Immunomodulatory Transcription Factor BATF2 regulates the Interferon Stimulated Genes Expression during Influenza A virus Infection

Immunomodulatory Transcription Factor BATF2 regulates the Interferon Stimulated Genes Expression during Influenza A virus Infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immunomodulatory Transcription Factor BATF2 regulates the Interferon Stimulated Genes Expression during Influenza A virus Infection Mohsan Ullah Goraya, Nelam Sajjad, Jamal Muhammad Khan, Aftab Ullah, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6721231/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The basic leucine zipper ATF-like transcription factor 2 (BATF2) is involved in regulating immune, inflammatory, and antitumor responses. However, its role in viral infections, particularly influenza virus, remains poorly understood. This study delves into the influence of BATF2 expression on influenza virus replication and the innate immune response in pulmonary epithelial cells. Using interfered BATF2 expression in cells, we observed restriction in influenza A virus replication, accompanied by an increase in the expression of interferon-stimulated genes (ISGs), whereas the transcription factor Blimp-1 expression was decreased. Conversely, overexpression of BATF2 in A549 cells supported influenza virus replication and suppressed the expression of ISGs and pro-inflammatory cytokines. Notably, BATF2 overexpression was correlated with elevated expression of Blimp-1. These findings collectively suggest that BATF2 plays a role in modulating the innate immune response during influenza virus infection, influencing viral replication. The balanced expression of BATF2 helps regulate cytokine expression and cellular responses, thereby preventing excessive inflammation and cytokine storms. Our study provides insights into the intricate interplay between BATF2, innate immune responses, and viral infection. Understanding the precise mechanisms through which BATF2 regulates immune responses and along with Blimp-1 helps to initiate the cellular immune response during viral infections may have implications for the development of therapeutic strategies. Further investigations are warranted to elucidate the detailed functions of BATF2 in viral infections and explore its potential as a therapeutic target. BATF2 Immunoregulation Transcription factor antiviral cytokines interferons innate immunity influenza virus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Regular global outbreaks of viral diseases caused by novel or mutated viruses that can spread rapidly from person to person posed enormous threats to health and social disruption. Viral pandemics in modern history include the 1918 influenza pandemic, the HIV/AIDS pandemic, and the recent COVID-19 pandemic. The pandemics underscore the need for efficient readiness, surveillance, and response measures to prevent and mitigate their impact. Amongst these viral pandemics, respiratory viral infections stand out as the most significant, with the 1918 pandemic ranking among the most severe of these serious outbreaks. Influenza A viruses (IAVs) cause highly contagious respiratory disease in humans, with their pandemics being associated with higher mortality rates. IAV belong to the Orthomyxoviridae family. Notably, IAV pose a substantial risk of zoonotic infection and host switching (Shao et al., 2017 ) Additionally, they have been identified as harboring concerning mutations that could potentially lead to the emergence of a zoonotic pandemic (European Food Safety Authority et al., 2023 ). Annual epidemics occur due to evolution of IAV's through self-mutation and re-assortment mechanisms. IAVs can infect humans and other diverse creatures including pigs, horses, dogs, marine mammals, and birds (Shao et al., 2017 ). The genome of IAV consists of eight segments of negative-sense single-stranded RNA, encased by the nucleoprotein (NP). Up to the present time, influenza viruses have been found to code for a total of 17 viral proteins (Chen et al., 2018 ). Following infection with the influenza virus, pathogen recognition receptors (PRRs) within cells are activated, prompting the host to initiate the production of interferon (IFN). This, in turn, leads to the subsequent activation of interferon-stimulated genes (ISGs) (Goraya et al., 2020 ), such as MxA, 2'-5' oligoadenylate synthase (OAS), protein kinase R (PKR) (Schneider et al., 2014 ), and IFITMS (Liao et al., 2019 ). During viral infection, host cells regulate the immune response, employing this as a key strategy to clear the infection, restrict cytokine storms, and regulate the inflammatory process. Basic leucine zipper (bZIP) transcription factors are a group of DNA-binding proteins that contain a conserved domain called the bZIP domain. bZIP proteins are crucial transcriptional regulators found in all tissues and immune system cells. For example, FOS and JUN, two of the earliest bZIP proteins discovered, and form the heterodimer transcription factor known as activator protein 1 (AP-1) (Lee et al., 1987 ). Basic leucine zipper ATF-like transcription factors (BATF) are the subgroup of bZIP family and comprised of BATF, BATF2 and BATF3 (Guler et al., 2015 ). Unlike other bZIP transcription factors BATF and BATF3 lacking the transactivation domains, only contain a DNA-binding domain and a leucine zipper motif (Vinson et al., 1989 ). BATF can form heterodimers with JUN proteins, however due to lack of transactivation domain it is hypothesized that BATF are AP-1 competitive inhibitors (Su et al., 2008 ). A carboxyl-terminal domain, like FOS's, is present in BATF2, but its role is unclear. Subsequently, various complexes of the BATF family proteins with the JUN family proteins have been found to have unique roles in the differentiation of CD8 + dendritic cells (Hildner et al., 2008 ), T cells in addition to different transcriptional activator functions (Murphy et al., 2013 ). BATF2 is expressed in immune cells (dendritic cells, B cells, T cells, and macrophages) and originally identified as AP-1 inhibitor via its dimerization with c-JUN in cancer cells (Su et al., 2008 ;Roy et al., 2015 ). BATF2 has been shown to induce inflammatory responses in IFN-γ and LPS-activated macrophage in association with Irf1 (Roy et al., 2015 ), also reported to have heterodimeric binding with JUNB, Irf4 and Irf8 (Chang et al., 2018 ). Previous studies demonstrated that BATF2 act as antitumor and immune-regulatory transcription factor (Murphy et al., 2013 ;Kanemaru et al., 2017 ;Zsurka et al., 2023 ). An early study of Batf2 knockdown macrophages induced by IFN-γ, revealed important roles of BATF2 in immune-regulation, inflammatory responses and host-protective genes against mycobacterium (Roy et al., 2015 ). Batf2 −/− mice infected with Trypanosoma cruzi showed that BATF2 act as a negative regulator for Th17 immunopathology by suppressing IL-23a. Further, T. cruzi infected Batf2 −/− exhibited multiorgan tissue damage and reduced burden of parasite due to reduced suppression of IL-23a/Th17 mediated immunopathology (Kitada et al., 2017 ). In a different study, spontaneous colitis in Batf2 −/− mice was also accompanied by increased IL-23 levels (Kayama et al., 2019 ). A study focusing the BATF2 role in infectious diseases demonstrated that BATF2 act as an immune-regulator rather than just an immune-suppressor. Batf2 −/− mice infected with Mycobacterium tuberculosis , and Listeria monocytogenes showed reduced bacterial burden, tissue inflammation, pulmonary histopathology, and survived in acute infection. While, Batf2 −/− mice failed to restrict immunopathogenesis and intestinal fibro-granulomatous inflammation during Schistosoma mansoni infection (Guler et al., 2019 ). Notably, BATF2 is interferon stimulated gene and was up-regulated in all above mentioned infections and also up-regulated during infection with feline infectious peritonitis virus (Shuid et al., 2015 ), SARS-CoV2 (Blanco-Melo et al., 2020 ), and IAV (Zhou et al., 2021 ). These observations imply that induction of Batf2 differentially regulates immunological response pathways via a feedback mechanism after being exposed to disease-causing organisms. Increased expression of BATF2 has been observed in human cells following infection with IAV. However, there is no study conducted to explain the effect of BATF2 expression on influenza virus infection. This is the first study to report the effect of BATF2 expression on the replication of influenza virus and innate immune response in pulmonary epithelial cells. We tried to unveil the regulatory role of BATF2 on the expression of different immune response and its effect on IAV replication. We have found that loss of BAFT2 expression led to high expression of cytokines which restrict the IAV replication by up-regulating innate immunity. While, BATF2 expression regulates the expression of different ISGs to limit the hyper inflammatory response during viral infection. Further, detailed studies of BATF2 effect on the regulation of genes related to apoptosis, autophagy, understanding its impact on immune cell differentiation and cytokine production might offer insights into managing these conditions. 2. Materials and Methods 2.1. Antibodies and Reagents The primary antibodies used in this study including BATF2 (ProteinTech, #16592-1-AP), Blimp-1 (C14A4 #9115, Cell Signaling Technology, USA), and anti-β-actin (Transgen Biotechnology, HC201). A monoclonal antibody against the NP protein of WSN influenza virus was produced in our laboratory using the method as described previously (Yang et al., 2008 ). IFNβ (Sinobiologicals, Beijing), Vigofact was obtained from Vigorous Labs (Vigorous Biotechnology Beijing Co. Ltd). 2.2. Cell Culture and Virus Infection The cell lines used in the present study include 293T, A549, and MDCK cells (American Type Culture Collection, Manassas, VA, USA) and cells were maintained in culture media (Dulbecco’s modified Eagle medium, DMEM) containing 10% fetal calf serum (FCS), supplemented with penicillin (100U/mL) and streptomycin (100µg/ml). For differential expression of host cellular response, we infected 293T cells with influenza A/WSN/33 virus strain maintained in our laboratory and sent for RNA sequencing. Virus was added into cells at the indicated multiplicity of infection (MOI) according to our previous published study (Zhang et al., 2020 ). After viral adsorption cells were cultured for 1hr at 37°C, later cells were washed with phosphate-buffered saline (PBS) and then cultured in DMEM containing trypsin 2µg/ml (TPCK treated) for 12h. 2.3. Differential Expression of Selected Genes in Response to Influenza A Virus The total mRNA was extracted from the 293T cells control or infected with influenza A/WSN/33 virus for 12h by TRIzol reagent (Invitrogen) and the mRNA samples were sent to Shanghai OE-Biotech Ltd. for microarray analysis. According to the microarray data, cDNA libraries were constructed to confirm the expression levels of the selected genes by PCR and qPCR. Specific primers for RT-PCR and qRT-PCR were designed using Primer 5 software (Table 1 ). The heat map generated from the data of differential gene expression analysis. To ensure reproducibility, all experiments were conducted with three independent replicates. As in our previous study, 293T cells were used for initial screening due to their ease of transfection and high reproducibility in gene expression assays (Liao et al., 2019 ). While not derived from pulmonary tissue, they provided a practical model for identifying differentially expressed genes in response to influenza A virus infection, which were then validated in more relevant pulmonary epithelial cell models to explore BATF2’s role in the innate immune response. Table 1 List of primers used in this study Primer name Primer sequence (5’-3’) WSN-NP F TCAAACGTGGGATCAATG WSN-NP R GTGCAGACCGTGCTAAAA RSG1 F TTCTCCTTCACTGACCGTGC RSG1 R AGGCCATTGAGTATGTGGGC human GBP1F AGCCCTACAACTTCGGAACAG human GBP1R TCTGGATTCGCCATCAGTCG human BATF2 F GGGAATTTGCAGCACGAGTC human BATF2 R GAGCAGGAGGCACAATCCAT human BATF2 F GGGAGTTGTGCCATTTCAGG human BATF2 R AGAACACTTACTCTGGCCCTC human RSAD2-1 F CCCCAATGACAGGTTGCTCA human RSAD2-1 R GAGAGCTCAGAGGTTGCCTG human ATP6V0A4 F TCCATGTATCTCAGCACGCC human ATP6V0A4 R AATCAGAAGCATCCACGGCA Human ISG15 F AGCATCTTCACCGTCAGGTC Human ISG15 R GCGAACTCATCTTTGCCAGT human OASL1 F CCCTGAGGTCTATGTGAGC human OASL1 R GTGAAGCCTTCGTCCAAC human IL-6 F ACAAATTCGGTACATCCTCGAC human IL-6 R TGGCTTGTTCCTCACTACTCT Blimp-1 F GAAGCCAGACGGTTAACACA Blimp-1 R TGCTGGAGTTACACTTGGGG human Actin-F CTGTACGCCAACACAGTGCT human Actin-R GCTCAGGAGGAGCAATGATC Sh-BATF2 F GATCCGGCAAGAGAATAGGTGGTTTGCTTCCTGTCAGACAAACCACCTATTCTCTTGCCTTTTTG Sh-BATF2 R AATTCAAAAAGGCAAGAGAATAGGTGGTTTGTCTGACAGGAAGCAAACCACCTATTCTCTTGCCG OExp BATF2 F CGGAATTCATGGATTGTGCCTCCTGCTC OExp BATF2 R GCGTCGACGAAGTGGACTTGAGCAGAGG 2.4. sh-RNA-Based BATF2 Knockdown A549 Cell Line For further experiments A549 cell line was used as this cell line is best to study the influenza virus infections. To interfere with the endogenous expression of BATF2 at the transcript level for functional analysis during influenza virus infection, the primers were designed to amplify short hairpin RNA (sh-RNA)-based knockdown cell lines generated by infecting A549 cells with lentiviruses expressing specific sh-RNA in pSIH-H1-GFP vector as described previously (Wang et al., 2012 ;Chen et al., 2016 ). The sequences used in the sh-RNAs (NCBI accession No, NM_001300807) targeting specific genes were sh-RNA, 5’GCTCCTGTGGGCAAGAGAAT 3’, and 3’TATTCTCTTGCCCACAGGAGC 5’, and luciferase was used as a control. 2.5. Plasmids Construction and Gene Overexpression The full-length cDNA encoding human BATF2 was sub-cloned into the pNL-CMV vector with a Flag tag at the N-terminus to generate pNL-Flag-BATF2. The specific primers with restriction enzyme sites are shown in Table 1 . To establish the stable cell lines, HEK293T cells were seeded into a 10-cm cell culture dish in serum and antibiotic-free DMEM and were co-transfected with 8µg of pNL-BATF2 or pNL-EV (used as a control), pNL-package, and pNL-vsvG. After 5h, the transfection medium was replaced with DMEM supplemented with 5% FBS for additional 48h. The recombinant lentiviruses were harvested by collecting the supernatants from the transfected cells, and then A549 cells were transduced with the recombinant lentiviruses. The flag-tagged BATF2 over-expression in the recombinant lentivirus-transduced A549 cells was analyzed by western blot using anti-BATF2 monoclonal antibody (MAb) (dilution of 1:1500) as described in previous study (Zhang et al., 2020 ). All experiments were independently repeated three times to confirm the reproducibility of the findings. 2.6. Plaque Assay Plaque assay was performed to measure the viral replication in BATF2 knockdown or over expressing A549 cells. Briefly, supernatants from A549 cells infected with influenza A/WSN/33 virus were collected. MDCK cells cultured in-vitro were infected with the supernatants harvested from A/WSN/33 virus-infected A549 cells for 1hr. After the infection period over, PBS was used to wash the MDCK cells and then grown in α-minimal essential medium containing 1.5% low-melting-point agarose gel (Promega, Madison, WI) and TPCK (tolylsulfonyl phenylalanyl chloromethyl ketone) treated with trypsin (Sigma-Aldrich, St. Louis, MO). Subsequently MDCK cells were incubated for 72h, the numbers of plaques were counted (Wang et al., 2014 ). Each experiment was repeated three times to validate the reproducibility of the results. 2.7. RT-PCR and qRT-PCR Total RNA was isolated from A549 cells infected with influenza A/WSN/33 virus by Trizol method (TransGen Biotech, Beijing Co., Ltd) according to the manufacturer’s instructions at indicated time points. Isolated RNA (4µg) was reverse-transcribed into cDNA libraries by using M-MLV Reverse Transcriptase (Promega, United States) according to the manufacturer’s instructions with slight modifications. The cDNA was used for expression analysis by PCR, qRT-PCR using TransStart Green qPCR SuperMix 2X (TransGen Biotech), and PCR using Taq DNA polymerase (Takara Bio) as previously described (Goraya et al., 2015 ;Chen et al., 2017 ;Zhang et al., 2020 ). The amplified products by PCR were resolved by electrophoresis on a 1% agarose gel, and the intensity of bands was analyzed using Quantity One software (Bio-Rad, United States) as previously described (Chen et al., 2015 ). The primers specific for WSN-NP, BTAF2, ISG15, OASL1, IL-6, Blimp-1 and β-actin (the reference housekeeping gene for internal standardization) were designed using the Primer 5 software (Table 1 ). The data of qRT-PCR analysis was shown as normalized ratios, which was auto-calculated by LightCycler system (Roche, Switzerland) using ΔΔC T method. All experiments were performed in triplicate to ensure reproducibility of the results. 2.8. Western Blotting Cell lysates were prepared to collect the total protein, and western blot was performed as previously described (Danial et al., 1995 ). Briefly, the protein samples were separated by 12% SDS-polyacrylamide gel electrophoresis and then transferred onto nitrocellulose membranes. The membranes were probed with the antibodies at the appropriate dilution (BATF2, 1:1500; Blimp 1:1000 skimmed milk/TBST). β-actin was used as a protein control (1:5000 skimmed milk/TBST) 2.9. Quantification and statistical analysis All statistical analyses were performed using Microsoft excel and R software. Student’s t tests were used to determine the p values. A p value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). The results were shown as mean ± standard error. 2.9. Ethics Statement The animal protocol used in this study was approved by the Research Ethics Committee of Huaqiao University, School of Medicine, Quanzhou (A2024031). The procedures carried out in accordance with the approved guidelines. 3. Results 3.1. Cellular Gene Expression Following the Infection with Influenza A Virus Using total RNA isolated from A549 cells infected with influenza A/WSN/33 virus, microarray analysis was used to determine the expression of genes involved in the innate immune response. Differential expression of several genes involved in the immune response was observed between WSN virus-infected A549 cells and the control group. A p value less than 0.05 and a log2 fold change greater than 1 were used as thresholds for this differential expression. A heat map depicting the relative expression levels of the selected genes shown in Fig. 1 A. Validation RT-PCR and qRT-PCR experiments were performed on a subset of genes, including actin, RSG1, GBP1, BATF2, BATF2, RASD2 andATP6V0A4 (Fig. 1 B, D), to verify the microarray data. Both the microarray and PCR results for analyzing the expression changes in selected genes were consistent with one another. To determine the expression of BATF2 in response to influenza virus infection, we infected the human A549 cells with influenza A/WSN/33 virus and analyzed the gene expression of BATF2 in A549 cells. The goal of using the A549 cells in further experiments was to learn how influenza A/WSN/33 virus affects BATF2 expression in lung epithelial cells. The expression of BATF2 in A549 cells rose to the maximal level at 24h post-infection (Fig. 1 C). 3.2. Establishment of BATF2 Knockdown Cells We stimulated the A549 cells with IFNβ and infected the IFNAR knockout A549 cells with the influenza A/WSN/33 virus for a period of 12h so that we could determine whether or not the expression of BATF2 is dependent on IFNβ. Later total mRNA was collected from the stimulated and infected cells. The results of the qRT-PCR experiment showed that stimulation with IFNβ led to increased expression of BATF2 in cells that had been treated with IFNβ, in comparison to the cells that served as controls. In comparison to the A549 cells, the expression of BATF2 was lower in the IFNAR knockout A549 cells that were infected with the A/WSN/33 virus. According to these findings, the level of expression of BATF2 is dependent on the stimulation of IFNβ (Fig. 1 E, F). Furthermore, to determine the function of BATF2 in innate immune signaling, we generated stable A549 cell lines expressing specific sh-RNAs targeting BATF2 or luciferase control. The competent cells were observed under fluorescent microscope to detect the expression of GFPs (Figure S1 A), and RT-PCR was performed to confirm the silencing of BATF2 expression (Figure S1 B). The sh-RNA treated cells infected with influenza A/WSN/33 virus, and the RNA extracts were harvested at the indicated time (0, 12, and 24 hpi). The interference efficiency of sh-RNA was examined by qRT-PCR (Fig. 2 A). Compared with the control sh-RNA targeting luciferase, the specific sh-BATF2 caused a significant decrease in the expression of BATF2 after influenza A/WSN/33 virus infection. The BATF2 knockdown A549 cells showed a significant lower expression of BATF2 even in response to IFNβ stimulation and poly (I: C) treatment (Fig. 2 B, C). The lower expression of BATF2 had a negative effect on the replication of influenza virus especially at 24h. The qRT-PCR and plaque assay results showed limited replication of influenza virus (Fig. 2 D, E). Protein expression of BATF2 was also analyzed via western blotting by isolating the proteins from non-infected and infected with influenza A/WSN/33 virus A549 cells (Fig. 2 F). As BATF2 plays a regulatory role for inflammatory responses during infection so we further check the different cytokine expression in this study. 3.3. Silencing of BATF2 restricted the Replication of Influenza A Virus Results as presented above revealed that IAV infection could induce the expression of BATF2. For further investigations of the antiviral function of BATF2, we infected the BATF2 knockdown A549 cells with influenza A/WSN/33 virus, which activates the pathogen recognition receptors such as RIG-I and TLRs to induce interferon-mediated innate signaling (Kato et al., 2006 ;Pichlmair et al., 2006 ). After virus infection, total mRNA and proteins were collected from the BATF2 knockdown and luciferase control A549 cells at the indicated time points (0, 12, and 24 h hpi). The qRT-PCR was performed to analyze the replication of IAV in BATF2 knockdown cells. Interestingly, qRT-PCR results showed reduced replication of WSN virus in sh-BATF2 treated A549 cells than in sh-Luc treated cells (Fig. 2 D). Nucleoprotein (NP) was considered to measure the replication of influenza A virus. Silencing of endogenous BATF2 resulted in a significant decrease of viral replication, as evidenced by low viral load in culture supernatants of BATF2 knockdown A549 cells compared to supernatants of luciferase control cells. The plaque assay showed a lower number of plaques forming units of WSN in sh-BATF2 treated A549 cells as compared to the luciferase control (Fig. 2 E). To confirm the aforementioned results, total protein extracts were collected from the control and BATF2 knockdown A549 cells for western blot analysis. NP protein expression was found to be decreased in BATF2 knockdown cells compared to the control (Fig. 2 F). Therefore, BATF2 knockdown in A549 cells restricts the replication of influenza A virus compared to the luciferase control. 3.4. Knockdown of BATF2 leads to ISGs signatures To explore the contribution of BATF2 to innate immune signaling, the expression of endogenous BATF2 was knockdown by sh-RNA in A549 cells. We collected the total RNA from A549 BATF2 knockdown and sh-Luc cells infected with WSN virus at the indicated time points to perform qRT-PCR and RT-PCR for the expression of selected ISGs. Our results showed that the ISG15, OASL1, and IL-6 expression was significantly increased in BATF2 knockdown cells (Fig. 3 A,B,C), whereas expression of a transcriptional repressor Blimp-1 was significantly reduced in BTAF2 knockdown cells (Fig. 3 D). In addition, western blot results showed that the protein expression levels of Blimp-1 were also significantly reduced in BATF2 knockdown cells (Fig. 3 F). Interestingly, silencing of endogenous BATF2 restricted the replication of influenza A virus and caused increased expression of ISGs including the ISG15, OASL1 and IL-6 in A549 BATF2 knockdown cells during infection which resulted in limited replication of IAV. We also investigated the expression of effector differentiation transcriptional regulators Blimp-1. Previous study has reported that BATF2 promotes effector differentiation transcriptional regulators Blimp-1 (Kurachi et al., 2014 ) and BATF2 −/− mice showed reduced expression of Blimp-1 (Xin et al., 2015 ). Furthermore, we examined the expression levels of selected ISGs via RT-PCR which were consistent with qRT-PCR (Fig. 3 E). 3.5. Overexpression of BATF2 perturbs the ISGs expression Since silencing of BATF2 can increase cytokine expression against IAV infection, we further investigated whether forced expression of BATF2 could affect IAV replication. Thus, A549 cells were transiently transfected with the construct expressing BATF2 or with an empty vector and challenged with the influenza A/WSN/33 virus. The RT-PCR and qRT-PCR results showed that BATF2 was successfully overexpressed in A549 cells treated with pNL-BATF2 (Fig. 4 A, Figure S1 C), and the exogenous expression of BATF2 supported influenza A virus replication (Fig. 4 B). Furthermore, virus titers in cell culture supernatants were determined by plaque assay, and western blotting was performed to detect the protein expression of BTAF2 and viral NP. The results of the plaque assay and western blotting showed that the overexpression of BATF2 in A549 cells significantly supported the replication of IAV (Fig. 4 C,D). Previous studies showed that BATF2 act as immunomodulator factor and also play role to regulate the inflammatory response in chronically infected cells. Therefore, we analyzed the effects of BATF2 overexpression on the expression of cytokines. We hypothesized that BATF2 can regulate the cytokine storm in acute infections. Our data showed that overexpression of BATF2 restricts the expression of antiviral proteins ISG15, OASL1 and pro inflammatory cytokine IL-6. qRT-PCR and RT-PCR results showed that the ISG15, OASL1 and IL-6 were significantly suppressed in BATF2 overexpressed A549 cells (Fig. 5 A,B,C). Additionally, we examined the effects of BATF2 on the expression levels of transcriptional repressor Blimp-1 using RT-PCR and qRT-PCR. BATF2 overexpressing cells, on the other hand, showed an elevation of the transcriptional repressor Blimp-1 (Fig. 5 D, E). In addition, we examined the Blimp-1 protein expression via western blot and results showed that the protein expression levels of Blimp-1 were also significantly positively regulated in BATF2 overexpressing cells (Fig. 5 F). The enhanced expression of Blimp-1 mRNA was positively correlated with BATF2 overexpression. These results show that BATF2 can act as potential proximal regulator of cytokines and inflammatory response in innate immune signaling. 4. Discussion In response to viral infection, host cell pathogen recognition receptors (PRRs) detect pathogen-associated molecular patterns (PAMPs) presented by invading viruses. Viral PAMPs primarily consists of nucleic acids derived from viral DNA or RNA genomes. Distributed across diverse cellular compartments, PRRs prompt the activation of transcription factors such as IRF3/7 and NF-kB upon virus recognition (Schneider et al., 2014 ). This activation cascade ultimately leads to the expression of interferon and various interferon stimulated genes (ISGs), which plays pivotal role in restricting the replication of invading viruses. Remarkably, the transcription factor-mediated innate immune responses are also provoked by influenza A virus (IAV) infection (Ehrhardt et al., 2010 ). Among the pivotal coordinators in this network the BATF2 immunomodulatory transcription factor has emerged as a critical regulator of immune responses, especially in the context of viral infection. To combat infection, the host must activate immune responses. The expression of BATF2 was upregulated upon WSN virus infection in A549 cells, implying its inducibility by influenza viruses. Previous studies have demonstrated the importance of Basic leucine zipper transcription factor ATF-like (BATF) in lymphocyte regulation and differentiation (Murphy et al., 2013 ). With its expression modulated by stimuli and infection, BATF2 plays a pivotal role in the regulation of inflammatory cytokines (Su et al., 2008 ;Tussiwand et al., 2012 ). The precise functions of BATF2 remain an active subject of research, as scientists continually uncover its roles in different biological contexts. In this study, we examined the activity of endogenous BATF2 as an immune modulator against IAV replication in A549 cells. Silencing endogenous BATF2 in A549 cells resulted in restricted influenza A virus replication (Fig. 2 D, E). Conversely, upregulating BATF2 in A549 cells led to enhanced viral replication (Fig. 4 C). Previous knowledge identified BATF2 as an inhibitor of IL-23, a pro inflammatory cytokine (Kitada et al., 2017 ). The assembly of RIG-I and MDA5 activates downstream IRFs and other transcription factors to induce genes encoding IFNα/β and ISGs (Johnson and Gale, 2006 ). In epilepsy patients, loss of BATF2 correlates with upregulated ISGs, including ISG15, IFI27, IFIT1, and RSAD2 (Zsurka et al., 2023 ). In our study, BATF2 knockdown cells infected with WSN displayed increased expression levels of ISG15, OASL1, and IL-6 (Fig. 3 A, B, C). These findings hint at BATF2's infection-based functions. We propose that BATF2 play roles as both an inflammatory modulator and an immune response regulator during viral infection, potentially mitigating cytokine storms. Considering the high expression of ISGs, viral mRNA, and protein were significantly decreased in BATF2 knockdown cells compared to luciferase cells (Fig. 2 F). Conversely, ectopic BATF2 expression suppressed the mRNA expression of ISG15, OASL1 and IL-6 (Fig. 5 A, B, C). Previous research has also highlighted BATF2 complex role as an immune-regulator and immune-suppressor. For instance, Batf2 −/− mice exhibited low bacterial load, reduced tissue inflammation, pulmonary histopathology, and improved survival during acute infection with Mycobacterium tuberculosis and Listeria monocytogenes . Batf2 −/− mice failed to limit immunopathogenesis and intestinal fibro-granulomatous inflammation during Schistosoma mansoni infection (Guler et al., 2019 ). In this light, our findings suggest that BATF2's intrinsic expression during influenza virus infection governs antiviral ISG15 expression, thereby inhibiting viral replication. Moreover, BATF2 may influence inflammatory responses through its effect on IL-6, possibly suggesting at its involvement in inflammation and cytokine storm during viral infections. Although the current study establishes a foundational link between BATF2 expression and immune modulation during Influenza A infection, further functional assays, including targeted knockdowns or pharmacological inhibition of ISG15 and IL-6, are needed to fully elucidate the mechanistic role of BATF2. Future studies will be crucial to strengthen the causal relationship and explore its potential as a therapeutic target. Furthermore, BATF2 play two important regulatory functions. First, it directly upregulates essential TFs like T-bet, Runx3, and Blimp-1, as along with cytokine receptors that sense inflammation and reinforce effector differentiation. Second, BATF binds and represses downstream effector molecules like IFN-γ, perforin and granzyme B (Kurachi et al., 2014 ). Blimp-1, a key regulator of immune cell differentiation and B cells maturation for antibody responses, exhibited reduced expression in BATF2 knockdown cells during influenza virus infection (Fig. 3 D, F). The cooperative role of IRF4 in BATF2-mediated Blimp-1 regulation is evident (Xin et al., 2015 ). Loss of BATF2 disrupts the expression of several transcription factors, including Blimp-1. Suppression of Blimp-1 can, in turn, reduce the expression of cytokine-regulatory genes, potentially leading to excessive cytokine production (Kurachi et al., 2014 ). The absence of BATF2 might also delay cellular responses triggered by Blimp-1. Interestingly, the overexpression of BATF2 led to a suppressed antiviral response, suggesting that sustained infection-based BATF2 expression orchestrates a balanced innate immune response by modulating cytokines and initiating cellular immunity via Blimp-1 expression (Fig. 5 D, F). Although the role of BATF2 and IRFs in stimulating immune cells has been suggested in previous studies, our findings highlight the potential for BATF2 to also influence innate immune responses and inflammation during viral infections. This study offers preliminary insights into the complex interplay between BATF2, innate immunity, and inflammation. Further exploration of BATF2's role in viral infections promises deeper insights into its underlying mechanisms and potential therapeutic applications. Collectively, our study suggests a potential role of BATF2 as a regulator of immune responses and inflammation during influenza A virus infection. By modulating the expression of antiviral genes and cytokines, BATF2 may contributes to the delicate equilibrium required for an effective immune response, preventing excessive inflammation through IL-6 and cytokine. However, our study provides preliminary insights into the role of BATF2 in regulating immune responses during influenza infection. Further in-vivo studies using human-relevant influenza virus strains are essential to fully elucidate BATF2’s functions, particularly its role in regulating cytokine expression and modulating immune responses. These investigations could uncover new therapeutic strategies to optimize immune responses during viral infections, potentially preventing excessive inflammation and enhancing antiviral defenses. Declarations Ethics approval and consent to participate: This study was conducted in accordance with the Huaqiao University Quanzhou Guidelines, and Ethics Committee of School of Medicine (Approval Number: (A2024031). All experimental protocols involving animal models were reviewed and approved by the relevant institutional ethics committee. All methods were carried out in accordance with relevant guidelines and regulations. Consent for publication: NA Availability of data and materials: All data is included in the manuscript. Conflicts of Interest: The authors declare no conflict of interest. Funding: NA Author Contributions: Conceptualization, Funding acquisition, and Methodology was designed by Mohsan Ullah Goraya; Formal analysis, Methodology and revisions done by Nelam Sajjad; Writing – original draft, Mohsan Ullah Goraya and Jamal Muhammad Khan, review and preliminary experiments by Aftab Ullah, Overall supervision, revision and guidance by Diao Yong. Acknowledgement: All authors confirm that the following manuscript is a transparent and honest account of the reported research. This research is related to a previous study by the same author Mohsan Ullah Goraya. The previous study was performed on Zinc Finger CCCH-Type Antiviral Protein 1 and the current submission is focusing on BATF2. The study is following the methodology explained in previous study published in Frontiers in Microbiology (Zhang et al., 2020).” This work was supported by the Scientific Research Funds of Huaqiao University, Quanzhou, Fujian, China. References Blanco-Melo, D., Nilsson-Payant, B.E., Liu, W.C., Uhl, S., Hoagland, D., Møller, R., Jordan, T.X., Oishi, K., Panis, M., Sachs, D., Wang, T.T., Schwartz, R.E., Lim, J.K., Albrecht, R.A., and Tenoever, B.R. (2020). Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell 181 , 1036-1045.e1039. Chang, Y.K., Zuo, Z., and Stormo, G.D. (2018). Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq. BMC Molecular Biology 19 , 5. Chen, S., Luo, G., Yang, Z., Lin, S., Chen, S., Wang, S., Goraya, M.U., Chi, X., Zeng, X., and Chen, J.-L. (2016). Avian Tembusu virus infection effectively triggers host innate immune response through MDA5 and TLR3-dependent signaling pathways. Veterinary Research 47 , 74. Chen, S., Wang, L., Chen, J., Zhang, L., Wang, S., Goraya, M.U., Chi, X., Na, Y., Shao, W., Yang, Z., Zeng, X., Chen, S., and Chen, J.L. (2017). Avian Interferon-Inducible Transmembrane Protein Family Effectively Restricts Avian Tembusu Virus Infection. Front Microbiol 8 , 672. Chen, X., Liu, S., Goraya, M.U., Maarouf, M., Huang, S., and Chen, J.-L. (2018). Host Immune Response to Influenza A Virus Infection. Frontiers in Immunology 9. Chen, Z., Luo, G., Wang, Q., Wang, S., Chi, X., Huang, Y., Wei, H., Wu, B., Huang, S., and Chen, J.-L. (2015). Muscovy duck reovirus infection rapidly activates host innate immune signaling and induces an effective antiviral immune response involving critical interferons. Veterinary microbiology 175 , 232-243. Danial, N., Pernis, A., and Rothman, P. (1995). Jak-STAT signaling induced by the v-abl oncogene. Science 269 , 1875-1877. Ehrhardt, C., Seyer, R., Hrincius, E.R., Eierhoff, T., Wolff, T., and Ludwig, S. (2010). Interplay between influenza A virus and the innate immune signaling. Microbes Infect 12 , 81-87. European Food Safety Authority, E.C.F.D.P., Control, E.U.R.L.F.a.I., Adlhoch, C., Fusaro, A., Gonzales, J.L., Kuiken, T., Marangon, S., Niqueux, É., Staubach, C., Terregino, C., Aznar, I., Guajardo, I.M., and Baldinelli, F. (2023). Avian influenza overview September – December 2022. EFSA Journal 21 , e07786. Goraya, M.U., Abbas, M., Ashraf, M., and Munir, M. (2015). Isolation of buffalo poxvirus from clinical case and variations in the genetics of the B5R gene over fifty passages. Virus genes 51 , 45-50. Goraya, M.U., Zaighum, F., Sajjad, N., Anjum, F.R., Sakhawat, I., and Rahman, S.U. (2020). Web of interferon stimulated antiviral factors to control the influenza A viruses replication. Microbial Pathogenesis 139 , 103919. Guler, R., Mpotje, T., Ozturk, M., Nono, J.K., Parihar, S.P., Chia, J.E., Abdel Aziz, N., Hlaka, L., Kumar, S., Roy, S., Penn-Nicholson, A., Hanekom, W.A., Zak, D.E., Scriba, T.J., Suzuki, H., and Brombacher, F. (2019). Batf2 differentially regulates tissue immunopathology in Type 1 and Type 2 diseases. Mucosal Immunology 12 , 390-402. Guler, R., Roy, S., Suzuki, H., and Brombacher, F. (2015). Targeting Batf2 for infectious diseases and cancer. Oncotarget 6 , 26575-26582. Hildner, K., Edelson, B.T., Purtha, W.E., Diamond, M., Matsushita, H., Kohyama, M., Calderon, B., Schraml, B.U., Unanue, E.R., Diamond, M.S., Schreiber, R.D., Murphy, T.L., and Murphy, K.M. (2008). Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science 322 , 1097-1100. Johnson, C.L., and Gale, M., Jr. (2006). CARD games between virus and host get a new player. Trends Immunol 27 , 1-4. Kanemaru, H., Yamane, F., Fukushima, K., Matsuki, T., Kawasaki, T., Ebina, I., Kuniyoshi, K., Tanaka, H., Maruyama, K., Maeda, K., Satoh, T., and Akira, S. (2017). Antitumor effect of Batf2 through IL-12 p40 up-regulation in tumor-associated macrophages. Proceedings of the National Academy of Sciences 114 , E7331-E7340. Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis E Sousa, C., Matsuura, Y., Fujita, T., and Akira, S. (2006). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441 , 101-105. Kayama, H., Tani, H., Kitada, S., Opasawatchai, A., Okumura, R., Motooka, D., Nakamura, S., and Takeda, K. (2019). BATF2 prevents T-cell-mediated intestinal inflammation through regulation of the IL-23/IL-17 pathway. International Immunology 31 , 371-383. Kitada, S., Kayama, H., Okuzaki, D., Koga, R., Kobayashi, M., Arima, Y., Kumanogoh, A., Murakami, M., Ikawa, M., and Takeda, K. (2017). BATF2 inhibits immunopathological Th17 responses by suppressing Il23a expression during Trypanosoma cruzi infection. J Exp Med 214 , 1313-1331. Kurachi, M., Barnitz, R.A., Yosef, N., Odorizzi, P.M., Diiorio, M.A., Lemieux, M.E., Yates, K., Godec, J., Klatt, M.G., Regev, A., Wherry, E.J., and Haining, W.N. (2014). The transcription factor BATF operates as an essential differentiation checkpoint in early effector CD8+ T cells. Nat Immunol 15 , 373-383. Lee, W., Mitchell, P., and Tjian, R. (1987). Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49 , 741-752. Liao, Y., Goraya, M.U., Yuan, X., Zhang, B., Chiu, S.-H., and Chen, J.-L. (2019). Functional Involvement of Interferon-Inducible Transmembrane Proteins in Antiviral Immunity. Frontiers in Microbiology 10. Murphy, T.L., Tussiwand, R., and Murphy, K.M. (2013). Specificity through cooperation: BATF–IRF interactions control immune-regulatory networks. Nature Reviews Immunology 13 , 499-509. Pichlmair, A., Schulz, O., Tan, C.P., Naslund, T.I., Liljestrom, P., Weber, F., and Reis E Sousa, C. (2006). RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 314 , 997-1001. Roy, S., Guler, R., Parihar, S.P., Schmeier, S., Kaczkowski, B., Nishimura, H., Shin, J.W., Negishi, Y., Ozturk, M., Hurdayal, R., Kubosaki, A., Kimura, Y., De Hoon, M.J., Hayashizaki, Y., Brombacher, F., and Suzuki, H. (2015). Batf2/Irf1 induces inflammatory responses in classically activated macrophages, lipopolysaccharides, and mycobacterial infection. J Immunol 194 , 6035-6044. Schneider, W.M., Chevillotte, M.D., and Rice, C.M. (2014). Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol 32 , 513-545. Shao, W., Li, X., Goraya, M.U., Wang, S., and Chen, J.-L. 2017. Evolution of Influenza A Virus by Mutation and Re-Assortment. International Journal of Molecular Sciences [Online], 18. Shuid, A.N., Safi, N., Haghani, A., Mehrbod, P., Haron, M.S., Tan, S.W., and Omar, A.R. (2015). Apoptosis transcriptional mechanism of feline infectious peritonitis virus infected cells. Apoptosis 20 , 1457-1470. Su, Z.-Z., Lee, S.-G., Emdad, L., Lebdeva, I.V., Gupta, P., Valerie, K., Sarkar, D., and Fisher, P.B. (2008). Cloning and characterization of SARI (suppressor of AP-1, regulated by IFN). Proceedings of the National Academy of Sciences 105 , 20906-20911. Tussiwand, R., Lee, W.L., Murphy, T.L., Mashayekhi, M., Kc, W., Albring, J.C., Satpathy, A.T., Rotondo, J.A., Edelson, B.T., Kretzer, N.M., Wu, X., Weiss, L.A., Glasmacher, E., Li, P., Liao, W., Behnke, M., Lam, S.S., Aurthur, C.T., Leonard, W.J., Singh, H., Stallings, C.L., Sibley, L.D., Schreiber, R.D., and Murphy, K.M. (2012). Compensatory dendritic cell development mediated by BATF-IRF interactions. Nature 490 , 502-507. Vinson, C.R., Sigler, P.B., and Mcknight, S.L. (1989). Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246 , 911-916. Wang, S., Chi, X., Wei, H., Chen, Y., Chen, Z., Huang, S., and Chen, J.-L. (2014). Influenza A Virus-Induced Degradation of Eukaryotic Translation Initiation Factor 4B Contributes to Viral Replication by Suppressing IFITM3 Protein Expression. Journal of Virology 88 , 8375-8385. Wang, S., Li, H., Chen, Y., Wei, H., Gao, G.F., Liu, H., Huang, S., and Chen, J.-L. (2012). Transport of Influenza Virus Neuraminidase (NA) to Host Cell Surface Is Regulated by ARHGAP21 and Cdc42 Proteins. Journal of Biological Chemistry 287 , 9804-9816. Xin, G., Schauder, D.M., Lainez, B., Weinstein, J.S., Dai, Z., Chen, Y., Esplugues, E., Wen, R., Wang, D., Parish, I.A., Zajac, A.J., Craft, J., and Cui, W. (2015). A Critical Role of IL-21-Induced BATF in Sustaining CD8-T-Cell-Mediated Chronic Viral Control. Cell Rep 13 , 1118-1124. Yang, M., Berhane, Y., Salo, T., Li, M., Hole, K., and Clavijo, A. (2008). Development and application of monoclonal antibodies against avian influenza virus nucleoprotein. J Virol Methods 147 , 265-274. Zhang, B., Goraya, M.U., Chen, N., Xu, L., Hong, Y., Zhu, M., and Chen, J.-L. (2020). Zinc Finger CCCH-Type Antiviral Protein 1 Restricts the Viral Replication by Positively Regulating Type I Interferon Response. Frontiers in Microbiology 11. Zhou, A., Dong, X., Liu, M., and Tang, B. (2021). Comprehensive Transcriptomic Analysis Identifies Novel Antiviral Factors Against Influenza A Virus Infection. Frontiers in Immunology 12. Zsurka, G., Appel, M.L.T., Nastaly, M., Hallmann, K., Hansen, N., Nass, D., Baumgartner, T., Surges, R., Hartmann, G., Bartok, E., and Kunz, W.S. 2023. Loss of the Immunomodulatory Transcription Factor BATF2 in Humans Is Associated with a Neurological Phenotype. Cells [Online], 12. Additional Declarations No competing interests reported. Supplementary Files SuppleentaryFigure.tif Rawdata.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6721231","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":505310829,"identity":"6351fca3-420a-4b90-8cde-f0ff7919a8f6","order_by":0,"name":"Mohsan Ullah Goraya","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYFAD5sMHGBgbSNLClpZAspYcA+K0yLv3PvzMU8OQ2N/G803i5w4bOQb2w0c34NNieOa4sTTPMYbEGcd4t0n2nkkzZuBJS7uBV8uMNAZpHjaGxIb7vdskeNsOJzZI8JgR0sL8m+cfQ+L8YzzPJP8So0VeIo1NmreNIXHDMR4QgwgtBjzH2Czn9jEYbzzGZmwt25ZmzEbIL/Ltbcw33nxjkJ13jPnhzbdtNnL87IeP4bflAAMDEw/DfxCbRQJEsuFTDralgYGB8QeEzfyBkOpRMApGwSgYmQAAjHdIUrAFLwcAAAAASUVORK5CYII=","orcid":"","institution":"Huaqiao University Quanzhou Fujian","correspondingAuthor":true,"prefix":"","firstName":"Mohsan","middleName":"Ullah","lastName":"Goraya","suffix":""},{"id":505310830,"identity":"e333fe04-d099-41e5-8651-d40cde341a05","order_by":1,"name":"Nelam Sajjad","email":"","orcid":"","institution":"Fujian Agriculture and Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Nelam","middleName":"","lastName":"Sajjad","suffix":""},{"id":505310831,"identity":"fa5cf52f-1567-468f-8db7-bb95fe8d3e22","order_by":2,"name":"Jamal Muhammad Khan","email":"","orcid":"","institution":"Cholistan University of Veterinary and Animal Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jamal","middleName":"Muhammad","lastName":"Khan","suffix":""},{"id":505310833,"identity":"61e6d8e0-648a-435e-a959-ec7c53f100ad","order_by":3,"name":"Aftab Ullah","email":"","orcid":"","institution":"Huaqiao University Quanzhou Fujian","correspondingAuthor":false,"prefix":"","firstName":"Aftab","middleName":"","lastName":"Ullah","suffix":""},{"id":505310834,"identity":"a161e858-e220-4758-99df-6be72df616c1","order_by":4,"name":"Diao Yong","email":"","orcid":"","institution":"Huaqiao University Quanzhou Fujian","correspondingAuthor":false,"prefix":"","firstName":"Diao","middleName":"","lastName":"Yong","suffix":""}],"badges":[],"createdAt":"2025-05-22 05:08:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6721231/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6721231/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90033126,"identity":"f6d70395-5dd0-483e-a4d7-344a19ac8b62","added_by":"auto","created_at":"2025-08-27 15:27:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":181353,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferentially expressed genes in A549 cells infected with the influenza A/WSN/33 virus.\u003c/strong\u003e (A) Heat map showing microarray analysis of gene expression profile in A549 cells infected with mock and influenza A/WSN/33 virus for 12h. The identified genes were differentially expressed by ≥ 2-fold (n = 3) between mock and virus infection. (B, D) The expression data of the selected genes from using microarray analysis was confirmed by qRT-PCR and RT-PCR. (C) The expression level of BATF2 in influenza A/WSN/33 virus-infected A549 cells measured by qRT-PCR was expressed as fold change relative to the level at 0, 6, 12, 24h post-infection. (E) The expression level of BATF2 in FNβ treated and untreated A549 cells measured by qRT-PCR (Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (F) The expression level of BATF2 in influenza A/WSN/33 virus-infected A549 cells and A549 IFNAR\u003csup\u003e-/-\u003c/sup\u003e cells measured by qRT-PCR (Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/b4f5b5ec39f8e51eb4f156a5.png"},{"id":90032147,"identity":"9214632c-04a5-4b5e-8c0f-f3b6224ef10c","added_by":"auto","created_at":"2025-08-27 15:19:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":148629,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of endogenous BATF2 expression in A549 cells.\u003c/strong\u003e A549 cellstreated with sh-RNAs targeting BATF2 or luciferase control were infected with or without influenza A/WSN/33 virus at an MOI of 1.0,and the total mRNA was harvested at the indicated time points after infection. (A) qRT-PCR was performed to measure the interference efficiency of the sh-BATF2 Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (B) Expression of BATF2 in knockdown cells was affirmed by stimulating the cell with IFN-β Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (C) Efficiency of sh-BATF2 was analyzed by treating cells with Poly I: C. Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.) (D) WSN-NP mRNA expression measured by qRT-PCR in A549 cellsexpressing specific sh-BATF2 Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.) (E) The cell culture supernatants harvested from non-infected and infected with influenza A/WSN/33 virus to determine the viral titers by plaque assay using MDCK cells (Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (F) Protein extractscollected from the A549 cells expressing specific sh-BATF2 non-infected and infected with influenza A/WSN/33 virus and were subjected to western blot analysis with antibodies specific to BATF2 and WSN-NP.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/0f3628863a3a28d51954db7b.png"},{"id":90033127,"identity":"cddcfd57-a0a5-4504-9e2b-6aef86d97442","added_by":"auto","created_at":"2025-08-27 15:27:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":163457,"visible":true,"origin":"","legend":"\u003cp\u003eBATF2 is a potent immunomodulatory transcription Factor of type I interferon responses after influenza A/WSN/33 virus infection (A) qRT-PCR was performed to detect the mRNA expression of ISG15 at 0, 12,and 24 hpi (Data are represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.).(B) mRNA expression of OASL1 (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (C) The expression of pro inflammatory cytokine IL-6 in A549 cells expressingsh-BATF2 and sh-Luc in response to virus infection (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). \u0026nbsp;(D) qRT-PCR was performed to detect the expression of transcriptional repressor Blimp-1 mRNA in A549 cells expressingsh-BATF2 and sh-Luc during virus infection (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (E) Expression of different selected ISGs determined by RT-PCR. (F) Western blot was performed to detect the protein expression of BATF2 and Blimp-1. The expression levels of Blimp-1 and BATF2 are presented and normalized to the expression of β-actin.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/8db96a964a68ba2908387518.png"},{"id":90033616,"identity":"c8f86b1f-5db0-49fc-9c47-a774617f6f8b","added_by":"auto","created_at":"2025-08-27 15:35:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":91534,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of BATF2 promotes the replication of influenza A/WSN/33 virus. A549 cells stably expressing BATF2 or empty vector were infected with influenza A/WSN/33 virus at anMOI of 1.0 and harvested at the indicated time points (0, 12 and 24 hpi). (A) The forced expression of BATF2 in A549 cells was examined by qRT-PCR (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (B) The mRNA expression of WSN-NPwas examined by qRT-PCR (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (C) The viral titers in A549 cell culture supernatants were determined by plaque assay usingMDCK cells (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (D) The expression of BATF2 and WSN-NP in A549 cells was examined by western blotting with antibodies specific to BATF2 and WSN-NP.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/57e3c07dc44f454a3ee53157.png"},{"id":90032149,"identity":"5c338951-a6ce-4e15-b636-b45583fa61d9","added_by":"auto","created_at":"2025-08-27 15:19:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":168566,"visible":true,"origin":"","legend":"\u003cp\u003eExogenous expression of BATF2 perturbs the expression of antiviral innate immunity and inflammation. (A, B) qRT-PCR was performed to detect the mRNA expression of ISG15 and OASL1 at 0, 12, and 24 hpi (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (C) qRT-PCR was performed to detect the mRNA expression of pro inflammatory IL-6 in A549 cells with exogenous expression of BATF2 and empty vector after virus infection (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (D) qRT-PCR analysis determined that the expression of Blimp-1 mRNAs which was positively regulated in BATF2 expressing A549 cells in comparison to empty vector control (Data represented as mean ±SD. *p \u0026lt; 0.05; **p \u0026lt; 0.01.). (E) Expression of different selected ISGs determined by RT-PCR (F) Western blot was performed to detect the protein expression of Blimp-1. The expression levelsof Blimp-1 presented and normalized to the expression of β-actin.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/dceff6aa41d23f17604c5a5a.png"},{"id":90965080,"identity":"a8fe9d8c-49b0-4a25-b9ad-d5892f1787f0","added_by":"auto","created_at":"2025-09-10 06:23:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1545217,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/187b8df8-7850-4dac-b19c-831a05782a7f.pdf"},{"id":90033128,"identity":"6de0f8ce-d061-4478-8cb5-13f4d80bd6bf","added_by":"auto","created_at":"2025-08-27 15:27:01","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":2592162,"visible":true,"origin":"","legend":"","description":"","filename":"SuppleentaryFigure.tif","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/eb2e3613e13f02f8adcb6d43.tif"},{"id":90032152,"identity":"929c7d52-da89-446a-9eb2-0c07fc4d8f63","added_by":"auto","created_at":"2025-08-27 15:19:01","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1388330,"visible":true,"origin":"","legend":"","description":"","filename":"Rawdata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6721231/v1/ebe8ba7e014df5f1ea58b384.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immunomodulatory Transcription Factor BATF2 regulates the Interferon Stimulated Genes Expression during Influenza A virus Infection","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRegular global outbreaks of viral diseases caused by novel or mutated viruses that can spread rapidly from person to person posed enormous threats to health and social disruption. Viral pandemics in modern history include the 1918 influenza pandemic, the HIV/AIDS pandemic, and the recent COVID-19 pandemic. The pandemics underscore the need for efficient readiness, surveillance, and response measures to prevent and mitigate their impact. Amongst these viral pandemics, respiratory viral infections stand out as the most significant, with the 1918 pandemic ranking among the most severe of these serious outbreaks. Influenza A viruses (IAVs) cause highly contagious respiratory disease in humans, with their pandemics being associated with higher mortality rates. IAV belong to the Orthomyxoviridae family. Notably, IAV pose a substantial risk of zoonotic infection and host switching (Shao et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) Additionally, they have been identified as harboring concerning mutations that could potentially lead to the emergence of a zoonotic pandemic (European Food Safety Authority et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Annual epidemics occur due to evolution of IAV's through self-mutation and re-assortment mechanisms. IAVs can infect humans and other diverse creatures including pigs, horses, dogs, marine mammals, and birds (Shao et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The genome of IAV consists of eight segments of negative-sense single-stranded RNA, encased by the nucleoprotein (NP). Up to the present time, influenza viruses have been found to code for a total of 17 viral proteins (Chen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Following infection with the influenza virus, pathogen recognition receptors (PRRs) within cells are activated, prompting the host to initiate the production of interferon (IFN). This, in turn, leads to the subsequent activation of interferon-stimulated genes (ISGs) (Goraya et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), such as MxA, 2'-5' oligoadenylate synthase (OAS), protein kinase R (PKR) (Schneider et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and IFITMS (Liao et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). During viral infection, host cells regulate the immune response, employing this as a key strategy to clear the infection, restrict cytokine storms, and regulate the inflammatory process.\u003c/p\u003e\u003cp\u003eBasic leucine zipper (bZIP) transcription factors are a group of DNA-binding proteins that contain a conserved domain called the bZIP domain. bZIP proteins are crucial transcriptional regulators found in all tissues and immune system cells. For example, FOS and JUN, two of the earliest bZIP proteins discovered, and form the heterodimer transcription factor known as activator protein 1 (AP-1) (Lee et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). Basic leucine zipper ATF-like transcription factors (BATF) are the subgroup of bZIP family and comprised of BATF, BATF2 and BATF3 (Guler et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Unlike other bZIP transcription factors BATF and BATF3 lacking the transactivation domains, only contain a DNA-binding domain and a leucine zipper motif (Vinson et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). BATF can form heterodimers with JUN proteins, however due to lack of transactivation domain it is hypothesized that BATF are AP-1 competitive inhibitors (Su et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). A carboxyl-terminal domain, like FOS's, is present in BATF2, but its role is unclear. Subsequently, various complexes of the BATF family proteins with the JUN family proteins have been found to have unique roles in the differentiation of CD8\u003csup\u003e+\u003c/sup\u003e dendritic cells (Hildner et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), T cells in addition to different transcriptional activator functions (Murphy et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). BATF2 is expressed in immune cells (dendritic cells, B cells, T cells, and macrophages) and originally identified as AP-1 inhibitor via its dimerization with c-JUN in cancer cells (Su et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e;Roy et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). BATF2 has been shown to induce inflammatory responses in IFN-γ and LPS-activated macrophage in association with \u003cem\u003eIrf1\u003c/em\u003e (Roy et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), also reported to have heterodimeric binding with JUNB, \u003cem\u003eIrf4\u003c/em\u003e and \u003cem\u003eIrf8\u003c/em\u003e (Chang et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePrevious studies demonstrated that BATF2 act as antitumor and immune-regulatory transcription factor (Murphy et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e;Kanemaru et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2017\u003c/span\u003e;Zsurka et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). An early study of \u003cem\u003eBatf2\u003c/em\u003e knockdown macrophages induced by IFN-γ, revealed important roles of BATF2 in immune-regulation, inflammatory responses and host-protective genes against mycobacterium (Roy et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice infected with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e showed that BATF2 act as a negative regulator for Th17 immunopathology by suppressing IL-23a. Further, \u003cem\u003eT. cruzi\u003c/em\u003e infected \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e exhibited multiorgan tissue damage and reduced burden of parasite due to reduced suppression of IL-23a/Th17 mediated immunopathology (Kitada et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In a different study, spontaneous colitis in \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice was also accompanied by increased IL-23 levels (Kayama et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A study focusing the BATF2 role in infectious diseases demonstrated that BATF2 act as an immune-regulator rather than just an immune-suppressor. \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice infected with \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e, and \u003cem\u003eListeria monocytogenes\u003c/em\u003e showed reduced bacterial burden, tissue inflammation, pulmonary histopathology, and survived in acute infection. While, \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice failed to restrict immunopathogenesis and intestinal fibro-granulomatous inflammation during \u003cem\u003eSchistosoma mansoni\u003c/em\u003e infection (Guler et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Notably, BATF2 is interferon stimulated gene and was up-regulated in all above mentioned infections and also up-regulated during infection with feline infectious peritonitis virus (Shuid et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), SARS-CoV2 (Blanco-Melo et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and IAV (Zhou et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThese observations imply that induction of Batf2 differentially regulates immunological response pathways via a feedback mechanism after being exposed to disease-causing organisms. Increased expression of BATF2 has been observed in human cells following infection with IAV. However, there is no study conducted to explain the effect of BATF2 expression on influenza virus infection. This is the first study to report the effect of BATF2 expression on the replication of influenza virus and innate immune response in pulmonary epithelial cells. We tried to unveil the regulatory role of BATF2 on the expression of different immune response and its effect on IAV replication. We have found that loss of BAFT2 expression led to high expression of cytokines which restrict the IAV replication by up-regulating innate immunity. While, BATF2 expression regulates the expression of different ISGs to limit the hyper inflammatory response during viral infection. Further, detailed studies of BATF2 effect on the regulation of genes related to apoptosis, autophagy, understanding its impact on immune cell differentiation and cytokine production might offer insights into managing these conditions.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Antibodies and Reagents\u003c/h2\u003e\u003cp\u003eThe primary antibodies used in this study including BATF2 (ProteinTech, #16592-1-AP), Blimp-1 (C14A4 #9115, Cell Signaling Technology, USA), and anti-β-actin (Transgen Biotechnology, HC201). A monoclonal antibody against the NP protein of WSN influenza virus was produced in our laboratory using the method as described previously (Yang et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). IFNβ (Sinobiologicals, Beijing), Vigofact was obtained from Vigorous Labs (Vigorous Biotechnology Beijing Co. Ltd).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell Culture and Virus Infection\u003c/h2\u003e\u003cp\u003eThe cell lines used in the present study include 293T, A549, and MDCK cells (American Type Culture Collection, Manassas, VA, USA) and cells were maintained in culture media (Dulbecco\u0026rsquo;s modified Eagle medium, DMEM) containing 10% fetal calf serum (FCS), supplemented with penicillin (100U/mL) and streptomycin (100\u0026micro;g/ml). For differential expression of host cellular response, we infected 293T cells with influenza A/WSN/33 virus strain maintained in our laboratory and sent for RNA sequencing. Virus was added into cells at the indicated multiplicity of infection (MOI) according to our previous published study (Zhang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). After viral adsorption cells were cultured for 1hr at 37\u0026deg;C, later cells were washed with phosphate-buffered saline (PBS) and then cultured in DMEM containing trypsin 2\u0026micro;g/ml (TPCK treated) for 12h.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Differential Expression of Selected Genes in Response to Influenza A Virus\u003c/h2\u003e\u003cp\u003eThe total mRNA was extracted from the 293T cells control or infected with influenza A/WSN/33 virus for 12h by TRIzol reagent (Invitrogen) and the mRNA samples were sent to Shanghai OE-Biotech Ltd. for microarray analysis. According to the microarray data, cDNA libraries were constructed to confirm the expression levels of the selected genes by PCR and qPCR. Specific primers for RT-PCR and qRT-PCR were designed using Primer 5 software (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The heat map generated from the data of differential gene expression analysis. To ensure reproducibility, all experiments were conducted with three independent replicates. As in our previous study, 293T cells were used for initial screening due to their ease of transfection and high reproducibility in gene expression assays (Liao et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). While not derived from pulmonary tissue, they provided a practical model for identifying differentially expressed genes in response to influenza A virus infection, which were then validated in more relevant pulmonary epithelial cell models to explore BATF2\u0026rsquo;s role in the innate immune response.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primers used in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWSN-NP F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAAACGTGGGATCAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWSN-NP R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGCAGACCGTGCTAAAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRSG1 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTCCTTCACTGACCGTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRSG1 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGCCATTGAGTATGTGGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman GBP1F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCCCTACAACTTCGGAACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman GBP1R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTGGATTCGCCATCAGTCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman BATF2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGAATTTGCAGCACGAGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman BATF2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGCAGGAGGCACAATCCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman BATF2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGAGTTGTGCCATTTCAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman BATF2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGAACACTTACTCTGGCCCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman RSAD2-1 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCCAATGACAGGTTGCTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman RSAD2-1 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGAGCTCAGAGGTTGCCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman ATP6V0A4 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCATGTATCTCAGCACGCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman ATP6V0A4 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATCAGAAGCATCCACGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman ISG15 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCATCTTCACCGTCAGGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman ISG15 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCGAACTCATCTTTGCCAGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman OASL1 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCTGAGGTCTATGTGAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman OASL1 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGAAGCCTTCGTCCAAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman IL-6 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACAAATTCGGTACATCCTCGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman IL-6 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGCTTGTTCCTCACTACTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBlimp-1 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGCCAGACGGTTAACACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBlimp-1 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCTGGAGTTACACTTGGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman Actin-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGTACGCCAACACAGTGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ehuman Actin-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTCAGGAGGAGCAATGATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSh-BATF2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATCCGGCAAGAGAATAGGTGGTTTGCTTCCTGTCAGACAAACCACCTATTCTCTTGCCTTTTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSh-BATF2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATTCAAAAAGGCAAGAGAATAGGTGGTTTGTCTGACAGGAAGCAAACCACCTATTCTCTTGCCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOExp BATF2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGGAATTCATGGATTGTGCCTCCTGCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOExp BATF2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCGTCGACGAAGTGGACTTGAGCAGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. sh-RNA-Based BATF2 Knockdown A549 Cell Line\u003c/h2\u003e\u003cp\u003eFor further experiments A549 cell line was used as this cell line is best to study the influenza virus infections. To interfere with the endogenous expression of BATF2 at the transcript level for functional analysis during influenza virus infection, the primers were designed to amplify short hairpin RNA (sh-RNA)-based knockdown cell lines generated by infecting A549 cells with lentiviruses expressing specific sh-RNA in pSIH-H1-GFP vector as described previously (Wang et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2012\u003c/span\u003e;Chen et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The sequences used in the sh-RNAs (NCBI accession No, NM_001300807) targeting specific genes were sh-RNA, 5\u0026rsquo;GCTCCTGTGGGCAAGAGAAT 3\u0026rsquo;, and 3\u0026rsquo;TATTCTCTTGCCCACAGGAGC 5\u0026rsquo;, and luciferase was used as a control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Plasmids Construction and Gene Overexpression\u003c/h2\u003e\u003cp\u003eThe full-length cDNA encoding human BATF2 was sub-cloned into the pNL-CMV vector with a Flag tag at the N-terminus to generate pNL-Flag-BATF2. The specific primers with restriction enzyme sites are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. To establish the stable cell lines, HEK293T cells were seeded into a 10-cm cell culture dish in serum and antibiotic-free DMEM and were co-transfected with 8\u0026micro;g of pNL-BATF2 or pNL-EV (used as a control), pNL-package, and pNL-vsvG. After 5h, the transfection medium was replaced with DMEM supplemented with 5% FBS for additional 48h. The recombinant lentiviruses were harvested by collecting the supernatants from the transfected cells, and then A549 cells were transduced with the recombinant lentiviruses. The flag-tagged BATF2 over-expression in the recombinant lentivirus-transduced A549 cells was analyzed by western blot using anti-BATF2 monoclonal antibody (MAb) (dilution of 1:1500) as described in previous study (Zhang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). All experiments were independently repeated three times to confirm the reproducibility of the findings.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Plaque Assay\u003c/h2\u003e\u003cp\u003ePlaque assay was performed to measure the viral replication in BATF2 knockdown or over expressing A549 cells. Briefly, supernatants from A549 cells infected with influenza A/WSN/33 virus were collected. MDCK cells cultured in-vitro were infected with the supernatants harvested from A/WSN/33 virus-infected A549 cells for 1hr. After the infection period over, PBS was used to wash the MDCK cells and then grown in α-minimal essential medium containing 1.5% low-melting-point agarose gel (Promega, Madison, WI) and TPCK (tolylsulfonyl phenylalanyl chloromethyl ketone) treated with trypsin (Sigma-Aldrich, St. Louis, MO). Subsequently MDCK cells were incubated for 72h, the numbers of plaques were counted (Wang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Each experiment was repeated three times to validate the reproducibility of the results.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. RT-PCR and qRT-PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from A549 cells infected with influenza A/WSN/33 virus by Trizol method (TransGen Biotech, Beijing Co., Ltd) according to the manufacturer\u0026rsquo;s instructions at indicated time points. Isolated RNA (4\u0026micro;g) was reverse-transcribed into cDNA libraries by using M-MLV Reverse Transcriptase (Promega, United States) according to the manufacturer\u0026rsquo;s instructions with slight modifications. The cDNA was used for expression analysis by PCR, qRT-PCR using TransStart Green qPCR SuperMix 2X (TransGen Biotech), and PCR using Taq DNA polymerase (Takara Bio) as previously described (Goraya et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e;Chen et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e;Zhang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The amplified products by PCR were resolved by electrophoresis on a 1% agarose gel, and the intensity of bands was analyzed using Quantity One software (Bio-Rad, United States) as previously described (Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The primers specific for WSN-NP, BTAF2, ISG15, OASL1, IL-6, Blimp-1 and β-actin (the reference housekeeping gene for internal standardization) were designed using the Primer 5 software (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The data of qRT-PCR analysis was shown as normalized ratios, which was auto-calculated by LightCycler system (Roche, Switzerland) using ΔΔC\u003csub\u003eT\u003c/sub\u003e method. All experiments were performed in triplicate to ensure reproducibility of the results.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Western Blotting\u003c/h2\u003e\u003cp\u003eCell lysates were prepared to collect the total protein, and western blot was performed as previously described (Danial et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Briefly, the protein samples were separated by 12% SDS-polyacrylamide gel electrophoresis and then transferred onto nitrocellulose membranes. The membranes were probed with the antibodies at the appropriate dilution (BATF2, 1:1500; Blimp 1:1000 skimmed milk/TBST). β-actin was used as a protein control (1:5000 skimmed milk/TBST)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Quantification and statistical analysis\u003c/h2\u003e\u003cp\u003eAll statistical analyses were performed using Microsoft excel and R software. Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e tests were used to determine the \u003cem\u003ep\u003c/em\u003e values. A \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant (*\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The results were shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Ethics Statement\u003c/h2\u003e\u003cp\u003eThe animal protocol used in this study was approved by the Research Ethics Committee of Huaqiao University, School of Medicine, Quanzhou (A2024031). The procedures carried out in accordance with the approved guidelines.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Cellular Gene Expression Following the Infection with Influenza A Virus\u003c/h2\u003e\u003cp\u003eUsing total RNA isolated from A549 cells infected with influenza A/WSN/33 virus, microarray analysis was used to determine the expression of genes involved in the innate immune response. Differential expression of several genes involved in the immune response was observed between WSN virus-infected A549 cells and the control group. A \u003cem\u003ep\u003c/em\u003e value less than 0.05 and a log2 fold change greater than 1 were used as thresholds for this differential expression. A heat map depicting the relative expression levels of the selected genes shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. Validation RT-PCR and qRT-PCR experiments were performed on a subset of genes, including actin, RSG1, GBP1, BATF2, BATF2, RASD2 andATP6V0A4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, D), to verify the microarray data. Both the microarray and PCR results for analyzing the expression changes in selected genes were consistent with one another. To determine the expression of BATF2 in response to influenza virus infection, we infected the human A549 cells with influenza A/WSN/33 virus and analyzed the gene expression of BATF2 in A549 cells. The goal of using the A549 cells in further experiments was to learn how influenza A/WSN/33 virus affects BATF2 expression in lung epithelial cells. The expression of BATF2 in A549 cells rose to the maximal level at 24h post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Establishment of BATF2 Knockdown Cells\u003c/h2\u003e\u003cp\u003eWe stimulated the A549 cells with IFNβ and infected the IFNAR knockout A549 cells with the influenza A/WSN/33 virus for a period of 12h so that we could determine whether or not the expression of BATF2 is dependent on IFNβ. Later total mRNA was collected from the stimulated and infected cells. The results of the qRT-PCR experiment showed that stimulation with IFNβ led to increased expression of BATF2 in cells that had been treated with IFNβ, in comparison to the cells that served as controls. In comparison to the A549 cells, the expression of BATF2 was lower in the IFNAR knockout A549 cells that were infected with the A/WSN/33 virus. According to these findings, the level of expression of BATF2 is dependent on the stimulation of IFNβ (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F).\u003c/p\u003e\u003cp\u003eFurthermore, to determine the function of BATF2 in innate immune signaling, we generated stable A549 cell lines expressing specific sh-RNAs targeting BATF2 or luciferase control. The competent cells were observed under fluorescent microscope to detect the expression of GFPs (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA), and RT-PCR was performed to confirm the silencing of BATF2 expression (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). The sh-RNA treated cells infected with influenza A/WSN/33 virus, and the RNA extracts were harvested at the indicated time (0, 12, and 24 hpi). The interference efficiency of sh-RNA was examined by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Compared with the control sh-RNA targeting luciferase, the specific sh-BATF2 caused a significant decrease in the expression of BATF2 after influenza A/WSN/33 virus infection. The BATF2 knockdown A549 cells showed a significant lower expression of BATF2 even in response to IFNβ stimulation and poly (I: C) treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). The lower expression of BATF2 had a negative effect on the replication of influenza virus especially at 24h. The qRT-PCR and plaque assay results showed limited replication of influenza virus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E). Protein expression of BATF2 was also analyzed via western blotting by isolating the proteins from non-infected and infected with influenza A/WSN/33 virus A549 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). As BATF2 plays a regulatory role for inflammatory responses during infection so we further check the different cytokine expression in this study.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.3. Silencing of BATF2 restricted the Replication of Influenza A Virus\u003c/h2\u003e\u003cp\u003eResults as presented above revealed that IAV infection could induce the expression of BATF2. For further investigations of the antiviral function of BATF2, we infected the BATF2 knockdown A549 cells with influenza A/WSN/33 virus, which activates the pathogen recognition receptors such as RIG-I and TLRs to induce interferon-mediated innate signaling (Kato et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e;Pichlmair et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). After virus infection, total mRNA and proteins were collected from the BATF2 knockdown and luciferase control A549 cells at the indicated time points (0, 12, and 24 h hpi). The qRT-PCR was performed to analyze the replication of IAV in BATF2 knockdown cells. Interestingly, qRT-PCR results showed reduced replication of WSN virus in sh-BATF2 treated A549 cells than in sh-Luc treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Nucleoprotein (NP) was considered to measure the replication of influenza A virus. Silencing of endogenous BATF2 resulted in a significant decrease of viral replication, as evidenced by low viral load in culture supernatants of BATF2 knockdown A549 cells compared to supernatants of luciferase control cells. The plaque assay showed a lower number of plaques forming units of WSN in sh-BATF2 treated A549 cells as compared to the luciferase control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). To confirm the aforementioned results, total protein extracts were collected from the control and BATF2 knockdown A549 cells for western blot analysis. NP protein expression was found to be decreased in BATF2 knockdown cells compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Therefore, BATF2 knockdown in A549 cells restricts the replication of influenza A virus compared to the luciferase control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Knockdown of BATF2 leads to ISGs signatures\u003c/h2\u003e\u003cp\u003eTo explore the contribution of BATF2 to innate immune signaling, the expression of endogenous BATF2 was knockdown by sh-RNA in A549 cells. We collected the total RNA from A549 BATF2 knockdown and sh-Luc cells infected with WSN virus at the indicated time points to perform qRT-PCR and RT-PCR for the expression of selected ISGs. Our results showed that the ISG15, OASL1, and IL-6 expression was significantly increased in BATF2 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA,B,C), whereas expression of a transcriptional repressor Blimp-1 was significantly reduced in BTAF2 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition, western blot results showed that the protein expression levels of Blimp-1 were also significantly reduced in BATF2 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eInterestingly, silencing of endogenous BATF2 restricted the replication of influenza A virus and caused increased expression of ISGs including the ISG15, OASL1 and IL-6 in A549 BATF2 knockdown cells during infection which resulted in limited replication of IAV. We also investigated the expression of effector differentiation transcriptional regulators Blimp-1. Previous study has reported that BATF2 promotes effector differentiation transcriptional regulators Blimp-1 (Kurachi et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and BATF2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice showed reduced expression of Blimp-1 (Xin et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, we examined the expression levels of selected ISGs via RT-PCR which were consistent with qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.5. Overexpression of BATF2 perturbs the ISGs expression\u003c/h2\u003e\u003cp\u003eSince silencing of BATF2 can increase cytokine expression against IAV infection, we further investigated whether forced expression of BATF2 could affect IAV replication. Thus, A549 cells were transiently transfected with the construct expressing BATF2 or with an empty vector and challenged with the influenza A/WSN/33 virus. The RT-PCR and qRT-PCR results showed that BATF2 was successfully overexpressed in A549 cells treated with pNL-BATF2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), and the exogenous expression of BATF2 supported influenza A virus replication (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Furthermore, virus titers in cell culture supernatants were determined by plaque assay, and western blotting was performed to detect the protein expression of BTAF2 and viral NP. The results of the plaque assay and western blotting showed that the overexpression of BATF2 in A549 cells significantly supported the replication of IAV (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC,D).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003ePrevious studies showed that BATF2 act as immunomodulator factor and also play role to regulate the inflammatory response in chronically infected cells. Therefore, we analyzed the effects of BATF2 overexpression on the expression of cytokines. We hypothesized that BATF2 can regulate the cytokine storm in acute infections. Our data showed that overexpression of BATF2 restricts the expression of antiviral proteins ISG15, OASL1 and pro inflammatory cytokine IL-6. qRT-PCR and RT-PCR results showed that the ISG15, OASL1 and IL-6 were significantly suppressed in BATF2 overexpressed A549 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA,B,C). Additionally, we examined the effects of BATF2 on the expression levels of transcriptional repressor Blimp-1 using RT-PCR and qRT-PCR. BATF2 overexpressing cells, on the other hand, showed an elevation of the transcriptional repressor Blimp-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, E). In addition, we examined the Blimp-1 protein expression via western blot and results showed that the protein expression levels of Blimp-1 were also significantly positively regulated in BATF2 overexpressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). The enhanced expression of Blimp-1 mRNA was positively correlated with BATF2 overexpression. These results show that BATF2 can act as potential proximal regulator of cytokines and inflammatory response in innate immune signaling.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn response to viral infection, host cell pathogen recognition receptors (PRRs) detect pathogen-associated molecular patterns (PAMPs) presented by invading viruses. Viral PAMPs primarily consists of nucleic acids derived from viral DNA or RNA genomes. Distributed across diverse cellular compartments, PRRs prompt the activation of transcription factors such as IRF3/7 and NF-kB upon virus recognition (Schneider et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This activation cascade ultimately leads to the expression of interferon and various interferon stimulated genes (ISGs), which plays pivotal role in restricting the replication of invading viruses. Remarkably, the transcription factor-mediated innate immune responses are also provoked by influenza A virus (IAV) infection (Ehrhardt et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Among the pivotal coordinators in this network the BATF2 immunomodulatory transcription factor has emerged as a critical regulator of immune responses, especially in the context of viral infection. To combat infection, the host must activate immune responses. The expression of BATF2 was upregulated upon WSN virus infection in A549 cells, implying its inducibility by influenza viruses. Previous studies have demonstrated the importance of Basic leucine zipper transcription factor ATF-like (BATF) in lymphocyte regulation and differentiation (Murphy et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). With its expression modulated by stimuli and infection, BATF2 plays a pivotal role in the regulation of inflammatory cytokines (Su et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e;Tussiwand et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The precise functions of BATF2 remain an active subject of research, as scientists continually uncover its roles in different biological contexts.\u003c/p\u003e\u003cp\u003eIn this study, we examined the activity of endogenous BATF2 as an immune modulator against IAV replication in A549 cells. Silencing endogenous BATF2 in A549 cells resulted in restricted influenza A virus replication (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E). Conversely, upregulating BATF2 in A549 cells led to enhanced viral replication (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Previous knowledge identified BATF2 as an inhibitor of IL-23, a pro inflammatory cytokine (Kitada et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The assembly of RIG-I and MDA5 activates downstream IRFs and other transcription factors to induce genes encoding IFNα/β and ISGs (Johnson and Gale, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In epilepsy patients, loss of BATF2 correlates with upregulated ISGs, including ISG15, IFI27, IFIT1, and RSAD2 (Zsurka et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In our study, BATF2 knockdown cells infected with WSN displayed increased expression levels of ISG15, OASL1, and IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, C). These findings hint at BATF2's infection-based functions. We propose that BATF2 play roles as both an inflammatory modulator and an immune response regulator during viral infection, potentially mitigating cytokine storms. Considering the high expression of ISGs, viral mRNA, and protein were significantly decreased in BATF2 knockdown cells compared to luciferase cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Conversely, ectopic BATF2 expression suppressed the mRNA expression of ISG15, OASL1 and IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B, C). Previous research has also highlighted BATF2 complex role as an immune-regulator and immune-suppressor. For instance, \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited low bacterial load, reduced tissue inflammation, pulmonary histopathology, and improved survival during acute infection with \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e and \u003cem\u003eListeria monocytogenes\u003c/em\u003e. \u003cem\u003eBatf2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice failed to limit immunopathogenesis and intestinal fibro-granulomatous inflammation during \u003cem\u003eSchistosoma mansoni\u003c/em\u003e infection (Guler et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this light, our findings suggest that BATF2's intrinsic expression during influenza virus infection governs antiviral ISG15 expression, thereby inhibiting viral replication. Moreover, BATF2 may influence inflammatory responses through its effect on IL-6, possibly suggesting at its involvement in inflammation and cytokine storm during viral infections. Although the current study establishes a foundational link between BATF2 expression and immune modulation during Influenza A infection, further functional assays, including targeted knockdowns or pharmacological inhibition of ISG15 and IL-6, are needed to fully elucidate the mechanistic role of BATF2. Future studies will be crucial to strengthen the causal relationship and explore its potential as a therapeutic target.\u003c/p\u003e\u003cp\u003eFurthermore, BATF2 play two important regulatory functions. First, it directly upregulates essential TFs like T-bet, Runx3, and Blimp-1, as along with cytokine receptors that sense inflammation and reinforce effector differentiation. Second, BATF binds and represses downstream effector molecules like IFN-γ, perforin and granzyme B (Kurachi et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Blimp-1, a key regulator of immune cell differentiation and B cells maturation for antibody responses, exhibited reduced expression in BATF2 knockdown cells during influenza virus infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, F). The cooperative role of IRF4 in BATF2-mediated Blimp-1 regulation is evident (Xin et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Loss of BATF2 disrupts the expression of several transcription factors, including Blimp-1. Suppression of Blimp-1 can, in turn, reduce the expression of cytokine-regulatory genes, potentially leading to excessive cytokine production (Kurachi et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The absence of BATF2 might also delay cellular responses triggered by Blimp-1. Interestingly, the overexpression of BATF2 led to a suppressed antiviral response, suggesting that sustained infection-based BATF2 expression orchestrates a balanced innate immune response by modulating cytokines and initiating cellular immunity via Blimp-1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, F). Although the role of BATF2 and IRFs in stimulating immune cells has been suggested in previous studies, our findings highlight the potential for BATF2 to also influence innate immune responses and inflammation during viral infections. This study offers preliminary insights into the complex interplay between BATF2, innate immunity, and inflammation. Further exploration of BATF2's role in viral infections promises deeper insights into its underlying mechanisms and potential therapeutic applications.\u003c/p\u003e\u003cp\u003eCollectively, our study suggests a potential role of BATF2 as a regulator of immune responses and inflammation during influenza A virus infection. By modulating the expression of antiviral genes and cytokines, BATF2 may contributes to the delicate equilibrium required for an effective immune response, preventing excessive inflammation through IL-6 and cytokine. However, our study provides preliminary insights into the role of BATF2 in regulating immune responses during influenza infection. Further in-vivo studies using human-relevant influenza virus strains are essential to fully elucidate BATF2\u0026rsquo;s functions, particularly its role in regulating cytokine expression and modulating immune responses. These investigations could uncover new therapeutic strategies to optimize immune responses during viral infections, potentially preventing excessive inflammation and enhancing antiviral defenses.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate:\u0026nbsp;This study was conducted in accordance with the Huaqiao University Quanzhou Guidelines, and Ethics Committee of School of Medicine (Approval Number: (A2024031). All experimental protocols involving animal models were reviewed and approved by the relevant institutional ethics committee. All methods were carried out in accordance with relevant guidelines and regulations.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsent for publication:\u0026nbsp;NA\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials:\u0026nbsp;All data is included in the manuscript.\u003c/p\u003e\n\u003cp\u003eConflicts of Interest:\u0026nbsp;The authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003eFunding: \u0026nbsp;NA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, Funding acquisition, and Methodology was designed by Mohsan Ullah Goraya; Formal analysis, Methodology and revisions done by Nelam Sajjad; Writing – original draft, Mohsan Ullah Goraya and Jamal Muhammad Khan, review and preliminary experiments by Aftab Ullah, Overall supervision, revision and guidance by Diao Yong.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAcknowledgement: All authors confirm that the following manuscript is a transparent and honest account of the reported research. This research is related to a previous study by the same author Mohsan Ullah Goraya. The previous study was performed on Zinc Finger CCCH-Type Antiviral Protein 1 and the current submission is focusing on BATF2. The study is following the methodology explained in previous study published in Frontiers in Microbiology (Zhang et al., 2020).” This work was supported by the Scientific Research Funds of Huaqiao University, Quanzhou, Fujian, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBlanco-Melo, D., Nilsson-Payant, B.E., Liu, W.C., Uhl, S., Hoagland, D., M\u0026oslash;ller, R., Jordan, T.X., Oishi, K., Panis, M., Sachs, D., Wang, T.T., Schwartz, R.E., Lim, J.K., Albrecht, R.A., and Tenoever, B.R. (2020). Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. \u003cem\u003eCell\u003c/em\u003e 181\u003cstrong\u003e,\u003c/strong\u003e 1036-1045.e1039.\u003c/li\u003e\n \u003cli\u003eChang, Y.K., Zuo, Z., and Stormo, G.D. (2018). Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq. \u003cem\u003eBMC Molecular Biology\u003c/em\u003e 19\u003cstrong\u003e,\u003c/strong\u003e 5.\u003c/li\u003e\n \u003cli\u003eChen, S., Luo, G., Yang, Z., Lin, S., Chen, S., Wang, S., Goraya, M.U., Chi, X., Zeng, X., and Chen, J.-L. (2016). Avian Tembusu virus infection effectively triggers host innate immune response through MDA5 and TLR3-dependent signaling pathways. \u003cem\u003eVeterinary Research\u003c/em\u003e 47\u003cstrong\u003e,\u003c/strong\u003e 74.\u003c/li\u003e\n \u003cli\u003eChen, S., Wang, L., Chen, J., Zhang, L., Wang, S., Goraya, M.U., Chi, X., Na, Y., Shao, W., Yang, Z., Zeng, X., Chen, S., and Chen, J.L. (2017). Avian Interferon-Inducible Transmembrane Protein Family Effectively Restricts Avian Tembusu Virus Infection. \u003cem\u003eFront Microbiol\u003c/em\u003e 8\u003cstrong\u003e,\u003c/strong\u003e 672.\u003c/li\u003e\n \u003cli\u003eChen, X., Liu, S., Goraya, M.U., Maarouf, M., Huang, S., and Chen, J.-L. (2018). Host Immune Response to Influenza A Virus Infection. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e 9.\u003c/li\u003e\n \u003cli\u003eChen, Z., Luo, G., Wang, Q., Wang, S., Chi, X., Huang, Y., Wei, H., Wu, B., Huang, S., and Chen, J.-L. (2015). Muscovy duck reovirus infection rapidly activates host innate immune signaling and induces an effective antiviral immune response involving critical interferons. \u003cem\u003eVeterinary microbiology\u003c/em\u003e 175\u003cstrong\u003e,\u003c/strong\u003e 232-243.\u003c/li\u003e\n \u003cli\u003eDanial, N., Pernis, A., and Rothman, P. (1995). Jak-STAT signaling induced by the v-abl oncogene. \u003cem\u003eScience\u003c/em\u003e 269\u003cstrong\u003e,\u003c/strong\u003e 1875-1877.\u003c/li\u003e\n \u003cli\u003eEhrhardt, C., Seyer, R., Hrincius, E.R., Eierhoff, T., Wolff, T., and Ludwig, S. (2010). Interplay between influenza A virus and the innate immune signaling. \u003cem\u003eMicrobes Infect\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 81-87.\u003c/li\u003e\n \u003cli\u003eEuropean Food Safety Authority, E.C.F.D.P., Control, E.U.R.L.F.a.I., Adlhoch, C., Fusaro, A., Gonzales, J.L., Kuiken, T., Marangon, S., Niqueux, \u0026Eacute;., Staubach, C., Terregino, C., Aznar, I., Guajardo, I.M., and Baldinelli, F. (2023). Avian influenza overview September \u0026ndash; December 2022. \u003cem\u003eEFSA Journal\u003c/em\u003e 21\u003cstrong\u003e,\u003c/strong\u003e e07786.\u003c/li\u003e\n \u003cli\u003eGoraya, M.U., Abbas, M., Ashraf, M., and Munir, M. (2015). Isolation of buffalo poxvirus from clinical case and variations in the genetics of the B5R gene over fifty passages. \u003cem\u003eVirus genes\u003c/em\u003e 51\u003cstrong\u003e,\u003c/strong\u003e 45-50.\u003c/li\u003e\n \u003cli\u003eGoraya, M.U., Zaighum, F., Sajjad, N., Anjum, F.R., Sakhawat, I., and Rahman, S.U. (2020). Web of interferon stimulated antiviral factors to control the influenza A viruses replication. \u003cem\u003eMicrobial Pathogenesis\u003c/em\u003e 139\u003cstrong\u003e,\u003c/strong\u003e 103919.\u003c/li\u003e\n \u003cli\u003eGuler, R., Mpotje, T., Ozturk, M., Nono, J.K., Parihar, S.P., Chia, J.E., Abdel Aziz, N., Hlaka, L., Kumar, S., Roy, S., Penn-Nicholson, A., Hanekom, W.A., Zak, D.E., Scriba, T.J., Suzuki, H., and Brombacher, F. (2019). Batf2 differentially regulates tissue immunopathology in Type 1 and Type 2 diseases. \u003cem\u003eMucosal Immunology\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 390-402.\u003c/li\u003e\n \u003cli\u003eGuler, R., Roy, S., Suzuki, H., and Brombacher, F. (2015). Targeting Batf2 for infectious diseases and cancer. \u003cem\u003eOncotarget\u003c/em\u003e 6\u003cstrong\u003e,\u003c/strong\u003e 26575-26582.\u003c/li\u003e\n \u003cli\u003eHildner, K., Edelson, B.T., Purtha, W.E., Diamond, M., Matsushita, H., Kohyama, M., Calderon, B., Schraml, B.U., Unanue, E.R., Diamond, M.S., Schreiber, R.D., Murphy, T.L., and Murphy, K.M. (2008). Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. \u003cem\u003eScience\u003c/em\u003e 322\u003cstrong\u003e,\u003c/strong\u003e 1097-1100.\u003c/li\u003e\n \u003cli\u003eJohnson, C.L., and Gale, M., Jr. (2006). CARD games between virus and host get a new player. \u003cem\u003eTrends Immunol\u003c/em\u003e 27\u003cstrong\u003e,\u003c/strong\u003e 1-4.\u003c/li\u003e\n \u003cli\u003eKanemaru, H., Yamane, F., Fukushima, K., Matsuki, T., Kawasaki, T., Ebina, I., Kuniyoshi, K., Tanaka, H., Maruyama, K., Maeda, K., Satoh, T., and Akira, S. (2017). Antitumor effect of Batf2 through IL-12 p40 up-regulation in tumor-associated macrophages. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 114\u003cstrong\u003e,\u003c/strong\u003e E7331-E7340.\u003c/li\u003e\n \u003cli\u003eKato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis E Sousa, C., Matsuura, Y., Fujita, T., and Akira, S. (2006). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. \u003cem\u003eNature\u003c/em\u003e 441\u003cstrong\u003e,\u003c/strong\u003e 101-105.\u003c/li\u003e\n \u003cli\u003eKayama, H., Tani, H., Kitada, S., Opasawatchai, A., Okumura, R., Motooka, D., Nakamura, S., and Takeda, K. (2019). BATF2 prevents T-cell-mediated intestinal inflammation through regulation of the IL-23/IL-17 pathway. \u003cem\u003eInternational Immunology\u003c/em\u003e 31\u003cstrong\u003e,\u003c/strong\u003e 371-383.\u003c/li\u003e\n \u003cli\u003eKitada, S., Kayama, H., Okuzaki, D., Koga, R., Kobayashi, M., Arima, Y., Kumanogoh, A., Murakami, M., Ikawa, M., and Takeda, K. (2017). BATF2 inhibits immunopathological Th17 responses by suppressing Il23a expression during Trypanosoma cruzi infection. \u003cem\u003eJ Exp Med\u003c/em\u003e 214\u003cstrong\u003e,\u003c/strong\u003e 1313-1331.\u003c/li\u003e\n \u003cli\u003eKurachi, M., Barnitz, R.A., Yosef, N., Odorizzi, P.M., Diiorio, M.A., Lemieux, M.E., Yates, K., Godec, J., Klatt, M.G., Regev, A., Wherry, E.J., and Haining, W.N. (2014). The transcription factor BATF operates as an essential differentiation checkpoint in early effector CD8+ T cells. \u003cem\u003eNat Immunol\u003c/em\u003e 15\u003cstrong\u003e,\u003c/strong\u003e 373-383.\u003c/li\u003e\n \u003cli\u003eLee, W., Mitchell, P., and Tjian, R. (1987). Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. \u003cem\u003eCell\u003c/em\u003e 49\u003cstrong\u003e,\u003c/strong\u003e 741-752.\u003c/li\u003e\n \u003cli\u003eLiao, Y., Goraya, M.U., Yuan, X., Zhang, B., Chiu, S.-H., and Chen, J.-L. (2019). Functional Involvement of Interferon-Inducible Transmembrane Proteins in Antiviral Immunity. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e 10.\u003c/li\u003e\n \u003cli\u003eMurphy, T.L., Tussiwand, R., and Murphy, K.M. (2013). Specificity through cooperation: BATF\u0026ndash;IRF interactions control immune-regulatory networks. \u003cem\u003eNature Reviews Immunology\u003c/em\u003e 13\u003cstrong\u003e,\u003c/strong\u003e 499-509.\u003c/li\u003e\n \u003cli\u003ePichlmair, A., Schulz, O., Tan, C.P., Naslund, T.I., Liljestrom, P., Weber, F., and Reis E Sousa, C. (2006). RIG-I-mediated antiviral responses to single-stranded RNA bearing 5\u0026apos;-phosphates. \u003cem\u003eScience\u003c/em\u003e 314\u003cstrong\u003e,\u003c/strong\u003e 997-1001.\u003c/li\u003e\n \u003cli\u003eRoy, S., Guler, R., Parihar, S.P., Schmeier, S., Kaczkowski, B., Nishimura, H., Shin, J.W., Negishi, Y., Ozturk, M., Hurdayal, R., Kubosaki, A., Kimura, Y., De Hoon, M.J., Hayashizaki, Y., Brombacher, F., and Suzuki, H. (2015). Batf2/Irf1 induces inflammatory responses in classically activated macrophages, lipopolysaccharides, and mycobacterial infection. \u003cem\u003eJ Immunol\u003c/em\u003e 194\u003cstrong\u003e,\u003c/strong\u003e 6035-6044.\u003c/li\u003e\n \u003cli\u003eSchneider, W.M., Chevillotte, M.D., and Rice, C.M. (2014). Interferon-stimulated genes: a complex web of host defenses. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e 32\u003cstrong\u003e,\u003c/strong\u003e 513-545.\u003c/li\u003e\n \u003cli\u003eShao, W., Li, X., Goraya, M.U., Wang, S., and Chen, J.-L. 2017. Evolution of Influenza A Virus by Mutation and Re-Assortment. \u003cem\u003eInternational Journal of Molecular Sciences\u0026nbsp;\u003c/em\u003e[Online], 18.\u003c/li\u003e\n \u003cli\u003eShuid, A.N., Safi, N., Haghani, A., Mehrbod, P., Haron, M.S., Tan, S.W., and Omar, A.R. (2015). Apoptosis transcriptional mechanism of feline infectious peritonitis virus infected cells. \u003cem\u003eApoptosis\u003c/em\u003e 20\u003cstrong\u003e,\u003c/strong\u003e 1457-1470.\u003c/li\u003e\n \u003cli\u003eSu, Z.-Z., Lee, S.-G., Emdad, L., Lebdeva, I.V., Gupta, P., Valerie, K., Sarkar, D., and Fisher, P.B. (2008). Cloning and characterization of SARI (suppressor of AP-1, regulated by IFN). \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 105\u003cstrong\u003e,\u003c/strong\u003e 20906-20911.\u003c/li\u003e\n \u003cli\u003eTussiwand, R., Lee, W.L., Murphy, T.L., Mashayekhi, M., Kc, W., Albring, J.C., Satpathy, A.T., Rotondo, J.A., Edelson, B.T., Kretzer, N.M., Wu, X., Weiss, L.A., Glasmacher, E., Li, P., Liao, W., Behnke, M., Lam, S.S., Aurthur, C.T., Leonard, W.J., Singh, H., Stallings, C.L., Sibley, L.D., Schreiber, R.D., and Murphy, K.M. (2012). Compensatory dendritic cell development mediated by BATF-IRF interactions. \u003cem\u003eNature\u003c/em\u003e 490\u003cstrong\u003e,\u003c/strong\u003e 502-507.\u003c/li\u003e\n \u003cli\u003eVinson, C.R., Sigler, P.B., and Mcknight, S.L. (1989). Scissors-grip model for DNA recognition by a family of leucine zipper proteins. \u003cem\u003eScience\u003c/em\u003e 246\u003cstrong\u003e,\u003c/strong\u003e 911-916.\u003c/li\u003e\n \u003cli\u003eWang, S., Chi, X., Wei, H., Chen, Y., Chen, Z., Huang, S., and Chen, J.-L. (2014). Influenza A Virus-Induced Degradation of Eukaryotic Translation Initiation Factor 4B Contributes to Viral Replication by Suppressing IFITM3 Protein Expression. \u003cem\u003eJournal of Virology\u003c/em\u003e 88\u003cstrong\u003e,\u003c/strong\u003e 8375-8385.\u003c/li\u003e\n \u003cli\u003eWang, S., Li, H., Chen, Y., Wei, H., Gao, G.F., Liu, H., Huang, S., and Chen, J.-L. (2012). Transport of Influenza Virus Neuraminidase (NA) to Host Cell Surface Is Regulated by ARHGAP21 and Cdc42 Proteins. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e 287\u003cstrong\u003e,\u003c/strong\u003e 9804-9816.\u003c/li\u003e\n \u003cli\u003eXin, G., Schauder, D.M., Lainez, B., Weinstein, J.S., Dai, Z., Chen, Y., Esplugues, E., Wen, R., Wang, D., Parish, I.A., Zajac, A.J., Craft, J., and Cui, W. (2015). A Critical Role of IL-21-Induced BATF in Sustaining CD8-T-Cell-Mediated Chronic Viral Control. \u003cem\u003eCell Rep\u003c/em\u003e 13\u003cstrong\u003e,\u003c/strong\u003e 1118-1124.\u003c/li\u003e\n \u003cli\u003eYang, M., Berhane, Y., Salo, T., Li, M., Hole, K., and Clavijo, A. (2008). Development and application of monoclonal antibodies against avian influenza virus nucleoprotein. \u003cem\u003eJ Virol Methods\u003c/em\u003e 147\u003cstrong\u003e,\u003c/strong\u003e 265-274.\u003c/li\u003e\n \u003cli\u003eZhang, B., Goraya, M.U., Chen, N., Xu, L., Hong, Y., Zhu, M., and Chen, J.-L. (2020). Zinc Finger CCCH-Type Antiviral Protein 1 Restricts the Viral Replication by Positively Regulating Type I Interferon Response. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e 11.\u003c/li\u003e\n \u003cli\u003eZhou, A., Dong, X., Liu, M., and Tang, B. (2021). Comprehensive Transcriptomic Analysis Identifies Novel Antiviral Factors Against Influenza A Virus Infection. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e 12.\u003c/li\u003e\n \u003cli\u003eZsurka, G., Appel, M.L.T., Nastaly, M., Hallmann, K., Hansen, N., Nass, D., Baumgartner, T., Surges, R., Hartmann, G., Bartok, E., and Kunz, W.S. 2023. Loss of the Immunomodulatory Transcription Factor BATF2 in Humans Is Associated with a Neurological Phenotype. \u003cem\u003eCells\u0026nbsp;\u003c/em\u003e[Online], 12.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"BATF2, Immunoregulation, Transcription factor, antiviral cytokines, interferons, innate immunity, influenza virus","lastPublishedDoi":"10.21203/rs.3.rs-6721231/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6721231/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe basic leucine zipper ATF-like transcription factor 2 (BATF2) is involved in regulating immune, inflammatory, and antitumor responses. However, its role in viral infections, particularly influenza virus, remains poorly understood. This study delves into the influence of BATF2 expression on influenza virus replication and the innate immune response in pulmonary epithelial cells. Using interfered BATF2 expression in cells, we observed restriction in influenza A virus replication, accompanied by an increase in the expression of interferon-stimulated genes (ISGs), whereas the transcription factor Blimp-1 expression was decreased. Conversely, overexpression of BATF2 in A549 cells supported influenza virus replication and suppressed the expression of ISGs and pro-inflammatory cytokines. Notably, BATF2 overexpression was correlated with elevated expression of Blimp-1. These findings collectively suggest that BATF2 plays a role in modulating the innate immune response during influenza virus infection, influencing viral replication. The balanced expression of BATF2 helps regulate cytokine expression and cellular responses, thereby preventing excessive inflammation and cytokine storms. Our study provides insights into the intricate interplay between BATF2, innate immune responses, and viral infection. Understanding the precise mechanisms through which BATF2 regulates immune responses and along with Blimp-1 helps to initiate the cellular immune response during viral infections may have implications for the development of therapeutic strategies. Further investigations are warranted to elucidate the detailed functions of BATF2 in viral infections and explore its potential as a therapeutic target.\u003c/p\u003e","manuscriptTitle":"Immunomodulatory Transcription Factor BATF2 regulates the Interferon Stimulated Genes Expression during Influenza A virus Infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-27 15:18:56","doi":"10.21203/rs.3.rs-6721231/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"56a5b4e3-e9cd-4b1a-a0af-52196f752fc9","owner":[],"postedDate":"August 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-10T06:23:14+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-27 15:18:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6721231","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6721231","identity":"rs-6721231","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}