lin (\u0026gamma;\u0026delta; T, CD19, CD11b, TCR-\u0026beta;, Ly6G/C, TER-119), L/D, MHC-II, CD11c, CD45, etc. DCs were sorted as L/D\u003csup\u003e\u0026minus;\u003c/sup\u003eCD11c\u003csup\u003e+\u003c/sup\u003eMHCII\u003csup\u003e+\u003c/sup\u003e cells, and ILC3 were obtained through Lin\u003csup\u003e\u0026minus;\u003c/sup\u003eL/D\u003csup\u003e\u0026minus;\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e sorting, noting that Lin\u003csup\u003e\u0026minus;\u003c/sup\u003eL/D\u003csup\u003e\u0026minus;\u003c/sup\u003eCD45\u003csup\u003e++\u003c/sup\u003e indicates ILC2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eIn Vitro Stimulation Culture of Primary Cells\u003c/h2\u003e\n \u003cp\u003eILC3s were seeded in a 24-well plate at a density of 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells per well. HK-\u003cem\u003eLGG\u003c/em\u003e (50\u0026micro;L), \u003cem\u003eLGG\u003c/em\u003e supernatant (50\u0026micro;L), and DCs (5\u0026times;10\u003csup\u003e5\u003c/sup\u003e) were added to the culture medium with ILC3 and incubated for 8 hours before being analyzed by flow cytometry and qPCR.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eOrganoid Extraction and Culture\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cspan\u003e1. After euthanizing the mouse, the small intestine was removed, mesentery and fat were discarded, and the intestinal segment was longitudinally opened and washed with cold PBS until the supernatant was clear. The intestinal segments were cut into 2mm pieces and gently washed with cold PBS, then added to 15mL of crypt isolation solution (1 mM EDTA in PBS). Incubated at room temperature for 30 minutes.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e2. The crypt isolation solution was discarded, and 10mL of DPBS was added to repeatedly pipette the fragments. After the fragments settled, the supernatant was collected through a 70\u0026micro;m cell strainer into a 50mL centrifuge tube, labeled as 1, and this step was repeated four times. The 3rd and 4th filtrates were centrifuged at 300xg for 5 minutes, and the supernatant was discarded. The pellet was resuspended in 1mL of DME/F12\u0026thinsp;+\u0026thinsp;1% P/S and transferred to a 1.5mL centrifuge tube, then centrifuged at 200xg for 3 minutes, and the supernatant was discarded.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e3. The pellet was mixed with 250\u0026micro;L of complete medium and 250\u0026micro;L of Matrigel (operation on ice), mixed well by pipetting. 50\u0026micro;L was pipetted into the center of a well in a 24-well plate and incubated in a culture incubator for 30 minutes. Then, 500\u0026micro;L of complete culture medium (STEMCELL #6000) was added to each well, and 500\u0026micro;L of PBS was added to the remaining wells.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e4. When organoids begin to bud, they should be passaged. First, the old culture medium is removed, and 2 mL of DME/F12 is added for pipetting up and down before collection into a centrifuge tube. After centrifugation, the supernatant is discarded, and the pellet is resuspended in complete culture medium and Matrigel for further cultivation.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eCo-culture Model of ILC3 and Intestinal Organoids\u003c/h2\u003e\n \u003cp\u003eHK-\u003cem\u003eLGG\u003c/em\u003e, DCs, and ILC3 are added to the organoid culture medium to observe their effects on the growth and development of organoids. Medium 1 is the organoid culture medium. Medium 2 consists of RPMI-1640 (1% penicillin and streptomycin, 1% HEPES, 10% FBS). HK-\u003cem\u003eLGG\u003c/em\u003e, DCs, and ILC3 can be added to Medium 2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis of data\u003c/h2\u003e\n \u003cp\u003eFlow cytometry results were analyzed using FlowJo version 10.8.1. Graphs were plotted using GraphPad Prism version 8.0.2 software. Data analysis was carried out using one-way ANOVA to compare differences between control and experimental groups. (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 is denoted by *; P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 by **; P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 by ***).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eSTM\u003c/b\u003e \u003cb\u003eInfection Causes Mortality and Intestinal Lesions in Mice\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study found that mice infected with \u003cem\u003eSTM\u003c/em\u003e exhibited weight loss and even death. The body weight of mice in the PBS group increased, while that of mice in the \u003cem\u003eSTM\u003c/em\u003e group significantly decreased, with mortality observed on the third day and a survival rate of only 25% by the eighth day (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eA/B). \u003cem\u003eSTM\u003c/em\u003e infection also led to the atrophy of the small intestine and colon in mice. The length of the small intestine in the PBS group was about 33 cm, and the colon was about 8 cm. In contrast, the small intestine in the \u003cem\u003eSTM\u003c/em\u003e group was about 26 cm, and the colon was about 6 cm (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). To explore the immunological changes occurring in the mouse intestine during this process, mice were euthanized on the third day for further examination. Pathological sections revealed tissue damage in the small intestine and colon of mice in the \u003cem\u003eSTM\u003c/em\u003e group, including villi fracture, thinning of the intestinal wall, and extensive infiltration of red blood cells and lymphocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Immunofluorescence experiments identified significant expression of intestinal villin protein, stem cell differentiation protein LGR5, and epithelial cell marker protein EpCAM in the intestines of \u003cem\u003eSTM\u003c/em\u003e-infected mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). ELISA and qPCR analyses showed that the secretion of IL-22 and the transcription level of the mIL-22 gene in the intestines of mice in the \u003cem\u003eSTM\u003c/em\u003e group were significantly higher than in the PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). The experimental results indicate that \u003cem\u003eSTM\u003c/em\u003e infection in the mouse intestine causes severe intestinal damage and endangers the lives of the mice, with higher levels of IL-22 being secreted in the intestine. Further investigation into the cause of this phenomenon is warranted.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSTM\u003c/b\u003e \u003cb\u003eInfection Leads to Significant Changes in Mouse Intestinal Microflora and IL-22 Secretion by ILC3\u003c/b\u003e\u003c/p\u003e \u003cp\u003e16s-RNA analysis of mouse intestinal contents revealed an increased proportion of \u003cem\u003eLacticaseibacillus\u003c/em\u003e genus in the intestine post-\u003cem\u003eSTM\u003c/em\u003e infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Box plots of α-diversity analysis indicated that the abundance and diversity of intestinal microbiota significantly decreased after \u003cem\u003eSTM\u003c/em\u003e infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). β-diversity analysis and PCA analysis both showed significant differences in species diversity between the PBS and \u003cem\u003eSTM\u003c/em\u003e groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eC/D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFlow cytometry detection revealed that IL-22 expression mainly originated from CD45\u003csup\u003e+\u003c/sup\u003e immune cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), with gating strategy shown in Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003es1\u003c/span\u003eA. Lymphocytes known to secrete IL-22 primarily include ILC3 and CD4\u003csup\u003e+\u003c/sup\u003e T cells. To determine the source of IL-22, we separately measured the levels of IL-22 secreted by ILC3 and CD4\u003csup\u003e+\u003c/sup\u003e T cells. Results showed a significant increase in both the number of ILC3 cells and the IL-22 they secreted (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), with gating strategy shown in Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003es1\u003c/span\u003eB. In every million lymphocytes, the absolute number of ILC3 in the PBS group was 47,800, compared to 25,600 in the \u003cem\u003eSTM\u003c/em\u003e group. Meanwhile, the secretion of IL-22 by CD4\u003csup\u003e+\u003c/sup\u003e T cells showed almost no change (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), with gating strategy shown in Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003es1\u003c/span\u003eC. Given the significant increase in \u003cem\u003eLacticaseibacillus\u003c/em\u003e at the early stages of \u003cem\u003eSTM\u003c/em\u003e infection, along with an increase in the number of ILC3 and the IL-22 they secreted, does \u003cem\u003eLacticaseibacillus\u003c/em\u003e play a crucial role in resisting \u003cem\u003eSTM\u003c/em\u003e infection?\u003c/p\u003e \u003cp\u003e \u003cb\u003eFeeding Mice with\u003c/b\u003e \u003cb\u003eLGG\u003c/b\u003e \u003cb\u003ePrevents\u003c/b\u003e \u003cb\u003eSTM\u003c/b\u003e \u003cb\u003eInfection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo explore the specific role of \u003cem\u003eLacticaseibacillus\u003c/em\u003e in the intestinal \u003cem\u003eSTM\u003c/em\u003e infection, we orally administered the standard strain of \u003cem\u003eLacticaseibacillus\u003c/em\u003e, \u003cem\u003eLGG\u003c/em\u003e, to mice and then infected them with \u003cem\u003eSTM\u003c/em\u003e after 7 days. By analyzing the mortality and body weight changes of the mice, it was found that compared to the \u003cem\u003eLGG\u003c/em\u003e-\u003cem\u003eSTM\u003c/em\u003e group, mice in the PBS-\u003cem\u003eSTM\u003c/em\u003e group experienced more severe weight loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) and had a lower survival rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The lengths of the small intestine and colon in the \u003cem\u003eLGG\u003c/em\u003e-\u003cem\u003eSTM\u003c/em\u003e group were also found to be closer to those of the PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Analysis of the Salmonella load in feces revealed a significantly lower number of Salmonella in the feces of mice in the \u003cem\u003eLGG\u003c/em\u003e-\u003cem\u003eSTM\u003c/em\u003e group compared to the PBS-\u003cem\u003eSTM\u003c/em\u003e group (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003es2\u003c/span\u003eA). The degree of pathological changes in the intestines of mice in the \u003cem\u003eLGG\u003c/em\u003e-\u003cem\u003eSTM\u003c/em\u003e group was also significantly lower than that in the PBS-\u003cem\u003eSTM\u003c/em\u003e group, with the villi in the jejunum of the \u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eSTM\u003c/em\u003e group mice showing shortening and atrophy, and epithelial cells showing mild lesions. The villi in the jejunum of PBS\u0026thinsp;+\u0026thinsp;\u003cem\u003eSTM\u003c/em\u003e group mice exhibited shortening, fragmentation, and breaking, with vacuolization, necrosis, and shedding of the intestinal epithelial cells, among other histopathological changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Immunofluorescence experiments further revealed that the expression levels of VILLIN and LGR5 proteins in the small intestine of mice in the \u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eSTM\u003c/em\u003e group were lower than in the PBS-\u003cem\u003eSTM\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These results suggest that feeding \u003cem\u003eLGG\u003c/em\u003e can significantly reduce the mortality and intestinal lesions caused by \u003cem\u003eSTM\u003c/em\u003e infection in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFeeding\u003c/b\u003e \u003cb\u003eLGG\u003c/b\u003e \u003cb\u003ePromotes the Development of ILC3 and Secretion of IL-22 in the Mouse Intestine\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe further investigated the effect of feeding \u003cem\u003eLGG\u003c/em\u003e on the activation of intestinal ILC3 in mice and used TLR2 knockout mice to verify the importance of TLR2 in this process. Flow cytometry results showed that feeding \u003cem\u003eLGG\u003c/em\u003e increased the number of ILC3 in the mouse intestine and promoted the secretion of IL-22. However, after feeding \u003cem\u003eLGG\u003c/em\u003e to TLR2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, the activation effect of \u003cem\u003eLGG\u003c/em\u003e on ILC3 was absent (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eA/B), indicating a key role of TLR2 in the activation of ILC3 by \u003cem\u003eLGG\u003c/em\u003e. It is known that TLRs are mainly expressed on the surface of DCs in the mouse intestine. We also conducted flow cytometry analysis on DCs (gating strategy shown in Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003es2\u003c/span\u003eB), and results showed significant differences in the expression of IL-23 by DCs in the lamina propria of TLR2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice and wild-type mice after feeding \u003cem\u003eLGG\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In summary, feeding \u003cem\u003eLGG\u003c/em\u003e to wild-type mice significantly promoted the secretion of IL-23 by DCs in the lamina propria, and concurrently, the number of ILC3 and the secretion of IL-22 were also significantly increased, while feeding \u003cem\u003eLGG\u003c/em\u003e to TLR2 knockout mice did not induce these changes. These results suggest that \u003cem\u003eLGG\u003c/em\u003e may interact with DCs and promote the secretion of IL-23. Therefore, we conducted in vitro experiments to verify whether IL-23 secreted by DCs stimulated by \u003cem\u003eLGG\u003c/em\u003e could promote the activation of ILC3 and the secretion of IL-22.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHK-\u003c/b\u003e \u003cb\u003eLGG\u003c/b\u003e \u003cb\u003ePromotes IL-22 Secretion by ILC3 through DCs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eInitially, we obtained DCs and ILC3, with the flow cytometry sorting strategy for DCs shown in Fig. s3A and for ILC3 cells shown in Fig. s3B. Subsequently, an in vitro co-culture model was constructed (Fig. s3C), followed by control experiments using \u003cem\u003eLGG\u003c/em\u003e culture supernatant and HK-\u003cem\u003eLGG\u003c/em\u003e. In vitro studies found that without DCs, neither HK-\u003cem\u003eLGG\u003c/em\u003e nor \u003cem\u003eLGG\u003c/em\u003e supernatant could promote IL-22 secretion by ILC3. However, when DCs were added, the HK-\u003cem\u003eLGG\u003c/em\u003e group could promote IL-22 secretion by ILC3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Next, we measured the transcription levels of mIL-22 in co-cultured ILC3 cells and mIL-23 in DCs via qPCR experiments. It was found that the transcription of mIL-22 in the culture medium of the HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC group was significantly higher than in other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), while the transcription level of mIL-23 in the \u003cem\u003eLGG\u003c/em\u003e supernatant\u0026thinsp;+\u0026thinsp;DC group was significantly lower than in the HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). These results indicate that HK-\u003cem\u003eLGG\u003c/em\u003e can promote the secretion of IL-23 by DCs, and the IL-23 secreted by DCs can further promote the secretion of IL-22 by ILC3. To explore whether IL-22 could further enhance the function of the intestinal mucosal immune barrier in this process, we conducted further experimental studies using organoids.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eIL-22 Regulates the Immune Barrier Function of Intestinal Epithelium\u003c/h2\u003e \u003cp\u003eFirstly, we successfully established an in vitro culture model of mouse intestinal organoids (Fig. s3D), with isolated intestinal crypts approximately 10 \u0026micro;m in size, cultured in a matrix gel. Budding began in large numbers on day 3, and by day 7, they had grown into mature entities approximately 100\u0026micro;m in diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Next, we co-cultured HK-\u003cem\u003eLGG\u003c/em\u003e, DCs, ILC3, and organoids. The results showed no significant developmental changes in the organoids in the Ctrl group, HK-\u003cem\u003eLGG\u003c/em\u003e group, HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC group, and HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;ILC3 group; however, the organoids in the HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC\u0026thinsp;+\u0026thinsp;ILC3 group developed faster. On days 3 and 5, we assessed the volume and budding of the organoids, finding that budding and growth in the HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC\u0026thinsp;+\u0026thinsp;ILC3 group were significantly higher than in the other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Immunofluorescence experiments revealed that the expression of villin, epithelial protein, and LGR5 protein in the organoids of the HK-\u003cem\u003eLGG\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DC\u0026thinsp;+\u0026thinsp;ILC3 group was also higher than in the ILC3 group and the DC\u0026thinsp;+\u0026thinsp;ILC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). These results demonstrate that HK-\u003cem\u003eLGG\u003c/em\u003e can promote DCs to secrete IL-23, which then encourages ILC3 to secrete IL-22, and IL-22 ultimately promotes the development of organoids.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eStudies have reported that components of the \u003cem\u003eLGG\u003c/em\u003e cell wall can be recognized by TLR2, stimulating DCs to secrete IL-23[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Based on existing research reports and our experimental results, a regulatory pathway diagram was created: LTA and LAM from HK-\u003cem\u003eLGG\u003c/em\u003e can be recognized by TLR2-expressing DCs leading to the secretion of IL-23, which acts on ILC3 to promote the secretion of IL-22. IL-22 can perform multiple functions, including promoting the development of organoids and activating epithelial cells and Paneth cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eSTM\u003c/em\u003e is a pathogenic bacterium that triggers a series of physiological and immune responses upon infection in mice, significantly impacting the host's health status. Through pathogenicity experiments and 16S sequencing analysis, we have gained a deeper understanding of the impact of \u003cem\u003eSTM\u003c/em\u003e infection on the mouse intestinal microbiota and the host immune system. This study found that mice infected with \u003cem\u003eSTM\u003c/em\u003e experienced a reduction in the abundance of \u003cem\u003eLacticaseibacillus\u003c/em\u003e in the intestine and intestinal lesions, while there was a significant increase in ILC3 and the secretion of IL-22 in the intestinal lamina propria. These results suggest that \u003cem\u003eLacticaseibacillus\u003c/em\u003e in the mouse intestine may play an important role during \u003cem\u003eSTM\u003c/em\u003e infection, potentially regulating ILC3 to secrete IL-22. Thus, the regulatory relationship between the microbiota and ILC3\u0026mdash;whether it is a positive or negative feedback mechanism\u0026mdash;warrants further exploration.\u003c/p\u003e \u003cp\u003eIntestinal microbiota play a crucial role in the development and maintenance of the host's immune system, especially in regulating the development and differentiation of lymphocytes within the intestinal lamina propria [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. To explore the role of \u003cem\u003eLacticaseibacillus\u003c/em\u003e in \u003cem\u003eSTM\u003c/em\u003e infection, we first orally administered the model probiotic \u003cem\u003eLGG\u003c/em\u003e to mice before subjecting them to \u003cem\u003eSTM\u003c/em\u003e infection. The results showed that feeding \u003cem\u003eLGG\u003c/em\u003e significantly alleviated the symptoms of \u003cem\u003eSTM\u003c/em\u003e infection in mice. Research has reported that DCs expressing TLR2 play an important role in the regulation of intestinal microbiota[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], particularly lipoarabinomannan (LAM) and lipoteichoic acid (LTA) from \u003cem\u003eLGG\u003c/em\u003e, which can activate DCs to secrete IL-23 through TLR2 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Subsequently, ILC3 can produce the cytokine interleukin IL-22 in response to IL-23 signaling [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo further explore the activating effect of \u003cem\u003eLGG\u003c/em\u003e on the intestinal immune barrier, we constructed an in vitro cell co-culture model for validation. Our results found that HK-\u003cem\u003eLGG\u003c/em\u003e can activate DCs via TLR2 and promote the secretion of IL-23, which in turn can enhance the proliferation of ILC3 cells and the secretion of IL-22. In the mouse intestine, research has documented the crucial role of the IL-22-IL-22R signaling axis in immune responses and mucosal surface barrier functions [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Studies also report that IL-22 can promote epithelial cell activation and the expression of antimicrobial peptides through the activation of the STAT3 signaling pathway [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Multiple studies have underscored the importance of IL-22 produced by ILC3 in maintaining intestinal homeostasis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. We constructed a mouse intestinal organoid model to further validate the impact of IL-22 on organoid development, showing that IL-22 can also act on Paneth cells, stem cells, and epithelial cells in organoids to promote their growth and development.\u003c/p\u003e \u003cp\u003eIn this study, we discovered that LAM and LTA from \u003cem\u003eLGG\u003c/em\u003e can activate DCs and secrete IL-23 through TLR2, and IL-23 can further activate ILC3 to secrete IL-22, maintaining intestinal immune homeostasis. While this work provides a theoretical basis and experimental foundation for the development of new intestinal health regulatory products and treatment strategies, the complexity of the microbial species in the intestine leaves unanswered whether LAM and LTA from other microbial sources can also exert similar immunomodulatory effects.\u003c/p\u003e \u003cp\u003eIn recent years, research into the interactions between microbiota and the immune system has garnered considerable attention. On one hand, the immune system can regulate and shape the microbial flora. On the other hand, the colonized microbial flora can promote the development of the host's immune system and provide signals for subsequent immune responses. However, to date, our understanding of the interactions between microbiota and the immune system remains significantly limited, and unraveling these mysteries requires coordinated innovation across multiple disciplines. Our work is just the beginning, and in the future, we will delve deeper into exploring the mechanisms of interaction between \u003cem\u003eLGG\u003c/em\u003e and intestinal immune cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Novogene Co., for providing technical services such as detecting and analyzing of 16S rDNA sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data for this article were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database. 16S rRNA amplicon sequencing data in PRJNAXXXXXX.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell isolation, J.H.W.; data analysis, M.G.; manuscript preparation and writing, J.H.W.; Information collection, J.R.W.; supervision and project administration, C.F.W., Y.Z., and X.C. Preparation of experimental reagent materials, J.H.W., M.G. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have approved the content of this manuscript and provided consent for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments in this study were conducted according to the regulations of the Administration of Affairs Concerning Experimental Animals in China. The animal management procedures and all laboratory procedures abided by the regulations of the Animal Care and Ethics Committees of Jilin Agriculture University. The ethical review acceptance number is 20220302006.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (32273043, 32202890, U21A20261), the Science and Technology Development Program of Changchun City (21ZY42), the Science and Technology Development Program of Jilin Province (20200402041NC), and China Agriculture Research System of MOF and MARA (CARS-35).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;This paper does not report the original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eC F., C D.C., C V., B J., Probiotic activities of Lactobacillus casei rhamnosus: in vitro adherence to intestinal cells and antimicrobial properties, Res Microbiol. (2001) 152.\u003c/li\u003e\n\u003cli\u003eRavi M P., Loren S M., Ashish R K., Akhil M., Asma N., Patricia W L., Probiotic bacteria induce maturation of intestinal claudin 3 expression and barrier function, Am J Pathol. (2011) 180.\u003c/li\u003e\n\u003cli\u003eSeria Masole S., Bo F., Wentao Y., Guilian Y., Chunfeng W., The regulatory effect of Lactobacillus rhamnosus GG on T lymphocyte and the development of intestinal villi in piglets of different periods, AMB Express. (2020) 10.\u003c/li\u003e\n\u003cli\u003eYongsong B., Kaidi M., Jibo L., Jianping L., Chongpeng B., Anshan S., Deoxynivalenol exposure induces liver damage in mice: Inflammation and immune responses, oxidative stress, and protective effects of Lactobacillus rhamnosus GG, Food Chem Toxicol. (2021) 156.\u003c/li\u003e\n\u003cli\u003eTerrence E R., David A., Xueping E., Aaron Z., Lynn F., Vaishali K., Dinesh T., Matthew A C., William F S., Lactobacillus rhamnosus GG protects the intestinal epithelium from radiation injury through release of lipoteichoic acid, macrophage activation and the migration of mesenchymal stem cells, Gut. (2018) 68.\u003c/li\u003e\n\u003cli\u003eS U., D J B., T W., S R., G L., S B., J C., D J P., J E O., Host adapted serotypes of Salmonella enterica, Epidemiol Infect. (2000) 125.\u003c/li\u003e\n\u003cli\u003eShannon E M., Jennie M., Elaine S., Frederick J A., Martyn K., Sarah J O.B., Timothy F J., Aamir F., Robert M H., The global burden of nontyphoidal Salmonella gastroenteritis, Clin Infect Dis. (2010) 50.\u003c/li\u003e\n\u003cli\u003eMichael H S., Nobuhiko K., Yun-Gi K., Gabriel N., Microbiota-induced IL-1\u0026beta;, but not IL-6, is critical for the development of steady-state TH17 cells in the intestine, J Exp Med. (2012) 209.\u003c/li\u003e\n\u003cli\u003eGregory F S., Laurel A M., Theresa A., Thomas C F., Natalie A H., Jun K., Naoko S., Stephanie G., Rohini S., Adam M Z., M\u0026eacute;lanie R T., Taheri S., Masaru K., Donna L F., Ronald G C., Abraham S., Lynette A F., David B W., Philippe A T., Joshua R F., Hiroshi K., Frederic D B., Kyong-Mi C., David A., Innate lymphoid cells promote anatomical containment of lymphoid-resident commensal bacteria, Science. (2012) 336.\u003c/li\u003e\n\u003cli\u003eNaoko S.-T., Christian A J V., Sarah L.-P., Shinichiro S., Matthias L., Frederique R., Jean-Jacques M., Kader T., Nadine C.-B., Ofer M., Gerard E., James P D.S., Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense, Immunity. (2008) 29.\u003c/li\u003e\n\u003cli\u003eMaarten C., Anna R., Stefanie Katharina G., Daniel U., Ulrik L., Birgitta A., Jenny M., Peter B., Innate lymphoid cell type 3-derived interleukin-22 boosts lipocalin-2 production in intestinal epithelial cells via synergy between STAT3 and NF-\u0026kappa;B, J Biol Chem. (2019) 294.\u003c/li\u003e\n\u003cli\u003eCarlene L Z., Steven J W., Vincent A L., Min G., Zongliang Y., Karen M J., Baiyi C., Blake F F., Daniel J S., Stacey N H., Jeffrey R S., Henrietta T., Frances E L., Bruce A V., Alexander F R., Trenton R S., Jake Y C., Robin D H., Casey T W., A nonredundant role for T cell-derived interleukin 22 in antibacterial defense of colonic crypts, Immunity. (2022) 55.\u003c/li\u003e\n\u003cli\u003eM\u0026oacute;nica R.-H., Patricia A.-D., Natalie P., Julien J K., Ferry C., Remco M H., Janneke N S., Tom C., Yap1-Driven Intestinal Repair Is Controlled by Group 3 Innate Lymphoid Cells, Cell Rep. (2020) 30.\u003c/li\u003e\n\u003cli\u003eXiaohuan G., Ju Q., Tony T., Xuanming Y., Liufu D., Robert A A., Liang Z., Yang-Xin F., Induction of innate lymphoid cell-derived interleukin-22 by the transcription factor STAT3 mediates protection against intestinal infection, Immunity. (2014) 40.\u003c/li\u003e\n\u003cli\u003eMatthew R H., Thomas C F., Samuel H M., Judith R K., Fiona M M., Juan D., David R W., Stephanie H., Michael A F., Walter R., G\u0026eacute;rard E., Robert N B., Terri M L., Charles O E., Gregory F S., Immune tolerance. Group 3 innate lymphoid cells mediate intestinal selection of commensal bacteria-specific CD4⁺ T cells, Science. (2015) 348.\u003c/li\u003e\n\u003cli\u003eAng\u0026eacute;lique J., Zacarias G., Solenne M., Abdi D., Immo P., Philippe B., James P D.S., Nicolas S., Inflammation triggers ILC3 patrolling of the intestinal barrier, Nature immunology. (2022) 23.\u003c/li\u003e\n\u003cli\u003eBaomei W., Jong-Hyung L., Tetsuhiro K., Xiaofei L., Bruce A V., Niki M M., Triantafyllos C., George H., Macrophage \u0026beta;2-Integrins Regulate IL-22 by ILC3s and Protect from Lethal Citrobacter rodentium-Induced Colitis, Cell Rep. (2019) 26.\u003c/li\u003e\n\u003cli\u003eLaura O.-N., Paola M., Lee M W., The Role of TLR2 in Infection and Immunity, Front Immunol. (2012) 3.\u003c/li\u003e\n\u003cli\u003eJelena C., Nata\u0026scaron;a I., Alisa G.-M., Sergej T., Ninoslav M., Elena P., Ljiljana S.-M., DC-SIGN signalling induced by Trichinella spiralis products contributes to the tolerogenic signatures of human dendritic cells, Sci Rep. (2020) 10.\u003c/li\u003e\n\u003cli\u003eAnna T., Evelyn G., Esther J., Pere-Joan C., Carmen F., Determinant role for Toll-like receptor signalling in acute mycobacterial infection in the respiratory tract, Microbes Infect. (2006) 8.\u003c/li\u003e\n\u003cli\u003eScott M R., Qing L., Sophia O., Xuedong D., Ahmad F K., Yeritza H., Scott A F., Clifford V H., Christina L L., Nancy N., Myriam E R., Pamela A W., Roxana E R., TLR2 engagement on CD4(+) T cells enhances effector functions and protective responses to Mycobacterium tuberculosis, Eur J Immunol. (2014) 44.\u003c/li\u003e\n\u003cli\u003eYi-Guo C., Yong Z., Lin-Qiang D., Hui C., Yu-Juan Z., Nan-Jin Z., Keng Y., Li-Zhi Y., Zhang-Hua X., Xiao-Mei G., Yan-Rong Y., Xiao-Mu W., Wei-Ping M., Control of Methicillin-Resistant Staphylococcus aureus Pneumonia Utilizing TLR2 Agonist Pam3CSK4, PLoS One. (2016) 11.\u003c/li\u003e\n\u003cli\u003eDaniel F Z.-R., Dasom V K., Kendra N., Myunghoo K., Wan-Jung H W., Fatima B S.-M., Andrea A H., Shubhabrata M., Stephanie O., Rickesha B., June L R., Randy S L., Takeshi E., Matthew L B., Gretchen E D., Thymic development of gut-microbiota-specific T cells, Nature. (2021) 594.\u003c/li\u003e\n\u003cli\u003eMichelle G R., Wendy S G., Gut microbiota, metabolites and host immunity, Nat Rev Immunol. (2016) 16.\u003c/li\u003e\n\u003cli\u003eChenfeng J., Ziyi Z., Jinrui C., Dongxue S., Bing L., Jun L., Rongyu L., Junbo N., Di W., Na L., Zheng Q., Wenlan L., Immune-Enhancing Effects of a Novel Glucan from Purple Sweet Potato Ipomoea batatas (L.) Lam on RAW264.7 Macrophage Cells via TLR2- and TLR4-Mediated Pathways, J Agric Food Chem. (2021) 69.\u003c/li\u003e\n\u003cli\u003eMargarida C.-N., J\u0026eacute;r\u0026ocirc;me N., Zaynab M., Christopher S., Gunilla K., Immunological hyporesponsiveness in tuberculosis: The role of mycobacterial glycolipids, Front Immunol. (2022) 13.\u003c/li\u003e\n\u003cli\u003eDonald J Jr W., Edimara S R., Manoj K P., Gabriele K., Nathaniel H., Craig G., J\u0026ouml;rg K., C5a receptor-deficient dendritic cells promote induction of Treg and Th17 cells, Eur J Immunol. (2009) 40.\u003c/li\u003e\n\u003cli\u003ePiotr B., Samantha J R., Jan-Christian H., Elena T.T., Monika S K., Roberto R R.-G., Mi L., Maria C A.V., Lina K., Hao X., Michal S., Christoph M., Leif S L., Elena C., Liming T., Amanda J K., Holly R S., Autumn G Y., Mathias H S., Parastou Y., Danielle D., Abigail J., Heather M M., Caroline B M P., Paula L.-L., Will B., Ruaidhr\u0026iacute; J., Nicola G., Georg G., Richard M L., Aviv R., Richard A F., Skin-resident innate lymphoid cells converge on a pathogenic effector state, Nature. (2021) 592.\u003c/li\u003e\n\u003cli\u003eMakowski L., Chaib M., Rathmell J., Immunometabolism: From basic mechanisms to translation, Immunological reviews. (2020) 295:5-14.\u003c/li\u003e\n\u003cli\u003eHou Q., Ye L., Liu H., Huang L., Yang Q., Turner J., Yu Q., Lactobacillus accelerates ISCs regeneration to protect the integrity of intestinal mucosa through activation of STAT3 signaling pathway induced by LPLs secretion of IL-22, Cell death and differentiation. (2018) 25:1657-1670.\u003c/li\u003e\n\u003cli\u003eZenewicz L., Yancopoulos G., Valenzuela D., Murphy A., Stevens S., Flavell R., Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease, Immunity. (2008) 29:947-957.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"STM, LGG, ILC3, IL-22, DCs","lastPublishedDoi":"10.21203/rs.3.rs-4230746/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4230746/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e is a foodborne pathogen that causes disruption of intestinal mucosal immunity, leading to acute gastroenteritis in the host. In this study, it was discovered that infection with \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e (\u003cem\u003eSTM\u003c/em\u003e) results in a significant decrease in the abundance of \u003cem\u003eLacticaseibacillus\u003c/em\u003e in the intestines of mice, while the secretion of IL-22 by ILC3 is significantly increased. Feeding \u003cem\u003eLacticaseibacillus rhamnosus GG\u003c/em\u003e (\u003cem\u003eLGG\u003c/em\u003e) effectively alleviated the infection of \u003cem\u003eSTM\u003c/em\u003e in the mouse intestines. Experiments using TLR2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice revealed that TLR2-expressing dendritic cells (DCs) are crucial for \u003cem\u003eLGG\u003c/em\u003e's activation of ILC3. Subsequent in vitro experiments showed that heat-killed \u003cem\u003eLGG\u003c/em\u003e (HK\u003cem\u003e-LGG\u003c/em\u003e) could promote DCs to secrete IL-23, which in turn further promotes the activation of ILC3 and the secretion of IL-22. Finally, organoid experiments further verified that IL-22 secreted by ILC3 can enhance the intestinal mucosal immune barrier and inhibit STM infection. This study demonstrates that oral administration of \u003cem\u003eLGG\u003c/em\u003e is a potential method for preventing \u003cem\u003eSTM\u003c/em\u003e infection, providing a theoretical basis for the development of new intestinal health modulating products and treatment strategies.\u003c/p\u003e","manuscriptTitle":"LGG Promotes Activation of Intestinal ILC3 through TLR2 Receptor and Inhibits Salmonella Infection in Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-26 09:34:51","doi":"10.21203/rs.3.rs-4230746/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-07-02T21:39:01+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-11T05:08:01+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"BMC Veterinary Research","date":"2024-04-15T08:05:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2024-04-15T03:36:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-09T06:28:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a1b48a9-04d6-4bbb-a045-0ae23dfdf4b0","owner":[],"postedDate":"June 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-26T09:34:52+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-26 09:34:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4230746","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4230746","identity":"rs-4230746","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

References (1)

Source provenance

crossref
last seen: 2026-06-21T06:39:43.266271+00:00
europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0