MiR-191-5p Is Upregulated in Culture Media of Implanted Human Embryo on Day Three of Development

MiR-191-5p Is Upregulated in Culture Media of Implanted Human Embryo on Day Three of Development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research MiR-191-5 p Is Upregulated in Culture Media of Implanted Human Embryo on Day Three of Development Ricardo Josue Acuña-González, Fela Vanesa Morales-Hernández, Jorge Skiold López-Canales, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-122465/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Jul, 2021 Read the published version in Reproductive Biology and Endocrinology → Version 1 posted 10 You are reading this latest preprint version Abstract Background: Morphologic features are the most common criteria for selecting human embryo to be transferred to the receptive uterine cavity. However, such characteristics are not valid for embryos in cellular arrest. The aim of this study was to quantify the expression profile of hsa-miR-21-3 p , -24-1-5 p , -191-5 p , and -372-5 p on day 3 of culture media from in vitro fertilization (IVF) embryo that were implanted or failed to be implanted in patients (n=25 pregnant and 25, non-pregnant patients). Methods: Fifty patients were accepted in the Department of Reproductive Biology of a Hospital in México City, based on the Institutional inclusion criteria for in vitro fertilization. On day 3 of development, embryos were transferred to women, and the culture medium was collected from implanted embryos (n=25, pregnant patients) and non-implanted embryos (n=25, non-pregnant). In the culture medium, RNA was isolated using TRIzol reagent. MiRNA expression was detected through RT-PCR with specific primers. Expression bands were quantified using an optic density. Results: The expression profiles were compared between pregnant and non-pregnant patients revealing a significant 5.2-fold greater expression of hsa-miR-191-5 p in the former group ( p ≤0.001) and a significantly higher expression of hsa-miR-24-1-5 p ( p =0.043) in the latter. No significant difference was found between the two groups in regard hsa-miR-21-3 p or hsa-miR-372-5 p ( p =0.41). Conclusions: According to the results, has-miR-191-5 p could possibly be a possible biomarker of adequate human embryo development. This miRNA modulated IGF2BP-1 and IGF2R, which are associated with the implantation window. On the other hand, hsa-miR-24-1-5 p may be related to a poor prognosis of human embryo development. Endocrinology & Metabolism MiRNAs expression embryo development implantation embryo culture media Figures Figure 1 Figure 2 Background MicroRNAs (miRNAs), are a large class of small non-coding RNAs with a length of approximately 23 nucleotides. They play an important roles in post-transcriptional gene expression by binding to the complementary sequence of the 3´untransalted region (3´-UTR) or by degrading the target messenger RNA (mRNA) transcripts via complementary base pairing. [ 1 ] MiRNAs are essential to many cellular processes and can be transferred between cells to serve as a mode of cell-cell communication, [ 2 ] They are relatively stable when circulating. [ 3 ] MiRNAs regulate cell differentiation and proliferation, [ 4 ] apoptosis, [ 5 ] endometrial receptivity, [ 6 ] and decidualization. [ 7 ] They are involved in the development of different human pathologies, including endometrial cancer. Deficiencies in the processing of pre-miRNAs are associated with defects in embryonic development. [ 8 , 9 ] There is an elevated differential secretion of miR-372 and miR-645 in the culture media of euploid-implanted versus unplanted blastocysts. [ 10 ] The aim of the present study was to quantify the expression profile of hsa-miR-21-3 p , -24-1-5 p , -191-5 p , and − 372-5 p on day 3 of culture media from in vitro fertilization (IVF) embryos that were implanted or failed to be implanted in patients (n = 25 pregnant and 25 non-pregnant patients). Methods Patients and hormonal stimulation The present protocol was reviewed and approved by the Ethics and Research Committees of the Instituto Nacional de Perinatología (212250 − 22661). After the prospective participants received an explanation of the purpose of the study, those willing to take part signed informed consent. The study was conducted a total of 50 female patients diagnosed with infertility. The Inclusion criteria were an age of ≤ 37 years, regular menstrual cycles, normal uterine cavity confirmed by hysteroscopy, the absence of intrauterine adhesion or inflammation, ≥ 7 mm endometrial thickness in the late follicular phase determined by ultrasonography, a normal ovarian reserve (follicle-stimulating hormone 8 oocytes retrieved in a controlled ovary hyperstimulation cycle), and no use of exogenous hormone (estradiol/progesterone) during the endometrial cycle. The patients received controlled ovarian stimulation based on an assessment of FSH/LH. Upon observing a follicular diameter of 18 mm, oocyte maturation was stimulated with human chorionic gonadotropin, and follicular capture was performed 36 hours later, with ultrasound guidance. In vitro fertilization Once oocytes were fertilized in vitro , and the fertilization was evaluated by the presence of a second polar corpuscle, the development of which was monitored daily until it reached the 36-cell stage. Successfully fertilized oocytes were maintained in G-1 PLUS culture media (Vitrolife, Sweden). Two embryos with type I, II, or III quality on the third day of embryonic development were transferred to the uterine cavity using the Soft Cook technique and Flexible Pass intrauterine transfer cannula guided by abdominal ultrasound equipped with a real-time, 5-MHz sector electronic array endovaginal probe (Philips Epiq CVx; MO, USA). Fourteen days after embryo transfer, ultrasound was employed to analyze the successful implantation of the embryo in relation to endometrial receptivity, finding the development of the embryo sac in positive cases. Based on the results, the patients were assigned to one of two groups: 1) implanted embryos (n = 25, pregnant patients) and 2) non-implanted embryos (n = 25, non-pregnant patients). Total RNA Isolation, Retrotranscription and Polymerase Chain Reaction Total RNA was extracted with TRIzol reagent (InvitroGen, Carlsbad, CA), according to the manufacturer´s instructions. The concentration of RNA in each sample was measured as the A 260 /A 280 ratio on a NanoDrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA). Complementary DNA synthesis was carried out with AMV-Tfl (A1260, Madison WI, USA) according to manufacturer´s instructions. The total volume of the reaction mixture was 20 µL, consisting of 2 µl of an RNA samples, 5 µl buffer AMV-TfI 1X, 1 µl dNTP (10 mM), 2 µl MgSO 4 [50mM], 10 µl ddH 2 O, 1 µl AMV RT and 1 µL (20 pmol) of a specific sequence for primers were performed as follows: hsa-miR-21-3 p (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCC), hsa-miR-24-1-5 p (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGAT), hsa-miR-191-5 p (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG), and hsa-miR-372-5 p (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATA). The reactions mixture was incubated at 45 °C for 45 minutes. Three µL of cDNA product from each culture medium sample was amplified by PCR reactions carried out in 0.2 mL PCR tubes in a thermocycler (Techne touchgene gradient). Each tube contained 5 µl of buffer AMV-Tfi 1X, 1 µl (10 mM) dNTP, 2 µl (50 mM) MgSO 4 , 10 µl ddH 2 O, 1 µl (20 pmol) of a primer sequence. The primers were as follows: hsa-miR21-3 p (CGGCCGCAACACCAGT), hsa-miR24-1-5 p (CGGCCGTGCCTACTGA), hsa-miR-191-5 p (CGGCCGCAACGGAATC), and hsa-miR-372-5 p (CGGCCGCCTCAAATGTG), and 1 µl specific universal sequences (5´-GTG CAG GGT CCG AGG T-3´ ), the latter of which afforded the hairpin structure for detection. [ 11 ] PCR cycling conditions were 94 °C for 30 s and 40 cycles (94 °C for 30 s, 56 °C for 30 s, 72 °C for 30 s) and finally 72 °C for 10 min. Twenty µL of PCR amplicons were mixed with Tris/Acetic Acid EDTA 1X loading buffer (Bio-Rad, Hercules, CA, USA) and added to wells containing 4.0% agarose gels then run at 60 V at a constant temperature for 40 minutes. After electrophoresis, gels were visualized and captured by UV transillumination system (Gel Doc 2000, Bio-Rad, Hercules, CA, USA). The band of expression for the miRNAs of interest were determined by optical density with the ImageJ program (NIH; USA). Statistics. MiRNAs data is expressed as the mean ± SD. The comparison between implanted and non-implanted embryos was made by using the Student´s t- test, considering statistical significance at p < 0.05. Results Patient characteristics The clinical characteristics of pregnant and non-pregnant patients are show in Table 1 . There were no significant differences between the two groups in regard to mean age ( p = 0.23), body mass index ( p = 0.43), length of the menstrual cycle ( p = 0.71), duration of menstrual ( p = 0.54), or endometrial thickness on the day of LH surge ( p = 0.45). Table 1 Characteristics of the two groups of women undergoing endometrial receptivity those with implanted and non-implanted embryos. Variables Implanted (n = 25) Non-implanted (n = 25) p Age (years) 35.7 ± 2.4 36.8 ± 3.1 0.23 BMI (Kg/m 2 ) 27.2 ± 3.7 26.3 ± 3.2 0.43 Menstrual cycle length (days) 27.1 ± 4.4 27.9 ± 4.9 0.71 Menstrual duration (days) 5.1 ± 1.9 5.3 ± 1.4 0.54 Endometrial thickness (cm) 10.2 ± 0.8 9.8 ± 0.9 0.45 Body mass index (BMI). Expression of miRNAs of pregnant and non-pregnant patients Comparation was made between pregnant and non-pregnant patients of the expression profile of miRNAs obtained from culture media of human embryos, and the optical density for the miRNAs of interest (Fig. 1 ). The relative optical density detected in the pregnant patients was 71.5 ± 2.0; 47.18 ± 2.9; 134.91 ± 15.91; and 37.43 ± 3.8 for hsa-miR-21-3 p , hsa-miR-24-1-5 p , hsa-miR-191-5 p and hsa-miR-372-5 p , respectively, and in non-pregnant patients was 65.56 ± 2.6; 77.0 ± 8.3; 24.82 ± 4.3; and 40.76 ± 3.7 for hsa-miR-21-3 p , hsa-miR-24-1-5 p , hsa-miR-191-5 p and hsa-miR-372-5 p , respectively. Whereas the most abundantly expressed miRNA in pregnant patients was hsa-miR-191-5 p , the least expressed was has-miR-372-5 p (Fig. 1 C). In non-pregnant patients, hsa-miR-24-1-5 p was the most robustly expressed hsa-miR191-5 p the least expressed (Fig. 1 C). Upon comparing the samples of pregnant versus non-pregnant patients a 5.2-fold greater level was found for hsa-miR191-5 p in the culture media from human embryos within pregnant patients ( p ≤ 0.001), and 1.6-fold greater level for hsa-miR-24-1-5 p in the culture media from human embryos in non-pregnant patients ( p = 0.043). No statistically significant differences were detected in relation to hsa-miR-24-1-5 p ( p = 0.38) or hsa-miR-372-5 p ( p = 0.41; Fig. 1 C). Discussion During the development of murine embryos from the stage of division to blastocyst, expression of miRNAs predominates over other non-coding RNAs, which evidences their likely role in regulating different pathways of differentiation and cell proliferation. [ 12 ] In the present study, the determination of the expression of four miRNAs in the embryo culture media of pregnant and non-pregnant patients demonstrated a stronger expression of hsa-miR-191-5 p in pregnant patients and hsa-miR-24-1-5 p in non-pregnant patients. The miRNAs that showed no significant difference between pregnant and non-pregnant patients were hsa-miR- hsa-miR-21-3 p and hsa-miR-372-5 p (Fig. 1 C). A model is illustrated of activity of hsa-miR191-5 p on endometrial markers in implantation window as well as hsa-miR-24-1-5 p on cell proliferation and migration (Fig. 2 ). Rosenbluth et. al. , (2014) described an increase in miR-191 in the culture media of developing embryos having undergone implantation. [ 13 ] The current results indicated a significant 5.2-times greater expression of this miRNA in the culture media of human embryos of pregnant versus non-pregnant patients. Recently Wang et. al. , (2016) demonstrated that the expression of hsa-miR-191-5 p modulates various proteins, two of which belong to the insulin-type growth factor family (IGF2BP-1 and IGF2R) associated in the decidualization of endometrial tissue. [ 14 ] According to the present findings and data in the literature, miRNAs, are not only potential biomarkers of implantation feasibility, but also could be secreted to the extracellular environment in order to induce activation of the cells or white tissues favoring their implantation and embryonic development. Interestingly, hsa-miR-24-1-5 p showed a 1.6-times greater expression in the embryos of non-pregnant patients (Fig. 1 C). Elevated levels of miR-645 are reported to be correlated with adverse obstetrics tests results related to preeclampsia and intrauterine growth restriction. [ 13 ] Currently, hsa-miR-24-1 was strongly expressed in embryos that failed to be implanted into the endometrium. No significant difference was observed for hsa-miR-21-3 p and the hsa-miR-372-5 p between pregnant and non-pregnant patients (Fig. 1 C). Analysis by prediction software provided evidences that both miRNAs are "constitutive", being involved in the regulation of MAP3K-1 and CDK6 cyclin, critical genes in the cell cycle, as well as signaling and apoptosis pathways. [ 15 ] MiR-372-5 p is known to aid in the conversion of human fibroblasts into pluripotential stem cells, suggesting an important role of this (along with other) miRNAs in balancing differentiation and maintenance of cell pluripotency. Consequently, some miRNAs are linked to embryonic viability and others to poor prognosis. In the future, the full description of embryonic mynAoma may be an especially useful tool in the clinical field. Conclusions In conclusion, hsa-miR-191-5 p is possibly a suitable human embryo development biomarker. This miRNA modulates IGF2BP-1 and IGF2R, which are associated with the implantation period. On the other hand, hsa-miR-24-1-5 p may be associated with a wrong prognosis of human embryo development. Abbreviations BMI: Body mass index; CDK6: cyclin-dependent kinase 6; IVF: in vitro fertilization; hsa-miR: homo sapiens-microRNA; PCR: polymerase chain reaction; RT: Retrotranscription; MAP3K-1: mitogen-activated protein kinase. Declarations Ethics approval and consent to participate Each patient was informed that after the embryo transfer, the culture medium would be taken to perform miRNA expression assays and that this procedure would not affect the development of the embryos. In all cases, the consent signature was obtained. The present protocol was reviewed and approved by the Ethics and Research Committees of the Instituto Nacional de Perinatología (212250-22661). Consent for publication All authors carefully read the manuscript and gave permission to submit the manuscript to the journal of BMC Developmental Biology Availability of data and materials The information available to the study is described in the manuscript. Competing Interest All authors declare that they have no competing interests with respect to the research, authorship, and/or publication of this article. Funding The current study was supported by a grant (212250-22661 assigned to HFH) from the Instituto Nacional de Perinatología “Isidro Espinosa de lo Reyes” of Ciudad de México, México. The institute was not involved in any of the stage of the study so it has no conflict of interest with the content of the manuscript. Authors´ contributions RJAG: performed the experiments for RNA isolation, RT-PCR, determination of the expression by optical density, participated in the discussion of the results and in the preparation of the manuscript. FVMH: perform in vitro fertilization, obtained the culture medium for the development embryos of the embryos, and the discussion of the results. JSLC: participated in the analysis and discussion of results. JLC: participated in the analysis and discussion of results. MOC: carry out the ultrasonographic monitoring of the patients included in this study and in the preparation of the manuscript. HFH: participated in the design of the study, analysis of results, obtaining support for the study and in writing the manuscript Acknowledgments It is part of the experimental work of Ricardo Acuña-González for obtaining the degree of Master of Science (514220750) from the Programa de Ciencias Médicas, Odontológicas y de la Salud, Universidad Nacional Autónoma de México (UNAM). We thank CONACyT for supporting his studies. References Wilczynska A, Bushell M: The complexity of miRNA-mediated repression. Cell Death Differ 2015, 22: 22-33. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO: Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 2007, 9: 654-659. Turchinovich A, Weiz L, Langheinz A, Burwinkel B: Characterization of extracellular circulating microRNA. Nucleic Acids Res 2011, 39: 7223-7233. Li J, Wang G, Jiang J, Zhang L, Zhou P, Ren H: MicroRNA-127-3p regulates myoblast proliferation by targeting Sept7. Biotechnol Lett 2020. Hui P, Wang Y, Chen B, Wang Z, Qin S: Mir-29c Expression in Glioma and Its Effects on Tumor Cell Proliferation and Apoptosis. Iran J Public Health 2020, 49: 304-311. Altmae S, Martinez-Conejero JA, Esteban FJ, Ruiz-Alonso M, Stavreus-Evers A, Horcajadas JA, Salumets A: MicroRNAs miR-30b, miR-30d, and miR-494 regulate human endometrial receptivity. Reprod Sci 2013, 20: 308-317. Estella C, Herrer I, Moreno-Moya JM, Quinonero A, Martinez S, Pellicer A, Simon C: miRNA signature and Dicer requirement during human endometrial stromal decidualization in vitro. PLoS One 2012, 7: e41080. Boren T, Xiong Y, Hakam A, Wenham R, Apte S, Wei Z, Kamath S, Chen DT, Dressman H, Lancaster JM: MicroRNAs and their target messenger RNAs associated with endometrial carcinogenesis. Gynecol Oncol 2008, 110: 206-215. Yang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G: Dicer is required for embryonic angiogenesis during mouse development. J Biol Chem 2005, 280: 9330-9335. Capalbo A, Ubaldi FM, Cimadomo D, Noli L, Khalaf Y, Farcomeni A, Ilic D, Rienzi L: MicroRNAs in spent blastocyst culture medium are derived from trophectoderm cells and can be explored for human embryo reproductive competence assessment. Fertil Steril 2016, 105: 225-235 e221-223. Wang GL, Zhang CY: Sensitive detection of microRNAs with hairpin probe-based circular exponential amplification assay. Anal Chem 2012, 84: 7037-7042. Ohnishi Y, Totoki Y, Toyoda A, Watanabe T, Yamamoto Y, Tokunaga K, Sakaki Y, Sasaki H, Hohjoh H: Small RNA class transition from siRNA/piRNA to miRNA during pre-implantation mouse development. Nucleic Acids Res 2010, 38: 5141-5151. Rosenbluth EM, Shelton DN, Wells LM, Sparks AE, Van Voorhis BJ: Human embryos secrete microRNAs into culture media--a potential biomarker for implantation. Fertil Steril 2014, 101: 1493-1500. Wang Y, Lv Y, Gao S, Zhang Y, Sun J, Gong C, Chen X, Li G: MicroRNA Profiles in Spontaneous Decidualized Menstrual Endometrium and Early Pregnancy Decidua with Successfully Implanted Embryos. PLoS One 2016, 11: e0143116. Maragkakis M, Reczko M, Simossis VA, Alexiou P, Papadopoulos GL, Dalamagas T, Giannopoulos G, Goumas G, Koukis E, Kourtis K, et al: DIANA-microT web server: elucidating microRNA functions through target prediction. Nucleic Acids Res 2009, 37: W273-276. Cite Share Download PDF Status: Published Journal Publication published 13 Jul, 2021 Read the published version in Reproductive Biology and Endocrinology → Version 1 posted Editorial decision: Major revision 30 Jan, 2021 Review # 2 received at journal 27 Jan, 2021 Reviewer # 2 agreed at journal 24 Jan, 2021 Review # 1 received at journal 18 Jan, 2021 Reviewers invited by journal 05 Jan, 2021 Reviewer # 1 agreed at journal 05 Jan, 2021 Editor assigned by journal 29 Nov, 2020 Submission checks completed at journal 29 Nov, 2020 Editor invited by journal 29 Nov, 2020 First submitted to journal 26 Nov, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-122465","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":5910297,"identity":"d5b5b9e3-1935-454a-a04f-cae083bba397","order_by":0,"name":"Ricardo Josue Acuña-González","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ricardo","middleName":"Josue","lastName":"Acuña-González","suffix":""},{"id":5910298,"identity":"c534815b-cd23-49f1-94d2-a9c588f6a5e0","order_by":1,"name":"Fela Vanesa Morales-Hernández","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fela","middleName":"Vanesa","lastName":"Morales-Hernández","suffix":""},{"id":5910299,"identity":"22dffc05-cea4-4f36-a26b-2a2e38e1c085","order_by":2,"name":"Jorge Skiold López-Canales","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"Skiold","lastName":"López-Canales","suffix":""},{"id":5910300,"identity":"8513a6d2-8746-46ef-83a4-75b759b3c2c2","order_by":3,"name":"Jair Lozano-Cuenca","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jair","middleName":"","lastName":"Lozano-Cuenca","suffix":""},{"id":5910301,"identity":"e8c92717-137a-47f3-87c3-0c4d4e1947d1","order_by":4,"name":"Mauricio Osorio-Caballero","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mauricio","middleName":"","lastName":"Osorio-Caballero","suffix":""},{"id":5910302,"identity":"f2832cf7-9e1d-4326-bcc4-9ba3fc37afa3","order_by":5,"name":"Héctor Flores-Herrera","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBAC9nYwdUCOn4GBjTgtPIchWowlG0jVkrjhANFamJmPffjw546x8Y3kZw8+VDDI84sdIKSFLXnmzLZncmY30swNZ5xhMJw5OwG/FntmHmNm3obDxmY3EsykedsYEgxuE9DCA9Ly58/hxM0z0r+RoIWB7XDiBokcom1hS2bsbTtsLHHmTZnkjDMShP3Cw958mOHHn8Ny/O3p2yQ+VNjI80sT0IIAAmCVEsQqBwH+A6SoHgWjYBSMgpEEAJQiP7SwkpcRAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-7604-6158","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Héctor","middleName":"","lastName":"Flores-Herrera","suffix":""}],"badges":[],"createdAt":"2020-12-05 12:41:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-122465/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-122465/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12958-021-00786-1","type":"published","date":"2021-07-13T15:02:28+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":4132141,"identity":"73f0bc8d-7518-48a5-be0c-3499aa01e970","added_by":"auto","created_at":"2020-12-09 17:16:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":79492,"visible":true,"origin":"","legend":"Expression of hsa-miRNAs in the culture medium of human embryos with type II development. Marker (Lane 1), negative control (Lane 2) samples of the culture medium of the 25 implanted (A, pregnant patients) and non-implanted embryos (B non-pregnant patients). The optical density of each band was determined and the mean ± standard deviation is shown (C). The significant difference is indicated which was made by the Student's t-test and was taken as a difference of less than 0.5.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-122465/v1/532630d4068fb2d6c774aec3.jpg"},{"id":4132142,"identity":"9fba129b-8e1e-4597-985a-dc8e2a55e5ec","added_by":"auto","created_at":"2020-12-09 17:16:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":77627,"visible":true,"origin":"","legend":"Differential expression of hsa-miR-191-5p and hsa-miR-24-1-5p in the culture medium of human embryos with type II development. The secretion of hsa-miR-191-5p by developing embryos stimulates the expression of insulin-like growth factor-associated proteins (IGF2BP-1 and IGF2R) associated with the implantation window in endometrial cells and responsible for inducing major changes in the decidualization of endometrial tissue (A) (14). For its part, the increase in the expression of hsa-miR-24-1-5p in the culture medium of developing embryos of non-implanted (non-pregnant patients) has been associated with inhibition in cell proliferation and migration (B).","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-122465/v1/1e89abb57343168be7442c21.jpg"},{"id":15670184,"identity":"1123deaf-9f93-456a-802a-e41d57aa0e08","added_by":"auto","created_at":"2021-11-18 13:57:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":690161,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-122465/v1/43ee00e1-beaf-4371-9d91-e22cc23b40ac.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eMiR-191-5\u003cem\u003ep\u003c/em\u003e Is Upregulated in Culture Media of Implanted Human Embryo on Day Three of Development\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eMicroRNAs (miRNAs), are a large class of small non-coding RNAs with a length of approximately 23 nucleotides. They play an important roles in post-transcriptional gene expression by binding to the complementary sequence of the 3\u0026acute;untransalted region (3\u0026acute;-UTR) or by degrading the target messenger RNA (mRNA) transcripts via complementary base pairing. \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e MiRNAs are essential to many cellular processes and can be transferred between cells to serve as a mode of cell-cell communication, \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e They are relatively stable when circulating. \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eMiRNAs regulate cell differentiation and proliferation, \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e apoptosis, \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e endometrial receptivity, \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e and decidualization. \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e They are involved in the development of different human pathologies, including endometrial cancer. Deficiencies in the processing of pre-miRNAs are associated with defects in embryonic development. \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e There is an elevated differential secretion of miR-372 and miR-645 in the culture media of euploid-implanted versus unplanted blastocysts. \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e The aim of the present study was to quantify the expression profile of hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e, -24-1-5\u003cem\u003ep\u003c/em\u003e, -191-5\u003cem\u003ep\u003c/em\u003e, and \u0026minus;\u0026thinsp;372-5\u003cem\u003ep\u003c/em\u003e on day 3 of culture media from \u003cem\u003ein vitro\u003c/em\u003e fertilization (IVF) embryos that were implanted or failed to be implanted in patients (n\u0026thinsp;=\u0026thinsp;25 pregnant and 25 non-pregnant patients).\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003ePatients and hormonal stimulation\u003c/h2\u003e\n\u003cp\u003eThe present protocol was reviewed and approved by the Ethics and Research Committees of the Instituto Nacional de Perinatolog\u0026iacute;a (212250\u0026thinsp;\u0026minus;\u0026thinsp;22661). After the prospective participants received an explanation of the purpose of the study, those willing to take part signed informed consent. The study was conducted a total of 50 female patients diagnosed with infertility. The Inclusion criteria were an age of \u0026le;\u0026thinsp;37 years, regular menstrual cycles, normal uterine cavity confirmed by hysteroscopy, the absence of intrauterine adhesion or inflammation, \u0026ge;\u0026thinsp;7\u0026nbsp;mm endometrial thickness in the late follicular phase determined by ultrasonography, a normal ovarian reserve (follicle-stimulating hormone\u0026thinsp;\u0026lt;\u0026thinsp;9.0\u0026nbsp;mU/mL), a normal ovarian response to the stimulation protocols (\u0026gt;\u0026thinsp;8 oocytes retrieved in a controlled ovary hyperstimulation cycle), and no use of exogenous hormone (estradiol/progesterone) during the endometrial cycle.\u003c/p\u003e\n\u003cp\u003eThe patients received controlled ovarian stimulation based on an assessment of FSH/LH. Upon observing a follicular diameter of 18\u0026nbsp;mm, oocyte maturation was stimulated with human chorionic gonadotropin, and follicular capture was performed 36 hours later, with ultrasound guidance.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eIn vitro fertilization\u003c/h2\u003e\n\u003cp\u003eOnce oocytes were fertilized \u003cem\u003ein vitro\u003c/em\u003e, and the fertilization was evaluated by the presence of a second polar corpuscle, the development of which was monitored daily until it reached the 36-cell stage. Successfully fertilized oocytes were maintained in G-1 PLUS culture media (Vitrolife, Sweden). Two embryos with type I, II, or III quality on the third day of embryonic development were transferred to the uterine cavity using the Soft Cook technique and Flexible Pass intrauterine transfer cannula guided by abdominal ultrasound equipped with a real-time, 5-MHz sector electronic array endovaginal probe (Philips Epiq CVx; MO, USA). Fourteen days after embryo transfer, ultrasound was employed to analyze the successful implantation of the embryo in relation to endometrial receptivity, finding the development of the embryo sac in positive cases. Based on the results, the patients were assigned to one of two groups: 1) implanted embryos (n\u0026thinsp;=\u0026thinsp;25, pregnant patients) and 2) non-implanted embryos (n\u0026thinsp;=\u0026thinsp;25, non-pregnant patients).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eTotal RNA Isolation, Retrotranscription and Polymerase Chain Reaction\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted with TRIzol reagent (InvitroGen, Carlsbad, CA), according to the manufacturer\u0026acute;s instructions. The concentration of RNA in each sample was measured as the A\u003csub\u003e260\u003c/sub\u003e/A\u003csub\u003e280\u003c/sub\u003e ratio on a NanoDrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA).\u003c/p\u003e\n\u003cp\u003eComplementary DNA synthesis was carried out with AMV-Tfl (A1260, Madison WI, USA) according to manufacturer\u0026acute;s instructions. The total volume of the reaction mixture was 20\u0026nbsp;\u0026micro;L, consisting of 2\u0026nbsp;\u0026micro;l of an RNA samples, 5\u0026nbsp;\u0026micro;l buffer AMV-TfI 1X, 1\u0026nbsp;\u0026micro;l dNTP (10\u0026nbsp;mM), 2\u0026nbsp;\u0026micro;l MgSO\u003csub\u003e4\u003c/sub\u003e [50mM], 10\u0026nbsp;\u0026micro;l ddH\u003csub\u003e2\u003c/sub\u003eO, 1\u0026nbsp;\u0026micro;l AMV RT and 1\u0026nbsp;\u0026micro;L (20\u0026nbsp;pmol) of a specific sequence for primers were performed as follows: hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCC), hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGAT), hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG), and hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATA). The reactions mixture was incubated at 45\u0026nbsp;\u0026deg;C for 45 minutes.\u003c/p\u003e\n\u003cp\u003eThree \u0026micro;L of cDNA product from each culture medium sample was amplified by PCR reactions carried out in 0.2\u0026nbsp;mL PCR tubes in a thermocycler (Techne touchgene gradient). Each tube contained 5\u0026nbsp;\u0026micro;l of buffer AMV-Tfi 1X, 1\u0026nbsp;\u0026micro;l (10\u0026nbsp;mM) dNTP, 2\u0026nbsp;\u0026micro;l (50\u0026nbsp;mM) MgSO\u003csub\u003e4\u003c/sub\u003e, 10\u0026nbsp;\u0026micro;l ddH\u003csub\u003e2\u003c/sub\u003eO, 1\u0026nbsp;\u0026micro;l (20\u0026nbsp;pmol) of a primer sequence. The primers were as follows: hsa-miR21-3\u003cem\u003ep\u003c/em\u003e (CGGCCGCAACACCAGT), hsa-miR24-1-5\u003cem\u003ep\u003c/em\u003e (CGGCCGTGCCTACTGA), hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e (CGGCCGCAACGGAATC), and hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e (CGGCCGCCTCAAATGTG), and 1\u0026nbsp;\u0026micro;l specific universal sequences (5\u0026acute;-GTG CAG GGT CCG AGG T-3\u0026acute; ), the latter of which afforded the hairpin structure for detection. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e PCR cycling conditions were 94\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s and 40 cycles (94\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s, 56\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s, 72\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s) and finally 72\u0026nbsp;\u0026deg;C for 10\u0026nbsp;min.\u003c/p\u003e\n\u003cp\u003eTwenty \u0026micro;L of PCR amplicons were mixed with Tris/Acetic Acid EDTA 1X loading buffer (Bio-Rad, Hercules, CA, USA) and added to wells containing 4.0% agarose gels then run at 60\u0026nbsp;V at a constant temperature for 40 minutes. After electrophoresis, gels were visualized and captured by UV transillumination system (Gel Doc 2000, Bio-Rad, Hercules, CA, USA). The band of expression for the miRNAs of interest were determined by optical density with the ImageJ program (NIH; USA).\u003c/p\u003e\n\u003ch2\u003eStatistics.\u003c/h2\u003e\n\u003cp\u003eMiRNAs data is expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. The comparison between implanted and non-implanted embryos was made by using the Student\u0026acute;s \u003cem\u003et-\u003c/em\u003e test, considering statistical significance at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003ePatient characteristics\u003c/h2\u003e\n\u003cp\u003eThe clinical characteristics of pregnant and non-pregnant patients are show in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. There were no significant differences between the two groups in regard to mean age (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.23), body mass index (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.43), length of the menstrual cycle (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.71), duration of menstrual (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.54), or endometrial thickness on the day of LH surge (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.45).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eCharacteristics of the two groups of women undergoing endometrial receptivity those with implanted and non-implanted embryos.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVariables\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eImplanted (n\u0026thinsp;=\u0026thinsp;25)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNon-implanted (n\u0026thinsp;=\u0026thinsp;25)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAge (years)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e35.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e36.8\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.23\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBMI (Kg/m\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e27.2\u0026thinsp;\u0026plusmn;\u0026thinsp;3.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e26.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.43\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMenstrual cycle length (days)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e27.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e27.9\u0026thinsp;\u0026plusmn;\u0026thinsp;4.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.71\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMenstrual duration (days)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e5.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e5.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.54\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEndometrial thickness (cm)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e10.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e9.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.45\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003eBody mass index (BMI).\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eExpression of miRNAs of pregnant and non-pregnant patients\u003c/h2\u003e\n\u003cp\u003eComparation was made between pregnant and non-pregnant patients of the expression profile of miRNAs obtained from culture media of human embryos, and the optical density for the miRNAs of interest (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The relative optical density detected in the pregnant patients was 71.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0; 47.18\u0026thinsp;\u0026plusmn;\u0026thinsp;2.9; 134.91\u0026thinsp;\u0026plusmn;\u0026thinsp;15.91; and 37.43\u0026thinsp;\u0026plusmn;\u0026thinsp;3.8 for hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e, hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e and hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e, respectively, and in non-pregnant patients was 65.56\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6; 77.0\u0026thinsp;\u0026plusmn;\u0026thinsp;8.3; 24.82\u0026thinsp;\u0026plusmn;\u0026thinsp;4.3; and 40.76\u0026thinsp;\u0026plusmn;\u0026thinsp;3.7 for hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e, hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e and hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e, respectively. Whereas the most abundantly expressed miRNA in pregnant patients was hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e, the least expressed was has-miR-372-5\u003cem\u003ep\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). In non-pregnant patients, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e was the most robustly expressed hsa-miR191-5\u003cem\u003ep\u003c/em\u003e the least expressed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). Upon comparing the samples of pregnant versus non-pregnant patients a 5.2-fold greater level was found for hsa-miR191-5\u003cem\u003ep\u003c/em\u003e in the culture media from human embryos within pregnant patients (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001), and 1.6-fold greater level for hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e in the culture media from human embryos in non-pregnant patients (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.043). No statistically significant differences were detected in relation to hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.38) or hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.41; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDuring the development of murine embryos from the stage of division to blastocyst, expression of miRNAs predominates over other non-coding RNAs, which evidences their likely role in regulating different pathways of differentiation and cell proliferation. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e In the present study, the determination of the expression of four miRNAs in the embryo culture media of pregnant and non-pregnant patients demonstrated a stronger expression of hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e in pregnant patients and hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e in non-pregnant patients. The miRNAs that showed no significant difference between pregnant and non-pregnant patients were hsa-miR- hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e and hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\n\u003cp\u003eA model is illustrated of activity of hsa-miR191-5\u003cem\u003ep\u003c/em\u003e on endometrial markers in implantation window as well as hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e on cell proliferation and migration (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Rosenbluth \u003cem\u003eet. al.\u003c/em\u003e, (2014) described an increase in miR-191 in the culture media of developing embryos having undergone implantation. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e The current results indicated a significant 5.2-times greater expression of this miRNA in the culture media of human embryos of pregnant versus non-pregnant patients. Recently Wang \u003cem\u003eet. al.\u003c/em\u003e, (2016) demonstrated that the expression of hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e modulates various proteins, two of which belong to the insulin-type growth factor family (IGF2BP-1 and IGF2R) associated in the decidualization of endometrial tissue. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e According to the present findings and data in the literature, miRNAs, are not only potential biomarkers of implantation feasibility, but also could be secreted to the extracellular environment in order to induce activation of the cells or white tissues favoring their implantation and embryonic development.\u003c/p\u003e\n\u003cp\u003eInterestingly, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e showed a 1.6-times greater expression in the embryos of non-pregnant patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). Elevated levels of miR-645 are reported to be correlated with adverse obstetrics tests results related to preeclampsia and intrauterine growth restriction. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e Currently, hsa-miR-24-1 was strongly expressed in embryos that failed to be implanted into the endometrium.\u003c/p\u003e\n\u003cp\u003eNo significant difference was observed for hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e and the hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e between pregnant and non-pregnant patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). Analysis by prediction software provided evidences that both miRNAs are \"constitutive\", being involved in the regulation of MAP3K-1 and CDK6 cyclin, critical genes in the cell cycle, as well as signaling and apoptosis pathways. \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e MiR-372-5\u003cem\u003ep\u003c/em\u003e is known to aid in the conversion of human fibroblasts into pluripotential stem cells, suggesting an important role of this (along with other) miRNAs in balancing differentiation and maintenance of cell pluripotency.\u003c/p\u003e\n\u003cp\u003eConsequently, some miRNAs are linked to embryonic viability and others to poor prognosis. In the future, the full description of embryonic mynAoma may be an especially useful tool in the clinical field.\u003c/p\u003e"},{"header":"Conclusions","content":" \u003cp\u003eIn conclusion, hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e is possibly a suitable human embryo development biomarker. This miRNA modulates IGF2BP-1 and IGF2R, which are associated with the implantation period. On the other hand, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e may be associated with a wrong prognosis of human embryo development.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eBMI: Body mass index; CDK6: cyclin-dependent kinase 6; IVF: in vitro fertilization; hsa-miR: homo sapiens-microRNA; PCR: polymerase chain reaction; RT: Retrotranscription; MAP3K-1: mitogen-activated protein kinase.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEach patient was informed that after the embryo transfer, the culture medium would be taken to perform miRNA expression assays and that this procedure would not affect the development of the embryos. In all cases, the consent signature was obtained. The present protocol was reviewed and approved by the Ethics and Research Committees of the Instituto Nacional de Perinatolog\u0026iacute;a (212250-22661).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors carefully read the manuscript and gave permission to submit the manuscript to the journal of BMC Developmental Biology\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe information available to the study is described in the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests with respect to the research, authorship, and/or publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe current study was supported by a grant (212250-22661 assigned to HFH) from the Instituto Nacional de Perinatolog\u0026iacute;a \u0026ldquo;Isidro Espinosa de lo Reyes\u0026rdquo; of Ciudad de M\u0026eacute;xico, M\u0026eacute;xico. The institute was not involved in any of the stage of the study so it has no conflict of interest with the content of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026acute; contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRJAG: performed the experiments for RNA isolation, RT-PCR, determination of the expression by optical density, participated in the discussion of the results and in the preparation of the manuscript.\u003c/p\u003e\n\u003cp\u003eFVMH: perform \u003cem\u003ein vitro\u003c/em\u003e fertilization, obtained the culture medium for the development embryos of the embryos, and the discussion of the results.\u003c/p\u003e\n\u003cp\u003eJSLC: participated in the analysis and discussion of results.\u003c/p\u003e\n\u003cp\u003eJLC: participated in the analysis and discussion of results.\u003c/p\u003e\n\u003cp\u003eMOC: carry out the ultrasonographic monitoring of the patients included in this study and in the preparation of the manuscript.\u003c/p\u003e\n\u003cp\u003eHFH: participated in the design of the study, analysis of results, obtaining support for the study and in writing the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt is part of the experimental work of Ricardo Acu\u0026ntilde;a-Gonz\u0026aacute;lez for obtaining the degree of Master of Science (514220750) from the Programa de Ciencias M\u0026eacute;dicas, Odontol\u0026oacute;gicas y de la Salud, Universidad Nacional Aut\u0026oacute;noma de M\u0026eacute;xico (UNAM). We thank CONACyT for supporting his studies.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWilczynska A, Bushell M: \u003cstrong\u003eThe complexity of miRNA-mediated repression.\u003c/strong\u003e \u003cem\u003eCell Death Differ \u003c/em\u003e2015, \u003cstrong\u003e22:\u003c/strong\u003e22-33.\u003c/li\u003e\n\u003cli\u003eValadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO: \u003cstrong\u003eExosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells.\u003c/strong\u003e \u003cem\u003eNat Cell Biol \u003c/em\u003e2007, \u003cstrong\u003e9:\u003c/strong\u003e654-659.\u003c/li\u003e\n\u003cli\u003eTurchinovich A, Weiz L, Langheinz A, Burwinkel B: \u003cstrong\u003eCharacterization of extracellular circulating microRNA.\u003c/strong\u003e \u003cem\u003eNucleic Acids Res \u003c/em\u003e2011, \u003cstrong\u003e39:\u003c/strong\u003e7223-7233.\u003c/li\u003e\n\u003cli\u003eLi J, Wang G, Jiang J, Zhang L, Zhou P, Ren H: \u003cstrong\u003eMicroRNA-127-3p regulates myoblast proliferation by targeting Sept7.\u003c/strong\u003e \u003cem\u003eBiotechnol Lett \u003c/em\u003e2020.\u003c/li\u003e\n\u003cli\u003eHui P, Wang Y, Chen B, Wang Z, Qin S: \u003cstrong\u003eMir-29c Expression in Glioma and Its Effects on Tumor Cell Proliferation and Apoptosis.\u003c/strong\u003e \u003cem\u003eIran J Public Health \u003c/em\u003e2020, \u003cstrong\u003e49:\u003c/strong\u003e304-311.\u003c/li\u003e\n\u003cli\u003eAltmae S, Martinez-Conejero JA, Esteban FJ, Ruiz-Alonso M, Stavreus-Evers A, Horcajadas JA, Salumets A: \u003cstrong\u003eMicroRNAs miR-30b, miR-30d, and miR-494 regulate human endometrial receptivity.\u003c/strong\u003e \u003cem\u003eReprod Sci \u003c/em\u003e2013, \u003cstrong\u003e20:\u003c/strong\u003e308-317.\u003c/li\u003e\n\u003cli\u003eEstella C, Herrer I, Moreno-Moya JM, Quinonero A, Martinez S, Pellicer A, Simon C: \u003cstrong\u003emiRNA signature and Dicer requirement during human endometrial stromal decidualization in vitro.\u003c/strong\u003e \u003cem\u003ePLoS One \u003c/em\u003e2012, \u003cstrong\u003e7:\u003c/strong\u003ee41080.\u003c/li\u003e\n\u003cli\u003eBoren T, Xiong Y, Hakam A, Wenham R, Apte S, Wei Z, Kamath S, Chen DT, Dressman H, Lancaster JM: \u003cstrong\u003eMicroRNAs and their target messenger RNAs associated with endometrial carcinogenesis.\u003c/strong\u003e \u003cem\u003eGynecol Oncol \u003c/em\u003e2008, \u003cstrong\u003e110:\u003c/strong\u003e206-215.\u003c/li\u003e\n\u003cli\u003eYang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G: \u003cstrong\u003eDicer is required for embryonic angiogenesis during mouse development.\u003c/strong\u003e \u003cem\u003eJ Biol Chem \u003c/em\u003e2005, \u003cstrong\u003e280:\u003c/strong\u003e9330-9335.\u003c/li\u003e\n\u003cli\u003eCapalbo A, Ubaldi FM, Cimadomo D, Noli L, Khalaf Y, Farcomeni A, Ilic D, Rienzi L: \u003cstrong\u003eMicroRNAs in spent blastocyst culture medium are derived from trophectoderm cells and can be explored for human embryo reproductive competence assessment.\u003c/strong\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2016, \u003cstrong\u003e105:\u003c/strong\u003e225-235 e221-223.\u003c/li\u003e\n\u003cli\u003eWang GL, Zhang CY: \u003cstrong\u003eSensitive detection of microRNAs with hairpin probe-based circular exponential amplification assay.\u003c/strong\u003e \u003cem\u003eAnal Chem \u003c/em\u003e2012, \u003cstrong\u003e84:\u003c/strong\u003e7037-7042.\u003c/li\u003e\n\u003cli\u003eOhnishi Y, Totoki Y, Toyoda A, Watanabe T, Yamamoto Y, Tokunaga K, Sakaki Y, Sasaki H, Hohjoh H: \u003cstrong\u003eSmall RNA class transition from siRNA/piRNA to miRNA during pre-implantation mouse development.\u003c/strong\u003e \u003cem\u003eNucleic Acids Res \u003c/em\u003e2010, \u003cstrong\u003e38:\u003c/strong\u003e5141-5151.\u003c/li\u003e\n\u003cli\u003eRosenbluth EM, Shelton DN, Wells LM, Sparks AE, Van Voorhis BJ: \u003cstrong\u003eHuman embryos secrete microRNAs into culture media--a potential biomarker for implantation.\u003c/strong\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2014, \u003cstrong\u003e101:\u003c/strong\u003e1493-1500.\u003c/li\u003e\n\u003cli\u003eWang Y, Lv Y, Gao S, Zhang Y, Sun J, Gong C, Chen X, Li G: \u003cstrong\u003eMicroRNA Profiles in Spontaneous Decidualized Menstrual Endometrium and Early Pregnancy Decidua with Successfully Implanted Embryos.\u003c/strong\u003e \u003cem\u003ePLoS One \u003c/em\u003e2016, \u003cstrong\u003e11:\u003c/strong\u003ee0143116.\u003c/li\u003e\n\u003cli\u003eMaragkakis M, Reczko M, Simossis VA, Alexiou P, Papadopoulos GL, Dalamagas T, Giannopoulos G, Goumas G, Koukis E, Kourtis K, et al: \u003cstrong\u003eDIANA-microT web server: elucidating microRNA functions through target prediction.\u003c/strong\u003e \u003cem\u003eNucleic Acids Res \u003c/em\u003e2009, \u003cstrong\u003e37:\u003c/strong\u003eW273-276.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"reproductive-biology-and-endocrinology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbej","sideBox":"Learn more about [Reproductive Biology and Endocrinology](http://rbej.biomedcentral.com)","snPcode":"12958","submissionUrl":"https://submission.nature.com/new-submission/12958/3","title":"Reproductive Biology and Endocrinology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"MiRNAs expression, embryo development, implantation, embryo culture media","lastPublishedDoi":"10.21203/rs.3.rs-122465/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-122465/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Morphologic features are the most common criteria for selecting human embryo to be transferred to the receptive uterine cavity. However, such characteristics are not valid for embryos in cellular arrest. The aim of this study was to quantify the expression profile of hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e, -24-1-5\u003cem\u003ep\u003c/em\u003e, -191-5\u003cem\u003ep\u003c/em\u003e, and -372-5\u003cem\u003ep\u003c/em\u003e on day 3 of culture media from \u003cem\u003ein vitro\u003c/em\u003e fertilization (IVF) embryo that were implanted or failed to be implanted in patients (n=25 pregnant and 25, non-pregnant patients). \u003c/p\u003e\u003cp\u003eMethods: Fifty patients were accepted in the Department of Reproductive Biology of a Hospital in México City, based on the Institutional inclusion criteria for \u003cem\u003ein vitro\u003c/em\u003e fertilization. On day 3 of development, embryos were transferred to women, and the culture medium was collected from implanted embryos (n=25, pregnant patients) and non-implanted embryos (n=25, non-pregnant). In the culture medium, RNA was isolated using TRIzol reagent. MiRNA expression was detected through RT-PCR with specific primers. Expression bands were quantified using an optic density.\u003c/p\u003e\u003cp\u003eResults: The expression profiles were compared between pregnant and non-pregnant patients revealing a significant 5.2-fold greater expression of hsa-miR-191-5\u003cem\u003ep\u003c/em\u003e in the former group (\u003cem\u003ep \u003c/em\u003e≤0.001) and a significantly higher expression of hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e =0.043) in the latter. No significant difference was found between the two groups in regard hsa-miR-21-3\u003cem\u003ep\u003c/em\u003e or hsa-miR-372-5\u003cem\u003ep\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e =0.41). \u003c/p\u003e\u003cp\u003eConclusions: According to the results, has-miR-191-5\u003cem\u003ep\u003c/em\u003e could possibly be a possible biomarker of adequate human embryo development. This miRNA modulated IGF2BP-1 and IGF2R, which are associated with the implantation window. On the other hand, hsa-miR-24-1-5\u003cem\u003ep\u003c/em\u003e may be related to a poor prognosis of human embryo development.\u003c/p\u003e","manuscriptTitle":"MiR-191-5p Is Upregulated in Culture Media of Implanted Human Embryo on Day Three of Development","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-12-09 17:16:12","doi":"10.21203/rs.3.rs-122465/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-01-31T00:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-01-28T00:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2021-01-25T00:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-01-19T00:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewersInvited","content":"","date":"2021-01-06T00:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2021-01-06T00:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2020-11-30T00:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-11-29T23:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-11-29T23:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-11-27T00:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"reproductive-biology-and-endocrinology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbej","sideBox":"Learn more about [Reproductive Biology and Endocrinology](http://rbej.biomedcentral.com)","snPcode":"12958","submissionUrl":"https://submission.nature.com/new-submission/12958/3","title":"Reproductive Biology and Endocrinology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"24421891-6cf3-4eea-84f2-3e4e7ed5c52a","owner":[],"postedDate":"December 9th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":1400170,"name":"Endocrinology \u0026 Metabolism"}],"tags":[],"updatedAt":"2021-08-22T15:26:59+00:00","versionOfRecord":{"articleIdentity":"rs-122465","link":"https://doi.org/10.1186/s12958-021-00786-1","journal":{"identity":"reproductive-biology-and-endocrinology","isVorOnly":false,"title":"Reproductive Biology and Endocrinology"},"publishedOn":"2021-07-13 15:02:28","publishedOnDateReadable":"July 13th, 2021"},"versionCreatedAt":"2020-12-09 17:16:12","video":"","vorDoi":"10.1186/s12958-021-00786-1","vorDoiUrl":"https://doi.org/10.1186/s12958-021-00786-1","workflowStages":[]},"version":"v1","identity":"rs-122465","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-122465","identity":"rs-122465","version":["v1"]},"buildId":"ehx78VzkSd0WSzXnipQa-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}