{"paper_id":"fe26f718-a30d-4861-bcc9-fe7955606c29","body_text":"Journal of \nEndocrinology\n249:2\n71–82J J Reavey et al. Obesity and menstruation\n-20-0446\nRESEARCH\nObesity is associated with heavy menstruation \nthat may be due to delayed endometrial repair\nJane J Reavey, Catherine Walker, Alison A Murray, Savita Brito-Mutunayagam, Sheona Sweeney, Moira Nicol, \nAna Cambursano, Hilary O D Critchley and Jacqueline A Maybin\nMRC Centre for Reproductive Health, University of Edinburgh, Edinburgh, UK\nCorrespondence should be addressed to J A Maybin: Jackie.Maybin@ed.ac.uk\nAbstract\nHeavy menstrual bleeding is common and debilitating but the causes remain ill \ndefined. Rates of obesity in women are increasing and its impact on menstrual blood \nloss (MBL) is unknown. Therefore, we quantified BMI and MBL in women not taking \nhormones and with regular menstrual cycles and revealed a positive correlation. In a \nmouse model of simulated menstruation, diet-induced obesity also resulted in delayed \nendometrial repair, a surrogate marker for MBL. BrdU staining of mouse uterine tissue \nrevealed decreased proliferation during menstruation in the luminal epithelium of mice \non a high-fat diet. Menstruation is known to initiate local endometrial inflammation \nand endometrial hypoxia; hence, the impact of body weight on these processes was \ninvestigated. A panel of hypoxia-regulated genes ( VEGF, ADM, LDHA, SLC2A1) showed \nconsistently higher mean values in the endometrium of women with obesity and in uteri \nof mice with increased weight vs normal controls, although statistical significance was \nnot reached . The inflammatory mediators, Tnf and Il6 were significantly increased in the \nuterus of mice on a high-fat diet, consistent with a pro-inflammatory local endometrial \nenvironment in these mice. In conclusion, obesity was associated with increased MBL in \nwomen. Mice given a high-fat diet had delayed endometrial repair at menstruation and \nprovided a model in which to study the influence of obesity on menstrual physiology. \nOur results indicate that obesity results in a more pro-inflammatory local endometrial \nenvironment at menstruation, which may delay endometrial repair and increase \nmenstrual blood loss.\nIntroduction\nAbnormal uterine bleeding (AUB) is a common and \nincapacitating symptom that affects up to one in three \nwomen of reproductive age (RCOG 2011). Heavy menstrual \nbleeding (HMB) is one of the most common reasons for \nreferral to gynaecology clinics with greater than 800,000 \nwomen seeking treatment per year in the United Kingdom \nalone ( NICE 2018 ). In addition, HMB has a significant \neconomic impact. A conservative estimation of the cost \nof menstrual complaints from the United States revealed \nthat each woman with HMB spends $333 per year on extra \nmenstrual and pharmaceutical products. Furthermore, \nindirect costs due to work absence or inability to perform \nchildcare/household tasks resulted in a loss of $2291 \nper woman per year ( Frick et al. 2009). These figures are \nin addition to the financial costs generated in general \npractice and specialist hospital services. Subjectively, \nHMB is defined as excessive menstrual blood loss which \ninterferes with a woman’s physical, social, emotional \n2\nKey Words \n f endometrium\n f menses\n f inflammation\n f obese\n f menorrhagia\n f AUB\nJournal of Endocrinology  \n(2021) 249, 71–82\n249\nhttps://doi.org/10.1530/JOE-20-0446\nPublished by Bioscientifica Ltd.\n© 2021 The authors\nPrinted in Great Britain\nhttps://joe.bioscientifica.com\n This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n72\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\nand/or material quality of life ( NICE 2018). An objective \ndefinition is a total menstrual blood loss (MBL) of greater \nthan 80 mL per menstrual cycle.\nAccording to the FIGO classification system, abnormal \nuterine bleeding may be categorised into structural causes \n(PALM: Polyps, Adenomyosis, Leiomyoma, Malignancy \nand hyperplasia) and non-structural causes (COEIN: \nCoagulopathy, Ovulatory dysfunction, Endometrial, \nIatrogenic and Not otherwise classified) ( Munro et  al. \n2011, 2018). Up to 50% of women have no structural \ncause for their regular AUB and are assigned the AUB-E \n(AUB of endometrial origin) category. The cause of AUB-E \nremains undefined but current studies implicate excessive \ninflammation, delayed repair of the endometrium and/or \nimpaired vasoconstriction of the specialised endometrial \nspiral arterioles ( Marsh et al. 1997, Abberton et al. 1999, \nMalik et al. 2006, Critchley et al. 2020).\nObesity is an abnormal or excessive fat accumulation \nthat presents a risk to health and is quantified as a BMI of \n≥30 kg/m2 (see WHO Fact Sheet 'Obesity and overweight' \nwebsite: https://www.who.int/news-room/fact-sheets/\ndetail/obesity-and-overweight (accessed 27 August 2020)). \nData from the Health Survey for England showed that \nthe prevalence of obesity in women aged 35–44 was 24% \nin 2009, 30% in 2018 and has increased to 33% in 2019 \n(NHS 2020 ). Obesity has previously been identified as \nhaving a profound impact on female reproductive health. \nHigh BMI is associated with early initiation of menarche, \nmenstrual irregularities during adolescence, polycystic \novary syndrome, suboptimal hormonal contraceptive \nefficacy and infertility ( Zaadstra et al. 1993, Pettigrew & \nHamilton-Fairley 1997 , Lash & Armstrong 2009 , Kulie \net al. 2011). Adipose tissue is a major endocrine organ and \nadipose-derived hormones may have a significant impact \non uterine/endometrial function and thus influence \non quantity of MBL. Minimal data are available in the \nliterature to determine the influence of BMI on volume \nof menstrual blood loss, making it difficult to counsel \nwomen appropriately in the clinical setting.\nWe hypothesised that a high BMI would result in \nincreased menstrual blood loss and contribute to the \nsymptom of HMB. To test this hypothesis, 121 women \ncompleted a pictorial based assessment chart (PBAC) \nof their menstrual loss and calculated their BMI. To \ndecrease genetic and environmental heterogeneity, we \nalso used a mouse model of simulated menstruation \n(Brasted et  al. 2003 ) where mice were randomised to a \nhigh-fat or control diet for three months prior to menses \ninduction. As a surrogate marker of MBL, endometrial \nrepair was graded and compared in the two groups  \n(Kaitu’u-Lino et al. 2007). Current evidence indicates that \nhypoxia is required for efficient endometrial repair in both \nwomen and the mouse model of simulated menses (Maybin \net al. 2018) and that increased endometrial inflammation is \nassociated with HMB (Malik et al. 2006). Therefore, a panel \nof hypoxia regulated genes and inflammatory mediators \nwere compared in human and mouse tissue, comparing \nresults in normal and high BMI/weight groups.\nMethods\nHuman studies\nHeight and weight measurement were obtained from \n164 healthy women of reproductive age attending \ngynaecological outpatient clinics in NHS Lothian. \nWritten consent was obtained from all participants \nand a favourable ethical opinion granted from Lothian \nResearch Ethics Committee (REC 15/WS/0212,  \nREC 10/S1402/59, REC 07/S1103/29, REC 1994/6/17). All \nwomen reported regular menstrual cycles (21–35 days). \nThe women were not using hormonal contraceptives and \nhad no exogenous hormone exposure for 2 months prior \nto participation. In this study, 121 women returned a fully \ncompleted pictorial-based assessment chart (PBAC; Fig. \n1) (Table 1). The PBAC contains pictorial representation \nof graded staining from slight to severe, across different \nFigure 1\nParticipant recruitment. PBAC, pictorial-based assessment chart.\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n73\nResearch\nJ J Reavey et al. Obesity and menstruation\n249:2\nJournal of \nEndocrinology\nabsorbencies of menstrual towels and tampons. This \nis a validated technique and correlates with objective \nmenstrual blood loss measurements obtained using the \nalkaline haematin method (Wyatt et al. 2001). Participants \nwere asked to complete the PBAC each time they changed \ntheir menstrual pad/tampon over one menses. A scoring \nsystem for the PBAC was based on previous studies to give \nan estimated MBL in millilitres (Higham et al. 1990, Wyatt \net al. 2001).\nEndometrial biopsies ( n  = 28) were collected during \nthe late secretory or menstrual phase with a suction \ncurette (Pipelle, Laboratorie CCD, Paris, France) from a \nsubset of participants without fibroids >3 cm or symptoms \nof endometriosis (Table 1). Twenty women had a BMI <30 \nand 8 a BMI >30. Tissue was divided and (i) placed in \nRNA later, RNA stabilization solution (Ambion (Europe) \nLtd., Warrington, UK), (ii) fixed in 4% neutral buffered \nformalin for wax embedding. Biopsies were confirmed as \nlate secretory/menstrual by (i) histological dating (criteria \nof Noyes et al. 1950), (ii) reported last menstrual period \nand (iii) serum progesterone and oestradiol concentrations \nat the time of biopsy (Table 2).\nMenstrual blood loss (MBL) was objectively measured \nin the women providing endometrial tissue using a \nmodified alkaline haematin method ( Hallberg & Nilsson \n1964, Maybin et al. 2017) and heavy menstrual bleeding \n(HMB) defined as a blood loss of >80 mL per cycle. \nWomen were given the same brand of menstrual products \n(Tampax® tampons/Always® towels, Proctor & Gamble, \nUK) with verbal and written instruction on collection. The \ntechnique was validated in our laboratory using a known \nvolume of whole blood applied to menstrual products. \nThe proportion of women with HMB in those with a BMI \n<30 and >30 who provided endometrial biopsies was 60% \nand 50%, respectively.\nMouse studies\nAll experimental animal procedures were approved by \nthe University of Edinburgh ethical committee and \nperformed in accordance with the Animals Scientific \nProcedures Act (1986) of the UK Home Office (PPL \n70/8754). Female C57BL/6JOlaHsd mice were purchased \nfrom Envigo (Hillcrest, UK). Mice were randomised to \nhigh fat or control diet (Special Diets Services 826172 \n– RM 58% AFE Fat or 826171 – RM 11% AFE Fat) for  \n12 weeks and body weight recorded weekly. Endometrial \nshedding and repair were simulated in ovariectomised \nmice as previously described (Brasted et al. 2003, Cousins \net al. 2014). In brief, 6- to 9-week-old female mice were \novariectomised on day 1 of the protocol to deplete \nendogenous steroid production. Mice then received daily \nsubcutaneous injections of oestradiol (E 2) in peanut oil \n(100 ng) on days 7–9. A progesterone implant (P4) was \nplaced subcutaneously on day 13, mice also received \ndaily injections of E 2 (5 ng) from days 13 to 15. On day \n15, decidualisation of one uterine horn was induced by \ntranscervical injection of 20 μL peanut oil using a non-\nsurgical transfer device (ParaTechsTM, Lexington, KY, \nUSA). Decidualisation is a prerequisite for endometrial \nbreakdown at menses. P4-withdrawal was induced 4 days \nafter decidualisation (day 19) by removal of the P4 implant \nto trigger endometrial breakdown and repair. Mice received \nan intra-peritoneal injection of bromodeoxyuridine \n(BrdU, 0.25 mg) 1.5 h prior to culling. Mice were culled \nby cervical dislocation 24 h after P4-withdrawal (T24). \nUteri were dissected and collected in RNA later (Ambion) \nand 4% neutral buffered formalin for paraffin embedding. \nAny animal with failed decidualisation was excluded from \nthe study as there was no endometrial breakdown/repair \nTable 1 Summary of characteristics of 121 participants \ncompleting the pictorial-based assessment chart (PBAC) as \nmean (range) or number (%).\nCharacteristics of the participants  \nAge 42.8 (19–55)\nParity 1.6 (0–4)\nBody mass index 26.9 (17.2–43.6)\nFibroids on ultrasound\n Present 48 (39.7%)\n Absent 58 (47.9%)\n Unknown 15 (12.4%)\nFibroid size (cm)* 4.4 (0.5–11.8)\nSmoking (never) 50 (41.3%)\nUse of mefenamic acid/tranexamic acid \nduring PBAC\n42 (34.7%)\nDiabetes 1 (0.82%)\n*Measurements only in women with fibroids present.\nTable 2 Serum hormone levels in women providing endometrial biopsies.\nNon-obese (BMI<30, n  = 20) Obese (BMI>30, n  = 8)\nMean BMI, kg/m2 (range) 22.6 (20.6–28.9) 37.1 (33.3–42.3)\nMean serum oestradiol, pmol/L (range) 247.5 (20–1142) 258.3 (78–1177)\nMean serum progesterone, nmol/L (range) 8.37 (0.2–18.9) 2.2 (0.2–3.4)\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n74\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\nto grade. This was n  = 2 out of 12 mice fed a normal diet \n(16.6% failed decidualisation rate) and n  = 9 out of 15 \nmice on a high fat diet (60% failed decidualisation rate).\nEndometrial repair histological grading\n5μm mouse uterine sections were stained with \nhaematoxylin and eosin (H&E) and stage of breakdown/\nrepair graded by two masked independent observers using \na previously published scoring system ( n  = 11 normal \ndiet, n  = 6 high-fat diet) ( Kaitu’u-Lino et al. 2007, 2009,  \nMaybin et al. 2018) (Table 3). Very occasionally a section \nshowed features between two grades and this was assigned \na score of x.5. The average score from the two reviewers was \nused to grade endometrial repair in each mouse. Where \nscores differed by >2 grades, the observers examined the \nslide together and decided upon the most appropriate \nscore. Statistical analysis was carried out on the finalised \nhistological scores. The data are displayed as a percentage \nof mice at each repair grade and values were rounded to \nthe nearest whole, with values of >0.5 rounded up.\nImmunohistochemistry\nEndometrial cell proliferation was detected in 5 μm mouse \nuterine sections using BrdU antibody. Paraffin sections \nwere dewaxed and rehydrated. Heat induced antigen \nretrieval was carried out in 0.1 M citrate buffer (pH 6) in \na pressure cooker. Endogenous peroxidase activity was \nquenched by immersing slides in 3% hydrogen peroxide \nin methanol. Sections were sequentially incubated \nin avidin and biotin (Vector, Burlingame, CA, USA) \naccording to manufacturer’s instructions. Normal rabbit \nserum was used as protein block (30 min) and as diluent \nfor primary and secondary antibodies. BrdU antibody \n(Fitzgerald, Acton, MA, USA) was applied (1:5000) and \nsections incubated overnight at 4°C. Negative controls \nwere incubated with Sheep IgG (Merck, Dorset, UK) \nat the same concentration as the primary antibody.  \nBiotinylated rabbit anti-sheep secondary antibody (Vector) \nwas applied at 1:200 for 30 min. Sections were incubated \nwith avidin-biotin-peroxidase complex (Vector) before \nvisualisation of positive signal using diaminobenzidine \n(DAKO, Santa Clara, CA, USA). Sections were counter-\nstained with hematoxylin, dehydrated and mounted with \nPertex (Cellpath, Hemel Hempstead, UK). The images \nwere taken using a Zeiss Z1 imager widefield microscope \n(×20 magnification), captured by Axiocam HRC camera \nand processed using ZEN software.\nReal-time quantitative reverse transcription PCR\nTotal RNA from human endometrium and mouse uterine \nsamples was extracted using the RNeasy Mini Kit (Qiagen \nLtd) according to manufacturer’s instructions. RNA \nsamples were reverse transcribed using iScript cDNA \nsynthesis kit (Bio-Rad Laboratories Ltd) alongside control \nsamples. mRNA transcripts were quantified relative to \nappropriate reference genes (Human: SDHA and ATP5B, \nMouse: RLP13 and ACTB), as determined by geNorm \nassay (Primerdesign Ltd, Southampton, UK). Specific \nprimers were designed using the universal probe library \nassay design centre and checked with BLAST ( Table 4). \nReactions were performed in triplicate alongside controls \nusing ABI QuantStudio system under standard conditions \nwith TaqPath ProAmp Master Mix (Life Technologies). \nQuantification was performed using the 2-ΔΔCt \nmethod with normalisation against a sample of liver or  \nplacental cDNA.\nStatistical analysis\nStatistical analysis was performed using the GraphPad \nPrism 8 Software version 8.4.3 (GraphPad Prism Software, \nInc.). Since the MBL values were highly skewed, the \nassociation between MBL and BMI was assessed by linear \nregression using the logarithms of the MBL values as \nthe response variable. Forward stepwise multiple linear \nregression was used to test which other factors significantly \npredicted the logarithm of MBL after adjusting for the \nTable 3 Histological scoring system for endometrial repair (Kaitu’u-Lino et al. 2007).\nHistological repair grade Histological description\n1 Decidualised tissue. Expansion of stromal compartment, presence of decidual cells. Glands pushed towards \nthe myometrium.\n2 Early breakdown. Some loss of structural integrity between decidual cells. Most decidua still intact.\n3 Complete breakdown. Complete tissue destruction in decidual zone. No intact decidual tissue. Some \nsloughing of the endometrium from the myometrium.\n4 Early repair. Beginnings of re-epithelialisation. Dissociation of necrotic tissue from the myometrium.\n5 Complete repair. Stromal restoration, complete re-epithelialisation. Small amount of luminal debris.\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n75\nResearch\nJ J Reavey et al. Obesity and menstruation\n249:2\nJournal of \nEndocrinology\neffect of BMI. Mann–Whitney tests were used to analyse \nmouse endometrial repair and human and mouse PCR \ndata. A value of P < 0.05 was considered statistically \nsignificant.\nResults\nThere is a positive correlation between BMI and \nmenstrual blood loss measured by PBAC score\nHeavy menstrual bleeding, defined as a PBAC score >80 mL, \nwas present in 63% of participants. Women with obesity \n(BMI >30) constituted 25% of all participants. Regression \nanalysis showed a weak positive association between \nmenstrual pictorial-based assessment chart (PBAC) score \nand BMI (Fig. 2, P = 0.02). Multiple regression showed that \nonly the presence of fibroids added significantly to BMI in \npredicting PBAC (P = 0.004), with BMI remaining borderline \nsignificant when adjusted for fibroids (P = 0.051). Among \nother potential confounders, after adjusting for BMI and \nfibroids, the P-values were, respectively, 0.43 for age, 0.57 \nfor parity, 0.08 for smoking and 0.14 for mefenamic or \ntranexamic acid. Given the known heterogeneity of \nthese human participants, including age, parity, presence \nof fibroids and genetic variations ( Table 1), we used the \nmouse model of simulated menstruation.\nMice with high body weight had delayed \nendometrial repair\nWomen with HMB are known to bleed for longer \nthan those with normal loss ( Maybin et  al. 2018 ),  \nconsistent with delayed endometrial repair. As \ndetermination of menstrual blood loss is difficult and \noften inaccurate in mice, we quantified endometrial \nrepair as a surrogate marker for HMB. Mice were placed on \na high fat or normal diet prior to induction of simulated \nmenstruation to define the role of weight on endometrial \nrepair during menstruation (Fig. 3A).\nMice on a high fat diet ( n  = 6) had a significantly \nincreased body weight ( P < 0.0001) with a mean weight \nof 34 g vs a mean weight of 23 g in mice maintained on a \nnormal diet (n  = 10) (Fig. 3B). Quantification of endometrial \nbreakdown and repair from grade 1 (decidualisation) to 5 \n(full repair) was assessed at 24 h following progesterone \nwithdrawal. This timepoint was selected as endometrial \nrepair has previously been shown to be well underway by \n24 h after removal of the progesterone pellet (the trigger \nfor menstruation). This revealed that mice on a high \nFigure 2\nAssociation between human participant BMI and menstrual blood loss \n(MBL). Linear correlation analysis of BMI and MBL assessed by pictorial-\nbased assessment chart (PBAC) score.\nTable 4 Details of PCR primers and universal probe library probe number.\nGene of interest Primer (forward) Primer (reverse) Probe\nVEGFA CATTGGAGCCTTCCCTTG ATGATTCTGCCCTCCTCCTT 22\nADM GCCTGCCCAGACCCTTAT GTAGCGCTTGACTCGGATG 57\nLDHA TCTCTGTAGCAGATTTGGCAGA AAGACATCATCCTTTATTCCGTAAA 31\nSLC2A1 GGTTGTGCCATACTCATGACC CAGATAGGACATCCAGGGTAGC 67\nIL10 TGGGGGAGAACCTGAAGAC CCTTGCTCTTGTTTTCACAGG 30\nIL6 GATGAGTACAAAAGTCCTGATCCA CTGCAGCCACTGGTTCTGT 40\nIl1B TACCTGTCCTGCGTGTTGAA TCTTTGGGTAATTTTTGGGATCT 78\nTNF TCCAGACTTCCTTGAGACACG CCCGGTCTCCCAAATAAATAC 36\nVegfa TTAAACGAACGTACTTGCAGATG AGAGGTCTGGTTCCCGAAA 4\nAdm TTCGCAGTTCCGAAAGAAGT AGCGAGTCCCGTAGGGTAG 42\nLdha GGCACTGACGCAGACAAG TGATCACCTCGTAGGCACTG 12\nSlc2a1 GGACCCTGCACCTCATTG GCCACGATGCTCAGATAGG 20\nIl10 CAGAGCCACATGCTCCTAGA TGTCCAGCTGGTCCTTTGTT 41\nIl6 GCTACCAAACTGGATATAATCAGGA CCAGGTAGCTATGGTACTCCAGAA 6\nIl1b AGTTGACGGACCCCAAAAG AGCTGGATGCTCTCATCAGG 38\nTnf CTGTAGCCCACGTCGTAGC TTTGAGATCCATGCCGTTG 25\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n76\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\nfat diet had significantly delayed endometrial repair vs \nthose on a normal diet (mean 3.5 vs 4.4, P < 0.05). The \npercentage of mice at each endometrial repair grade is \nshown in Fig. 3C and representative images of histological \ngrade 5 (full repair) and grade 3 (complete breakdown), \nthe most common grade assigned in the normal and high-\nfat diet groups respectively, are shown in Fig. 3D.\nMice with high body weight had decreased \nendometrial cell proliferation 24h following \nprogesterone withdrawal\nProgesterone withdrawal is the trigger for menstruation \nand we have previously determined that 24h following \nprogesterone implant removal in our mouse model is the \ntime of active endometrial repair ( Maybin et  al. 2018 ). \nTo examine the impact of body weight on endometrial \ncell proliferation at menstruation, immunohistochemical \nstaining for BrdU was carried out on uterine sections \ncollected 24 h following progesterone withdrawal. This \nrevealed positive nuclear staining in luminal epithelial \ncells and occasional stromal cells ( Fig. 4). Comparison of \nstaining from mice on a normal vs high-fat diet showed \nincreased BrdU staining at 24 h in mice maintained on a \nnormal diet (Fig. 4).\nImpact of obesity on hypoxia regulated genes\nWe have previously shown that a lack of hypoxia delays \nendometrial repair ( Maybin et  al. 2018 ). Therefore, we \ninvestigated the impact of high body weight on a panel \nof known hypoxia-regulated genes in uterine samples \nfrom mice and endometrium from women in the late \nsecretory/menstrual phase without fibroids >3 cm ( Fig. \n5A). Mice with high body weight had significantly \nincreased uterine  Slc2a1  24 h following progesterone \nwithdrawal compared to those of normal weight  \n(P< 0.05) but this increase was not observed for Vegfa, \nAdm or Ldha. In women, there were no significant \ndifferences in late secretory/menstrual phase endometrial \nVEGFA, ADM, LDHA or SLC2A1 between obese women \nand those with a normal BMI ( Fig. 5B).\nImpact of obesity on local uterine \ninflammatory markers\nIncreased inflammation of the endometrium at \nmenstruation has previously been associated with heavy \nmenstrual bleeding (Smith et al. 1981, Malik et al. 2006). \nWe examined four recognised inflammatory mediators in \nthe mouse uterine and human endometrial samples taken \nFigure 3\nA high fat diet resulted in delayed endometrial \nrepair in the mouse model of menstruation. (A) \nMouse model of simulated menstruation. E, \noestradiol, Ovex ovariectomy. T0 time of \nprogesterone implant removal, T8, 8h following \nprogesterone withdrawal, T24, 24h following \nprogesterone withdrawal. (B) Mice maintained on \na high-fat diet for 3 months prior to menses \ninduction had significantly increased body weight \nat the time of ovariectomy when compared to \nthose on normal diet. (C) Mice on a high-fat diet \nhad significantly decreased histological repair \ngrades 24 h following progesterone withdrawal. \nThe graph shows the percentage of mice at each \nrepair grade. (D) Representative images of \nhistological repair grade 5 (LE, luminal epithelium \nfully restored) and grade 3 (DM, decidualised \nmass present, minimal epithelial coverage). E, \nendometrium. ****P< 0.0001, *P < 0.05.\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n77\nResearch\nJ J Reavey et al. Obesity and menstruation\n249:2\nJournal of \nEndocrinology\nFigure 4\nMice on a high fat diet have decreased endometrial BrdU staining 24 h following progesterone withdrawal. Upper panel = representative slides from \nthree mice on normal diet. Lower panel = representative slides from three mice on a high fat diet. Images on right of each panel = higher magnification. \nLE, luminal epithelium; DM, decidualised mass; E, endometrium; My, myometrium; insets, negative control stained with concentration matched IgG.\nFigure 5\nReverse transcription quantitative real-time PCR assessment of hypoxia-regulated genes. (A) Vegfa, Adm, Ldha and Slc2a1 concentrations in decidualised \nuterine tissue from mice on normal (n  = 10) and high-fat (n  = 6) diets 24 h following progesterone withdrawal. (B) VEGFA, ADM, LDHA and SLC2A1 \nconcentrations in late secretory and menstrual endometrial tissue from women with a normal BMI (<30, n  = 20) and those who are classified as having \nobesity (>30, n  = 8). Mean and s.e.m . mean displayed on graphs, *P < 0.05.\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n78\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\nfrom women in the late secretory/menstrual phase without \nfibroids >3 cm. Mice on a high fat diet had significantly \nincreased uterine Tnf and  Il6  when compared to mice \nmaintained on normal diet ( P < 0.05) ( Fig. 6A ). There \nwere no significant differences in uterine Il10 or Il1b, but \nboth inflammatory mediators had a higher median value \nthan mice on a high fat diet. Endometrium from women \nwith obesity did not show significantly higher TNF or IL6,  \nIL10 or IL1B vs endometrium from women with a normal \nBMI (Fig. 6B).\nDiscussion\nIn the present study, we found that the BMI of women \nwas positively correlated with menstrual blood loss. Mice \non a high fat diet had significantly increased body weight \nand delayed endometrial repair at simulated menstruation \nwhen compared to mice on a normal diet, consistent with \nprolonged menstrual bleeding. Examination of the uterus \nof these high fat diet mice 24 h following progesterone \nwithdrawal (i.e. at the time of menstrual repair) \nrevealed decreased luminal epithelial cell proliferation \nand increased local inflammatory mediators. These \nfindings indicate that increased body weight impacts on \nendometrial function during menstruation resulting in \nincreased menstrual blood loss.\nAdipose tissue is a dynamic tissue with important \nmetabolic and endocrine functions ( Ouchi et  al. 2011 ). \nIt has a key role in metabolism of sex steroids and is \nan important source of oestrogen due to its aromatase \nactivity, converting androgens to oestrone ( Siiteri 1987). \nThis has significant implications in post-menopausal \nwomen with obesity, providing unopposed oestrogens \nand increasing the risk of endometrial cancer ( Onstad \net  al. 2016 ). Adipose tissue is also known to produce a \nnumber of adipokines, including leptin, adiponectin, \nresistin and plasminogen activator inhibitor-1 ( Kershaw \n& Flier 2004 ). Adipose tissue functions are dysregulated \nin those with obesity ( Ouchi et al. 2011), with aberrant \nFigure 6\nRT-qPCR assessment of inflammatory mediators. (A) Tnf, Il6, Il10, Il1b in decidualised uterine tissue from mice on normal (n  = 10) and high-fat (n  = 6) diets \n24 h after progesterone withdrawal. (B) TNF, IL6, IL10, IL1B in endometrial tissue following progesterone withdrawal from women with normal (<30,  \nn  = 20) and obese (>30, n  = 8) BMI measurements. *P < 0.05.\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n79\nResearch\nJ J Reavey et al. Obesity and menstruation\n249:2\nJournal of \nEndocrinology\nsecretion of adipokines altering inflammatory responses, \nendothelial cell function and coagulation.\nPrevious studies assessing the impact of obesity on \nendometrial function have focused mainly on endometrial \ncancer ( MacKintosh et  al. 2019 ) or implantation during \nassisted conception ( Broughton & Moley 2017 ). To our \nknowledge, this is the first study of the impact of obesity \non the volume of menstrual blood loss in regularly cycling \nwomen, where there is sequential exposure to oestradiol \nand progesterone. We found a weak positive correlation \nbetween BMI and menstrual blood loss assessed by PBAC \nscore. This human data is limited by a number of factors. \nWe assessed the amount of menstrual blood loss over one \ncycle and acknowledge that the volume of blood may \nvary in different cycles in the same woman. Our sample \npopulation had a high prevalence of HMB, with 63% \nhaving an estimated menstrual blood loss of >80 mL. \nPrevalence of HMB in the general population has been \nestimated at up to 33% ( RCOG 2011), although lack of \na robust definition that considers cultural, social and \nenvironmental influences means these figures may be \ndifficult to interpret. However, caution should be applied \nin generalising the findings herein to non-gynaecology \nsettings. We also acknowledge the heterogeneity of the \nwomen in our study and that BMI and menstrual blood \nloss have multiple risk factors. The lipid profile of our study \nparticipants was unknown. Although increased serum \ntriglycerides are associated with endometrial cancer (Seth \net al. 2012) the impact of lipid profile on the endometrium \nand menstrual physiology requires further research. Only \none participant in our study had diabetes so we feel this \nfactor would not have been a significant confounder. \nMultiple regression analysis for the presence of fibroids \nrevealed that the correlation between BMI and menstrual \nblood loss remained close to statistical significance, \nindicating that there is still a strong suggestion of a BMI \neffect on menstrual blood loss independent of the effect \nof fibroids. However, other factors such as adenomyosis \nand the presence of coagulopathies ( Munro et  al. 2018) \nwere unknown in our study population. Therefore, to \nminimise heterogeneity and delineate the role of body \nweight on endometrial function at menstruation, we \nutilised our mouse model of simulated menses. We \nobserved reduced rates of decidualisation in response to \nthe artificial stimulus of transcervical injection of oil, \nconsistent with previously published findings in obese \nmice without hormone manipulation to induce menses. \nThis previous study examined the impact of obesity on \nimplantation and found that mice on a high fat diet had \nimpaired decidualisation, with 50% smaller deciduomas \nin pseudopregnant mice and significantly smaller \nimplantation sites in pregnant mice ( Rhee et  al. 2016 ). \nThe mechanism for this reduced decidualisation rate in \ndiet-induced obesity remains undetermined and is an \narea for future research. The impaired decidualisation rate \nseen in women with polycystic ovary syndrome has been \nlinked to progesterone resistance ( Piltonen et  al. 2015 ) \nand it remains to be determined if obesity has a similar \nimpact on endometrial progesterone response.\nIn the mice that underwent decidualisation, which is \na prerequisite for menstruation, we observed significantly \ndelayed endometrial repair 24 h after progesterone \nwithdrawal in mice on a high-fat diet. This diet induced \nmouse model of obesity has been extensively used to \nstudy endocrine and inflammatory mechanisms in \nobesity (Lyall et al. 2020, Zheng et al. 2020). However, a \nlimitation of this model is that it excludes non-dietary risk \nfactors for obesity, for example, altered sleep patterns, lack \nof physical activity and endocrine disruption. This may \nbe a potential limiting factor when translating results to \nhumans. It is possible that the difference in endometrial \nrepair between our two groups is not caused by diet, but \nis instead an artefact of differences in the decidualisation \nfailure rate caused by the diet. However, our necessary \nexclusive inclusion of mice that have decidualised in the \nhigh-fat diet group is clinically relevant, as this is a similar \nselection process to our inclusion of women with a high \nBMI who have regular menstrual cycles, tha is, are likely to \nbe ovulating regularly and therefore undergo spontaneous \ndecidualisation in the secretory phase. Women with \novulatory dysfunction should be treated using different \nclinical protocols to those presenting with regular \ncycles. Our findings in this mouse model are consistent \nwith our finding of a positive correlation between BMI \nand MBL in regularly cycling women. Examination of \nendometrial proliferation revealed decreased luminal \nepithelial BrdU staining in mice on a high-fat diet. \nLuminal reepithelialisation is an essential part of repair of \nthe denuded endometrial surface at menstruation ( Garry \net al. 2009) and reduced proliferation may contribute to \nprolonged menstrual bleeding. A potential explanation \nfor this decreased proliferation may be the altered effects \nof leptin with increased body weight. Leptin is a hormone \nsecreted from adipose cells that regulates energy balance \nby suppressing food intake. Obesity has been shown \nto cause leptin resistance ( Klok et  al. 2007 ). A human \nendometrial epithelial cell line exposed to physiological \nlevels of leptin displayed increased proliferation  in vitro , \nleading authors to propose that leptin has an important \nrole in endometrial remodelling (Tanaka & Umesaki 2008).  \nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n80\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\nHence leptin resistance in those with obesity may result in \ndecreased endometrial proliferation and could contribute \nto delayed endometrial repair at menstruation.\nWe have shown that endometrial hypoxia is necessary \nfor normal endometrial repair in our mouse model of \nsimulated menstruation ( Maybin et al. 2018). Therefore, \nwe examined a panel of known hypoxia regulated genes \nto determine if there was an altered endometrial hypoxic \nresponse at menstruation in those with obesity. Data herein \nshow a non-significant trend towards increased hypoxia-\nregulated genes in endometrium from high fat diet mice \nand from women with a BMI >30. We acknowledge \nthat our numbers for these studies in mouse uterus and \nhuman endometrial tissue are relatively small and there is \nvariability in our outcome measurements, likely due to the \nheterogeneity and complexity of examining in vivo tissue. \nThis may account for the lack of statistical significance. \nThis non-significant increase in hypoxia regulated \nfactors was unexpected and may be due to relative low \nnumbers but could also be explained by increased or \nprolonged endometrial hypoxia during menstruation in \nthose women with obesity and mice on a high-fat diet. \nAlternatively, the physiological hypoxia of menstruation \nthat is observed 8 h following progesterone withdrawal in \nthe mouse model (Cousins et al. 2016, Maybin et al. 2018) \nmay be delayed until 24 h in mice with increased body \nweight. The role of hypoxia in obesity is debated in the \nliterature. Mouse studies suggest hypoxia in adipose tissue \nhas an important role in the adipose tissue dysfunction \nobserved in obesity, but this has not been confirmed in \nhuman studies ( Goossens & Blaak 2015 ). The impact of \nany such adipose tissue hypoxia on end organ function \nremains to be determined.\nWhen functioning normally, adipose tissue produces \nmultiple factors that result in pro- and anti-inflammatory \neffects. However, obesity is associated with dysfunctional \nadipose tissue, characterised by macrophage infiltration \n(Ouchi et al. 2011). This infiltration results in a more pro-\ninflammatory profile with obesity-induced inflammation \ncausing disorders at other tissue sites, including the \npancreas ( Hotamisligil et  al. 1993 , Saltiel & Olefsky \n2017). Our findings herein are consistent with these \nobservations at other tissue sites, detailing increased \nlocal inflammatory mediators in the uterus of mice on \na high fat diet. A previous study of human endometrial \ntissue found no significant association between BMI and \naltered endometrial gene expression measured by RNASeq \n(Holdsworth-Carson et  al. 2020 ). Consistent with these \nfindings in women with and without endometriosis, \nnone of the inflammatory mediators examined herein \nwere significantly increased in endometrium from women \nwith obesity vs normal BMI. However, all showed non-\nsignificant increased levels in the presence of obesity. This \nlack of significance may reflect the small sample number \nand the inevitable human tissue heterogeneity due to \ndifferences in parity, age and hormone levels. Most of this \nvariability can be overcome by utilising the mouse model \nof simulated menses. Given the known heterogeneity of \nhuman participants and our findings in the mouse model \nof simulated menses, overall these data are consistent \nwith a pro-inflammatory peri-menstrual endometrial \nenvironment in the presence of increased adiposity. \nWomen with abnormal uterine bleeding have been shown \nto have an increased inflammatory response in their \nendometrium at menstruation ( Malik et al. 2006, Smith \net al. 2007). In particular, TNF has been implicated in the \naetiology of HMB, with studies demonstrating increased \nlevels of TNF in the menstrual effluent of women with \nHMB compared to normal controls ( Malik et  al. 2006 ). \nTherefore, this pro-inflammatory profile of endometrium \nduring menstruation may contribute to increased blood \nloss in women with obesity.\nThe impact of obesity on endometrial function is thus \nlikely to be multifactorial. Our data have revealed that \nincreasing BMI is positively correlated with menstrual \nblood loss in women and have confirmed that a high fat \ndiet significantly delayed endometrial repair in a mouse \nmodel of menstruation. Mice with increased body weight \nalso displayed significantly elevated uterine inflammatory \nmediators and decreased endometrial epithelial cell \nproliferation. The impact of obesity on menstrual blood \nloss has been scarcely reported in the literature and we \nbelieve our results provide new evidence that increased \nbody weight may contribute to heavy menstrual bleeding. \nThis will facilitate evidence-based shared decision  \nmaking between clinicians and patients regarding \nlifestyle adjustments in the management of this  \ncommon symptom.\nDeclaration of interest\nJ J R, C W, A M, S B-M, S S, M N, A C and J A M have no conflicts of interest to \ndeclare. H O D C has clinical research support for laboratory consumables \nand staff from Bayer AG and provides consultancy advice (but with no \npersonal remuneration) for Bayer AG, PregLem SA, Gedeon Richter, Vifor \nPharma UK Ltd, AbbVie Inc; Myovant Sciences GmbH. H O D C receives \nroyalties from UpToDate for article on abnormal uterine bleeding.\nFunding\nThis work was supported by Wellcome Trust Fellowships 209589/Z/17/Z \nand 100646/Z/12/Z, Wellbeing of Women grant RG1820 and the Barbour \nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n81\nResearch\nJ J Reavey et al. Obesity and menstruation\n249:2\nJournal of \nEndocrinology\nWatson trust. This work was also in part funded by MRC Research Grants \nG0000066, G0500047, G0600048, and MR/ J003611/1. The work was \nundertaken in the MRC Centre for Reproductive Health, funded by grants \nG1002033 and MR/N022556/1.\nAcknowledgements\nThe authors are extremely grateful to all patients who participated in the \nstudy. The authors thank our clinical research staff Ms Sharon McPherson \nand Ms Catherine Murray for their help with participant recruitment. In \naddition, the authors acknowledge Ms Rocío Martínez Aguilar and Ms \nOlympia Kelepouri for their advice and technical support, Ms Sheila Milne \nfor her expert assistance with manuscript formatting and Dr Rob Elton for \nhis statistical expertise.\nReferences\nAbberton KM, Healy DL & Rogers PA 1999 Smooth muscle alpha actin \nand myosin heavy chain expression in the vascular smooth muscle \ncells surrounding human endometrial arterioles. Human Reproduction \n14 3095–3100. (https://doi.org/10.1093/humrep/14.12.3095)\nBrasted M, White CA, Kennedy TG & Salamonsen LA 2003 Mimicking the \nevents of menstruation in the murine uterus. Biology of Reproduction \n69 1273–1280. (https://doi.org/10.1095/biolreprod.103.016550)\nBroughton DE & Moley KH 2017 Obesity and female infertility: potential \nmediators of obesity’s impact. Fertility and Sterility 107 840–847. \n(https://doi.org/10.1016/j.fertnstert.2017.01.017)\nCousins FL, Murray A, Esnal A, Gibson DA, Critchley HO & Saunders PT \n2014 Evidence from a mouse model that epithelial cell migration and \nmesenchymal-epithelial transition contribute to rapid restoration \nof uterine tissue integrity during menstruation. PLoS ONE 9 e86378. \n(https://doi.org/10.1371/journal.pone.0086378)\nCousins FL, Murray AA, Scanlon JP & Saunders PT 2016 Hypoxyprobe \nreveals dynamic spatial and temporal changes in hypoxia in a mouse \nmodel of endometrial breakdown and repair. BMC Research Notes 9 30. \n(https://doi.org/10.1186/s13104-016-1842-8)\nCritchley HOD, Maybin JA, Armstrong GM & Williams ARW 2020 \nPhysiology of the endometrium and regulation of menstruation. \nPhysiological Reviews 100 1149–1179. (https://doi.org/10.1152/\nphysrev.00031.2019)\nFrick KD, Clark MA, Steinwachs DM, Langenberg P, Stovall D, Munro MG, \nDickersin K & STOP-DUB Research Group 2009 Financial and quality-\nof-life burden of dysfunctional uterine bleeding among women \nagreeing to obtain surgical treatment. Women’s Health Issues 19 70–78. \n(https://doi.org/10.1016/j.whi.2008.07.002)\nGarry R, Hart R, Karthigasu KA & Burke C 2009 A re-appraisal of \nthe morphological changes within the endometrium during \nmenstruation: a hysteroscopic, histological and scanning electron \nmicroscopic study. Human Reproduction 24 1393–1401. (https://doi.\norg/10.1093/humrep/dep036)\nGoossens GH & Blaak EE 2015 Adipose tissue dysfunction and impaired \nmetabolic health in human obesity: a matter of oxygen? Frontiers in \nEndocrinology 6 55. (https://doi.org/10.3389/fendo.2015.00055)\nHallberg L & Nilsson L 1964 Determination of menstrual blood loss. \nScandinavian Journal of Clinical and Laboratory Investigation 16 \n244–248. (https://doi.org/10.3109/00365516409060511)\nHigham JM, O’Brien PM & Shaw RW 1990 Assessment of menstrual \nblood loss using a pictorial chart. British Journal of Obstetrics and \nGynaecology 97 734–739. (https://doi.org/10.1111/j.1471-0528.1990.\ntb16249.x)\nHoldsworth-Carson SJ, Chung J, Sloggett C, Mortlock S, Fung JN, \nMontgomery GW, Dior UP, Healey M, Rogers PA & Girling JE 2020 \nObesity does not alter endometrial gene expression in women with \nendometriosis. Reproductive Biomedicine Online 41 113–118. (https://\ndoi.org/10.1016/j.rbmo.2020.03.015)\nHotamisligil GS, Shargill NS & Spiegelman BM 1993 Adipose expression \nof tumor necrosis factor-alpha: direct role in obesity-linked \ninsulin resistance. Science 259 87–91. (https://doi.org/10.1126/\nscience.7678183)\nKaitu’u-Lino TJ, Morison NB & Salamonsen LA 2007 Neutrophil \ndepletion retards endometrial repair in a mouse model. Cell and Tissue \nResearch 328 197–206. (https://doi.org/10.1007/s00441-006-0358-2)\nKaitu’u-Lino TJ, Phillips DJ, Morison NB & Salamonsen LA 2009 A new \nrole for activin in endometrial repair after menses. Endocrinology 150 \n1904–1911. (https://doi.org/10.1210/en.2008-0738)\nKershaw EE & Flier JS 2004 Adipose tissue as an endocrine organ. Journal \nof Clinical Endocrinology and Metabolism 89 2548–2556. (https://doi.\norg/10.1210/jc.2004-0395)\nKlok MD, Jakobsdottir S & Drent ML 2007 The role of leptin and ghrelin \nin the regulation of food intake and body weight in humans: a \nreview. Obesity Reviews 8 21–34. (https://doi.org/10.1111/j.1467-\n789X.2006.00270.x)\nKulie T, Slattengren A, Redmer J, Counts H, Eglash A & Schrager S 2011 \nObesity and women’s health: an evidence-based review. Journal of the \nAmerican Board of Family Medicine 24 75–85. (https://doi.org/10.3122/\njabfm.2011.01.100076)\nLash MM & Armstrong A 2009 Impact of obesity on women’s health. \nFertility and Sterility 91 1712–1716. (https://doi.org/10.1016/j.\nfertnstert.2008.02.141)\nLyall MJ, Thomson JP, Cartier J, Ottaviano R, Kendall TJ, Meehan RR & \nDrake AJ 2020 Non-alcoholic fatty liver disease (NAFLD) is associated \nwith dynamic changes in DNA hydroxymethylation. Epigenetics 15 \n61–71. (https://doi.org/10.1080/15592294.2019.1649527)\nMacKintosh ML, Derbyshire AE, McVey RJ, Bolton J, Nickkho-Amiry M, \nHiggins CL, Kamieniorz M, Pemberton PW, Kirmani BH, Ahmed B, \net al. 2019 The impact of obesity and bariatric surgery on circulating \nand tissue biomarkers of endometrial cancer risk. International Journal \nof Cancer 144 641–650. (https://doi.org/10.1002/ijc.31913)\nMalik S, Day K, Perrault I, Charnock-Jones DS & Smith SK 2006 Reduced \nlevels of VEGF-A and MMP-2 and MMP-9 activity and increased \nTNF-alpha in menstrual endometrium and effluent in women with \nmenorrhagia. Human Reproduction 21 2158–2166. (https://doi.\norg/10.1093/humrep/del089)\nMarsh MM, Malakooti N, Taylor NH, Findlay JK & Salamonsen LA 1997 \nEndothelin and neutral endopeptidase in the endometrium of women \nwith menorrhagia. Human Reproduction 12 2036–2040. (https://doi.\norg/10.1093/humrep/12.9.2036)\nMaybin JA, Boswell L, Young VJ, Duncan WC & Critchley HOD \n2017 Reduced transforming growth factor-beta activity in the \nendometrium of women with heavy menstrual bleeding. Journal of \nClinical Endocrinology and Metabolism 102 1299–1308. (https://doi.\norg/10.1210/jc.2016-3437)\nMaybin JA, Murray AA, Saunders PTK, Hirani N, Carmeliet P & \nCritchley HOD 2018 Hypoxia and hypoxia inducible factor-1alpha \nare required for normal endometrial repair during menstruation. \nNature Communications 9 295. (https://doi.org/10.1038/s41467-017-\n02375-6)\nMunro MG, Critchley HO, Broder MS, Fraser IS & FIGO Working Group \non Menstrual Disorders 2011 FIGO classification system (PALM-\nCOEIN) for causes of abnormal uterine bleeding in nongravid women \nof reproductive age. International Journal of Gynaecology and Obstetrics \n113 3–13. (https://doi.org/10.1016/j.ijgo.2010.11.011)\nMunro MG, Critchley HOD, Fraser IS & Committee FMD 2018 The two \nFIGO systems for normal and abnormal uterine bleeding symptoms \nand classification of causes of abnormal uterine bleeding in the \nreproductive years: 2018 revisions. International Journal of Gynaecology \nand Obstetrics 143 393–408. (https://doi.org/10.1002/ijgo.12666)\nNHS 2020 Statistics on Obesity, Physical Activity and Diet, England 2020. \nPart 3: Adult Overweight and Obesity. NHS Digital. (available at: https://\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/\n\n\n82\nObesity and menstruationJ J Reavey et al.249:2\nJournal of \nEndocrinology\ndigital.nhs.uk/data-and-information/publications/statistical/statistics-\non-obesity-physical-activity-and-diet/england-2020/part-3-adult-\nobesity-copy). Accessed on 26 October 2020. (available at: https://\nfiles.digital.nhs.uk/DE/D1D9C5/HSE19-Overweight-obesity-tab.xlsx)\nNICE 2018 NG88: Heavy Menstrual Bleeding: Assessment and Management. \nNational Institute for Health and Clinical Excellence (NICE). \n(available at: https://www.nice.org.uk/guidance/ng88). Accessed on \n26 October 2020.\nNoyes RW, Hertig AT & Rock J 1950 Dating the endometrial biopsy. \nFertility and Sterility 1 3–25.\nOnstad MA, Schmandt RE & Lu KH 2016 Addressing the role of obesity in \nendometrial cancer risk, prevention, and treatment. Journal of Clinical \nOncology 34 4225–4230. (https://doi.org/10.1200/JCO.2016.69.4638)\nOuchi N, Parker JL, Lugus JJ & Walsh K 2011 Adipokines in inflammation \nand metabolic disease. Nature Reviews: Immunology 11 85–97. (https://\ndoi.org/10.1038/nri2921)\nPettigrew R & Hamilton-Fairley D 1997 Obesity and female reproductive \nfunction. British Medical Bulletin 53 341–358. (https://doi.\norg/10.1093/oxfordjournals.bmb.a011617)\nPiltonen TT, Chen JC, Khatun M, Kangasniemi M, Liakka A, Spitzer T, \nTran N, Huddleston H, Irwin JC & Giudice LC 2015 Endometrial \nstromal fibroblasts from women with polycystic ovary syndrome have \nimpaired progesterone-mediated decidualization, aberrant cytokine \nprofiles and promote enhanced immune cell migration in vitro. Human \nReproduction 30 1203–1215. (https://doi.org/10.1093/humrep/dev055)\nRCOG 2011 National Heavy Menstrual Bleeding Audit First Annual Report. \nLondon: RCOG Press. (available at: https://www.rcog.org.uk/\nglobalassets/documents/guidelines/research--audit/nationalhmbaudit\n_1stannualreport_may2011.pdf). Accessed on 27 August 2020.\nRhee JS, Saben JL, Mayer AL, Schulte MB, Asghar Z, Stephens C, Chi MM \n& Moley KH 2016 Diet-induced obesity impairs endometrial stromal \ncell decidualization: a potential role for impaired autophagy. Human \nReproduction 31 1315–1326. (https://doi.org/10.1093/humrep/\ndew048)\nSaltiel AR & Olefsky JM 2017 Inflammatory mechanisms linking obesity \nand metabolic disease. Journal of Clinical Investigation 127 1–4. \n(https://doi.org/10.1172/JCI92035)\nSeth D, Garmo H, Wigertz A, Holmberg L, Hammar N, Jungner I, \nLambe M, Walldius G & Van Hemelrijck M 2012 Lipid profiles \nand the risk of endometrial cancer in the Swedish AMORIS study. \nInternational Journal of Molecular Epidemiology and Genetics 3 122–133.\nSiiteri PK 1987 Adipose tissue as a source of hormones. American Journal of \nClinical Nutrition 45 (Supplement) 277–282. (https://doi.org/10.1093/\najcn/45.1.277)\nSmith SK, Abel MH, Kelly RW & Baird DT 1981 Prostaglandin synthesis \nin the endometrium of women with ovular dysfunctional uterine \nbleeding. British Journal of Obstetrics and Gynaecology 88 434–442. \n(https://doi.org/10.1111/j.1471-0528.1981.tb01009.x)\nSmith OP, Jabbour HN & Critchley HO 2007 Cyclooxygenase enzyme \nexpression and E series prostaglandin receptor signalling are \nenhanced in heavy menstruation. Human Reproduction 22 1450–1456. \n(https://doi.org/10.1093/humrep/del503)\nTanaka T & Umesaki N 2008 Leptin regulates the proliferation and \napoptosis of human endometrial epithelial cells. International \nJournal of Molecular Medicine 22 683–689. (https://doi.org/10.3892/\nijmm_00000073)\nWyatt KM, Dimmock PW, Walker TJ & O’Brien PM 2001 Determination \nof total menstrual blood loss. Fertility and Sterility 76 125–131. \n(https://doi.org/10.1016/s0015-0282(01)01847-7)\nZaadstra BM, Seidell JC, Van Noord PA, te Velde ER, Habbema JD, \nVrieswijk B & Karbaat J 1993 Fat and female fecundity: prospective \nstudy of effect of body fat distribution on conception rates. BMJ 306 \n484–487. (https://doi.org/10.1136/bmj.306.6876.484)\nZheng J, Manabe Y & Sugawara T 2020 Siphonaxanthin, a carotenoid \nfrom green algae Codium cylindricum, protects Ob/Ob mice fed on a \nhigh-fat diet against lipotoxicity by ameliorating somatic stresses and \nrestoring anti-oxidative capacity. Nutrition Research 77 29–42. (https://\ndoi.org/10.1016/j.nutres.2020.02.001)\nReceived in final form 15 February 2021\nAccepted 9 March 2021\nhttps://doi.org/10.1530/JOE-20-0446\nhttps://joe.bioscientifica.com © 2021 The authors\nPublished by Bioscientifica Ltd.\nPrinted in Great Britain This work is licensed under a Creative Commons \nAttribution 4.0 International License.\nDownloaded from Bioscientifica.com at 06/11/2026 04:29:06AM\nvia Open Access. This work is licensed under a Creative Commons Attribution\n4.0 International License.\nhttp://creativecommons.org/licenses/by/4.0/","source_license":"CC0","license_restricted":false}