{"paper_id":"fc3e7170-ae53-44ea-bd7a-a86ba3ddaaf6","body_text":"Laparoscopy assists with direct visualization of pelvic structures for diagnostic and prognosticating future reproductive chance in patients with primary amenorrhea. A patient with Müllerian abnormalities or gonadal agenesis can present with primary amenorrhea. Here, we present a case of a 25-year-old woman with primary amenorrhea despite developing normal secondary sexual characteristics with a blind end vagina. She underwent karyotyping, which was negative for the sex determining region of the Y chromosome gene. Subsequently, she had a diagnostic laparoscopy. Two normally sized ovaries were visualized with follicles, rudimentary fallopian tubes with the fimbria ends. The uterus was absent. It confirms Mayer–Rokitansky–Küster–Hauser syndrome. With these findings, we counseled the patient for vaginal dilation and assisted reproductive conception through surrogacy using her follicles. Laparoscopy plays a vital role in evaluating primary amenorrhea, especially in cases with difficult diagnosis and prediction of future reproductive chances.\nThe Role of Laparoscopy in Evaluating a “25-Year-Old” Woman with Primary Amenorrhea: A Case Report\n- Open\nAbstract\nIntroduction\nPrimary amenorrhea is defined as the absence of menstruation by the age of 13 years in the absence of normal growth or secondary sexual development, or the lack of menses by the age of 15 years in the setting of normal growth and secondary sexual characteristics. It presents a diagnostic challenge to clinicians.[1,2] It can result from a variety of etiologies, including congenital anomalies of the reproductive tract, hormonal disturbances, chromosomal abnormalities, or structural abnormalities of the genital tract.[3] While the evaluation typically involves a comprehensive medical history, physical examination, hormonal assays, and imaging studies, there are instances where the precise cause remains elusive.[4,5] Laparoscopy has emerged as a valuable tool in the investigative armamentarium for primary amenorrhea, particularly when noninvasive modalities fail to yield a definitive diagnosis. This minimally invasive surgical procedure offers direct visualization of the pelvic structures, allowing for the identification of anatomical anomalies such as müllerian duct abnormalities, ovarian dysfunction, or the presence of pelvic masses.[3-6] In this case, we present a compelling clinical scenario of primary amenorrhea wherein diagnostic laparoscopy played a pivotal role in elucidating the underlying pathology and predicting future reproductive chance.\nCase Presentation\nMiss BD is a 25-year-old single nulligravid woman who presented with primary amenorrhea despite achieving normal secondary sexual characteristics (axillary hair growth, pubic hair growth, and breast development) at the age of 16 years. She is the second of two children. She had an elder sister who had normal pubertal development. Her mother and sister attained menarche at 13 and 14 years, respectively. There was no family history of ambiguous genitalia. There was no history of amenorrhea in the first- and second-degree relatives. There was no history of pelvic surgeries, chemotherapy, or radiotherapy.\nThe patient weighed 97.4 kg, height of 1.56 m tall, with a body mass index of 40.02 kg/m2. Blood pressure was 110/70 mm Hg, and other vital signs were within normal limits. The breast was at Tanner stage 5, and the pubic hair was at Tanner stage 5 of sexual maturity. No mass was palpable per abdomen. The external genitalia were normal with normal pubic hair, normal urethral meatus, and no clitoromegaly. The vaginal canal was shortened, 3 cm long, and blind ending. She was not sexually active. She moved from one hospital to another from the onset of puberty until her presentation to this center [Figure 1].\nInvestigations\nShe had a transabdominal ultrasound done, which could not visualize the uterus, and a hormonal profile was done, which showed follicle-stimulating hormone (FSH) 4.6 mIU/mL, luteinising hormone (LH) 25.1 mIU/mL, prolactin 5 ng/mL, testosterone 2.2 pg/mL, and estradiol 124 pg/mL. Hormone profile showed an LH:FSH ratio of more than 2 and hyperandrogenism. The pregnancy test was negative.\nSex determining region of the Y chromosome (SRY)-determining region report showed DNA was extracted from the patient’s peripheral blood sample using the QIAmp blood DNA mini kit (Qiagen, Hilden, Germany). Polymerase chain reaction (PCR) was done with a pair of SRY forward (tacaggccatgcacagagag) and reverse (tcttgagtgtgtggctttcg) primers and Taq DNA polymerase. We used appropriate positive and negative controls. We did electrophoresis of the PCR product in 2% agarose gels, and the bands were visualized under ultraviolet light. The patient’s sample was negative for the SRY gene. We did not see any Y chromosome material in the patient’s DNA material. Electrolyte, urea, and creatinine were within standard limits.\nMiss BD was counseled preoperatively about the procedure that which was diagnostic and not curative, and to predict her future reproductive options.\nThe patient underwent a diagnostic laparoscopy, which revealed the following findings.\nGrossly normal bladder and bowel, both ovaries were visible, and grossly normal with multiple developing follicles. Both fimbria ends of the fallopian tubes were present and rudimentary.\nWe could not visualize the uterus. We visualized evidence of folliculogenesis and well-formed ovaries on direct vision, which is the advantage of laparoscopy over ultrasound.\nProcedure for laparoscopy\nMiss BD was anesthesized with general anesthesia. Routine cleaning was done with an antiseptic solution and properly draped under aseptic technique. She was positioned in Lloyd-Davies’ position. A small incision was made through the umbilicus. Pneumoperitoneum was created with a Veres needle, with carbon dioxide used as an insufflator. A primary port 10 mm was inserted with a laparoscope connected to a camera and image processor. The intra-abdominal pressure was maintained between 12 and 15 mmHg at a flow rate of 1–4 L/min. A secondary port was inserted with a 5 mm trocar for easy manipulation, and the above findings were observed under direct vision. The abdomen was deflated gently by releasing the gas, and the instruments were removed under direct vision. The incisions were closed with absorbable suture, and the procedure was well tolerated by the patient [Figure 2].\nPostoperative recovery\nShe recovered from anesthesia. She was given antibiotics and analgesics. We have counseled her on the diagnosis of primary amenorrhea secondary to Müllerian agenesis. She was counseled on serial vaginal dilatation using vaginal molds for coitus. In view of the well-formed ovaries with follicles, she was counseled on the need for assisted reproduction through surrogacy using her own egg when she desires fertility. In addition, the option of uterine transplantation was given, but the procedure is not available in our center. She was discharged 48 h after the surgery.\nDiscussion\nPrimary amenorrhea is the absence of menses by the age of 15 years in the presence of normal secondary sexual characteristics or by the age of 13 years when there is a concomitant absence of secondary sexual characteristics.[1-3] The causes of primary amenorrhea include hypogonadotropic hypogonadism, characterized by low LH and FSH secretion, hypergonadotropic hypogonadism associated with increased LH and FSH secretion, and gonadal dysfunction, anatomic variants of Müllerian duct derivatives, outflow tract abnormalities, and transient/functional hypogonadism.[1] One of the abnormalities of Müllerian duct derivatives as a cause of primary amenorrhea is referred to as Mayer–Rokitansky–Küster–Hauser syndrome (MRKH). Typically, it presents with normal secondary sexual characteristics and primary amenorrhea. Clinically, it is divided into type 1 and type 2.[1] The type 1 variant is characterized by agenesis of the uterus, fallopian tubes, cervix, and upper vagina, and type 2 is associated with renal, skeletal, auditory, and/or cardiac valve abnormalities in addition to aberrant Müllerian duct structures.[1] No obvious skeletal abnormalities and no hearing abnormalities, and there was no murmur; however, an electrocardiogram was not done. The case reported here exemplifies the type 1 variant. MRKH syndrome affects about 7% of women of reproductive age and up to 15% of adolescents with primary amenorrhea.[4,5] It affects approximately 1 in 5000 of 46 XX individuals with phenotypical female external genitalia.[5]\nMaking the diagnosis of primary amenorrhea is straightforward; however, unraveling its cause needs careful history taking, physical examination, and targeted investigations based on the clinical findings. This patient presented with absent menses at the age of 25 years with well-developed secondary sexual characteristics. Initial workup includes a pregnancy test and a hormonal profile. A pregnancy test was done initially, which was negative; however, pregnancy is not a common cause of primary amenorrhea. A pelvic ultrasound then helps to delineate urogenital anatomy, and in this case, we could not visualize the uterus. In a situation like this, the cause can either be complete androgen insensitivity syndrome or MRKH syndrome.[6] We differentiated the two cases by carrying out a karyotype, which is 46XX in MRKH syndrome but 46XY in complete androgen insensitivity syndrome.[1,6] This patient’s karyotype was 46XX, which was in support of the diagnosis of Müllerian agenesis. In some instances, magnetic resonance imaging (MRI) or computed tomography (CT) imaging can define specific details of urogenital, renal, and adrenal anatomies.[1] MRI or CT was not done in this patient because an ultrasound scan was readily available. The patient had no renal symptoms, her renal function test was normal, and the ultrasound scan did not reveal any renal or adrenal abnormality. Laparoscopy has emerged as an additional tool in the evaluation of women with primary amenorrhea, as it offers real-time visualization of the pelvic organs.[7] In some cases, it may also provide therapeutic options for the reconstruction of the Müllerian abnormalities[7,8]; however, in this case, laparoscopy was employed as an adjunct to the pelvic ultrasound to make the diagnosis of Müllerian agenesis in her and to prognosticate her future reproductive chances. It allowed the patient herself to visualize her pelvis when the video recording was given to her after the procedure, which improved her understanding of the condition.\nManagement of primary amenorrhea depends on the underlying cause.[6] For those caused by Müllerian agenesis, counseling on options for vaginal lengthening, which can either be nonsurgical vaginal dilation or surgical vaginoplasty[5,6] A diagnosis of Müllerian agenesis negatively impacts sexual and psychological health as women with this disorder may have low self-esteem due to their inability to conceive, as well as their inability to perform sexual intercourse thus there is a need for psychosocial counseling.[9] Legal adoption, assisted reproduction in the form of in vitro fertilization with surrogacy, and uterine transplant are the options for managing the infertility associated with this condition.[9,10] Although these procedures are still quite expensive for an average Nigerian, a uterine transplant is not yet readily available. We offered all these to the patient. She chose serial dilatation of the vagina pending the time she was going to be ready for conception and is currently still on follow-up.\nConclusion\nPrimary amenorrhea secondary to Müllerian agenesis, although uncommon, poses a diagnostic dilemma and future management challenges; hence, the role of laparoscopy for direct visualization of ovaries and other pelvic structures, thereby assisting in prognosticating future reproductive chance.\nWhat is already known?\nMüllerian agenesis is a cause of primary amenorrhea and is usually diagnosed with an ultrasound. However, there is a difficulty in prognosticating future reproductive chance.\nWhat is new?\nLaparoscopy helped with direct visualization of ovaries with evidence of folliculogenesis and other pelvic structures, thereby assisting in predicting future reproductive chance and adequate counseling as regards assisted conception through surrogacy using her own gametes.\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form, the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published, and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\nFinancial support and sponsorship\nNil.\nConflicts of interest\nThere are no conflicts of interest.\nReferences\nAssisted conception; laparoscopy; Mayer–Rokitansky–Küster–Hauser syndrome; primary amenorrhea","source_license":"CC0","license_restricted":false}