{"paper_id":"f5620809-6621-48f6-be9d-4d8f261bc838","body_text":"Luiza da Gama Coelho Riccio \n \n \n \n \n \n \nO inibidor Btk Ibrutinib limita o desenvolvimento da \nendometriose em camundongos \n \n \n \n \n \n  \n  \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \nSão Paulo \n2021  \nTese apresentada à Faculdade de \nMedicina da Universidade de São Paulo \npara obtenção do título de Doutor em \nCiências \n \nPrograma de Obstetrícia e Ginecologia  \n \nOrientador: Prof. Dr. Maurício Simões \nAbrão \n\n \nLuiza da Gama Coelho Riccio \n \n \n \n \n \n \nO inibidor Btk Ibrutinib limita o desenvolvimento da \nendometriose em camundongos \n \n \n \n \n \n  \n  \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n  \n \n \n \n \nSão Paulo \n2021 \n  \nTese apresentada à Faculdade de \nMedicina da Universidade de São Paulo \npara obtenção do título de Doutor em \nCiências \n \nPrograma de Obstetrícia e Ginecologia \n \nOrientador: Prof. Dr. Maurício Simões \nAbrão  \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n  \n\n\n \nLuiza da Gama Coelho Riccio \n \n \n \n \n \n \nBtk inhibitor Ibrutinib limits endometriosis development in mice \n \n \n \n \n \n  \n  \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \nSão Paulo \n2021  \nThesis presented to the Faculdade de \nMedicina da Universidade de São Paulo \nto obtain the degree of Doctor in Science \n \nProgram of Obstetrics and Gynecology \n \nSupervisor: Prof. Dr. Maurício Simões \nAbrão \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \nTo Augusto Riccio  \nin memoriam \n  \n\n \nACKNOWLEDGMENTS \n \n \nThis dissertation could not have been finished without the loving support \nof those who stood by me along this long path. \nFirst, I would like to thank Professor Maurício Abrão, my mentor and \nsupervisor, for guiding me through the beautiful path of science. I am thankful for \nall he taught me  – since my first year of medical residency  – and, especially, \nduring this post -graduation journey . I am very proud of now being part of his \namazing research team, and I also thank all Endometriosis’ group members.  \nI thank to everyone from the Divisão de Ginecologia do Hospital das \nClínicas da FMUSP, and to Professor Edmund Baracat, for being a great leader \nfor this team.  \nThe experiments that resulted in this work were conducted in Paris, France. \nI spent a year abroad, and during this period I had the opportunity to learn a lot: \nworking in a laboratory  of immunology, speaking French, and living in a foreign \ncountry. All these steps were really challenging; however, I would not have \nachieved them without all the great people I was lucky to have by my side during \nthis pathway.  \nI would like to thank Professor Charles Chapron very much, for welcoming \nme into his team  – I felt really bienvenue there. I was honored to have the \namazing opportunity of this scientific collaboration. \nA special thanks to Professor Frédéric Batteux, who was a great mentor in \nresearch, taught me so much and made me feel like home in his laboratory.  \nI am thankful to Sandrine Chouzenoux, who took me by the hand and \ntaught me all I know about working in a laboratory, with a lot of patience – as she \nwas also teaching me how to speak French. I thank to Prof. Mohamed Jeljeli, who \nwas the perfect work partner, very helpful and supportive, and became a dear \nfriend. I thank Prof. Pietro Santulli and Dr. Mathilde Bourdon, for all the help, and \nfor inspiring me to one day be a gynecologist/obstetrician and a researcher at the \nsame time, like they do. Thank you to Carole Nicco, Luidivine Doridot and Niloufar \nKavian, for all the support in the labor atory. Thanks to Marine, for always being \nhelpful while working with the mice. Thanks to the team of Plateforme Imageries \n\n \ndu Vivant (PIV), for all the image acquisitions. I thank to Prof. Fernando Reis for \nhis help with additional experiments, and for all he taught me about statistics. I \nalso thank my fellow- students in the laboratory, that  became friends: Charlotte, \nOlivier, Valerya, Marine, Sixtine, Guillaume, Einas, Nathaniel and Christophe. I \nam thankful to all the members of Inserm U1016- Batteux at Hôpital Cochin , \nUniversité Paris-Descartes: you were La Dream Team! Vous seriez toujours les \nbienvenus au Brèsil. \nIn Paris, I was also lucky to live with a lot of brilliant people at Maison du \nBrésil. We shared our post -graduation experiences, challenges of living abroad \nand great karaoke nights. We took care of each other and built a home away from \nhome, with amazing academic discussions in the kitchen, concerning all fields of \nknowledge. I am thankful to them all, especially to Anita, Silvia, Rita, Bruna, Rafa, \nGustavo, Gabriel, Thabata, Ju Vinuto, Juliane and Fabriccio. And I thank to Júlia, \nfor also sharing the French experience with me.  \nMy thanks to the professors who have been in my qualification exam –  \nProf. Verônica Coelho, Prof. Maria de Lourdes Brizot and Prof. Gustavo Maciel – \nfor the insightful reflections which I hope to have incorporated in this version.  \nI would like to thank Prof. Adolfo Liao, for supporting my academic journey, \nand all Vila family. I am very proud to be part of this team and work together to \nbuild a SUS how it is supposed to be. \nThanks to Marta Privato, for her help and support since the very beginning \nof this research. I thank to Lucinda, for guiding me patiently thr ough the \nadministrative procedures of post-graduation. \nI thank to Dr . Marco Uchôa, my godfather in Obstetrics, and Dr. Elenice \nRamos, my godmother in Gynecology. Thanks to Prof . Paulo Benigno and Prof. \nLuciola Crisóstomo, for introducing me to scientific research. \nI thank my closest friends, that are like family to me, for their loving support: \nManu, Naty, Ju, Veca, Barty , and my friends from Experimental. I thank my \nfriends from medical residency: the Massa Placentária Única and the Melhor Ano; \nthey have been my family in São Paulo, since 2012. A special thanks to Laurinha, \nDébora, Tiago, Fê, Ivy, Edson, Ci l, Eli, Kita, and Hanna, for their friendship and \nconstant support.  I am thankful to my dear friends from college: Peixe, Rê, May,\n\n \nMarquito, Dênis, Paty, Musi , Nara  and Polly. I thank Nina, for sharing our \nacademic struggles and being such a comprehensive and supportive friend. \nThanks to my dear friend Am ália, with whom I have shared every step of this \njourney and, even in another country, was always there for me.  \nThanks, with love, to Cris, Ivan, Ana, Gal, Guaíra, Sandra, Nando, Adeline, \nRosana, Cassinha and Acácia. Thanks to Sônia, Luiz  and Iara, for being there \nfor my parents. A big thanks to Cristina, for her support , and for keeping me \nmentally healthy throughout this challenge. \nThanks to my love and partner in life, Mathieu. I was really lucky that our \npaths crossed during my year in France, and even more that we decided to share \nour lives. Je t’aime, mon amour. I am thankful to his family, who is also mine now: \nAnnie, Dominique, Bérengère, Alexis, Augustin, Hortense, Therèse, Constant,  \nand his uncles, aunts, and cousins.  \nFinally, I would like to thank my family. Es pecially my parents ( mainha e \npainho), who provided me all the good opportunities I had in lif e and made me \nthe person I am proud to be today . Thanks for keeping me surrounded by love , \nand for always believing I was capable of any thing – even when I thought I was \nnot. I would like to thank my grandparents: Alberino and Lí lia in memoriam, and \nNoêmia, who I am lucky to still have in my life , supporting and praying for me , \nwith her 100 years of wisdom and love. A special thank with saudade to my uncle \nAugusto, who encouraged me to fly out of the nest, move to a big city , and later \nto another country – where this work was done. I will always miss his wise advice \nand great support, but I still look up to him as an example in life. \n \nMuito obrigada a todos! \nLuiza \n  \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n« L’essentiel est invisible aux yeux » \nAntoine de Saint-Exupéry  \n\n \nNORMATIZATION ADOPTED \n \n \nThis dissertation is in accordance with the following norms: \n \nReferences: adapted from the International Committee of Medical Journals \nEditors (Vancouver). \nUniversity of São Paulo, Medical School. Division of Library and Documentation. \n“Guia de apresentação de dissertações, teses e monografias” . Elaborated by \nAnneliese Carneiro da Cunha, Maria Julia de A. L. Freddi, Maria F. Crestana, \nMarinalva de Souza Aragão, Suely Campos Cardoso, Valéria Vilhena. 3ª ed. São \nPaulo: Divisão de Biblioteca e Documentação; 2011. \nAbbreviations of titles and journals in accordance with the List of Journals \nIndexed in Index Medicus.  \n\n \nSUMMARY \n \n \n \nLIST OF ABBREVIATIONS, SYMBOLS AND ACRONYMS \nLIST OF FIGURES \nLIST OF TABLES \nRESUMO \nABSTRACT \n1 INTRODUCTION ............................................................................................. 2 \n2 OBJECTIVES .................................................................................................. 7 \n    2.1 Primary .................................................................................................... 7 \n    2.2 Secondary ............................................................................................... 7 \n3 LITERATURE REVIEW................................................................................... 9 \n    3.1 Endometriosis ........................................................................................ 9 \n          3.1.1 Animal models of endometriosis .................................................... 11 \n    3.2 Immunology of endometriosis ............................................................ 13 \n          3.2.1 Immunosurveillance ....................................................................... 14 \n          3.2.2 Innate immunity ............................................................................. 16 \n                    3.2.2.1 The role of NK cells .......................................................... 16  \n                    3.2.2.2 The role of macrophages .................................................. 18 \n          3.2.3 Adaptive cell-mediated immunity: T lymphocytes .......................... 20 \n          3.2.4 Inflammatory mediators ................................................................. 21 \n    3.3 B lymphocytes and endometriosis ..................................................... 24 \n          3.3.1 Regulatory B cells .......................................................................... 30 \n          3.3.2 Anti-CD20 and B lymphocytes depletion ....................................... 31 \n          3.3.3 Ibrutinib: a Bruton´s tyrosine kinase (Btk) inhibitor ........................ 32 \n4 METHODS .................................................................................................... 35 \n    4.1 Mice ....................................................................................................... 35 \n          4.1.1 Sample size ................................................................................... 35 \n          4.1.2 Murine model of endometriosis...................................................... 36 \n          4.1.3 In vivo treatment of the operated mice .......................................... 40 \n    4.2 Ultrasonography to evaluate implants’ size ....................................... 42 \n    4.3 Histology ............................................................................................... 43 \n\n \n4.4 RNA extraction and reverse transcription followed by q uantitative \nreal-time polymerase chain reaction (RT-qPCR) ..................................... 43 \n    4.5 Isolation and stimulation of spleen and peritoneal cells .................. 44 \n    4.6 Flow cytometry ..................................................................................... 44 \n    4.7 Cytokine assessment by Enzyme- Linked Immunosorbent Assay  \n(ELISA) ........................................................................................................ 45 \n    4.8 Statistical analysis ............................................................................... 46 \n5 RESULTS ...................................................................................................... 48 \n    5.1 Effects of B cell modulating treatment on endometriotic implants’ size \nin mice. ........................................................................................................ 48 \n    5.2 Flow cytometry analysis of the B cells populations.......................... 49 \n    5.3 B cell blockade impacted the distribution of M1 and M2 macrophage \nsubsets. ...................................................................................................... 50 \n    5.4 Effects of Ibrutinib on quantitative expression of genes in \nendometriotic implants of mice ................................................................ 53 \n    5.5 Effects of Ibrutinib on T lymphocytes ................................................ 54 \n    5.6 Effects of Ibrutinib on cytokine balance ............................................. 56 \n6 DISCUSSION ................................................................................................ 59 \n    6.1 Ibrutinib .................................................................................................  60 \n    6.2 Regulatory B cells ................................................................................ 61 \n    6.3 Effects of Ibrutinib on macrophages .................................................. 62 \n    6.4 Effects of Ibrutinib on T lymphocytes ................................................ 64 \n    6.5 Effects of Ibrutinib on cytokines ......................................................... 65 \n    6.6 Murine model of endometriosis .......................................................... 65 \n    6.7 Strengths and limitations .................................................................... 67 \n    6.8 Final considerations............................................................................. 68 \n7 CONCLUSIONS ............................................................................................ 70 \n8 REFERENCES .............................................................................................. 72 \nAPPENDIXES \nImmunology of endometriosis \nThe role of B lymphocytes: a systematic review \nB lymphocytes inactivation by Ibrutinib limits endometriosis progression \nin mice\n\n \nLIST OF ABBREVIATIONS, SYMBOLS AND ACRONYMS \n \n \n%    percent \n≤    less than or equal \n±    plus-minus \nαSMA   alpha smooth muscle actin \nβ-actin   beta-actin \nµg    microgram \nμm    micrometer \nANA    antinuclear antibodies \nANOVA   one-way analysis of variance \nANVISA   Agência Nacional De Vigilância Sanitária \nBAFF    B cell activation factor \nBAFF-R   B cell activation factor receptor \nBALB/c   Bagg and Albino \nBcl-2    B-cell lymphoma 2 \nBCMA   B cell maturation antigen \nBCR    B cell receptor \nBLys    B lymphocyte stimulator \nBreg    regulatory B cells \nBtk    Bruton’s tyrosine kinase \nC   celsius \nCD    cluster of differentiation \nCOX-2   cyclooxygenase-2 \nD    day \nDIE    deep infiltrating endometriosis \nDNA    deoxyribonucleic acid \nEDT    endometriosis \nEDTA   ethylenediaminetetraacetic acid \nEGF   epidermal growth factor \nEGFR   epidermal growth factor receptor \nELISA   enzyme-linked immunosorbent assay \n\n \nFACS   fluorescence-activated cell sorting \nFasL    Fas ligand \nFDA    food and drug administration \nFizz-1   found in inflammatory zone 1  \nFSC   forward scatter \nGnRH   gonadotropin-releasing hormone \nH&E    Hematoxylin & Eosin  \nHGF   hepatocyte growth factor \nIFN    interferon  \nIg    immunoglobulin \nIGF-1    insulin-like growth factor \nIL    interleukin \niNOS    inducible nitric oxide synthase  \nINSERM   Institut National de la Santé et de la Recherche Médicale \nItk    interleukin-2-inducible T-cell kinase \nKAR    killer activation receptor  \nkg   kilogram \nKIR    killer immunoglobulin-like receptor \nL    litre \nLPMs   large peritoneal macrophages  \nMAC-1   macrophage-1 antigen \nMAPK   mitogen-activated protein kinase \nMFI    mean fluorescence intensity \nmg    milligram \nMHC    major histocompatibility complex \nmL    millilitre \nmm    millimeter \nmmol   milimoles \nMRI   magnetic resonance imaging \nmRNA   messenger ribonucleic acid \nNF-κB   nuclear factor kappa B  \nNK    natural killer \nNS    non-significant \n\n \nOMA    ovarian endometrioma \nPBS    phosphate buffered saline \nPDGF   platelet-derived growth factor  \nPerC    peritoneal cavity \npg  picogram \nPRISMA  preferred reporting items for systematic reviews and meta-\nanalyses \nrASRM  revised American Society of Reproductive Medicine \nRNA   ribonucleic acid \nROS   reactive oxygen species \nRPMI    Roswell Park Memorial Institute \nRT-qPCR   reverse transcription quantitative polymerase chain reaction  \nSEM    standard error of the mean \nsICAM-1  intercellular adhesion molecule soluble form \nSNK    Student-Newman-Keuls \nSPMs   small peritoneal macrophages \nSR    Sirius Red \nSSC side-scattered light  \nTACI  transmembrane activator and calcium-modulator and \ncyclophilin ligand interactor \nTCR    T-cell receptor \nTEC    tec protein tyrosine kinase \nTGF    transforming growth factor \nTh    T helper \nTLR4    toll-like receptor 4 \nTNF    tumor necrosis factor \nTreg   regulatory T cell \nUSD   United States dollar \nVEGF   vascular endothelial growth factor  \nvs    versus \nXLA    X-linked agammaglobulinemia \n \n  \n\n \nLIST OF FIGURES \n \n \nFigure 1 – Immune response in endometriosis ................................................ 30 \nFigure 2 – Results provided by sample size calculator .................................... 36 \nFigure 3 – Surgically induced endometriosis murine model ............................ 38 \nFigure 4 – Surgical findings in endometriosis murine model ........................... 39 \nFigure 5 – In vivo treatment of the operated mice ........................................... 41 \nFigure 6 – Ultrasonography to evaluate implants’ size in mice ........................ 42 \nFigure 7 – Gating strategy for identification of mouse regulatory B cells (Breg)..45  \nFigure 8 – Effects of B cell modulating treatment on endometriotic implants \ndevelopment in mice. ....................................................................................... 49 \nFigure 9 – B cell phenotype analysis in spleen and peritoneal cavity of \nendometriotic mice ........................................................................................... 52 \nFigure 10 – Macrophage M1/M2 distribution in spleen and peritoneal cavity in \nendometriotic mice ........................................................................................... 53 \nFigure 11 – Effects of Ibrutinib on quantitative expression of genes in \nendometriotic implants of mice ......................................................................... 54 \nFigure 12 – Effects of Ibrutinib on peritoneal T lymphocytes ........................... 55 \nFigure 13 – Effects of Ibrutinib on splenic T lymphocytes ................................ 55 \nFigure 14 – Effects of Ibrutinib on systemic cytokines of endometriotic mice .. 56 \nFigure 15 – Effects of Ibrutinib on peritoneal cytokines of endometriotic mice 57 \nFigure 16 – Summary of Ibrutinib effects that limited endometriosis \ndevelopment in mice. ....................................................................................... 57 \n \n  \n\n \nLIST OF TABLES \n \n \nTable 1 – Studies that evaluated the role of B lymphocytes in endometriosis. 25 \nTable 2 – List of murine primers used for quantitative real-time polymerase \nchain reaction (RT-qPCR) analysis for tissues and cells .................................. 44 \n \n  \n\n \nRESUMO \n \n \nRiccio LGC. O inibidor Btk I brutinib limita o desenvolvimento da endometriose \nem camundongos [tese]. São Paulo: Faculdade de Medicina, Universidade de \nSão Paulo; 2021. \n \nIntrodução: Endometriose é uma doença crônica ginecológica caracterizada \npela presença e crescimento de células endometriais fora da cavidade uterina. \nÉ uma doença inflamatória benigna, porém frequente, afetando cerca de 5-15% \ndas mulheres em idade reprodutiva, causando dor pélvica crônica e infertilidade. \nA fisiopatologia da endometriose ainda não está completamente esclarecida, e \nsua progressão está associada à inflamação crônica e a alterações na resposta \nimunológica. Células endometriais que alcançam a cavidade peritoneal através \nda menstruação retrógrada escapam dos mecanismos de imunovigilância , \nprovavelmente devido a uma redução da atividade fagocítica dos macrófagos e \nda citotoxicidade das células natural killer . A imunidade adaptativa também \ncontribui para o desenvolvimento da doença. A presença de uma ativação \npoliclonal dos linfócitos B, com produção de autoanticorpos anti-endométrio, foi \ndescrita em mulheres com endometriose . Porém, o papel exato destas células \nno mecanismo da doença ainda não é totalmente conhecido. Existe uma \nnecessidade urgente de opções terapêuticas não- hormonais para o tratamento \nda endometriose e terapias imunes podem trazer novas perspectivas. Objetivo: \nAvaliar os efeitos da depleção com anti-CD20 e da inativação com o inibidor da \nBruton´s tyrosine kinase (Btk) dos linfócitos B no desenvolvimento da \nendometriose em camundongos. Métodos: Neste estudo experimental, o \ndesenvolvimento da endometriose foi comparado entre um grupo controle e \nanimais tratados com o anticorpo anti-CD20, que causa a depleção dos linfócitos \nB, e com o inibidor Btk Ibrutinib, que leva à inativação destas células. Foram \nutilizados dez animais por grupo por experimento independente. Foi utilizado o \nmodelo cirúrgico de endometriose, com transplante de tecido endometrial para a \ncavidade peritoneal d os camundongos. As lesões de endometriose foram \ncomparadas através do volume, peso, medidas ultrassonográficas, histologia e \n\n \nexpressão gênica de genes alvo nos implantes. O s fenótipos dos linfócitos B, B \nativados, B regulatórios (Breg), linfócitos T e macrófagos foram avaliados através \nda citometria de fluxo das células extraídas do baço e fluido peritoneal dos \ncamundongos. Citocinas no soro e no fluido peritoneal foram quantificadas por \nELISA. Resultados: O Ibrutinib preveniu o crescimento das lesões de \nendometriose, reduziu a expressão de ciclooxigenase- 2, alpha smooth muscle \nactine e colágeno tipo I nas lesões, inativou os linfócitos B e aumentou o número \nde linfócitos Breg no baço de camundongos com endometriose. Além disso, o \nnúmero de macrófagos M2 diminuiu na cavidade peritoneal dos animais tratados \ncom Ibrutinib, comparados àqueles tratados com anti -CD20 e controles. A \ndepleção dos linfócitos B com o anticorpo anti -CD20 não teve efeito sobre o \ncrescimento e atividade dos implantes, nem sobre os macrófagos. Conclusão: \nO tratamento com Ibrutinib reduziu o tamanho e a atividade das lesões, bem \ncomo a expressão de marcadores de inflamação e fibrose, enquanto a depleção \ncompleta dos linfócitos B com o anti-CD20 não teve impacto sobre a doença. No \nentanto, ainda é incerto se a inativação dos linfócitos através do tratamento com \no Ibrutinib poderia interferir no desenvolvimento da endometriose em humanos. \nNovos estudos podem ajudar a esclarecer o papel dos linfócitos B e seus \nsubtipos na endom etriose e contribuir para o desenvolvimento de novas \nestratégias terapêuticas.  \n \nDescritores: Endometriose; Linfócitos B; Imunologia; Linfócitos B reguladores; \nMacrófagos; Camundongos. \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n\n \nABSTRACT \n \n \nRiccio LGC. Btk inhibitor Ibrutinib limits endometriosis development in mice  \n[thesis]. São Paulo: “Faculdade de Medicina, Universidade de São Paulo”; 2021. \n \nIntroduction: Endometriosis is a chronic gynecological disorder characterized \nby the presence and growth of endometrial tissue outside the uterine cavity. It is \na benign but frequent inflammatory disease that occurs in about 5-15% of women \nin reproductive age, causing chronic pelvic  pain and infertility. The \nphysiopathology of endometriosis is not completely understood, and its \nprogression is associated with chronic inflammation and aberrant immune \nresponse. Endometrial cells that reach peritoneal cavity through retrograde \nmenstruation escape immunosurveillance probably due to reduced macrophagic \nphagocytosis and decreased natural killer cells cytotoxicity. Adaptive immune \ncells also contribute to disease progression. A polyclonal activation of B cells and \nthe presence of anti-endometrial autoantibodies have been described in a large \nproportion of women with endometriosis , though their exact role in the disease \nmechanisms remains unclear. There is an urgent need for new non- hormonal \ntherapeutic strategies and targeting immune system cells can open new \nperspectives. Objective: To evaluate the effects of B lymphocyte depletion and \ninactivation on endometriosis development in mice. Methods: The experimental \nstudy included comparison of endometriosis development for 21 days in control \nmice versus animals treated with the anti -CD20 depleting antibody or with the \nBruton´s tyrosine kinase (Btk) inhibitor Ibrutinib, that prevents B cell activation. \nTen animals per group for each independent experiment were used. After \nsyngeneic endometrial trans plantation, murine endometriotic lesions were \ncompared between treated and control mice using volume, weight, \nultrasonographic measures, histology, and target genes expression in lesions. \nPhenotyping of activated and regulatory B cells (Breg), T lymphocytes and \nmacrophages was performed by flow cytometry on isolated spleen and peritoneal \ncells of mice. Cytokines in the serum and peritoneal fluid were assayed by ELISA. \nResults: Btk inhibitor Ibrutinib prevented lesion growth, reduced mRNA \n\n \nexpression of cyclooxygenase-2, alpha smooth muscle actin and type I collagen \nin the lesions and skewed activated B cells toward Breg in the spleen of mice with \nendometriosis. In addition, the number of M2 macrophages decreased in the \nperitoneal cavity of Ibrutinib- treated mice compared to anti -CD20 and control \nmice. Depletion of B cells using an anti -CD20 antibody had no effect on activity \nand growth of endometriotic lesions , neither on the macrophages, compared to \ncontrol mice. Conclusion: Ibrutinib treatment reduced the size and activity of the \nlesions, as well as the expression of inflammatory and fibrotic markers, whereas \ncomplete B lymphocyte depletion by anti -CD20 had no impact on the course of \nthe disease. However, it is still unclear whether B cell inactivation by Ibrutinib can \nprevent establishment and/or progression of endometriosis in humans. Further \ninvestigation may contribute to clarifying the role of B cell subsets in human \nendometriosis and to developing new therapeutic strategies.  \n \nDescriptors: Endometriosis; B -Lymphocytes; Immunology; B-lymphocytes \nregulatory; Macrophages; Mice. \n \n \n \n.\n\n \n  \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n                                                               1 INTRODUCTION\n\n2 \n \n1 INTRODUCTION \n \n \nEndometriosis is a chronic gynecological disorder , characterized by the \npresence and growth of endometrial tissue outside the uterine cavity (Giudice \nand Kao, 2004; Tosti et al., 2015). It is a benign but frequent inflammatory disease \nthat occurs in  about 5 -15% of women in reproductive age (Giudice and Kao , \n2004). The main symptoms of endometriosis are chronic pelvic pain (40-60%) \nand infertility ( 20-30%), with a major impact in the quality of life of the patients  \n(Waller et al., 1993). \nThe current theory on endometriosis pathogenesis is based on the so-called \nretrograde menstruation phenomenon. It is defined as the reflux of endometrial \nfragments through the fallopian tubes during menstruation,  with subsequent \nimplantation in the peritoneal cavity  (Sampson, 1927; McKinnon et al. , 2018). \nHowever, as menstrual regurgitation occurs in 90% of women (Halme et al. , \n1984), and only a small part of them suffers  from endometriosis, this theory is \nmore likely to explain the initiation of the disorder. Additional inflammatory factors \nmay be implicated in the development of endometriotic lesions (D’Hooghe and \nDebrock, 2002) and maintenance of the disease.  \nHormonal abnormalities are also involved in endometriosis. The expression \nof aromatase in endometriotic implants induces local estrogen synthesis that, \nalong with the progesterone resistance, favor proliferation of endometriotic \nlesions (McKinnon et al. , 2018). However, hormonal interventions to treat \nendometriosis may control the symptoms, but have not been fully successful  in \ncontrolling di sease’s progression, highlighting the role of other factors in \nendometriosis pathophysiology (Vercellini et al., 2014; Tosti et al., 2017).  \nIndeed, many studies have emphasized the role of chronic inflammation and \naberrant immune response as major mechanisms of endometriosis development \n(Riccio et al. , 2018). Several immunological abnormalities have been reported, \nsuch as decreased natural killer (NK) cytotoxicity and T cell reactivity, polyclonal \nactivation of B cells and antibody production, modifications in inflammatory \nmediators, and increased number and activation of peritoneal macrophages \n\n3 \n \n(Riccio et al., 2018). However, many aspects of the role of the immune system in \nendometriosis remains to be clarified. \nMacrophages are the most prevalent type of immune cells in the peritoneal \nfluid (Ho et al., 1997), and their number, activation and cytokine production are \nincreased in endometriosis  (Oral et al ., 1996; Berkkanoglu and Arici , 2003; \nKrálíčková and Vetvicka , 2015). These cells induce inflammation, tissue repair, \nangiogenesis and the recruitment of fibroblasts and endothelial cells, through the \nproduction of immunomodulators  (Oral et al. , 1996; McLaren,  2000). The \nperitoneal environment is regulated by activated macrophages through  the \nphagocytosis of red blood cells, tissue fragments and cellular debris (Králíčková \nand Vetvicka, 2015).  \nHowever, it seems that these immunosurveillance mechanisms are \ndefective in endometriosis and the macrophages fail to eliminate ectopic \nendometrial cells that reach peritoneal cavity through  retrograde menstruation \n(Králíčková and Vetvicka, 2015).  \nEndometriosis is associated with an imbalance towards pro- inflammatory \ncytokines mainly produced by innate immune cells , like macrophages and NK \ncells (Beste et al., 2014). This phenomenon leads to recruitment and activation \nof other immune cells like B lymphocytes, T lymphocytes and NK cells , that \ncontribute to chronic local inflammation. In addition, they  induce neo-\nangiogenesis and activation of stro mal and epithelial endometri al cells, leading \nto endometriotic implants development (Riccio et al. , 2018). Moreover, \ninflammation induces reactive oxygen species (ROS) production in endometriotic \ncells that activate various tyrosine kinases (Ngô et al., 2009; Santulli et al., 2015), \ncontributing to this process.  \nIn addition to innate immunity, cells from adaptive immunity also play a role \nin endometriosis  (Riccio et al. , 2018). Activation of CD4 + T cells has been \ndescribed with an imbalance towards a T helper (Th) 2 phenotype that drives the \nfibrosis of lesions (Podgaec et al., 2007; Chen et al., 2012, 2016) and a combined \nincrease in Th17 cells maintains the inflammatory process (Gogacz et al., 2016). \nRegulatory CD4+FoxP3+ T cells have been investigated over the last few years \nwith controversies regarding their number and their role (de Barros et al. , 2017). \nRecent findings seem to support  the major role of regulatory T cells in limiting \n\n4 \n \nendometriosis development, such as fewer activated regulatory cells on active \nlesions and increased number and size of endometriotic lesions in mice depleted \nfor regulatory T cells (Tanaka et al., 2017).  \nB lymphocytes are important players of the adaptive immune response, and \nthey are responsible for the production of antibodies against antigens . In  \nendometriosis, these cells seem to contribute to the progression of the disease \nthrough autoantibody secretion (Straub, 2007). \nSeveral studies (Badawy et al., 1987, 1989; Gleicher et al., 1987; Odukoya \net al. , 1995, 1996a, 1996b; Lachapelle et al. , 1996; Chishima et al. , 2000; \nAntsiferova et al., 2005; Hever et al. , 2007; Berbic et al. , 2013; Scheerer et al. , \n2016; Walankiewicz et al., 2018) have described the presence of increased \nnumber and activation of B cells in the blood and peritoneal cavity of patients with \nendometriosis. A polyclonal activation of B cells is associated with an i ncreased \nexpression of activation markers like CD23 and Toll- like receptor 4 (TLR4), and \nof growth factors like B lymphocyte stimulator (BLys). BLys plays a key role in B \ncells survival, activation,  and differentiation into plasma cells . It binds  to B cell  \nreceptor (BCR) and through Bruton’s tyrosine kinase (Btk)  activates nuclear \nfactor kappa B (NF-κB) pathway (Shinners et al., 2007). \nMoreover, the presence of anti -endometrial autoantibodies  (Wild and \nShivers 1985; Fernández -Shaw et al., 1993) has been described in a large \nproportion of women with endometriosis, though its clinical significance remains \nto be determined. I t has been hypothesized that infertility associated to \nendometriosis may be partly due to polyclonal B  cell activation, associated with \nB-1 cell proliferation resulting in autoantibody abnormalities  (Chishima et al.,  \n2000). \nEndometriosis is a chronic inflammatory disease that presents changes in \nboth humoral and cellular immuni ty (Nothnick, 2001), leading to inflammatory \nreactions and proliferation of endometriotic cells (Osuga et al., 2011). There are \nsome common aspects between endometriosis and autoimmune disorders, such \nas: tissue injury, polyclonal activation of B cells, abnormalities of B and T \nlymphocytes, changes in apoptosis, association with other autoimmune diseases, \nmultiple organ involvement, familial occurrence and possible environmental and \ngenetic factors associated (Nothnick, 2001).  \n\n5 \n \nThe pathogenesis of endometriosis is multifactorial. Several authors have \nattempted to clarify the role of the immune system in endometriosis and various \nabnormalities have been detected, including increased B lymphocytes and \nexcessive production of autoantibodies. The import ance of the immune system \nin the pathogenesis of endometriosis supports the idea of using therapeutic \nstrategies involving compounds  that modulate specifically the functions of \nimmune cells (Osuga et al., 2011).  \nThus, in th e present  study, we have hypothesized that B lymphocytes \ncontribute to endometriosis development and B cell depletion or inactivation can \nlimit disease’s progression. We have evaluated the effects of B cell s through a \ndouble strategy – complete depletion with anti-CD20 antibody or inactivation with \nBtk inhibitor Ibrutinib – to characterize their effects on disease development in a \nrelevant mice model of endometriosis. \nThere is an urgent need for new approaches to the medical treatment of \nendometriosis, especially non-hormonal therapies, and the better understanding \nof the immunological aspects of endometriosis could lead to the development of \nnew therapeutic strategies targeting immune cells. \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n2 OBJECTIVES\n\n7 \n \n2 OBJECTIVES \n \n \n2.1 Primary \n \n \n• To evaluate the effects of B lymphocyte depletion with anti -CD20 and \ninactivation with Btk inhibitor Ibrutinib on endometriosis development  in \nmice. \n \n2.2 Secondary \n \n \n• To evaluate the effects of both strategies on M1 and M2 macrophage \npopulations in the spleen and peritoneal fluid of endometriotic mice.  \n• To evaluate the effects of Ibrutinib treatment on T lymphocyte subsets in the \nspleen and peritoneal fluid of endometriotic mice.  \n• To evaluate the effects of Ibrutinib treatment on inflammatory and \nimmunomodulatory cytokines in the serum and peritoneal fluid of \nendometriotic mice. \n \n \n \n \n \n \n \n \n \n \n \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n3 LITERATURE REVIEW \n\n9 \n \n3 LITERATURE REVIEW \n \n \n3.1 Endometriosis \n \n \nEndometriosis is a gynecological disease currently defined as: “the \npresence of functional endometrial-like tissue outside the uterus, but in the pelvic \ncavity, or even outside, with evidence that lesions are cellularly active, or have \nan effect on normal physiology” (Audebert et al., 1992). Initially, peritoneal \nendometriosis, deep infiltrating endometriosis, endometrioma and adenomyosis \nwhere defined all together as “adenomyoma” (Benagiano et al., 2014). \nThe surgeon Thomas Cullen first described the morphology and clinic of \n“adenomyoma” in his book “Adenomyoma of the Uterus”, in the end of the 19\nth \ncentury (Benagiano et al., 2014). In 1860, Austrian pathologist Karl von \nRokitansky described the microscopical aspects of endometriosis, although he \ndid not appear to recognize that the disease he was examining was already being \nreferred to by other names (Nezhat et al., 2012). In the 192 0s, Sampson first \nintroduced the term “endometriosis” and Frankl described “adenomyosis”, so the \ntwo diseases became separate entities, with different diagnosis criteria of the so-\ncalled “adenomyoma” (Benagiano et al., 2014).  \nThe introduction of laparoscopy in the early 1960s made it possible to \ndistinguish three different clinical presentations of endometriosis: a) peritoneal \nendometriosis, characterized by small superficial lesions, usually located in the \npelvis; b) ovarian endometrioma (OMA), a cyst containing chocolate colored fluid \nderived from repeated hemorrhages of the endometriotic foci; c) deep infiltrating \nendometriosis (DIE), with lesions that invade the peritoneum deeper than 5mm \n(Nisolle and Donnez, 1997). These three phenotypes may co- exist in the same \npatient and the disease is usually multifocal (Andres et al., 2018).  \nSeveral authors have proposed different classifications systems to \ncategorize endometriosis: Sampson (1921) proposed a classification for ovarian \n\n10 \n \ncysts; Wicks and Larson (1949) classified endometriosis based on histological \nfindings; Acosta et al. (1973) used surgical findings and Chapron et al. (2003) \nconsidered anatomical distribution of lesions in anterior and posterior \ncompartments. However, none of these classifications systems have been widely \naccepted and used.  \nA score system was proposed in 1985 and revised in 1996 by the American \nSociety of Reproductive Medicine (rASRM). This system classifies endometriosis \nin four stages: I (1-5 points), II (6-15 points), III (16-40 points), and IV (>40 points). \nrASRM has been widely used and accepted in different countries, but it has some \nlimitations, concerning severity and location of deep infiltrating endometriosis. \nThe Enzian classification system was proposed in 2005 (Tuttlies et al., 2005) \nto improve rASRM  and include  location and severity of DIE, as well as its \nassociation with pain. It was revised and 2011 and it is considered a good \ncomplement do rASRM to describe DIE (Haas et al., 2013a). Unfortunately, the \nEnzian classification is more complex, does not have an international acceptance \nand it is mainly used in German-speaking countries (Haas et al., 2013b).  \nHistological analysis of endometriotic lesions show undifferentiated \nglandular and/or stromal cells surrounded by fibrotic tissue (Tosti et al., 2015). \nHowever, it has been shown that endometrial cells represent a minor component \nof the lesions and may be often absent, while a smooth muscle component \nand fibrosis represent consistent features of all disease forms.  Therefore, the \ninclusion of fibrosis in the definition of endometriosis has been recently proposed \n(Vigano et al., 2018). \nAbrão et al. (2003) compared the histological patterns with the stages of \nrASRM classification and showed that early disease (stages I and II) was \nassociated with stromal and well-differentiated histological pattern and advanced \ndisease (stages III and IV) was associated with pure or mixed undifferentiated \ndisease. \nThe gold standard for the diagnosis of endometriosis is by laparoscopy with \npathological confirmation (Dunselman et al.,  2014). However, there is an \nincreasing role of noninvasive diagnostic methods such as magnetic  resonance \nimaging (MRI) (Barbisan et al., 2021) and transvaginal ultrasound with or without \nbowel preparation (Goncalves et al., 2010, 2021; Mattos et al., 2019). \n\n11 \n \nThe disease can be asymptomatic or cause six main symptoms: \ndysmenorrhea; dyspareunia; noncyclic pelvic pain; urinary or bowel cyclic \nsymptoms and infertility. In most cases, the location and severity of the lesions \nare not clearly related to the symptoms, and the only strong association observed \nby most investigators is between deep posterior cul -de-sac lesions and \ndyspareunia (Vercellini et al., 2007). \nDeep infiltrating endometriosis is related to more severe symptoms than \nperitoneal endometriosis and can affect 48% of all women with the disease. DIE \ncan occur in multiple sites in the peritoneal cavity, including bowel, bladder, \nretrocervical area, vagina, and ureter (Bellelis et al., 2010). The treatment is often \nsurgical, but c omplete excision of all DIE lesions is challenging, can have high \nrates of complications and often requires a multidisciplinary approach (de Paula \nAndres et al., 2017). \nThe clinical management of symptoms include painkillers and nonsteroidal \nanti-inflammatory drugs, but the most effective  are hormonal compounds. The \ngoal is to achieve inhibition of ovulation and abolition of menstruation, based on \nthe concept that the response of the eutopic and ectopic endometrium is \nsubstantially similar  (Vercellini et al., 2014). Medical therapy should be \nconsidered a long-term treatment, as the therapy for other chronic inflammatory \nconditions, and it has been consistently demonstrated that, as long as \namenorrhea is achieved, there are no differences between the various availabl e \ndrugs in terms of pain relief  (Vercellini et al., 2009). Moreover, the desire for a \nspontaneous pregnancy may contribute to the decision between clinical and \nsurgical treatment, as the hormonal treatments are contraceptive. \n \n3.1.1 Animal models in endometriosis \n \n \nAlthough endometriosis has been described and studied for over a century, \nmany aspects of its pathophysiology  remain not completely understood. In this \ncontext, animal model s of the disease could help clarifying its aspects and \ndeveloping new therapeutic approaches. Many strategies have been tested to \nestablish and validate research animal models of endometriosis. Several animal \n\n12 \n \nmodels have been described, including non-human primates, rabbits, hamsters, \nrats, and mice, each one with its strengths and limitations.  \nThe occurrence of spontaneous endometriosis –  with lesions resembling \nhuman’s disease in morphology and location – has been described in non-human \nprimates (Story and Kennedy , 2004). It and has been suggested to result from  \nincreased exposure to retrograde menstruation due to controlled mating in \ncaptivity (D’Hooghe et al.,  1996). The study of spontaneous endometriosi s in \nprimates would probably be the most suitable model to research purposes, but \nits low incidence and slow progression lead to the development of methods to \nartificially induce endometriotic lesions in these animals (Tirado -González et al., \n2010).  \nThese techniques include the use of different methods to occlude the \nuterine cervix to increase menstrual reflux through fallopian tubes (D’Hooghe et \nal., 1994) and the transplantation of endometrial tissue to ectopic sites in the \nperitoneal cavity (Yang et al., 2000; Fazleabas et al., 2002). Lesions observed \nafter intraperitoneal inoculation of endometrium are similar to those observed in \nspontaneous disease in baboons (D’Hooghe et al., 1995). Primates offer a \nrelevant preclinical model with man y similarities to humans concerning \nreproductive anatomy, endocrinology , and physiology. (Tirado-González et al., \n2010). However, the limitations of using primate model s are ethical issues and \nhigh-cost development and maintenance (Van Duyne et al., 2009).  \nLaboratory mice have been widely used as endometriosis animal model s, \ndue to their low cost, possibility of studying endometrial lesions at different \nintervals of time, performing analysis in genetically similar animals, evaluating of \ndrug and treatments e ffects, and introducing endometrial tissue into recipients  \n(Becker et al., 2006). Although these models are the most used worldwide, they \nalso present several limitations. The main physiological difference is the lack of \nmenstruation in mice, so endometriosis must be induced surgically (Marcellin et \nal., 2017) or by peritoneal injection of endometrial tissue  (Fainaru et al., 2008). \nMurine models are classified in homologous and heterologous models , \naccordingly to the origin of the endometrial tissue used for induction.  \nHomologous models are based on the transplantation of endometrial \nfragments from syngeneic  animals in immunocompetent recipients. The \n\n13 \n \nfragments can be surgically implanted in the peritoneal wall or other abdominal \nsites (Marcellin et al., 2017) or injected intraperitoneally (Somigliana et al., 1999). \nIn these models, both donors and recipients receive exogenous estrogen \ntreatment to prevent variation in the estrogenic cycle. In addit ion, estrogen \ntherapy facilitates endometrial tissue growth in the donors to be suitable for \ntransplantation and contributes to endometriosis development  in recipients, as \nthis hormone plays an important role in the disease’s pathophysiology (Tirado -\nGonzález et al., 2010). \nIn heterologous models, endometrial human tissue is transplanted into \nimmunodeficient mice. The tissue can be obtained from menstrual fluid, \nendometrial biopsy (Story and Kennedy , 2004) or ovarian endometriomas \n(Santulli et al., 2016) and it can be transplanted by inoculation into the peritoneal \ncavity (Somigliana et al., 1999) or by laparotomy and suture of the fragments in \nthe peritoneal wall (Santulli et al., 2016). The main strength of the heterologous \nmodel is the use of human endometrium, but the transplanted tissue has a limited \nlifespan, being unable to persist beyond four weeks (Grümmer et al., 2001). Other \nlimitation is the lack of immune response of nude mice making it more susceptible \nfor infections and unable to mimic the immune changes against endometrial \ntissue observed in endometriosis (Bruner‐Tran et al., 2002). \nAlthough none of the currently available models is perfect in simulating all \naspects of the human disease, they are valuable tools to controlled studies that \naim better understanding the disease’s pathophysiology, developing new \ndiagnostic methods and therapeutic interventions (Tirado-González et al., 2010). \n \n3.2 Immunology of endometriosis \n \n \nThe pathophysiology of endometriosis is not completely understood. The \nmain theories that have been proposed to explain the disease are: a) retrograde \nmenstruation (Sampson, 1927): endometrial cells migrate through the fallopian \ntubes and reach the peritoneal cav ity; b) celomic metaplasia (Bulun , 2009); c) \nblood and lymphatic dissemination of endometrial cells (Abrã o et al., 2006); d) \n\n14 \n \nendometrium-derived stem cells migrating to ectopic sites (Hufnagel et al., 2015); \ne) epigenetic changes leading to a pro- inflammatory microenvironment (Laganà \net al.,  2017); f) environmental toxicants acting as endocrine disrupters on the \nfemale reproductive system  (Sofo et al.,  2015). However, none of them can \ncompletely explain the disease in all its aspects, and its pathophysiology seems \nto be multifactorial.  \nThe immune system also contributes to the development of endometriosis, \nand several abnormalities have been identified in women with the disease  \n(Christodoulakos et al., 2007). Disturbances in immune homeostasis are \nassociated with increase in implantation, proliferation,  and angiogenesis of the \nectopic endometrial tissue (Matarese et al., 2003).  \n \n3.2.1 Immunosurveillance \n \n \nRetrograde menstruation described by Sampson (1927) is a phenomenon \nknown to occur in most women in reproductive age with patent fallopian tubes \n(Halme et al., 1984). However, only 5- 15% of them are affected with \nendometriosis. Endometrial cells that migrate through uterine tubes are not able \nto implant in the peritoneal cavity of healthy women, they are eliminated by \nimmunosurveillance system  and apoptosis. Changes in cell -mediated and \nhumoral immunity probably prevent the clearance of the endometrial  cells that \nreach the peritoneal cavity and allow their implantation and development (Senturk \nand Arici, 1999; Paul Dmowski and Braun, 2004).  \nIt is not clear how ectopic endometrial cells perform immunosurveillance \nevasion, and some hypotheses have been proposed to explain this phenomenon. \nThe endometriotic implants produce proteins that interfere in their recognition by \nthe leukocytes, such as the intercellular adhesion molecule soluble form (sICAM-\n1). This circulating  protein binds to leukocyte function antigen (LFA -1) and the \nleukocytes become less available to identify the aberrant endometrial cells \nthrough their ICAM -1. The messenger ribonucleic acid ( mRNA) expression of \nsICAM-1 was shown to be increased in endometriotic stromal cells, compared to \nstromal cells of eutopic endometrium (Vigano et al., 2018). \n \n\n15 \n \nIn addition, dysfunctional or aberrant cells of the normal endometrium are \nusually eliminated by apoptosis as part of a tissue repair mechanism during \nmenstrual cycle. Overexpression of antiapoptotic factors and decreased \nexpression of proapoptotic factors  interfere in this mechanism of programmed \ncell death of the endometrial cells that reach peritoneal cavity, leading to the \ndevelopment of the disease (Tosti et al., 2015).  \nThe Fas-Fas ligand (Fas L) apoptosis pathway seem s to be involved in \nperitoneal immunosurveillance (Vetvicka et al., 2016). In endometriosis, \nincreased FasL expression in stromal cells leads to Fas -mediated apoptosis of \nactivated immune cells that express Fas, such as T lymphocytes and NK cells. \nThrough this mechanism, ectopic endometrial cells escape immunosurveillance  \n(Selam et al., 2002), so apoptosis pathways could be a therapeutic target for \nendometriosis. The use of gonadotropin- releasing hormone ( GnRH) analogs to \nincrease proapoptotic protein Bax and decrease antiapoptotic protein B cell \nlymphoma 2 ( Bcl-2) in endometrial cell cultures has been described (Bilotas et \nal., 2007). \nEctopic endometrial cells escape immunosurveillance and it has been \nproposed that stromal cells are involved in cellular adhesion to intraperitoneal \nsurface, whereas glandular cells play a role in invasion and growth of the lesion  \n(Ahn et al.,  2015). The growth of endometrial implants starts an intense \ninflammatory response, with immune cells recruitment, angiogenesis and \nproinflammatory cytokines and growth factors increasing. In addition, tissue-\nrepair mechanisms are also activated, with fibroblasts mobilization and \nproliferation of connective tissue (Paul Dmowski and Braun, 2004).\n \nEndometriosis is a chronic inflammatory disease, and inflammation plays a \nkey role through mitogen- activated protein kinase (MAPK) signaling pathways  \nleading to increased cyclooxygenase-2 (COX-2), interleukins and oxidative stress \n(Santulli et al.,  2015). MAPK are altered in endometriotic lesions, and it was \nshown that their inhibitors can control disease progression both in vitro  and in \nanimal models (Leconte et al., 2015). However, the use of MAPK inhibitors in the \ntreatment of  endometriosis is still limited due to their teratogenicity and side \neffects (Santulli et al., 2015). \n\n16 \n \nThe MAPK pathway can increase inflammation and endometriosis clinic \nrepercussion by : recruitment of immune cells and amplification of the \ninflammatory response (Kaminska, 2005); generation of an antiapoptotic signal \n(Harada et al., 2004); increased growth factor s expression leading to \nangiogenesis (Hamden et al., 2005); playing a role in  the development of pain \nand hypersensitivity to pain (Ji and Suter , 2007); or acting as intracellular and \nextracellular signal transducers in endometriotic cells (Santulli et al., 2015). \nMany functional changes in the immunological components of the peritoneal \nfluid of women with endometriosis have been described. Macrophages, NK cells, \nT lymphocytes, B lymphocytes and cytokines are altered (Ho et al., 1997), but the \nexact role of these changes in the progression of the disease has not been \ncompletely clarified (Gazvani and Templeton, 2002). \n \n3.2.2 Innate immunity \n \n \nMacrophages and NK cells are important players of innate immunity, and \nalterations in both types of cells have been described in endometriosis.  \nMacrophages number and activation are increased in endometriosis (Oral et al., \n1996), as well as their cytokines production (Berkkanoglu and Arici , 2003; \nKrálíčková and Vetvicka, 2015). \n \n3.2.2.1 The role of macrophages \n \n \nActivated macrophages can regulate the peritoneal environment by \nphagocyting red blood cells, damaged tissue fragments and cellular debris  \n(Králíčková and Vetvicka, 2015) or by producing soluble mediators like cytokines, \nprostaglandins, complement components and enzymes. Through the secretion \nof these immune mediators, macrophages can induce inflammation, tissue repair, \nand neovascularization and  may favor the recruitment of fibroblasts and \nendothelial cells (Oral et al., 1996; McLaren,  2000). The macrophage- derived \n\n17 \n \ncytokines stimulate the activation of other immune cells such as T and B \nlymphocytes. \nDespite of their increased activation, the phagocytic activity of macrophages \nis reduced in endometriosis (Králíčková and Ve tvicka, 2015), as they fail to \neliminate the ectopic endometrial cells that reach the cavity through retrograde \nmenstruation. The expression of CD36 receptor and the activation of matrix \nmetalloproteinases regulate macrophages ’ phagocytic function and both  \nmechanisms are suppressed by prostaglandin E2, which is overexpressed in \npatients with endometriosis (Wu et al., 2005).  \nThe scavenger function of the peritoneal macrophages depends on their \nattachment to extracellular  matrix components. Increased nonadherent \nmacrophages have been described in the peritoneal fluid of women with \nendometriosis, suggesting a defective scavenger function that could lead to \nsurvival of ectopic endometrial cells (Berkkanoglu and Arici, 2003). \nMacrophages exhibit a phenotypic plasticity in their various \nmicroenvironments and are classified in two main groups, with different functions. \nThe M1 macrophages produce high quantities  of inflammatory cytokines  and \nnitric oxide (NO) through inducible nitric oxide synthase (iNOS) (Orecchioni et al., \n2019) and are specialized in the elimination of microorganisms and defective  \ncells. Interferon (IFN)- γ and tumor necrosis factor (TNF) are associated with the \ninduction of “classically activated ” or M1 -like macrophages, expressing anti -\nmicrobial effector functions (Schleicher et al., 2016).  \nCytokines such as interleukin (IL) -4, IL -10, IL-13, or transforming  growth \nfactor (TGF)-β limit the release of proinflammatory factors  by macrophages and \npromote macrophage phenotypes that suppress T cell responses and/or support \ntissue repair , named “ alternatively activated” or M2 macrophages. These \nmacrophages present a distinct profile and have distinct functions: they modulate \nadaptive immune response, promote angiogenesis  and ti ssue repair, and \nscavenge cellular debris (Cominelli et al., 2014). M2 macrophages are related to \nupregulation of the resistin -like molecule alpha (Relma,  Retnla; also termed \n‘‘found in inflammatory zone-1’’, Fizz1) and arginase 1 (Arg1) (Schleicher et al., \n2016). Arg1 expression is characteristic for wound healing  and tissue \nregeneration (Schleicher et al., 2016).  \n\n18 \n \nAn imbalance in M1 macrophages was shown in the eutopic endometrium \nof women with endometriosis  (Takebayashi et al., 2015). H owever, M2 \nmacrophages are significantly upregulated in the peritoneum  and lesions of \nwomen (Bacci et al., 2009) and rhesus macaques with the disease (Smith et al., \n2012). Experiments with macrophage depletion further demonstrated the key role \nof M2 macrophages in endometriotic  grafting, development, and persistence  \n(Bacci et al., 2009; Haber et al., 2009). In addition, selective adoptive transfer of \nM2 macrophages indicated that they promote endometriosis progression (Bacci \net al., 2009). \nThe imbalance in macrophage subtypes was evaluated in a murine model \nof endometriosis, considering the classification in large peritoneal macrophages \n(LPMs) and small peritoneal  macrophages (SPMs)  (Yuan et al.,  2017). The \nauthors have shown an increased proportion of SPMs and an opposite trend for \nthe LPMs. They proposed that this new classification of macrophages should be \nincluded in further studies in endometriosis field. \nTo summarize, macrophages play a key role in the development of \nendometriosis once they fail to eliminate the ectopic endometrial cells that reach \nthe peritoneal cavity by retrograde menstruation.  In addition, tissue-repair \nmechanisms through M2 macr ophages in the peritoneal cavity contribute to the \nimplantation and proliferation of endometrial cells, resulting in the development \nof endometriotic lesions. \n \n3.2.2.2 The role of NK cells \n \n \nNatural killer (NK ) cells can kill target cells and secrete cytokines that \nparticipate in the adaptive immune response and tissue repair. NK cells are able \nto distinguish stressed cells that have undergone some  degree of injuries from \nnormal cells. Ectopic endometrial cells that reach the peritoneal cavity achieve to \nescape the clearance and are not  targeted or removed by NK cells in a not \ncompletely understood mechanism called “immunoescap e” (Vetvicka et al.,  \n2016). Decreased NK cell’s function could explain this mechanism, leading to \nadhesion and proliferation of endometrial cells, resulting in endometriotic lesions. \n\n19 \n \nHowever, it is also possible that this aberrant NK cell function is a consequence \nof the chronic inflammatory environment provided by the disease (Kikuchi et al., \n1993). \nDecreased NK cytotoxicity against endometrial cells in women with \nendometriosis was first described in 1991 (Oosterlynck et al., 1991) and it has \nbeen well established since then (Wilson et al., 1994). This phenomenon is more \nevident in the peritoneal cavity (Oosterlynck et al., 1993b; Ho et al.,  1997), but \nhas also been observed in peripheral blood of women with endometriosis \n(Oosterlynck et al., 1993a; Dias et al., 2012) and it can be correlated to advanced \nstages of the disease (Oosterlynck et al., 1993a). \nNK cells have different subsets, and they play a role in the interface between \ninnate and adaptive immune response. The NK T cells represent 15-20% of these \ncells and express T-cell receptor (TCR) and CD3 membrane complex, in addition \nto classical CD16 expression. They can both kill target cells and secrete cytokines \nsuch as IL -4 and IL- 10, which are important in the control of autoimmunity \n(Moretta, 2002). \nThe NK cell detection system includes a variety of cell surface activating \n(KAR) and inhibitory (KIR) receptors, that regulate NK cell activities. Among the \ncell surface activating receptors, two main receptors that trigger a cytotoxic \nresponse can be dist inguished: NKG2D and CD16 (FcgRIIIa). The second can \nbind and destroy immunoglobulin G (IgG)-coated stressed cells by a mechanism \ncalled antibody -dependent cell -mediated cytotoxicity. In addition, the cytotoxic \nactivity of the NK cells can be increased by cytokines such as IL-2 (Paul Dmowski \nand Braun 2004). \nGonzález-Foruria et al. (2015) evaluated ligands for NKG2D in the \nperitoneal fluid of women with endometriosis  and demonstrated a significant \nincrease in soluble NKG2D ligands. These soluble forms act as decoy receptors, \nrepresenting a lower expression of NKG2D in ectopic endometrial cell surface, \nheading toward greater evasion from NK cell recognition. \nDespite the decreased NK cell function in endometriosis, the mechanisms \nof this suppression are not clear. There is also no consensus regarding the \nnumber of NK cells in endometriosis , neither in the blood nor  in the peritoneal \ncavity (Oosterlynck et al., 1993a, 1993b; Hsu et al.,  1997; Dias et al.,  2012). \n\n20 \n \nQualitatively, an increased expression of KIR on peritoneal NK cells from women \nwith endometriosis was reported, which could explain the decreased peritoneal \nNK cell activity in these patients (Wu et al., 2000; Maeda et al., 2002). \nProstaglandins and cytokines derived from macrophages in the \ninflammatory peritoneal environment in endometriosis may also modulate NK \nactivity. This hypothesis is corroborated by studies showing that serum and \nperitoneal fluid of women with endometriosis suppressed NK cytotoxic activities  \nwhen compared to serum and peritoneal fluid of controls  (Oosterlynck et al.,  \n1993b). \nNK cells contribute to the balance of immune self -tolerance by targeting \ncells that present self-antigens. Therefore, their reduced activity in endometriosis \ncould explain the increased autoimmune reactivity observed in the disease  \n(Matarese et al., 2003). \n \n \n3.2.3 Adaptive cell-mediated immunity: T lymphocytes \n \n \nAdaptive immunity plays an essential role in the survival and proliferation of \nectopic endometrial cells. Indeed, endometriosis is characterized by the reduced \nactivity of cytotoxic T cells; modulation of cytokine secretion by T helper cells and \nautoantibody production by B lymphocytes  (Osuga et al., 2011; Králíčková and \nVetvicka, 2015).  \nT lymphocytes are derived from stem cells in the bone marrow and fetal \nliver, completing their development in the thymus . The main T cells subsets are \nthose that express glycoproteins CD4 and CD8, which function as co- receptors \nfor major histocompatibility complex ( MHC) class II and class I molecules, \nrespectively (Startseva, 1980; Paul Dmowski and Braun, 2004).  \nThe CD8+ T cells can activate macrophages and kill cells that are infected \nby virus or intracellular pathogens (Startseva , 1980; Paul Dmowski and Braun , \n2004). The CD4+ T cells can be classified in Th1 and Th2, with different functions: \nTh1 cells promote the differentiation of the CD8+ T cells and facilitate cell -\nmediated immunity by activating monocytes and macrophages; Th2 cells lead to \nthe differentiation of B cells i nto plasma cells that secrete antibodies.  The two \n\n21 \n \ngroups of lymphocytes secrete different cytokines: Th1: IL- 2, IL -12, interferon \n(IFN)-γ, TNF-α and TNF-β; Th2: IL -4, IL-5, IL-6, IL-10, and IL- 13 (Gazvani and \nTempleton, 2002).  \nStudies that have evaluated T lymphocytes in patients with endometriosis \nshowed higher CD4 +/CD8+ ratio and increased concentration of each subset in \nthe peritoneal fluid of the patients, but with a relative reduction in Th1 cells (Ho et \nal., 1997). The endometriotic lesions  showed higher concentration of T  \nlymphocytes when compared to eutopic endometrium, but with a similar \nCD4+/CD8+ ratio. There were no changes in the peripheral blood (Startseva, 1980; \nPaul Dmowski and Braun,  2004) and endometriotic lesions also showed higher \nTh17 lymphocyte fraction when compared to eutopic endometrium (Takamura et \nal., 2015). \nThe mechanism of implantation of the ectopic endometrial cells in the \nperitoneal cavity depends on  altered macrophages. These cells also produce \ninflammatory cytokines that recruit and activate Th1  and Th2 T cells (Ho et al., \n1997). \nAnother important subset of the T lymphocytes is the regulatory T cells \n(Treg). They are potent suppressors of inflammatory immune responses and are \nresponsible for maintaining antigen- specific T-cell tolerance and immune \nhomeostasis. A systematic review (de Barros et al., 2017) evaluated the role of \nTreg in endometriosis. The authors concluded that there is a higher concentration \nof Treg cells and/or their expression markers in the peritoneal fluid and in the \nendometriotic lesions of women with endometriosis, when compared to controls. \nHowever, there is no consensus about the concentration of Treg cells in the \neutopic endometrium and peripheral blood of these patients. \n \n3.2.4 Inflammatory mediators \n \n \nIncreased soluble factors such as autoantibodies, cytokines, growth factors, \nadhesion molecules, enzymes, hormones, prostaglandins, and ROS  have been \ndescribed in the blood, peritoneal fluid, and lesions of patients with endometriosis \n(Oral et al., 1996; Koninckx et al., 1998; Mathur, 2000; Harada et al., 2004). This \n\n22 \n \nfact is probably a consequence of the high number of leukocytes, macrophages, \nand other immune cells in the peritoneal cavity of these patients. \nThese proteins work as mediators of the immune system (Kayisli et al.,  \n2002), regulating:  proliferation and differentiation of immune cells ; \nimmunoglobulin secretion; cytotoxic activities and enzymes and acute phase \nproteins secretion (Gazvani and Templeton, 2002). \nStudies have shown that the high concentration of inflammatory mediators \nin the peritoneal fluid in endometriosis has toxic effects on oocyte pick up by the \nfimbria, sperm -oocyte interaction, and embryo implantation, leading to an \naberrant reproductive function in these women (Paul Dmowski and Braun, 2004). \nMany cytokines – IL-1 (Sikora et al.,  2018; Malvezzi et al.,  2019), IL -4 \n(OuYang et al., 2008), IL-6 (Podgaec et al., 2012; Malvezzi et al.,  2019), IL-8 \n(Arici et al., 1996; Iwabe et al., 1998; Malvezzi et al.,  2019), IL -10 (Ho et al., \n1997), IL-33 (Santulli et al., 2012), and TNF-α (Richter et al., 1998; Arlıer et al., \n2018) – and growth factors –TGF-β (Podgaec et al., 2012), insulin-like growth \nfactor (IGF-1) (Chang and Ho, 1997; Kim et al., 2000), hepatocyte growth factor \n(HGF) (Osuga et al., 1999), epidermal growth factor (EGF) (Laschke et al., 2006), \nplatelet-derived growth factor (PDGF) (Laschke et al.,  2006), and vascular \nendothelial growth factor (VEGF) (Mahnke et al., 2000; McLaren, 2000; Laschke \net al., 2006) – are significantly increased in endometriosis. In addition, studies \nhave shown that there are changes in the  Th1/Th2 balance toward Th2 in \nendometriosis (Moretta, 2002; Podgaec et al., 2007; Králíčková and Vetvicka,  \n2015). \nIn endometriotic lesions, VEGF induces angiogenesis,  and its \nimmunostaining was observed in the  epithelium of endometriotic implants \n(Shifren et al.,  1996), particularly in hemorrhagic red implants  (Donnez et al., \n1998). VEGF is also increased in the peritoneal fluid of women with endometriosis \n(Lebovic et al., 2001; Laschke et al., 2006). However, is not yet clarified whether \nit is produced by endometriotic lesions (Shifren et al., 1996; Lebovic et al., 2000) \nor by activated peritoneal macrophages (McLaren, 2000).  \nIL-6 is one of the main cytokines in the inflammatory cascade in \nendometriosis. It is elevated in the peritoneal cavity and blood of these patients, \nand it is correlated with disease activity (Oral and Arici, 1996; Harada et al., 2001) \n\n23 \n \nand infertility (Malvezzi et al., 2019). IL -10 is a potent down modulator of \ninflammatory responses and immune cell function – like B cells and macrophages \n– so it is probable that both IL-6 and IL-10 are partially responsible for the aberrant \nimmune regulation observed in endometriosis (Gazvani and Templeton, 2002). \nIL-6 can inhibit the proliferation of eutopic endometrial stromal cells \n(Zarmakoupis et al., 1995), but it has been shown that  ectopic stromal cells are \nresistant to IL-6, showing no inhibitory response (Rier et al., 1995). This cytokine \ninduces T cell activation and differentiation of B lymphocytes into antibody -\nproducing plasma cells, and it can lead to polyclonal B cell stimulation in \nautoimmune diseases (Paul Dmowski and Braun, 2004). IL-1 is another cytokine \nthat affects B cells and production of an tibodies in addition to increasing \nprostaglandins, collagen, and tissue repair (Ho et al., 1997; Senturk and Arici , \n1999). \nIL-1 and TNF-α usually initiate the cascade of cytokines and inflammatory \nresponse. TNF-α is increased in the peritoneal fluid of women with endometriosis, \nwith higher concentrations in the later stages of the disease (Funamizu et al., \n2014). It has been suggested that it may contribute to the adhesion of endometrial \ncells to the peritoneal cavity (Zhang et al., 1993) and regulation of inhibitory κ B \nprotein (Arlıer et al., 2018). \nIL-8 is also increased in endometriosis (Arici et al., 1996; Iwabe et al., 1998), \ncontributes to cell adhesion (Garcia-Velasco and Arici , 1999) and is a potent \nangiogenic factor (Paul Dmowski and Braun, 2004). IL-8 stimulates the growth of \ntopic and ectopic endometrial cells (Iwabe et al., 1998), probably through TNF-α \nactivation (Iwabe et al., 2000). It is produced by the mesothelium as a response \nto proinflammatory  cytokine stimuli  and IL-8 levels can be cor related to the \nseverity of the disease (Arici et al., 1996) and infertility (Malvezzi et al., 2019). \nConcerning the IL- 10 family, IL -19 and IL -22 were demonstrated to be \nsignificantly decreased in the sera of women with ovarian endometrioma (Santulli \net al., 2013). In addition, there was a reverse correlation between levels of these \ncytokines and the occurrence of deep dyspareunia in those patients. The authors \nconcluded that the low le vels of these anti-inflammatory cytokines may exert \neffects favorable to the development of ovarian endometrioma. \n\n24 \n \nIL-13 is another anti-inflammatory cytokine that was shown to be decreased \nin endometriosis. It is a  potent regulator of macrophage activation and its \nreduction in the peritoneal fluid of women with endometriosis could contribute to \nthe pathogenesis of the disease (Gallinelli et al., 2004).  \nThe cytokine production in the immune system works in a cascade mode:  \nthe biosynthesis of one type of cytokine activates the production of a whole group \nof inflammatory mediators. In addition, each  cytokine has various target tissues \nand biologic effects, which makes more difficult to clarify the role  of a specific \nmediator in the development of endometriosis. It has also been shown that they \ncan be produced by endometriotic cells, mesothelium, and other resident cells in \nthe peritoneal cavity (Harada et al., 2001; Song et al., 2003). Cytokines are also \nderegulated in the peripheral blood of women with endometriosis, suggesting a  \nsystemic effect of the disease (Paul Dmowski and Braun, 2004; Carmona et al., \n2012; Santulli et al., 2013). \n \n3.3 B lymphocytes and endometriosis \n \nThe immune cells of lymphoid lineage play a key role in the survival and \nproliferation of endometrial cells and many lymphocytes have been identified in \nendometriotic implants  (Klentzeris et al.,  1995). An aberrant function of these \nimmune cells has been described in endometriosis, with reduced activity of \ncytotoxic T cells , secretion of cytokines by T helper cells and autoantibody \nproduction by B lymphocytes (Osuga et al., 2011; Králíčková and Vetvicka, 2015). \nBone-marrow derived lymphocytes, or simply B lymphocytes, are players of \nhumoral immune response and produce antibodies against antigens. The major \nsubsets of B cells are follicular B cells, marginal zone B cells and B -1 B cells, \neach of which is found in distinct anatomic locations within lymphoid ti ssues \n(Abbas et al., 2011). In the pathogenesis of endometriosis, these cells seem to \ncontribute to the occurrence of the disease by autoantibody secretion (Straub, \n2007). \nTable 1 summarizes the results of 23 studies selected by systematic review \nof literature concerning the role of B lymphocytes in endometriosis (Riccio et al., \n2017). \n\n25 \n \n Table 1 – Studies that evaluated the role of B lymphocytes in endometriosis. \nSamples Study \ndesign Population Methods Markers B lymphocytes in EDT References \n Case-\ncontrol EDT x controls IBT Monoclonal \nantibodies \nIncreased B cells Badawy et al., \n1987 \nBlood/ serum Descriptive 59 EDT ELISA FAN; IgG; IgM lupus \nanticoagulant \nAbnormal polyclonal B cells \nactivation \nGleicher et al., \n1987 \n Case-\ncontrol 19 EDT x 26 infertile IBT; ELISA B cells; IgA; IgG. Increased B cells and IgG   Badawy et al., \n1989 \n Case-\ncontrol \n42 EDT x 20 infertile x  \n22 controls \nIn vitro stimulation \nwith polyclonal B-\ncell activators \nIgG1; IgG2; IgG3 \nNo difference in B cells. \n↓ polyclonal IgG2 production in \nEDT stages III and IV \nGebel et al., \n1993 \n Case-\ncontrol \n21 EDT x 18 controls ELISA sCD23 Activation of B cells Odukoya et al., \n1995  \n Case-\ncontrol \n25 EDT and idiopathic \ninfertility Flow cytometry CD19 No difference Nava-Loya et \nal., 1996 \n Case-\ncontrol 57 EDT x 40 controls ELISA sCD23; IgG Increased amount and \nactivation of B cells \nOdukoya et al., \n1996a \n Case-\ncontrol 31 EDT x 14 controls Flow cytometry; IF CD5; ANA B cells are related to ANA \nproduction. \nChishima et \nal., 2000 \n Case-\ncontrol \n175 EDT x 131 \ncontrols Flow cytometry CD20 Decreased B cells Gagné et al., \n2003 \n Case-\ncontrol 15 EDT x 20 controls Flow cytometry CD20; CD5 No difference Antsiferova et \nal., 2005 \n Case-\ncontrol \n10 OMA x 10 \nadenomyosis x 10 \nleiomyoma \nIHC; PCR; ELISA BlyS; Plasma cells Increased BlyS Hever et al., \n2007 \n\n26 \n \nTable 1 – Studies that evaluated the role of B lymphocytes in endometriosis (continuation). \nSamples Study \ndesign Population Methods Markers B lymphocytes in EDT References \nBlood/ serum Case-\ncontrol \n87 EDT x 33 \nadenomyosis x 205 \ncontrols \nPCR BlyS 817C/T \npolymorphism \nHeterozygosity ↓ risk of DIE; \nBlyS may play a role in the \npathogenesis. \nde Graaff et \nal., 2010 \n Case-\ncontrol \n165 infertile EDT x 83 \nidiopathic infertility x \n145 controls \nPCR BlyS 817C/T \npolymorphism No difference Christofolini et \nal., 2011 \n Case-\ncontrol 25 EDT x 20 controls Flow cytometry PD-1+/PD-L1+ \nCD19+ \nIncreased PD-1+/PD-L1+ B \ncells \nWalankiewicz \net al., 2018 \n Case-\ncontrol EDT x controls IBT Monoclonal \nantibodies \nIncreased B cells Badawy et al., \n1987 \nPeritoneal \nfluid \nCase-\ncontrol 19 EDT x 26 infertile IBT; ELISA B cells; IgA; IgG Increased B cells, IgA and IgG Badawy et al., \n1989 \n Case-\ncontrol \n25 EDT and idiopathic \ninfertility Flow cytometry CD 19 No difference Nava-Loya et \nal., 1996 \n Case- \ncontrol 47 EDT x 35 controls ELISA sCD23 ↑ B cell activation; higher in \nstages I and II \nOdukoya et al., \n1996b \n Case-\ncontrol 31 EDT x 14 controls Flow cytometry; IF CD5; ANA Increased B-1 cells Chishima et \nal., 2000 \n Case-\ncontrol 46 EDT x 52 controls ELISA; PCR IgG; IgA; Bcl-6; \nBlimp-1 \n↓ Bcl-6 and ↑ Blimp-1 \nNo difference in Ig \nYeol et al., \n2015 \n Descriptive 15 EDT ABC; IHC anti-leu-12 Very few B cells in the lesions Oosterlynck et \nal., 1993a \nEndometrium \n(eutopic and \nectopic) \nCase-\ncontrol 12 EDT x 23 controls IHC  CD22 No difference Witz et al., \n1994 \n\n27 \n \nTable 1 – Studies that evaluated the role of B lymphocytes in endometriosis (conclusion). \nSamples Study \ndesign Population Methods Markers B lymphocytes in EDT References \nEndometrium \n(eutopic and \nectopic) \nCase-\ncontrol \n21 infertile EDT x 18 \ncontrols IHC CD22 No difference in eutopic \nendometrium \nKlentzeris et \nal., 1995 \n Case-\ncontrol \n30 infertile EDT x 10 \ncontrols IHC   IgG No difference Nomiyama et \nal., 1997 \n Case-\ncontrol 15 EDT x 20 controls Flow cytometry CD20; CD5 Increased B cells. ↑ activation \nin ectopic endometrium \nAntsiferova et \nal., 2005 \n Case-\ncontrol \n10 OMA x 10 \nadenomyosis x 10 \nleiomyoma \nIHC; PCR; ELISA BlyS; Plasma cells ↑ BlyS and plasma cells Hever et al., \n2007 \n Case-\ncontrol \n87 EDT x 33 \nadenomyosis x 205 \ncontrols \nPCR BlyS 817C/T \npolymorphism \nHeterozygosity ↓ risk of DIE; \nBlyS may play a role in the \npathogenesis \nde Graaff et \nal., 2010 \n Case-\ncontrol \n48 EDT X 24 \nadenomyosis X 12 \ncontrols \nIHC CD20 \n↑ B cells in EDT lesions, \nadenomyosis and \nendometrium \nScheerer et al., \n2016 \nFollicular \nfluid \nCase-\ncontrol \n12 infertile EDT x 35 \ntubal factor x 13 \nidiopathic \nFlow cytometry \nCD3; CD4; CD8; \nCD14; CD20; CD45; \nCD56 \nIncreased B cells Lachapelle et \nal., 1996 \nPelvic lymph \nnodes \nCase-\ncontrol 7 EDT x 9 controls IHC  CD 20; CD79; \nplasma cells \nIncreased B cells during \nproliferative phase \nBerbic et al., \n2013 \nABC: avidin-biotin immunoperoxidase technique; ANA: antinuclear antibodies; Bcl-6: B cell leukemia lymphoma- 6; Blimp-1: B lymphocyte inducer of \nmaturation program-1; BlyS: B lymphocyte stimulator; DIE: deep infiltrating endometriosis; EDT: Endometriosis; ELISA: enzyme-linked immunosorbent assay; \nIBT: Immunobead rosette technique; IF: Immunofluorescence; IHC: Immunohistochemistry; OMA: ovarian endometrioma; PD-1: Programmed cell death 1; \nPD-L1: Programmed cell death 1 ligand; PCR: protein chain reaction. SOURCE: Riccio et al., 2017 – Updated\n\n28 \nDifferent markers and samples were assessed by the authors to evaluate \nthe direct or indirect role of B cells in endometriosis. Most of the selected studies \nhave reported increased number and/or activation of B lymphocytes or higher \nconcentration of antibodies in endometriosis (Badawy et al., 1987, 1989; Gleicher \net al., 1987; Gebel et al., 1993; Odukoya et al., 1995, 1996a, 1996b; Lachapelle \net al., 1996; Chishima et al., 2000; Antsiferova et al., 2005; Hever et al., 2007; de \nGraaff et al., 2010; Berbic et al., 2013; Scheerer et al., 2016; Walankiewicz et al., \n2018). \nAn increase in the reactivity of B lymphocytes in endometriosis was first \nsuggested in 1980 (Startseva, 1980). In the same year, another study (Weed and \nArquembourg, 1980) demonstrated IgG and complement deposits in the \nendometrium and decreased serum complement, suggesting an autoimmune \nresponse with complement consumption by the antigen-antibody complex. \nA few years later, the presence of anti-endometrial antibodies in the serum \nof women with endometriosis was described (Wild and Shivers , 1985). \nImmunohistochemical analysis revealed that these anti -endometrial antibodies \nbind to endometrial glands and to the ectopic tissue (Fernández -Shaw et al.,  \n1993). A subsequent western blot analysis demonstrated that autoantibodies \nreact with membrane proteins of the endometrial cells and that the \nimmunoreactivity increases with disease progression (Bohler et al., 2007). \nWhile evaluating the role of B cells through soluble CD23 and IgG \nautoantibodies, Odukoya et al.  (1995, 1996a, 1996b)  demonstrated increased \namount and activation of B cells in the blood and peritoneal fluid of women with \nendometriosis. They also described higher concentration of soluble CD23 in  \npatients with stage I and II endometriosis, suggesting that mild endometriosis \nmay be immunologica lly more active than severe endometriosis. Gebel et al.  \n(1993) findings also agree with this statement as they have reported reduced \npolyclonal IgG2 production in stage III and IV endometriosis. \nIt is speculated that the infertility associated endometriosi s is partly due to \nautoantibody abnormalities regarded as the result of polyclonal B -cell activation \nassociated with B -1-cell proliferation. Hever et al. ( 2007) analyzed significantly \nupregulated genes in endometriosis versus control endometrium and concluded \nthat 53 genes associated with immune responses had altered expression. \n\n29 \nIncreased B cells were described in the follicular fluid of infertile patients with  \nendometriosis (Lachapelle et al., 1996), suggesting that this could be one of the \nfactors impairing their fertility. \nBesides anti-endometrium antibodies, B lymphocytes seem to contribute to \nthe pathogenesis of endometriosis by producing anti-deoxyribonucleic acid (anti-\nDNA), antiphospholipid and antinuclear antibodies (ANA), usually observed in  \nautoimmune diseases (Osuga et al., 2011). ANA antibodies have been detected \nin 29- 47% of women with endometriosis (Iborra et al., 2000). However, ANA \npositivity does not seem to be an aggravating factor in patients with pelvic \nendometriosis (Dias et al., 2006).  \nSome authors have proposed that endometriosis has an autoimmune \netiology, presenting changes in both humoral and cellular immunity (Nothnick , \n2001) that lead to inflammatory reactions and proliferation of endometriotic cells  \n(Osuga et al.,  2011). Nothnick (2001) lists common characteristics between \nendometriosis and autoimmune diseases: tissue injury, polyclonal activation of B \ncells, abnormalities o f B and T lymphocytes, changes in apoptosis, association \nwith other autoimmune disorders, multiple organ involvement, familial occurrence \nand possible environmental and genetic factors associated.  \nPossible common backgrounds of immune dysfunctions  between \nautoimmune diseases and endometriosis were also proposed by Chishima et al. \n(2000). They reported that B cells are related to ANA production in the blood of \npatients with endometriosis and also found increased B -1 cells in peritoneal \nexudate cells of these women.  \nFigure 1 summarizes the hypothes is on role of the immune system in \nendometriosis (Riccio et al., 2018). \n \n\n30 \n \nSOURCE: Riccio et al., 2018. \nFigure 1 – Immune response in endometriosis \n \n \n3.3.1 Regulatory B cells \n \n \nInflammation is the key response to infections and after the pathogens are \ncleared, this response must be contr olled to avoid damaging host tissues. The \nrelease of anti-inflammatory mediators and cytokines limits inflammation and the \ncells that produce these factors are named “regulatory” or “suppressive”.   \nA population of suppressor B cells, collectively known as regulatory B cells \n(Breg), has been associated with the inhibition of excessive inflammation. They \ncontrol the expansion of pathogenic T cells and other pro- inflammatory \nlymphocytes through the production of IL- 10, IL -35 and TGF -β. Distinct Breg \npopulations can be induced by different inflammatory environments (Rosser and \nMauri, 2015). The study of mice lacking Breg cells that produce IL-10 has shown \nthat defective Breg can lead to chronic inflammation (Fillatreau et al., 2002; \nHonigberg et al., 2010; Herman et al., 2011) and that these animals were unable \nto recover from autoimmune diseases. \n\n\n31 \nMany subsets of Breg cells have been described, but it is still unclear how \nthey are developmentally linked (Rosser and Mauri, 2015). In humans, two main \nBreg phenotypes have been described: CD19 +CD24highCD38highCD1dhigh and \nCD19+CD24highCD27+ (Iwata et al., 2011). \nCurrently, there are two theories for Breg development: they consist in a \nspecific B cells lineage with a factor that controls the expression of their regulatory \ncharacteristics; or any B cell can be induced by inflammatory factors to develop \na suppressive nature and become a Breg (Rosser and Mauri, 2015).  \nSo far, a Breg -cell-specific transcription factor, like Foxp3 in Treg cells  \n(Rudensky, 2011) has not been identified.  This fact, in addition to the \nheterogeneity of Breg phenotypes, supports the theory that these cells are not a \nspecific lineage, but a more “reactive” form, induced by an inflammatory \nenvironment (Rosser and Mauri , 2015). It has been shown, in both mice and \nhuman, that immature B cells, mature B cells, and plasmablasts  are able to \ndifferentiate into Breg that produce IL-10.  \nRegulatory B cells, through the production of IL-10, TGF-β, and IL-35, can \ninteract with different immune cells to suppress immune responses. They can \ninduce the differentiation of other regulatory cells, such as Treg, and suppress \npro-inflammatory cells: monocytes that produce TNF-α; Th1 cells, cytotoxic CD8+ \nT cells and IL-12-producing dendritic cells (Rosser and Mauri, 2015).  \n \n3.3.2 Anti-CD20 and B lymphocytes depletion \n \n \nCluster of differentiation 20 (CD 20) is a membrane antigen present  on the \nsurface of all B lymphocytes: pre- B cells, mature B cells and even malignant B \ncells (Payandeh et al., 2019). This protein regulates B cells to proceed from a \nresting phase (G0) on to G1 phase and regulate the cell cycle from the S phase \nto mitosis . It plays a role in regulation of growth and differentiation of B \nlymphocytes (Stamenkovic and Seed, 1988; Tedder et al., 1988).  \nThe increased expression of CD20 has been detected in patients with \ncertain types of B -cell lymphoma and leukemia. High expression of CD20 \nmolecule on the surface of B cells make antibodies -based therapy a good \n\n32 \nstrategy (Payandeh et al., 2019). Anti-CD20 antibodies had been effectively used \nin the treatment of many diseases including cancer and immune related disorders \n(Du et al., 2017; Salles et al., 2017). \nAnti-CD20 antibodies  exert their effects on B cells via s everal molecular \nmechanisms: a) complement-dependent cytotoxicity : plasma membranes are \ndamaged without involvement of immune system cells or antibodies; b) antibody-\ndependent cell -mediated cytotoxicit y: cell-mediated lytic mechanism with  \nautoreactive antibodies ; c) programmed cell death, including apoptosis; d) \nantibody dependent cellular phagocytosis, catalyzed by macrophages, \nneutrophils and mature dendritic cells; e) ROS dependent non- apoptotic cell \ndeath; and f) homotypic adhesion and lysosome mediated non -apoptotic cell \ndeath, through the dispersion of lysosomes content in the cytoplasm (Payandeh \net al., 2019). \n \n3.3.3 Ibrutinib: a Bruton´s tyrosine kinase (Btk) inhibitor \n \n \nThe B cell activation factor (BAFF) also known as B lymphocyte stimulator  \n(Blys) belongs to TNF family and it is a key factor to B cells survival . BAFF is \nproduced by macrophages and plays a role in B lymphocytes development and \ndifferentiation into plasma cells (Schiemann et al., 2001). Regulation defects in \nBAFF expression led to its excessive production, increasing B cells activation and \nautoantibody production, causing autoimmune phenomena. High concentrations \nof BAFF were identified in the plasma of patients with autoimmune diseases such \nas lupus, Sjögren syndrome and rheumatoid arthritis (Zhang and Bridges, 2001; \nGroom et al.,  2002; Stohl et al., 2003; Ramos -Casals et al.,  2005).  Its \nconcentration is also elevated in endometriotic lesions (Hever et al., 2007). \nBAFF can bind to three different receptors of TNF superfamily: BAFF \nreceptor (BAFF-R), transmembrane activator and calcium -modulator and \ncyclophilin ligand interactor ( TACI) and B cell maturation antigen ( BCMA) \n(O’Connor et al., 2004). BCMA receptor is responsible for plasmocyte survival \n(Tarte et al., 2003) and its expression is increased in endometriotic lesions (Hever \net al., 2007). \n\n33 \nBAFF binds to BAFF-R, activates NF-κB pathway through Btk, leading to B \nlymphocyte survival, development, and function (Shinners et al., 2007). Btk was \ninitially shown to be defective in the primary immunodeficiency X -linked \nagammaglobulinemia (XLA) and shortly after its discovery,  it was placed in the \nsignal transduction pathway downstream of the B cell antigen receptor and was \nfound to have a major role in the control of B cell activation and antibody \nproduction (Herman et al., 2011). \nBtk has a crucial function in oncogenic signaling that is critical for \nproliferation and survival of leukemic cells in many B cell malignancies. Inhibitors \nof Btk have shown anti-tumor activity, first in animal models and later in humans, \nwith durable remissions against a variety of B-cell malignancies, including mantle \ncell lymphoma, follicular lymphoma, and chronic lymphocytic leukemia (Harrison, \n2012; Byrd et al., 2013; Jain et al., 2018). \nIbrutinib is an orally bioavailable covalent Btk inhibitor that irreversibly binds \nto Btk at Cysteine-481 residue (Honigberg et al., 2010; Herman et al., 2011). This \ndrug blocks NF -κB pathway leading to B lymphocytes inactivation.  Several \nstudies have shown that ibrutinib binds to Btk and leads to inhibition of BCR \nsignaling, reducing the activation of malignant B cells and B cells involved in \nautoimmunity and infectious disease pathogenesis (Hutcheson et al., 2012; Kil et \nal., 2012; Vargas et al., 2013). \nHowever, Ibrutinib is not a selective inhibitor, as its binding profile includes \nother kinases, such as interleukin- 2-inducible T -cell kinase (I tk); tec protein \ntyrosine kinase (TEC) and epidermal growth factor receptor (EGFR) (Dubovsky \net al., 2013; Cheng et al., 2014). \nIbrutinib was approved by Food and Drug Administration (FDA) in 2013, \ninitially for the treatment of mantle cell lymphoma (Wang et al., 2013), and has \nbeen used in the treatment of B cells autoimmune disfunctions and malignancies \nsince (Shinners et al., 2007; Rushworth et al., 2013; Kokhaei et al., 2016; Miklos \net al.,  2017). The drug is generally well tolerated, with rapid and durable \nresponses, but can have some side effects: diarrhea, upper respirat ory tract \ninfection, fatigue; and more severe but rare, bleeding, and atrial fibrillation (Tang \net al., 2018; Paydas, 2019). \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n4 METHODS \n\n35 \n \n4 METHODS \n \n \nAn experimental study was performed in scientific collaboration between the \nEndometriosis Division of Obstetrics and Gynecology Department of Hospital das \nClínicas da Faculdade de Medicina da Universidade de São Paulo , São Paulo, \nBrazil and U1016- Batteux of Institut National de la Santé et de la Recherche \nMédicale (INSERM), Hôpital Cochin, Université Paris -Descartes, Paris, France, \nbetween 2016 and 2018. \n \n4.1 Mice \n \n \nThe present study was reviewed and approved by Ethics Committees \nComité d ’Ethique en matière d'Expérimentation Animale, Paris Descartes \nUniversity (CEEA 34), Paris (PROJET No 2016040716219897 – V6 – APAFiS # \n7283) and Comitê de Ética em Pesquisa do Hospital das Clínicas da Faculdade \nde Medicina da Universidade de São Paulo (Parecer n\no 1.532.975). \nSix-week-old BALB/c female mice (Charles River Laboratories, L´Arbresle, \nFrance) weighing 16 -20g were used. Animals received humane care in \ncompliance with institutional guidelines and were housed in clean  cages under \nstandard 12h photoperiod with food and  water available ad libitum . All \nexperimental procedures and animal care were approved by the institutional \nboard. \n \n4.1.1 Sample Size \n \n \nThe volume of implants in mm 3 was considered as the primary outcome. \nSample size was calculated to  allow detection of a minimum 15mm3 difference \nbetween groups (based on hypothesis and preliminary data) with a  95% \nconfidence interval and power of 80% (0.8).  \n\n36 \n \nThe expected standard deviation was 10mm 3, based on a previous study \n(Leconte et al., 2015). As data were reported in means and standard error, we \nhave multiplied the standard error (2.65, mean of 3.9 and 1.4, the provided values \nin the study) by the square root (3.8) of the number of animals (15) to obtain the \nstandard deviation (10).  \nThen, we  inserted these data in an online calculator (available at \nhttp://www.obg.cuhk.edu.hk) and obtained a sample size of eight mice per group. \nThe results provided are shown in Figure 2. \n \n \nFigure 2 – Results provided by sample size calculator. To calculate sample size, \ndata of confidence interval, power, difference to be detected between groups and \nexpected standard deviation were inserted in an online calculator. The result was \neight mice per group \n \nTo account for any potential losses  occurring over the course of the \nexperiments we further added two mice in each group, so ten animals per group \nfor each independent experiment were included. Each experiment had three \ngroups: Control, that received only vehicle; Anti -CD20, treated with anti -CD20 \nantibody to achieve complete B lymphocyte depletion; and Ibrutinib, treated with \nthe Btk inhibitor to inactivate B lymphocytes. \n \n4.1.2 Murine model of endometriosis \n \n \nEndometriosis was surgically induced in mice by syngeneic transplantation \nof uterine tissue as previously described by  Marcellin et al., (2017). Five donor \nBALB/c mice provided uterine horns to generate endometriosis -like lesions in \n\n\n37 \n \neach group of 10 mice in each experiment performed. All mic e (donors and \nrecipients) received 56 µg/kg of 17β -estradiol (Provames®, Sanofi -Aventis, \nFrance) daily by oral gavage, during three days before the procedures. Figure 3 \nshows the steps of surgically induced murine model of endometriosis. A post-\noperative oral gavage of all recipient mice with 56 µg/kg/day of 17β -estradiol \n(Provames®, Sanofi-Aventis, France) was performed daily for three days after \nimplantation.  \nThe animals were euthanized 21 days after the surgery, and Figure 4 shows \nthe surgical findings, representative of endometriosis: solid -cystic peritoneal \nlesions, adhesions to other organs, and cysts with hemorrhagic fluid inside. \n\n38 \n \n \n\n\n39 \n \nFigure 3 – Surgically induced endometriosis m urine model. Donor mice were \neuthanized by cervical dislocation (a) and uterine horns were surgically extracted \n(b) and transferred into a Petri dish containing 37°C -warm phosphate buffered \nsaline (PBS) (c). The uterine horns were separated (d), cut in half (e) and opened \nlongitudinally with micro scissors (f) , so each uterus provided four samples that \nwere prepared for grafting onto the peritoneal cavity of recipient mice. The \nsamples had 7.72 ± 1.8 mm in the longest measure, with no significant difference \nbetween the groups  (p=0.8182). BALB/c recipient mice were anesthetized with \nisoflurane and mechanically ventilated. An incision was made on the ventral \nmidline (g) and half horn fragments were sutured onto the parietal peritoneum (h) \nwith two 7/0 polypropylene stitches (Prolen®, Ethicon, Somerville, NJ), one \nsample on the right side and another on the left side (i). In all mice, tissue samples \nwere sutured at similar positions of the abdominal wall to ensure that host tissue \nsites exhibited a comparable vascularization. The cutis was sutured with a 6/0 \nnylon thread (j)  \n \n \n \n  \n \n \nFigure 4 – Surgical findings in endometriosis murine model. Adhesions between \nbowel and solid-cystic peritoneal lesions (a;b); Splenic adhesions (c); Cyst with \nhemorrhagic fluid inside (d) \n \n \n \n \n\n\n40 \n \n4.1.3 In vivo treatment of the operated mice \n \n \nThe operated mice were randomly separated into three groups: Control, \nAnti-CD20 and Ibrutinib, with 10 animals per group for each independent \nexperiment. The in vivo treatment protocol is shown in Figure 5. \nThe Ibrutinib Group was treated with 15 mg/kg/day (Honigberg et al., 2010) \nof Ibrutinib (Pharmacyclics, Sunnyvale, USA). The dose of Ibrutinib was \npreviously tested in mice, and it was shown that 5mg/kg/day was an underdose, \nwith only partial Btk inhibition, and the drug became effective when the dose \nreached 10mg/kg/day (Schutt et al.,  2015) and was fully effective in 12.5 \nmg/kg/day (Honigberg et al., 2010). It was reported in Ibrutinib´s FDA approval \ndocument (Leighton 2013) that it becomes toxic in mice in 80mg/kg/day dose.  \nIn this study a 15mg/kg/day dose was chosen, considering that part of the  \nsubstance could be lost in the canula during oral gavage procedures. The drug \nwas diluted in 0.06% carboxymethyl cellulose/H 2O and administered by oral \ngavage with sesame oil daily, for 21 days, starting on the day of the surgery. The \nAnti-CD20 Group received an intraperitoneal 100 µg single dose of anti -CD20 \nantibody (clone 5D2, isotype IgG2a, kindly provided by Genentech, USA), the \nday after the surgery  (D1). The Control Group received vehicle by daily oral \ngavage for 21 days. \n \n\n41 \n \n \nFigure 5 – In vivo treatment of the operated mice. Representation of the steps of \nthe experiments and the treatment protocols for the three groups: Ibrutinib, Anti-\nCD20 and Control. E2: 17 β-estradiol; EDT: endometriosis; D: day; i.p.: \nintraperitoneal; mg: miligram; μg: microgram \n \n \nTwenty-one days after implantation, animals were euthanized by cervical \ndislocation. Retro- orbital blood sample was collected for cytokine analys is. \nPeritoneal cavity washing was performed with infusion and aspiration of 10mL of \nPBS to extract peritoneal cells to perform flow cytometry. Spleens were also \ncollected for flow cytometry analysis.  \nEndometriotic implants were surgically removed, weighed, and measured \nusing a rule caliper. Implants’ volume (TV) was calculated as follows: TV (mm\n3) \n= (L x W2)/2, where L is the longest and W the shortest measure of the lesi on in \nmm (Tomayko and Reynolds, 1989). The right-side implant of each mouse was \nfixed with 10% formaldehyde for subsequent histological analys is. The left-side \nimplant was frozen in liquid nitrogen for further RNA extraction and q uantitative \nreal-time reverse transcription quantitative polymerase chain reaction (RT-\nqPCR). \n\n\n42 \n \n4.2 Ultrasonography to evaluate implants’ size \n \n \nThe endometriotic implants were measured through serial ultrasonography, \nat Day 7 and Day 20 after the surgery, as previously described by Santulli et al., \n(2016). The Vevo 2100 high-frequency ultrasound imaging system (VisualSonics; \nToronto, Canada) was used. The probe has a 40-MHz center frequency (MS550) \nand an adaptable focal depth. The spatial resolution at the focus is 40 x 80 x 80 \nμm3.  \nFor the exam, the mouse was kept under anesthesia with 1.5% isoflurane, \nrestrained on a heated stage and had the abdomen shaved with depilatory cream. \nUltrasound contact gel was applied on the abdomen (Figure 6a ), and an image \nsequence with two- dimensional axial views of the endometriotic implant was \nacquired (Figure 6b), as the probe was swept from the upper to the lower \nabdominal wall of the mouse. The implant volume was calculated as described \n[TV (mm3) = (L x W2)/2]. The exams were performed at Plateforme Imageries du \nVivant (PIV) de l’Université Paris Descartes, INSERM U1016, Paris, France, and \nall the image acquisitions were performed by the same blinded operator. \n \n \n \nFigure 6 – Ultrasonography to evaluate implants’ size in mice . (a) Mice were \nanesthetized and submitted to ultrasonography at Day 7 and Day 20 after the \nsurgery to induce endometriosis; (b) Example image of endometriotic implant  \n \n \n \n \n\n\n43 \n \n4.3 Histology \n \n \nImplants fixed with 10% formaldehyde were set in paraffin. Serial 4- μm \nsections were prepared and stained with Hematoxylin & Eosin (H&E) and Sirius \nRed (SR) prior to histological examination by light microscopy. Stained tissue \nsections were examined by two  blinded pathologists experienced in \nendometriosis, to confirm the presence of the disease in the samples. \n \n4.4 RNA extraction and reverse transcription followed by quantitative \nreal-time polymerase chain reaction (RT-qPCR) \n \n \nTotal RNA extraction was performed with Trizol Reagent (Invitrogen, \nCarlsbad, USA), according to the manufacturer’s instructions, and it was followed \nby reverse transcription quantitative polymerase chain reaction (RT-qPCR) using \nQiagen one step kit. Seven  target genes –  COX-2, alpha s mooth muscle actin \n(αSMA), Type I Collagen, CD3, inducible nitric oxide synthase (iNOS), CD86 and \nFound in inflammatory zone 1 (Fizz-1) – and one reference gene, Beta-actin (β-\nactin) as internal control, were analyzed by RT -qPCR. Quantitative PCR was \ncarried out on a Light Cycler® 480, 96-well apparatus (Roche Molecular Systems, \nSwitzerland), with 160 ng of cDNA as template. We used the amplification kit \nLight Cycler 480 SYBR Green I Master (Roche Molecular Systems, Switzerland), \naccording to the manufacturer's instructions. The relative fold- changes of each \ntarget gene compared with the reference gene, was determined by the formula  \n2\n-ΔΔCt.  The used primers are listed in Table 2. \n \n \n \n \n \n \n \n\n44 \n \nTable 2 – List of murine primers used for quantitative real-time polymerase chain \nreaction (RT-qPCR) analysis for tissues and cells. \nGene Primer sequence 5'-3' (F) Primer sequence 5'-3' (R) \nβ-actin ACCACCATGTACCCAGGCATT CCACACAGAGTACTTGCGCTCA \nΑsma CTACGAACTGCCTGACGGG GCTGTTATAGGTGGTTTCGTGG \nType I collagen TGTTCGTGGTTCTCAGGGTAG TTGTCGTAGCAGGGTTCTTTC \nCOX-2 GCCTACTACAAGTGTTTCTTTTTGCA CATTTTGTTTGATTGTTCACACCAT \nCD3 CCCTGAGTCCCCTCTACACTT TGCCCCAGAAAGTGTTCCAC \niNOS GCCCAGCCAGGTACAGAG CCTTGGTGCAGAAAACCCTTA \nCD86 ACGGACTTGAACAACCAGACT CGTCTCCACGGAAACAGCAT \nFizz-1 TATGAACAGATGGGCCTCCT CCACTCTGGATCTCCCAAGA \nαSMA: alpha smooth muscle actin; β -actin: Beta-actin; COX-2: cyclooxygenase-2; Fizz-\n1: Found in inflammatory zone 1; iNOS: inducible nitric oxide synthase \n \n4.5 Isolation and stimulation of spleen and peritoneal cells \n \n \nSpleen were extracted from mice and crushed in complete Roswell Park \nMemorial Institute (RPMI) medium. Erythrocytes were lysed in potassium acetate \nsolution and spleen cells suspension was obtained after three times washes in \ncomplete medium. For each mous e, splenocytes were enumerated using a \nMalassez counting chamber. Isolation of peritoneal cells was performed as \ndescribed before (Ray and Dittel , 2010). Briefly, peritoneal cells were retrieved \nby peritoneal lavage with 8m L of cold PBS containing 2mmol/L of \nethylenediaminetetraacetic acid ( EDTA). Cells were counted and viability  – \nverified by trypan blue exclusion  – was typically >98%. Peritoneal cells \nstimulation was performed by 24h of incubation at 37°C in complete RPMI \nmedium with 10μg/m L of concanavalin A (Sigma Aldrich C5275). Then, \nsupernatant was collected and stored at -80°C for further cytokine assessment. \n \n4.6 Flow cytometry \n \n \nFlow cytometry was performed using a  fluorescence-activated cell sorting  \n(FACS) Fortessa II flow cytometer (BD Biosciences, USA), according to standard \ntechniques and data were analyzed with FlowJo software (TreeStar, Ashland, \n\n45 \n \nUSA). The following antibodies were used for cell-surface staining: Panel A for B \ncell phenotyping and regul atory B cells characterization: B200-Alexa Fluor 700, \nCD5-PercP-Cy5, CD19 -APC, CD1d -PE, and CD40- FITC. Panel B for \nmacrophage phenotyping and M1/M2 characterization: F4/80- BV711, CD11b-\nBV51, CD43 -BV421, CD206- Alexa Fluor 647, Ly6C -PeCy7, CD62L -FITC and \nCD80-PE, purchased from BioLegend, Ozyme (Montigny -le-Bretonneux, \nFrance). TCD4 + and TCD8+ cells and their subsets were identified using the \nfollowing antibodies: CD3- PE, CD4 -BV421, CD8 -PeCy7, CD44 -APC, CD62L -\nFITC, CD69-PercP-Cy5.  \nM1 macrophages were defined as F4/80 +CD11b+Ly6CHighCD206-CD43+ \nCD62L- and M2 macrophages as F4/80 +CD11b+Ly6cLowCD206+CD43-CD62L+ \n(Italiani and Boraschi , 2014). Regulatory B cells were defined as \nCD19+CD5+CD1dHigh (Mauri and Menon , 2015). Figure 7 shows an example of \nthe FACS gating strategy used.   \n \n \nFigure 7 – Gating strategy for identification of mouse regulatory B cells (Breg) . \nBreg were defined as CD19+CD5+CD1dHigh \n \n \n4.7 Cytokine assessment by Enzyme- Linked Immunosorbent Assay \n(ELISA) \n \n \nSerum and supernatant from cultured peritoneal cells were diluted (1:4) in \nELISA/ELISPOT diluent 1 x before being distributed on ELISA 96- well plates \nspecific of TNF-α, IL-1β, IL-4, IL-6, IL-10, IL-13 and IFN-γ (Mouse ELISA Ready-\n\n\n46 \n \nSET-Go! eBioscience, Austria). Concentrations were calculated from a standard \ncurve according to the manufacturer's protocol. \n \n4.8 Statistical analysis  \n \n \nAll data were analyzed using GraphPad Prism 5 software (GraphPad \nSoftware Inc, California, USA). A one- way analysis of variance (ANOVA) was \nperformed to compare the three experimental groups. When group means were \nsignificantly different using the one- way ANOVA, pairwise comparisons were \nperformed using Student -Newman-Keuls (SNK) post hoc test. The results from \nexperiments comparing only two groups (Control and Ibrutinib) were analyzed \nwith the Mann Whitney test. In the figures, the error bars represent the standard \nerror of the mean. A p value <0.05 was accepted as significant. \n \n \n \n \n \n \n \n \n \n \n \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n5 RESULTS \n\n48 \n \n5 RESULTS \n \n \n5.1 Effects of B cell modulating treatment on endometriotic implants’ \nsize in mice \n \n \nThe analysis of the endometriotic implants in the peritoneal cavity of mice is \nshown in Figure 8 . After 21 days of treatment, the Btk inhibitor Ibrutinib was \neffective in reducing the development of endometriosis in mice. Mice in this group \nhad smaller and less active implants (no fresh blood, no angiogenesis, and few \nglands) whereas Control and Anti -CD20 Groups showed persistent, larger,  and \nmore active lesions, through macroscopic (Figure 8a) and microscopic (Figures \n8c and 8d) evaluations.  \nImplant volume (Figure 8e) from Ibrutinib Group was significantly reduced \nat Day 21 compared to Control Group (15.27 ± 2.67 vs 36.35 ± 5.16 mm\n3, p=0.001) \nand to Anti -CD20 Group (15.27 ± 2.67 vs  43.12 ± 5.95 mm 3, p=0.0004). Also, \nimplant weight (Figure 8 f) was significantly decreased in Ibrutinib Group when \ncompared to Control (67.87 ± 4.43 mg vs 100.1± 8.84 mg, p=0.006) and to a \nlesser extent to the Anti -CD20 Group (67.87 ± 4.43mg vs  90.35 ± 9.04 mg, \np=0.13), but not significant.  \nUltrasound imaging analyses of the implants’ volume was also performed at \nD7 and at D20 after the procedure (Figure 8b), demonstrating a reduced volume \nin the Ibrutinib Group compared to Control and Anti -CD20 Groups (Figure 8g). \nThe ratio between D20 and D7 measures was 0.45 ± 0.06 for Ibrutinib Group \nversus 3.72 ± 0.61 for Anti -CD20 Group (p<0.0001) and 2.25 ± 0.43 for Control \nGroup (p=0.0002).  \n \n \n \n \n\n49 \n \n \nFigure 8 – Effects of B cell modulating treatment on endometriotic implants \ndevelopment in mice. (a) Macroscopic view of the implants. (b) Ultrasonography \nimages of peritoneal implants in mice on Day 20. (c) Staining with Hematoxylin & \nEosin of implants at Day 21. ( d) Staining with Sirius Red of implants at Day 21. \n(e) Volume of the endometriotic implants on Day 21. (f) Weight of the implants on \nDay 21. (g) Ratio of the implants’ volume evaluated through ultrasound between \nDay 20 (D20) and Day 7 (D7). Data are mean ± SEM. Each group had n=10 mice. \nThe one-way ANOVA was performed to detect significant differences among the \nthree groups and further pairwise comparisons were performed using SNK test. \nNS: non-significant; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. Scale bar: 100 μm \n \n \n5.2 Flow cytometry analysis of the B cells populations \n \n \nAnti-CD20 treatment depleted all B cells (defined as B220 +CD19+) in the \nspleen and peritoneum compared to Control Group (0.19 vs 42 %; 0.17 vs 23 %, \nrespectively, p<0.001, Figures 9a and 9d), while Ibrutinib treatment did not affect \nthe percentage of splenic (Figure 9a) or peritoneal B cells (Figure 9d). Activation \n\n\n50 \n \nof B cells was assessed by mean fluorescence intensity (MFI) of the co-\nstimulatory CD40 marker expression within the B cells population (B220+CD19+). \nIbrutinib treatment decreased B cells activation in the spleen (MFI = 332 ± 40 vs \n472 ± 47, p= 0.01, Figure 9b) and in the peritoneum (MFI = 267 ± 50 vs 617 ± 88, \np=0.01, Figure 9e) compared to Control Group. \nWhen gating on the CD19 +CD5+CD1dhigh subset, known as regulatory B \ncells (Breg) (Rosser and Mauri , 2015), a total depletion of these cells with the \nAnti-CD20 was observed (Figures 9c and 9f). Interestingly, Ibrutinib treatment \ninduced an important increase in the frequency of splenic Breg population \ncompared to the Control Group (6.04 ± 0.73 % vs 0.63 ± 0.05 %, p<0.0001, Figure \n9c). No significant difference was observed in the Breg population in the \nperitoneal cavity between Ibrutinib and Control Groups (Figure 9 f). The gating \nstrategy for identification of Breg frequency in Control Group and Ibrutinib Group \nis shown in Figures 9g and 9h, respectively. \n \n5.3 B cell blockade impacted the distribution of M1 and M2 \nmacrophage subsets \n \n \nConcerning macrophage distribution, Ibrutinib treatment induced, in the \nspleen, an important decrease in the frequency of the M1 subset (Figure 10 a) \nand a significant increase in the M2 subset (Figure 10b) compared to Control (M1 \nfrequency: 25.70 ± 4.00 % vs 32.89  ± 3.86 %, p=0.0006; M2 frequency: 56.66 ± \n7.66 % vs 32.27 ± 2.83 %, p<0.0001) and Anti -CD20 Groups (M1 frequency: \n25.70  ± 4.00 % vs 34.80 ± 4.46 %, p=0.0002; M2 frequency: 56.66 ± 7.66 % vs \n32.05 ± 3.82  %, p< 0.0001), resulting in a decreased M1/M2 ratio (p<0.0001, \nFigure 10c).  \nAn opposite variation was observed in the peritoneal cavity, where Ibrutinib \nincreased the frequency of M1 (Figure 10 d) while reducing M2 (Figure 10 e) \ncompared to Control (M1 frequency: 39.39 ± 2.73 % vs 25.59 ± 2.70 %, p<0.0001; \nM2 frequency: 34.24 ± 3.08 % vs 42.26 ± 4.58  %, p=0.0006) and Anti -CD20 \nGroups (M1 frequency: 39.39 ± 2.73 % vs 31.15 ± 1.66  %, p<0.0001; M2 \nfrequency: 34.74 ± 3.08 % vs 39.88 ± 2.44  %, p=0.0012) , resulting  in an \nincreased M1/M2 ratio (p<0.0001, Figure 10f).   \n\n51 \n \nThere was no significant difference in M1 or M2 frequency or M1/M2 ratio \nin the spleen (Figures 10 a-c) between Anti -CD20 and Control Groups (M1 \nfrequency: 34.80 ± 4.46 % vs 32.89 ± 3.86 %, p=0.3154; M2 frequency: 32.05 ± \n3.82 % vs 32.27 ± 2.83 %, p=1.000; M1/M2 ratio p=0.07). However, in the \nperitoneal cavity, an increased M1 frequency (Figure 10d) was observed in Anti-\nCD20 Group compared to Controls (31.15 ± 1.66 % vs 25.59 ± 2.70 %, p=0.0004), \nleading to a significant difference in the M1/M2 ratio (Figure 10f) between the two \nGroups (p=0.0002). \n \n\n52 \n \n \nFigure 9 – B cell phenotype analysis in spleen and peritoneal cavity of \nendometriotic mice.  Frequency of B cells (B220 +CD19+) in  spleen (a) and \nperitoneal cavity ( d) of mice. Data represent mean ± SEM. Surface CD40 \nexpression in B cells (activated B cells) in spleen ( b) and peritoneal cavity ( e). \nData represent the MFI of CD40 expression ± SEM. Frequency of Breg \n(B220+CD19+CD5+CD1dhigh) in spleen ( c) and peritoneal  cavity (f). Data \nrepresent mean ± SEM. Gating strategy for identification of regulatory B  cell \nfrequency in Control Group ( g) and Ibrutinib Group ( h). Each group had n =10 \nmice. The one- way ANOVA was performed to detect significant differences  \namong the three groups and further pairwise comparisons were performed using \nSNK test. NS: non-significant; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 \n\n\n53 \n \n \nFigure 10 – Macrophage M1/M2 distribution in spleen and peritoneal cavity in \nendometriotic mice. Macrophages were gated on  CD11b+F4/80+ cells isolated \nfrom spleen ( a;b) and from the peritoneal cavity ( d;e). M1 macrophages (a;d) \nwere further characterized as CD43+ and Ly6Chigh and M2 macrophages (b;e) as \nCD206+ and Ly6Clow. The ratio of M1/M2 population was calculated ( c;f). Data \nrepresent mean ± SEM. Each group had n=10 mice. The one-way ANOVA was \nperformed to detect significant differences among the three groups and further  \npairwise comparisons were performed using S NK test. NS, non-significant; *p ≤ \n0.05; **p ≤ 0.01; ***p ≤ 0.001 \n \n \n 5.4 Effects of Ibrutinib o n quantitative expression of genes in \nendometriotic implants of mice \n \n \n Ibrutinib Group showed a 5-fold reduction of mRNA expression of COX -2 \nin the lesions compared to the Control Group (p<0.0001, Figure 11a). The effects \nof Ibrutinib treatment on fibrosis were assessed by α SMA (Figure 11b) and type \nI collagen (Figure 11c) mRNA expression in the implants, and both were \nsignificantly reduced in this group, compared to controls  (p=0.0002 and p=0.04, \nrespectively). There were no differences in these inflammatory and fibrotic \nmarkers between the Anti-CD20 Group and the controls. \n\n\n54 \n \nImmune cells infiltration in the implants was evaluated through mRNA \nexpression of each cell subtype marker. iNOS and CD86 expression (for M 1 \nmacrophages, p<0.0001, Figure 11d; and p=0.0003, Figure 11e, respectively) \nwere increased in the Ibrutinib Group, while Fizz -1 expression (for M2 \nmacrophages, p=0.0042, Figure 11f) was decreased in Ibrutinib Group, \ncompared to Control Group. CD3 expression (for T lymphocytes, p=0.6133 , \nFigure 11g) was not significantly different between Ibrutinib and Control groups. \n \n \nFigure 11 – Effects of Ibrutinib on quantitative expression of genes in \nendometriotic implants of mice.  (a) COX-2; (b) αSMA; (c) Type 1 collagen; ( d) \niNOS (for M1 macrophages); (e) CD86 (for M1 macrophages); (f) Fizz-1 (for M2 \nmacrophages) and  (g) CD3 (for T lymphocytes) mRNA levels. Data are \nnormalized to the reference gene ( β-actin) and are expressed as ratio versus \nControl Group. Each group had n=10 mice. The Mann Whitney test was used to \ndetect significant differences.  NS, non-significant; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ \n0.001 \n \n 5.5 Effects of Ibrutinib on T lymphocytes \n \n \n There were no significant differences in T lymphocytes subsets number or \nactivation. Indeed, total number or proportion of naïve (defined as CD62L high \nCD44low) or memory (CD62L lowCD44high) CD4 + and CD8 + T cells were not \nsignificantly different in the peritoneum  (Figure 12) or in the spleen of mice \nbetween Ibrutinib and Control Group (Figure 13). \n\n\n55 \n \nFigure 12 – Effects of Ibrutinib on peritoneal T lymphocytes.  Frequency of \nperitoneal T lymphocytes subsets TCD4 + (a) and TCD8+ (d): Naïve (CD62L high \nCD44low) (b;e) and memory (CD62L low CD44high) (c;f). Data represent mean ± \nSEM. Each group had n=10 mice. The Mann Whitney test was used to detect \nsignificant differences. NS: Non-significant; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 \n \nFigure 13 – Effects of Ibrutinib on splenic T lymphocytes. Frequency of splenic T \nlymphocytes subsets TCD4+ (a) and TCD8+ (e): Naïve (CD62Lhigh CD44low) (b;f) \nand memory (CD62Llow CD44high) (c;g). Data represent mean ± SEM. Activated \nCD4+ T cells (CD69 mean fluorescence intensity) among either total CD4+ (d) or \nCD8+ (h) T cells. Each group had n=10 mice. The Mann Whitney test was used \nto detect significant differences. NS: Non- significant; *p≤0.05; **p≤0.01; \n***p≤0.001 \n\n\n56 \n \n5.6 Effects of Ibrutinib on cytokine balance \n \nCytokine concentration was measured in the serum (Figure 1 4) and \nperitoneal fluid (Figure 15) of endometriotic mice. In the serum, Ibrutinib treatment \ndecreased TNF-α (188.2 ± 25.24 vs 245.3 ± 26.13 pg/mL, p=0.0014, Figure 14a) \nand IL-6 concentrations (36.87 ± 1.18 vs 66.98 ± 4.19 pg/mL, p<0.0001, Figure \n14b) and increased IL -10 levels compared to Control Group (273.1 ±  24.23 vs \n175.5 ± 9.48 pg/m L, p=0.0015,  Figure 14c); no significant difference was \nobserved for IL-13 levels (p=0.6784, Figure 14d).  \nIn the peritoneal fluid, Ibrutinib treatment increased IFN -γ concentration \n(3231 ± 656.2 vs 1951 ± 1229 pg/mL, p=0.0133, Figure 15d) and decreased IL-\n13 (35.23 ± 29.84 vs  145.2 ± 73.29 pg/mL, p=0.0006,  Figure 15e) and IL- 4 \nconcentrations (9.371 ± 19.79 vs 30.03 ± 13.10, p=0.0220,  Figure 15f), when \ncompared to controls. No differences in peritoneal concentrations of TNF -α \n(p=1.000, Figure 15a), IL-6 (p=0.4470, Figure 15b), IL-10 (p=0.4470, Figure 15c) \nor IL-1β (p=0.3070, Figure 15g) were observed with Ibrutinib treatment compared \nto controls. \n \n \nFigure 14 – Effects of Ibrutinib on systemic cytokines of endometriotic mice.  (a) \nTNF-α; (b) IL-6; (c) IL-10 and ( d) IL-13 concentrations in the sera of mice \nmeasured by ELISA. Data represent mean ± SEM. Each group had n =10 mice. \nThe Mann– Whitney test was used to detect significant  differences. NS, non-\nsignificant; *p ≤ 0.05; **p ≤ 0.01; *** p ≤ 0.001 \n\n\n57 \n \n \nFigure 15 – Effects of Ibrutinib on peritoneal cytokines of endometriotic mice. (a) \nTNF-α; (b) IL-6; (c) IL-10; (d) IFN-γ; (e) IL-13; (f) IL-4 and (g) IL-1β concentrations \nin peritoneal fluid of mice measured by ELISA. Data represent mean ± SEM. Each \ngroup had n=10 mice. The Mann– Whitney test was used to detect significant \ndifferences. NS, non-significant; *p ≤ 0.05; **p ≤ 0.01; *** p ≤ 0.001 \n \n \nFigure 16 summarizes Ibrutinib effects that limited endometriosis \ndevelopment in mice. \n \n \n \nSOURCE: Riccio et al., 2019 \nFigure 16 – Summary of Ibrutinib effects that limited endometriosis development \nin mice \n \n \n\n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n6 DISCUSSION \n\n59 \n \n6 DISCUSSION \n \n \nMany studies have attempted to clarify the involvement  of the immune \nsystem in endometriosis and various abnormalities have been detected, including \nincreased B lymphocyte number and activation with excessive production of \nautoantibodies. Although there is evidence of an abnormal B-cell compartment in \npatients with endometriosis, its role in the development of the disease is not well \nunderstood. To evaluate the role of B cells on endometriosis a dual strategy was \napplied in the present study : a complete depletion of B cells using anti -CD20 \ntreatment or an immunomodulatory strategy using a Btk inhibitor that blocks B \ncell activation. \nIt was observed that treatment with Ibrutinib in a mouse model of \nendometriosis reduced the size and the activity of the lesions, as well as the \nexpression of inflammatory and fibrotic markers. Progression of endometriotic \nlesions has been associated with chronic inflammation and fibrosis leading to an \naltered tissue function. COX-2 is an enzyme involved in the conversion of \narachidonic acid to prostaglandins and has been associated with the \ninflammatory response and with lesion activity and growth in endometriosis (Cho \net al., 2010; Santulli et al., 2016). Moreover, increased expression of type I \ncollagen and αSMA, marking myofibroblast differentiation, has also been \nassociated with severe forms of endometriosis (González -Foruria et al., 2015; \nVigano et al., 2018). \nHowever, complete elimination of B cells using anti-CD20 had no impact on \nthe course of the disease with no differences in the size of lesions despite a \nconfirmed complete B cells depletion, maintained three weeks after the injection \nof the antibody. Anti-CD20-mediated depletion of B cells has been widely used in \nhumans for the treatment of both B cell malignancies as well as autoimmune and \nsystemic inflammatory diseases,  such as rheumatoid arthritis  and vasculitis \n(Edwards et al., 2004; Coiffier et al., 2009; Harrison, 2012; Guillevin et al., 2014).  \nOnce B lymphocyte inactivation by Ibrutinib was effective in limiting \nendometriosis development in mice, but complete B cells depletion had no effects, \n\n60 \n \nwe have hypothesized that regulatory B  cells (Breg) might play a role in \ncontrolling endometriosis. These immunosuppressor cells are increased in both \nnumber and suppressive ability in response to inflammation  (Rosser and Mauri, \n2015) and they can also be depleted by anti-CD20 (Lee-Chang et al., 2019).   \n \n6.1 Ibrutinib \n \n \nIbrutinib is an irreversible inhibitor of Btk, a non- receptor kinase essential \nfor B cells development and function of mature B cells. Btk was initially shown to \nbe defective in the primary immunodeficiency X -linked agammaglobulinemia \n(XLA) and s hortly after its discovery , it was placed in the signal transduction \npathway downstream of the  B cell antigen receptor and was found to have a \nmajor role in the control of B  cell activation (Herman et al., 2011). Many in vitro \nand in vivo studies confirm the activity of Ibrutinib a gainst Btk-restricted targets \n(Honigberg et al., 2010; Woyach et al., 2012).  \nBtk has a crucial function in oncogenic signaling that is critical for \nproliferation and survival of leukemic cells in many B cell malignancies. Inhibitors \nof Btk have shown anti-tumor activity, first in animal models and subsequently in \nthe clinics, with durable remissions against a variety of B -cell malignancies,  \nincluding mantle cell lymphoma, follicular lymphoma, and chronic lymphocytic \nleukemia (Harrison, 2012; Byrd et al., 2013; Jain et al., 2018).  \nIn normal cells, Btk controls B  cell signaling and has been shown to be \nimportant for B cell tolerance. Indeed, transgenic mice overexpressing Btk \ndevelop a systemic lupus erythematosus like syndrome, while inhibiting Btk by \ngenetic or pharmacologic manipulation in mice and humans can prevent \nautoimmune proinflammatory disorders such as systemic lupus, rheumatoid \narthritis, or type 1 diabetes (Honigberg et al., 2010; Chang et al., 2011; Hutcheson \net al., 2012; Manda et al., 2015).  \nBtk-deficient patients and mice suffer from humoral immunodeficiency, as \ntheir B cells fail to progress beyond the bone marrow (Rawlings et al.,  1993; \nThomas et al., 1993). They have reduced follicular compartments with expanded \ntransitional populations and a severe decrease in B -1 B cells, serum IgM and \n\n61 \n \nlgG3 levels and defective responses to various B cell activators (Khan et al., \n1995). However, Btk excision in fully developed, mature peripheral B cells, using \na Btkflox/Cre-ERT2 mouse model did not reduce follicular B cells nor B -1 cells, \ncontrasting their near absence in global  Btk-deficient mice. However, if B -1-\nrelated natural IgM levels remained normal in Btk flox/Cre-ERT2 mouse, B cell \nproliferation and activation especially against T -independent immunization were \nstill blunted (Nyhoff et al., 2018). These observations are in line with the normal \nfrequency of B cells and the decrease in B cell activation upon treatment of \nendometriotic mice with the Btk inhibitor  (Barnes et al., 2018; Tang et al., 2018; \nPaydas, 2019).  \n \n6.2 Regulatory B cells \n \n \nRegulatory B cells (Breg) secrete IL- 10, controlling effector immune \nresponses and autoimmune diseases , such as e ncephalomyelitis (Fillatreau et \nal., 2002), chronic intestinal inflammatory condition (Mizoguchi et al., 2002), and \narthritis (Mauri et al., 2003). It has been described that defective B reg function \nand development result in chronic inflammation (Rosser and Mauri, 2015).  \nThe current main theory about the origin of Breg supports that the primary \nrequisite for their cell differentiation is the environment in which a B cell finds itself \n(Rosser and Mauri, 2015). It is known that Breg cells increase in  number during \nthe inflammatory phase of several autoimmune disorders (Mizoguchi et al., 2002; \nEvans et al., 2007) and their differentiation is also induced by pro- inflammatory \ncytokines (Rosser and Mauri , 2015). Studies have  shown that chronic \ninflammatory diseases are exacerbated in the absence of Breg (Fillatreau et al., \n2002; Carter et al., 2011, 2012). \nDespite splenic populations of B cells had been most frequently studied, \nBreg have also been found in the lymph node drai ning the site of inflammation  \n(Mizoguchi et al., 2002). It has been demonstrated that Breg can develop and \nacquire their suppressive abilities outside the spleen, as splenectomy had no \neffect on their generation (Matsumoto et al., 2014). These findings support that \n\n62 \n \nthe induction of Breg differentiation is driven by an inflammatory environment \n(Rosser and Mauri, 2015).  \nIn the present study, we have identified the presence of Breg in the spleen \nand peritoneal fluid of mice with endometriosis (in both Control  and Ibrutinib \ngroups), and they were completely depleted in Anti -CD20 group. We have also \nobserved that Ibrutinib treatment led to an increased frequency of Breg in the \nspleen, when compared to controls, and this finding may contribute to the drug \neffects observed in endometriosis development. \nThe role of Btk in the development of B reg is unclear (Rosser and Mauri \n2015). However, in mice lacking B-cell linker (BLNK), a Btk adaptor molecule also \nimplicated in B cell signaling, the percentages of CD1dhighCD5+ regulatory B cells \nwere markedly increased (Jin et al., 2013), as observed in the present study in \nIbrutinib-treated endometriotic mice.  Additionally, the frequencies of marginal \nzone B cells and transitional stage 2 marginal zone precursor B cells, which have \nbeen reported to contain IL- 10–producing Breg, were also increased in BLNK -/- \nmice.  \nUntil the present, the role of Breg in endometriosis has not been studied . \nHowever, our findings and the previous information concerning other chronic \ninflammatory diseases may lead us to consider that these immunosuppressive \ncells may play a role in controlling endometriosis development. Further studies in \nthis field could hel p better understanding the role of regulatory B cells in \nendometriosis.  \n \n6.3 Effects of Ibrutinib on macrophages \n \n \nThe effect s of Ibrutinib on the course of endometriosis compared to anti -\nCD20 treatment led us to investigate extra B cell mediated effects of Btk. Growing \nevidence also suggests roles for Btk in mononuclear cells of the innate immune \nsystem, especially macrophages (Fiorcari et al., 2016; Weber et al., 2017). \nMacrophages play a central role in the orchestration of inflammation and \nfibrosis in endometriosis and undergo equally polarized activation into the M1 \n(classically) and M2 (alternatively) activated subsets (Bacci et al., 2009). Btk has \n\n63 \n \nbeen shown to regul ate macrophage polarization in response to various stimuli \nwith a skew from M1 to M2 macrophages (Gabhann et al., 2014).  \nThe discrepancy between the profile of macrophages in the spleen and in \nthe peritoneal cavity can be related to the role of Btk in cel lular migration (de \nGorter et al., 2007). Btk combines with Rac to modulate actin polymerization and \ncytoskeleton rearrangement, impacting on inflammatory mast cells or neutrophils \nrecruitment (Kuehn et al.,  2010), through macrophage- 1 antigen (MAC -1) \nactivation. Since MAC-1 is also expressed on macrophages, such phenomenon \nmay explain the inhibition of M2 cells migration into the peritoneal cavity in \nendometriotic mice treated with Ibrutinib.  \nInterestingly, the increase in the peritoneal M1/M2 ratio may participate of \nthe therapeutic effect of  Ibrutinib. Bacci et al. (2009) have shown a correlation \nbetween active endometriosis and an increased number of M2 cells in the \nperitoneal cavity of wome n and mice and that early injections of M2 cells \naggravate endometriosis in mice, while injections of M1 cells prevent it. \nMAC-1 can be expressed by both M1 and M2 macrophages. Regarding the \norigins of peritoneal macrophages, two macrophage subsets coexist  in the \nperitoneal cavity (PerC) in adult mice. One, called the large peritoneal \nmacrophage (LPM), contains approximately 90% of the PerC macrophages , \noriginates from the yolk -sac and appears to be maintained by self -renewal and \nindependent of hematopoiesis. The second population , called small peritoneal \nmacrophage (SPM), derives from blood monocytes that rapidly enter the PerC \nafter antigen stimulation and differentiate to mature SPM within two to four days. \nBoth macrophage subsets express MAC -1 but to a lesser extend for SPM \nmacrophages.  \nTherefore, if a systemic event may possibly impact macrophages \ndifferentiation, the polarization of macrophages may largely depend on the \nperitoneal microenvironment. Indeed, an increased M1/M2 ratio in the peritoneal \ncavity was shown in the present study, consistent with the increase d levels of \nIFN-γ and the decrease in the IL- 4 and IL- 13 levels in the peritoneal cavity of \nIbrutinib-treated animals compared to controls (Gabhann et al., 2014).  \nThese results ar e also consistent with the increase in the M1/M2 ratio in \nendometriotic lesions from  Ibrutinib-treated mice as reflected by the highest \n\n64 \n \nCD86 and iNOS mRNA levels and the lowest Fizz mRNA levels in the \nendometriotic lesions from ibrutinib-treated animals compared to controls. \n \n6.4 Effects of Ibrutinib on T lymphocytes \n \n \nT lymphocytes play an important role in the development of endometriosis \n(Riccio et al., 2018). Ibrutinib impacts mainly B cell through interaction with Btk, \nbut investigators (Cheng et al., 2014; Kokhaei et al., 2016; Long et al., 2017) have \ndescribed Ibrutinib also as an Itk inhibitor, subverting Th2 immunity and \npotentializing Th1 based immune responses (Dubovsky et al., 2013). \nThe Itk inhibition by Ibrutinib lead to increased number and function of T \nlymphocytes in chronic lymphocytic leukemia patients (Long et al., 2017; Parry et \nal., 2019; Solman et al., 2020)  However, affinity of Ibrutinib for Btk is 20 times  \nhigher than the one for Itk (Honigberg et al.,  2010), and the double Btk -Itk \ninhibition in mice was achieved with a 25 mg/kg/day dose (Dubovsky et al., 2013), \nmuch higher than the one used in this study. \nIt is also known that Btk is present in T lymphocytes (Tomlinson et al., 2004), \nalthough its role in these cells is not completely clarified, probably due to its much \nlower expression, about 0.1–1% of that in B lymphocytes (Smith et al., 1994; Xia \net al., 2020).  \nIn the present study, Ibrutinib had no effect on peritoneal or splenic T \nlymphocytes number or activation through flow cytometry evaluation, and there \nwas no difference in CD3 gene expression in the endometriotic implants from \nmice treated or not with I brutinib. Thus, the findings of effective control of \nendometriosis development by Ibrutinib seem to be due to its Btk inhibition \npathway in B lymphocytes, to its effects on regulatory B cells  and on M1/M2 \nmacrophages distribution, rather than its role on T cells. The use of a more \nselective Btk inhibitor such as Acalabrutinib could confirm the mechanisms \nbehind Ibrutinib’s effects on endometriosis development. \n \n \n \n\n65 \n \n6.5 Effects of Ibrutinib on cytokines \n \n \nB cells overexpressing wild-type Btk were selectively hyper responsive to B \ncell receptor (BcR) stimulation and showed enhanced Ca 2+ influx, NF -κB \nactivation, resistance to Fas-mediated apoptosis and defective elimination of self-\nreactive B cells in vivo, consistent with the pro-inflammatory and autoimmune role \nof Btk (Kil et al., 2012). As a result, the high production of IL- 6 by B cells from \nCD19-hBtk transgenic mice (Corneth et al.,  2016) fits with the decrease in \ninflammatory cytokines IL-6 and TNF-α induced by Ibrutinib in the present study.  \nThe role of Btk in IL-10 production is more complex as Btk-/- mice have been \nshown to overproduce IL-10 but not IL-6 upon allergic challenge. That means that \nBtk may support IL- 10 secretion upon an immuno- inflammatory challenge as \nobserved in Ibrutinib- treated endometriotic mice, further supporting the anti -\ninflammatory role of this molecule (Lundy et al., 2005). Such systemic modulation \nof cytokines by Ibrutinib has already been observed in other models of \ninflammatory diseases, like rheumatoid arthritis (Chang et al., 2011).  \nIn addition, increased Breg population in Ibrutinib- treated mice contributed \nto the higher IL- 10 concentration in this group , as they secrete this \nimmunomodulatory cytokine (Fillatreau et al., 2002). In endometriosis, decreased \nlevels of IL-6 and increased IL-10 have been associated with an amelioration of \nthe diseases (Schwager et al., 2011), as observed in this study.  \nThe cytokine distribution observed with Ibrutinib treatment in the present \nstudy w as characterized by a shift into a systemic Th2- like immunoregulatory \nprofile, with decreased pro-inflammatory cytokines TNF-α and IL-6 and increased \nanti-inflammatory IL- 10; and a local Th1- like inflammatory profile in the \nperitoneum, with increased IFN-γ and decreased IL-4 and IL-13. \n \n6.6 Murine model of endometriosis \n \n \nIn the present study we have used an animal model of endometriosis: a \nsyngeneic murine surgically induced model. It is a low- cost, easily reproducible \n\n66 \n \nmethod, with rapid development of the disease. However, considering that the \nendometrium is sutured onto the peritoneum, it leads to the question if this model \nis representative of all three phenotypes of the disease or if it only represents \nperitoneal endometriosis.  \nHowever, after three weeks of the implantation, it was possible to identify \npelvic organs adhesions (including bowel), large complex solid-cystic peritoneal \nlesions, and cysts with hemorrhagic fluid inside. These findings were consistently \nsimilar to human’s deep infiltrating endometriosis lesions and ovarian \nendometriomas, so i t can therefore be concluded that the model was \nappropriately representative of all three phenotypes of endometriosis. \nThe method we used to induce endometriosis in mice includes the \nadministration of 56 µg/kg/day of 17β-estradiol in two steps of the protocol. First, \nit is necessary to give estradiol to donors to increase the volume of the uterus, so \nit becomes technically viable to perfor m hysterectomy, open the horns \nlongitudinally and prepare the grafts . Then, all operated mice receive a post-\noperative oral gavage of 17β-estradiol for three days after implantation, to ensure \nendometrial grafting to the peritoneum and further development of endometriotic \nlesions, as they are estrogen-dependent. \nThe effects of estrogen in the immune system  in humans (Bouman et al., \n2005; Kovats, 2015; Khan and Ansar Ahmed , 2016) and mice (Verthelyi, 2001) \nhave already been described. Women have a higher incidence of autoimmune \ndiseases, increased cellular and humoral immune responses and are more \nresistant to certain infections, compared to men (Bouman et al., 2005). Estrogen \ncan interfere on most immune cell phenotypes, through mechanisms dependent \nor independent of estrogen receptors (Khan and Ansar Ahmed, 2016). \nHowever, all three groups (Ibrutinib,  Anti-CD20 and Control ) equally \nreceived 17β-estradiol as part of the protocol of surgically induced endometriosis \nin mice. In addition, the effects of three-day treatment with 17β-estradiol fade out \nand probably did not interfere on immune cells phenotype after endometriosis is \nstablished nor in its analysis 2 1 days later. So , we did not consider that the \nestrogen used in the endometriosis protocol had influence on the differences \nobserved between the groups in this study. \n \n\n67 \n \n6.7 Strengths and limitations \n \n \nInfertility is one of the main issues of endometriosis, however most of non-\nsurgical treatment options available are contraceptive, leaving women affected \nby the disease with the difficult choice between controlling the pain or trying to \nconceive. Many stu dies have demonstrated the important role of the immune \nsystem in the progression of endometriosis, so this could be a main target for the \ndevelopment of new non-hormonal therapeutic strategies.  \nIn the present study a drug approved by Food and Drug Administration (FDA) \nand by Agência Nacional de Vigilância Sanitária (ANVISA) that targets immune \ncells was shown to be effective in controlling endometriosis development in mice. \nThis study has the limitations of using an animal model and perhaps not \ncompletely clarifying all the mechanisms and pathways of the drug efficacy \nobserved.  \nThere is still a long path between animal studies results  and the use of \nIbrutinib to treat endometriosis in humans. Further studies are necessary to \nconfirm the results and the ef ficacy of the drug in humans. Even if we consider \nthe hypothetical success of future research, there are still other issues: the  \ncurrent estimated monthly average wholesale price of Ibrutinib is USD 13 324 \n(Barnes et al., 2018), and endometriosis is a chronic disease that affects young \nwomen that may need treatment for several years. Therefore, it is not a currently \nviable option in terms of cost -effectiveness. In addition, Ibrutinib is a drug with \nseveral collateral effects including some rare but severe, such as bleeding and \natrial fibrillation  (Tang et al., 2018; Paydas , 2019), and this fact may lead to \nquestioning if its use is worthy to treat a benign disease.  \nHowever, the efficacy of Ibrutinib in controlling endometriosis development \nin mice observed in the present study can open the door to further studies and to \nthe development of new immunoregulatory therapeutic strategies for \nendometriosis. \n \n \n \n\n68 \n \n6.8 Final considerations \n \n \nBtk inhibitor Ibrutinib controlled endometriosis development  in mice, while \ntotal B cell depletion using an anti-CD20 antibody had no effect on the course of \nthe disease. In addition, Breg were depleted by anti -CD20 antibody and \npreserved by Ibrutinib, suggesting that regulatory B cells might help blocking the \ndevelopment of endometriotic lesions. Btk Inhibitor Ibrutinib was effective \nprobably due to its effects on multiple immune cells: B lymphocytes, regulatory B \ncells, M1 and M2 macrophages. The use of I brutinib to skew activated B cells \ntowards regulatory B cells and increase the M1/M2 ratio into the peritoneal cavity \nopens new perspectives in both understanding and treating endometriosis.  \nFurther studies are necessary to better understand these pathways  and to \nstablish if this drug could by a therapeutic option to treat endometriosis in humans. \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n7 CONCLUSIONS \n\n70 \n \n7 CONCLUSIONS \n \n \n• B lymphocytes inactivation by Ibrutinib limited endometriosis development \nin mice and B lymphocytes total depletion with anti-CD20 antibody did not \nhave impact in the disease’ s development. These findings lead us to \nhypothesize if regulatory B  cells may play a role in controlling \nendometriosis, as they were depleted by Anti -CD20 and increased by \nIbrutinib. \n• B cell blockade impacted the proportion of M1 and M2 macrophage \nsubsets: Ibrutinib tre atment induced a decreased M1/M2 ratio in the \nspleen and increased M1/M2 ratio in the peritoneal fluid of mice.  These \nchanges in the distribution of macrophages subsets probably contributed \nto Ibrutinib’s effects in limiting endometriosis development. \n• Ibrutinib is a double Btk/Itk inhibitor, but t here were no significant \ndifferences in T lymphocytes subsets number or activation. This may be \ndue to the use of a dose under the required to achieve double inhibition. \n• The cytokine distribution observed with Ibrutinib treatment was \ncharacterized by a shift into a systemic Th2-like immunoregulatory profile, \nwith decreased pro-inflammatory cytokines TNF-α and IL-6 and increased \nanti-inflammatory IL -10; and a local Th1- like inflammatory profile in the \nperitoneum, with increased IFN -γ and decreased IL- 4 and IL- 13. These \nfindings were consistent with the effects of Ibrutinib on B cells, Breg and \nM1/M2 macrophages. \n \n \n \n \n \n \n \n \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n8 REFERENCES \n\n72 \n \n8 REFERENCES \n \nAbbas A, Lichtman A, Pillai S. Cellular and Molecular Immunology. 7th ed. 2011.  \nAbrao MS, Neme RM, Carvalho FM, Aldrighi JM, Pinotti JA. Histological \nclassification of endometriosis as a predictor of response to treatment. Int J \nGynaecol Obstet. 2003 Jul;82(1):31–40.  \nAbrao MS, Podgaec S, Dias JA, Averbach M, Garry R, Ferraz Silva LF,  et al. \nDeeply infiltrating endometriosis affecting the rectum and lymph nodes. Fertil \nSteril. 2006 Sep;86(3):543–7.  \nAcosta AA, Buttram VC, Besch PK, Malinak LR, Franklin RR, Vanderheyden JD. \nA proposed classification of pelvic endometriosis. Obstet Gynec ol. 1973 \nJul;42(1):19–25.  \nAhn SH, Monsanto SP, Miller C, Singh SS, Thomas R, Tayade C. \nPathophysiology and Immune Dysfunction in Endometriosis. Biomed Res Int. \n2015;2015:795976.  \nAndres MP, Borrelli GM, Abrão MS. Endometriosis classification according to \npain symptoms: can the ASRM classification be improved? Best Pract Res Clin \nObstet Gynaecol. 2018 Aug;51:111–8.  \nAntsiferova YS, Sotnikova NY, Posiseeva LV, Shor AL. Changes in the T-helper \ncytokine profile and in lymphocyte activation at the systemic and local levels in \nwomen with endometriosis. Fertil Steril. 2005 Dec;84(6):1705–11.  \nArici A, Tazuke SI, Attar E, Kliman HJ, Olive DL. Interleukin- 8 concentration in \nperitoneal fluid of patients with endometriosis and modulation of interleukin- 8 \nexpression in human mesothelial cells. Mol Hum Reprod. 1996 Jan;2(1):40–5.  \nArlıer S, Kayışlı ÜA, Arıcı A. Tumor necrosis factor alfa and interleukin 1 alfa \ninduced phosphorylation and degradat ion of inhibitory kappa B alpha are \nregulated by estradiol in endometrial cells. Turk J Obstet Gynecol. 2018 \nMar;15(1):50–9.  \nAudebert A, Bäckström T, Barlow DH, Benagiano G, Brosens I, Bühler K, et al. \nEndometriosis 1991: a discussion document. Hum Reprod. 1992 Mar;7(3):432–\n5.  \nBacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, Camisa B, et al. \nMacrophages are alternatively activated in patients with endometriosis and \nrequired for growth and vascularization of lesions in a mouse model of disease. \nAm J Pathol. 2009 Aug;175(2):547–56.  \nBadawy SZ, Cuenca V, Kaufman L, Stitzel A, Thompson M. The regulation of \nimmunoglobulin production by B cells in patients with endometriosis. Fertil Steril. \n1989 May;51(5):770–3.  \n\n73 \n \nBadawy SZ, Cuenca V, Stitzel A, Tice D. Imm une rosettes of T and B \nlymphocytes in infertile women with endometriosis. J Reprod Med. 1987 \nMar;32(3):194–7.  \nBarbisan CC, Andres MP, Torres LR, Libânio BB, Torres US, D’Ippolito G, et al. \nStructured MRI reporting increases completeness of radiological r eports and \nrequesting physicians’ satisfaction in the diagnostic workup for pelvic \nendometriosis. Abdom Radiol [Internet]. 2021 Feb 24 [cited 2021 May 7]; \nAvailable from: https://doi.org/10.1007/s00261-021-02966-4 \nBarnes JI, Divi V, Begaye A, Wong R, Coutr e S, Owens DK, et al. Cost -\neffectiveness of ibrutinib as first-line therapy for chronic lymphocytic leukemia in \nolder adults without deletion 17p. Blood Adv. 2018 Aug 10;2(15):1946–56.  \nde Barros IBL, Malvezzi H, Gueuvoghlanian- Silva BY, Piccinato CA, Rizz o LV, \nPodgaec S. What do we know about regulatory T cells and endometriosis? A \nsystematic review. J Reprod Immunol. 2017;120:48–55.  \nBecker CM, Wright RD, Satchi-Fainaro R, Funakoshi T, Folkman J, Kung AL, et \nal. A Novel Noninvasive Model of Endometriosis for Monitoring the Efficacy of \nAntiangiogenic Therapy. Am J Pathol. 2006 Jun;168(6):2074–84.  \nBellelis P, Dias JA, Podgaec S, Gonzales M, Baracat EC, Abrão MS. \nEpidemiological and clinical aspects of pelvic endometriosis –a case series. Rev \nAssoc Med Bras (1992). 2010 Aug;56(4):467–71.  \nBenagiano G, Brosens I, Lippi D. The history of endometriosis. Gynecol Obstet \nInvest. 2014;78(1):1–9.  \nBerbic M, Ng CHM, Black K, Markham R, Russell P, Basten A, et al. A novel pilot \nstudy of endometrial stromal cells and imm une cell populations in sentinel \nuterine-draining lymph nodes during the menstrual cycle and in endometriosis. \nReprod Sci. 2013 Nov;20(11):1339–48.  \nBerkkanoglu M, Arici A. Immunology and endometriosis. Am J Reprod Immunol. \n2003 Jul;50(1):48–59.  \nBeste MT, Pfäffle-Doyle N, Prentice EA, Morris SN, Lauffenburger DA, Isaacson \nKB, et al. Molecular Network Analysis of Endometriosis Reveals a Role for c-Jun–\nRegulated Macrophage Activation. Science Translational Medicine. 2014 Feb \n5;6(222):222ra16-222ra16.  \nBilotas M, Barañao RI, Buquet R, Sueldo C, Tesone M, Meresman G. Effect of \nGnRH analogues on apoptosis and expression of Bcl -2, Bax, Fas and FasL \nproteins in endometrial epithelial cell cultures from patients with endometriosis \nand controls. Hum Reprod. 2007 Mar;22(3):644–53.  \nBohler HC, Gercel -Taylor C, Lessey BA, Taylor DD. Endometriosis markers: \nimmunologic alterations as diagnostic indicators for endometriosis. Reprod Sci. \n2007 Sep;14(6):595–604.  \n\n74 \n \nBouman A, Heineman MJ, Faas MM. Sex hormones and the imm une response \nin humans. Hum Reprod Update. 2005 Aug;11(4):411–23.  \nBruner‐Tran KL, Webster ‐Clair D, Osteen KG. Experimental Endometriosis. \nAnnals of the New York Academy of Sciences. 2002;955(1):328–39.  \nBulun SE. Endometriosis. N Engl J Med. 2009 Jan 15;360(3):268–79.  \nByrd JC, Furman RR, Coutre SE, Flinn IW, Burger JA, Blum KA, et al. Targeting \nBTK with ibrutinib in relapsed chronic lymphocytic leukemia. N Engl J Med. 2013 \nJul 4;369(1):32–42.  \nCarmona F, Chapron C, Martínez-Zamora M-Á, Santulli P, Rabanal A, Martínez-\nFlorensa M, et al. Ovarian endometrioma but not deep infiltrating endometriosis \nis associated with increased serum levels of interleukin- 8 and interleukin- 6. J \nReprod Immunol. 2012 Sep;95(1–2):80–6.  \nCarter NA, Rosser EC, Mauri C. Interleukin- 10 produced by B cells is crucial for \nthe suppression of Th17/Th1 responses, induction of T regulatory type 1 cells \nand reduction of collagen-induced arthritis. Arthritis Res Ther. 2012;14(1):R32.  \nCarter NA, Vasconcellos R, Rosser EC, Tulone C, Muñoz -Suano A, Kamanaka \nM, et al. Mice lacking endogenous IL- 10-producing regulatory B cells develop \nexacerbated disease and present with an increased frequency of Th1/Th17 but a \ndecrease in regulatory T cells. J Immunol. 2011 May 15;186(10):5569–79.  \nChang BY, Huang MM, Francesco M, Chen J, Sokolove J, Magadala P, et al. The \nBruton tyrosine kinase inhibitor PCI -32765 ameliorates autoimmune arthritis by \ninhibition of multiple effector cells. Arthritis Res Ther. 2011;13(4):R115.  \nChang SY, Ho YS. Immunohistochemical analysis of insulin- like growth factor I, \ninsulin-like growth factor I receptor and insulin- like growth factor II in \nendometriotic tissue and endometrium. Acta Obstet Gynecol Scand. 1997 \nFeb;76(2):112–7.  \nChapron C , Fauconnier A, Vieira M, Barakat H, Dousset B, Pansini V, et al. \nAnatomical distribution of deeply infiltrating endometriosis: surgical implications \nand proposition for a classification. Hum Reprod. 2003 Jan;18(1):157–61.  \nChen P, Wang D-B, Liang Y-M. Evaluation of estrogen in endometriosis patients: \nRegulation of GATA-3 in endometrial cells and effects on Th2 cytokines. J Obstet \nGynaecol Res. 2016 Jun;42(6):669–77.  \nChen P, Zhang Z, Chen Q, Ren F, Li T, Zhang C, et al. Expression of Th1 and \nTh2 cytokine-associated transcription factors, T-bet and GATA-3, in the eutopic \nendometrium of women with endometriosis. Acta Histochem. 2012 \nDec;114(8):779–84.  \nCheng S, Ma J, Guo A, Lu P, Leonard JP, Coleman M, et al. BTK inhibition targets \nin vivo CLL proliferation t hrough its effects on B -cell receptor signaling activity. \nLeukemia. 2014 Mar;28(3):649–57.  \n\n75 \n \nChishima F, Hayakawa S, Hirata Y, Nagai N, Kanaeda T, Tsubata K, et al. \nPeritoneal and Peripheral B -1-Cell Populations in Patients with Endometriosis. \nJournal of Obstetrics and Gynaecology Research. 2000;26(2):141–9.  \nCho S, Park SH, Choi YS, Seo SK, Kim HY, Park KH, et al. Expression of \nCyclooxygenase-2 in Eutopic Endometrium and Ovarian Endometriotic Tissue in \nWomen with Severe Endometriosis. GOI. 2010;69(2):93–100.  \nChristodoulakos G, Augoulea A, Lambrinoudaki I, Sioulas V, Creatsas G. \nPathogenesis of endometriosis: The role of defective ‘immunosurveillance.’ The \nEuropean Journal of Contraception & Reproductive Health Care. 2007 Jan \n1;12(3):194–202.  \nChristofolini DM, Cavalheiro CM, Teles JS, Lerner TG, Brandes A, Bianco B, et \nal. Promoter - 817C>T variant of B lymphocyte stimulator gene (BLyS) and \nsusceptibility to endometriosis -related infertility and idiopathic infertility in \nBrazilian population. Scand J Immunol. 2011 Dec;74(6):628–31.  \nCoiffier B, Lepage E, Brière J, Herbrecht R, Tilly H, Bouabdallah R, et al. CHOP \nChemotherapy plus Rituximab Compared with CHOP Alone in Elderly Patients \nwith Diffuse Large- B-Cell Lymphoma [Internet]. \nhttp://dx.doi.org.proxy.insermbiblio.inist.fr/10.1056/NEJMoa011795. \nMassachusetts Medical Society; 2009 [cited 2020 Nov 6]. Available from: \nhttps://www-nejm-org.proxy.insermbiblio.inist.fr/doi/10.1056/NEJMoa011795 \nCominelli A, Gaide Chevronnay HP, Lemoine P, Courtoy PJ, Marbaix E, Henr iet \nP. Matrix metalloproteinase- 27 is expressed in CD163+/CD206+ M2 \nmacrophages in the cycling human endometrium and in superficial endometriotic \nlesions. Mol Hum Reprod. 2014 Aug;20(8):767–75.  \nCorneth OBJ, de Bruijn MJW, Rip J, Asmawidjaja PS, Kil LP, Hendriks RW. \nEnhanced Expression of Bruton’s Tyrosine Kinase in B Cells Drives Systemic \nAutoimmunity by Disrupting T Cell Homeostasis. J Immunol. 2016 01;197(1):58–\n67.  \nD’Hooghe TM, Bambra CS, De Jonge I, Lauweryns JM, Koninckx PR. The \nprevalence of spontaneous endometriosis in the baboon (Papio anubis, Papio \ncynocephalus) increases with the duration of captivity. Acta Obstet Gynecol \nScand. 1996 Feb;75(2):98–101.  \nD’Hooghe TM, Bambra CS, Raeymaekers BM, De Jonge I, Lauweryns JM, \nKoninckx PR. Intrapelvic injec tion of menstrual endometrium causes \nendometriosis in baboons (Papio cynocephalus and Papio anubis). Am J Obstet \nGynecol. 1995 Jul;173(1):125–34.  \nD’Hooghe TM, Bambra CS, Suleman MA, Dunselman GA, Evers HL, Koninckx \nPR. Development of a model of retrograde menstruation in baboons (Papio \nanubis)**Supported by the Commission of the European Communities (DG VIII \nDevelopment and DG XII Science, Research and Development) and by the \n\n76 \n \nVlaamse Interuniversitaire Raad (Flemish Interuniversity Council), Brussels, \nBelgium. Fertility and Sterility. 1994 Sep 1;62(3):635–8.  \nD’Hooghe TM, Debrock S. Endometriosis, retrograde menstruation and \nperitoneal inflammation in women and in baboons. Hum Reprod Update. 2002 \nFeb;8(1):84–8.  \nDias JA, de Oliveira RM, Abrao MS. Antinuclear antibodies and endometriosis. \nInt J Gynaecol Obstet. 2006 Jun;93(3):262–3.  \nDias JA, Podgaec S, de Oliveira RM, Carnevale Marin ML, Baracat EC, Abrão \nMS. Patients with endometriosis of the rectosigmoid have a higher percentage of \nnatural killer cells in peripheral blood. J Minim Invasive Gynecol. 2012 \nJun;19(3):317–24.  \nDonnez J, Smoes P, Gillerot S, Casanas-Roux F, Nisolle M. Vascular endothelial \ngrowth factor (VEGF) in endometriosis. Hum Reprod. 1998 Jun;13(6):1686–90.  \nDu FH, Mills EA, Mao -Draayer Y. Next -generation anti -CD20 monoclonal \nantibodies in autoimmune disease treatment. Auto Immun Highlights. 2017 Nov \n16;8(1):12.  \nDubovsky JA, Beckwith KA, Natarajan G, Woyach JA, Jaglowski S, Zhong Y, et \nal. Ibrutinib is an irreversible molecular inhibitor of ITK driving a Th1- selective \npressure in T lymphocytes. Blood. 2013 Oct 10;122(15):2539–49.  \nDunselman G a. J, Vermeulen N, Becker C, Calhaz-Jorge C, D’Hooghe T, De Bie \nB, et al. ESHRE guideline: management of women with endometriosis. Hum \nReprod. 2014 Mar;29(3):400–12.  \nEdwards JCW, Szczepanski L, Szechinski J, Filipowicz-Sosnowska A, Emery P, \nClose DR, et al. Efficacy of B-cell-targeted therapy with rituximab in patients with \nrheumatoid arthritis. N Engl J Med. 2004 Jun 17;350(25):2572–81.  \nEvans JG, Chavez -Rueda KA, Eddaoudi A, Meyer -Bahlburg A, Rawlings DJ, \nEhrenstein MR, et al. Novel Suppressive Function of Transitional 2 B Cells in \nExperimental Arthritis. The Journal of Immunology. 2007 Jun 15;178(12):7868 –\n78.  \nFainaru O, Adini A, Benny O, Adini I, Short S, Bazinet L, et al. Dendritic cells \nsupport angiogenesis and promote lesion growth in a murine model of \nendometriosis. The FASEB Journal. 2008;22(2):522–9.  \nFazleabas AT, Brudney A, Gurates B, Chai D, Bulun S. A Modified Baboon Model \nfor Endometriosis. Annals of the New York Academy of Sciences. \n2002;955(1):308–17.  \nFernández-Shaw S, Hicks BR, Yudkin PL, Kennedy S, Barlow DH, Starkey PM. \nAnti-endometrial and anti -endothelial auto- antibodies in women with \nendometriosis. Hum Reprod. 1993 Feb;8(2):310–5.  \n\n77 \n \nFillatreau S, Sweenie CH, McGeachy MJ, Gray D, Anderton SM. B cells regulate \nautoimmunity by provision of IL-10. Nat Immunol. 2002 Oct;3(10):944–50.  \nFiorcari S, Maffei R, Audrito V, Martinelli S, Hacken ET, Zucchini P, et al. Ibrutinib \nmodifies the function of monocyte/macrophage population in chronic lymphocytic \nleukemia. Oncotarget. 2016 Sep 1;7(40):65968–81.  \nFunamizu A, Fukui A, Kamoi M, Fuchinoue K, Yokota M, Fukuhara R, et al. \nExpression of Natural Cytotoxicit y Receptors on Peritoneal Fluid Natural Killer \nCell and Cytokine Production by Peritoneal Fluid Natural Killer Cell in Women \nwith Endometriosis. American Journal of Reproductive Immunology. \n2014;71(4):359–67.  \nGabhann JN, Hams E, Smith S, Wynne C, Byrne JC , Brennan K, et al. Btk \nRegulates Macrophage Polarization in Response to Lipopolysaccharide. PLOS \nONE. 2014 Jan 21;9(1):e85834.  \nGagné D, Rivard M, Pagé M, Shazand K, Hugo P, Gosselin D. Blood leukocyte \nsubsets are modulated in patients with endometriosis.  Fertil Steril. 2003 \nJul;80(1):43–53.  \nGallinelli A, Chiossi G, Giannella L, Marsella T, Genazzani AD, Volpe A. Different \nconcentrations of interleukins in the peritoneal fluid of women with endometriosis: \nrelationships with lymphocyte subsets. Gynecol Endocrinol. 2004 Mar;18(3):144–\n51.  \nGarcia-Velasco JA, Arici A. Interleukin-8 expression in endometrial stromal cells \nis regulated by integrin-dependent cell adhesion. Molecular Human Reproduction. \n1999 Dec 1;5(12):1135–40.  \nGazvani R, Templeton A. Peritoneal environment, cytokines and angiogenesis in \nthe pathophysiology of endometriosis. Reproduction. 2002 Feb;123(2):217–26.  \nGebel HM, Braun DP, Rotman C, Rana N, Dmowski WP. Mitogen induced \nproduction of polyclonal IgG is decreased in women with severe endometriosis. \nAm J Reprod Immunol. 1993 Mar;29(2):124–30.  \nGiudice LC, Kao LC. Endometriosis. Lancet. 2004 Nov 13;364(9447):1789–99.  \nGleicher N, el -Roeiy A, Confino E, Friberg J. Is endometriosis an autoimmune \ndisease? Obstet Gynecol. 1987 Jul;70(1):115–22.  \nGogacz M, Winkler I, Bojarska-Junak A, Tabarkiewicz J, Semczuk A, Rechberger \nT, et al. Increased percentage of Th17 cells in peritoneal fluid is associated with \nseverity of endometriosis. J Reprod Immunol. 2016;117:39–44.  \nGoncalves MO da C, Podgaec S, Dias JA, Gonzalez M, Abrao MS. Transvaginal \nultrasonography with bowel preparation is able to predict the number of lesions \nand rectosigmoid layers affected in cases of deep endometriosis, defining \nsurgical strategy. Hum Reprod. 2010 Mar 1;25(3):665–71.  \n\n78 \n \nGoncalves MO, Siufi Neto J, Andres MP, Siufi D, de Mattos LA, Abrao MS. \nSystematic evaluation of endometriosis by transvaginal ultrasound can \naccurately replace diagnostic laparoscopy, mainly for deep and ovarian \nendometriosis. Human Reproduction [Internet]. 2021 Apr 16 [cited 2021 May \n7];(deab085). Available from: https://doi.org/10.1093/humrep/deab085 \nGonzález-Foruria I, Santulli P, Chouzenoux S, Carmona F, Batteux F, Chapron \nC. Soluble ligands for the NKG2D receptor are released during endometriosis \nand correlate with disease severity. PLoS One. 2015;10(3):e0119961.  \nde Gorter DJJ, Beuling EA, Kersseboom R, Middendorp S, van Gils JM, Hendriks \nRW, et al. Bruton’s Tyrosine Kinase and Phospholipase C γ2 Mediate \nChemokine-Controlled B Cell Migration and Homing. Imm unity. 2007 Jan \n1;26(1):93–104.  \nde Graaff AA, Dunselman GAJ, Delvoux B, van Kaam KJ, Smits LJM, Romano \nA. B lymphocyte stimulator - 817C>T promoter polymorphism and the \npredisposition for the development of deep infiltrating endometriosis. Fertil Steril. \n2010 Aug;94(3):1108–10.  \nGroom J, Kalled SL, Cutler AH, Olson C, Woodcock SA, Schneider P, et al. \nAssociation of BAFF/BLyS overexpression and altered B cell differentiation with \nSjögren’s syndrome. J Clin Invest. 2002 Jan 1;109(1):59–68.  \nGrümmer R, Schwarzer F, Bainczyk K, Hess-Stumpp H, Regidor P-A, Schindler \nAE, et al. Peritoneal endometriosis: validation of an in- vivo model. Human \nReproduction. 2001 Aug 1;16(8):1736–43.  \nGuillevin L, Pagnoux C, Karras A, Khouatra C, Aumaître O, Cohen P, et al. \nRituximab versus azathioprine for maintenance in ANCA-associated vasculitis. N \nEngl J Med. 2014 Nov 6;371(19):1771–80.  \nHaas D, Shebl O, Shamiyeh A, Oppelt P. The rASRM score and the Enzian \nclassification for endometriosis: their strengths and weaknesses. Acta Obstetricia \net Gynecologica Scandinavica. 2013a;92(1):3–7.  \nHaas D, Wurm P, Shamiyeh A, Shebl O, Chvatal R, Oppelt P. Efficacy of the \nrevised Enzian classification: a retrospective analysis. Does the revised Enzian \nclassification solve the problem of duplicate classification in rASRM and Enzian? \nArch Gynecol Obstet. 2013b May;287(5):941–5.  \nHaber E, Danenberg HD, Koroukhov N, Ron- El R, Golomb G, Schachter M. \nPeritoneal macrophage depletion by liposomal bisphosphonate attenuates \nendometriosis in the rat model. Hum Reprod. 2009 Feb;24(2):398–407.  \nHalme J, Hammond MG, Hulka JF, Raj SG, Talbert LM. Retrograde menstruation \nin healthy women and in patients with endometriosis. Obstet Gynecol. 1984 \nAug;64(2):151–4.  \nHamden KE, Whitman AG, Ford PW, Shelton JG, McCubrey JA, Akula SM. Raf \nand VEGF: emerging therapeutic targets  in Kaposi’s sarcoma- associated \n\n79 \n \nherpesvirus infection and angiogenesis in hematopoietic and nonhematopoietic \ntumors. Leukemia. 2005 Jan;19(1):18–26.  \nHarada H, Quearry B, Ruiz -Vela A, Korsmeyer SJ. Survival factor -induced \nextracellular signal -regulated kin ase phosphorylates BIM, inhibiting its \nassociation with BAX and proapoptotic activity. Proc Natl Acad Sci U S A. 2004 \nOct 26;101(43):15313–7.  \nHarada T, Iwabe T, Terakawa N. Role of cytokines in endometriosis. Fertil Steril. \n2001 Jul;76(1):1–10.  \nHarrison C. Trial watch: BTK inhibitor shows positive results in B cell \nmalignancies. Nat Rev Drug Discov. 2012 Jan 20;11(2):96.  \nHerman SEM, Gordon AL, Hertlein E, Ramanunni A, Zhang X, Jaglowski S, et al. \nBruton tyrosine kinase represents a promising therapeutic target for treatment of \nchronic lymphocytic leukemia and is effectively targeted by PCI -32765. Blood. \n2011 Jun 9;117(23):6287–96.  \nHever A, Roth RB, Hevezi P, Marin ME, Acosta JA, Acosta H, et al. Human \nendometriosis is associated with plasma cells and overexpression of B \nlymphocyte stimulator. Proc Natl Acad Sci U S A. 2007 Jul 24;104(30):12451–6.  \nHo HN, Wu MY, Yang YS. Peritoneal cellular immunity and endometriosis. Am J \nReprod Immunol. 1997 Dec;38(6):400–12.  \nHonigberg LA, Smith AM, Sirisawad M, Verner E, Loury D, Chang B, et al. The \nBruton tyrosine kinase inhibitor PCI -32765 blocks B -cell activation and is \nefficacious in models of autoimmune disease and B -cell malignancy. Proc Natl \nAcad Sci U S A. 2010 Jul 20;107(29):13075–80.  \nHsu CC, Lin YS, Wang ST, Huang KE. Immunomodulation in women with \nendometriosis receiving GnRH agonist. Obstet Gynecol. 1997 Jun;89(6):993–8.  \nHufnagel D, Li F, Cosar E, Krikun G, Taylor HS. The Role of Stem Cells in the \nEtiology and Pathophysiology of Endometriosis. Semin Reprod Med. 2015 \nSep;33(5):333–40.  \nHutcheson J, Vanarsa K, Bashmakov A, Grewal S, Sajitharan D, Chang BY, et \nal. Modulating proximal cell signaling by targeting Btk ameliorates humoral \nautoimmunity and end -organ disease in murine lupus. Arthritis Res Ther. 2012 \nNov 8;14(6):R243.  \nIborra A, Palacio JR, Ulcova- Gallova Z, Martínez P. Autoimmune response in \nwomen with endometriosis. Am J Reprod Immunol. 2000 Oct;44(4):236–41.  \nItaliani P, Boraschi D. From Monocytes to M1/M2 Macrophages: Phenotypical vs. \nFunctional Differentiation. \nFront Immunol [Internet]. 2014 [cited 2021 Apr 14];5. \nAvailable from: \nhttps://www.frontiersin.org/articles/10.3389/fimmu.2014.00514/full \n\n80 \n \nIwabe T, Harada T, Tsudo T, Nagano Y, Yoshida S, Tanikawa M, et al. Tumor \nnecrosis factor -alpha promotes  proliferation of endometriotic stromal cells by \ninducing interleukin- 8 gene and protein expression. J Clin Endocrinol Metab. \n2000 Feb;85(2):824–9.  \nIwabe T, Harada T, Tsudo T, Tanikawa M, Onohara Y, Terakawa N. Pathogenetic \nsignificance of increased levels of interleukin-8 in the peritoneal fluid of patients \nwith endometriosis. Fertil Steril. 1998 May;69(5):924–30.  \nIwata Y, Matsushita T, Horikawa M, DiLillo DJ, Yanaba K, Venturi GM, et al. \nCharacterization of a rare IL-10–competent B-cell subset in humans that parallels \nmouse regulatory B10 cells. Blood. 2011 Jan 13;117(2):530–41.  \nJain P, Romaguera J, Srour SA, Lee HJ, Hagemeister F, Westin J, et al. Four -\nyear follow-up of a single arm, phase II clinical trial of ibrutinib with rituximab (IR) \nin patients with relapsed/refractory mantle cell lymphoma (MCL). Br J Haematol. \n2018;182(3):404–11.  \nJi R-R, Suter MR. p38 MAPK, microglial signaling, and neuropathic pain. Mol \nPain. 2007 Nov 1;3:33.  \nJin G, Hamaguchi Y, Matsushita T, Hasegawa M, Le Huu D, Ishiura N, et al. B-\ncell linker protein expression contributes to controlling allergic and autoimmune \ndiseases by mediating IL- 10 production in regulatory B cells. J Allergy Clin \nImmunol. 2013 Jun;131(6):1674–82.  \nKaminska B. MAPK signalling pathways as molecular tar gets for anti -\ninflammatory therapy —from molecular mechanisms to therapeutic benefits. \nBiochimica et Biophysica Acta (BBA) -  Proteins and Proteomics. 2005 Dec \n30;1754(1):253–62.  \nKayisli UA, Mahutte NG, Arici A. Uterine chemokines in reproductive physiology \nand pathology. Am J Reprod Immunol. 2002 Apr;47(4):213–21.  \nKhan D, Ansar Ahmed S. The Immune System Is a Natural Target for Estrogen \nAction: Opposing Effects of Estrogen in Two Prototypical Autoimmune Diseases. \nFront Immunol [Internet]. 2016 [cited 2021 May 6];6. Available from: \nhttps://www.frontiersin.org/articles/10.3389/fimmu.2015.00635/full \nKhan WN, Alt FW, Gerstein RM, Malynn BA, Larsson I, Rathbun G, et al. \nDefective B cell development and function in Btk-deficient mice. Immunity. 1995 \nSep;3(3):283–99.  \nKikuchi Y, Ishikawa N, Hirata J, Imaizumi E, Sasa H, Nagata I. Changes of \nperipheral blood lymphocyte subsets before and after operation of patients with \nendometriosis. Acta Obstet Gynecol Scand. 1993 Apr;72(3):157–61.  \nKil LP, de Bruijn MJW, van Nimwegen M, Corneth OBJ, van Hamburg JP, Dingjan \nGM, et al. Btk levels set the threshold for B-cell activation and negative selection \nof autoreactive B cells in mice. Blood. 2012 Apr 19;119(16):3744–56.  \n\n81 \n \nKim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors \n(IGFs), IGF -binding proteins (IGFBPs), and IGFBP -3 protease activity in the \nperitoneal fluid of patients with and without endometriosis. Fertil Steril. 2000  \nMay;73(5):996–1000.  \nKlentzeris LD, Bulmer JN, Liu DT, Morrison L. Endometrial leukocyte \nsubpopulations in women with endometriosis. Eur J Obstet Gynecol Reprod Biol. \n1995 Nov;63(1):41–7.  \nKokhaei P, Jadidi -Niaragh F, Sotoodeh Jahromi A, Osterborg A, Mell stedt H, \nHojjat-Farsangi M. Ibrutinib- A double- edge sword in cancer and autoimmune \ndisorders. J Drug Target. 2016;24(5):373–85.  \nKoninckx PR, Kennedy SH, Barlow DH. Endometriotic disease: the role of \nperitoneal fluid. Hum Reprod Update. 1998 Sep 1;4(5):741–51.  \nKovats S. Estrogen receptors regulate innate immune cells and signaling \npathways. Cell Immunol. 2015 Apr;294(2):63–9.  \nKrálíčková M, Vetvicka V. Immunological aspects of endometriosis: a review. Ann \nTransl Med. 2015 Jul;3(11):153.  \nKuehn HS, Rådinger M, Brown JM, Ali K, Vanhaesebroeck B, Beaven MA, et al. \nBtk-dependent Rac activation and actin rearrangement following Fceps ilonRI \naggregation promotes enhanced chemotactic responses of mast cells. J Cell Sci. \n2010 Aug 1;123(Pt 15):2576–85.  \nLachapelle MH, Hemmings R, Roy DC, Falcone T, Miron P. Flow cytometric \nevaluation of leukocyte subpopulations in the follicular fluids of infertile patients. \nFertil Steril. 1996 Jun;65(6):1135–40.  \nLaganà AS, Vitale SG, Salmeri FM, Triolo O, Ban Frangež H, Vrtačnik -Bokal E, \net al. Unus pro omnibus, omnes pro uno: A novel, evidence- based, unifying \ntheory for the pathogenesis of endometriosis.  Med Hypotheses. 2017 \nJun;103:10–20.  \nLaschke MW, Elitzsch A, Vollmar B, Vajkoczy P, Menger MD. Combined \ninhibition of vascular endothelial growth factor (VEGF), fibroblast growth factor \nand platelet-derived growth factor, but not inhibition of VEGF alone,  effectively \nsuppresses angiogenesis and vessel maturation in endometriotic lesions. Hum \nReprod. 2006 Jan 1;21(1):262–8.  \nLebovic DI, Bentzien F, Chao VA, Garrett EN, Meng YG, Taylor RN. Induction of \nan angiogenic phenotype in endometriotic stromal cell cultures by interleukin-\n1beta. Mol Hum Reprod. 2000 Mar;6(3):269–75.  \nLebovic DI, Mueller MD, Taylor RN. Immunobiology of endometriosis. Fertil Steril. \n2001 Jan;75(1):1–10.  \n\n82 \n \nLeconte M, Santulli P, Chouzenoux S, Marcellin L, Cerles O, Chapron C, et al. \nInhibition of MAPK and VEGFR by Sorafenib Controls the Progression of \nEndometriosis. Reprod Sci. 2015 Sep;22(9):1171–80.  \nLee-Chang C, Rashidi A, Miska J, Zhang P, Pituch KC, Hou D, et al. Myeloid-\nderived suppressive cells promote B cell –mediated immunosuppressi on via \ntransfer of PD-L1 in glioblastoma. Cancer Immunol Res. 2019 Dec;7(12):1928 –\n43.  \nLeighton JK. Imbruvica (ibrutinib) pharmacology review. Application number: \n205552Orig1s000 [Internet]. Food and Drug Administration (FDA); 2013. \nAvailable from: \nhttps://www.accessdata.fda.gov/drugsatfda_docs/nda/2013/205552Orig1s000P\nharmR.pdf \nLong M, Beckwith K, Do P, Mundy BL, Gordon A, Lehman AM, et al. Ibrutinib \ntreatment improves T cell number and function in CLL patients. J Clin Invest. \n2017 Aug 1;127(8):3052–64.  \nLundy SK, Berlin AA, Martens TF, Lukacs NW. Deficiency of regulatory B cells \nincreases allergic airway inflammation. Inflamm Res. 2005 Dec;54(12):514–21.  \nMaeda N, Izumiya C, Yamamoto Y, Oguri H, Kusume T, Fukaya T. Increased \nkiller inhibitory receptor KIR2DL1 expression among natural killer cells in women \nwith pelvic endometriosis. Fertil Steril. 2002 Feb;77(2):297–302.  \nMahnke JL, Dawood MY, Huang JC. Vascular endothelial growth factor and \ninterleukin-6 in peritoneal fluid of women with endometriosis. Fert il Steril. 2000 \nJan;73(1):166–70.  \nMalvezzi H, Hernandes C, Piccinato CA, Podgaec S. Interleukin in endometriosis-\nassociated infertility -pelvic pain: systematic review and meta- analysis. \nReproduction. 2019;158(1):1–12.  \nManda S, Dunbar N, Marx -Wood CR, Dan ilov AV. Ibrutinib is an effective \ntreatment of autoimmune haemolytic anaemia in chronic lymphocytic leukaemia. \nBr J Haematol. 2015 Sep;170(5):734–6.  \nMarcellin L, Santulli P, Chouzenoux S, Cerles O, Nicco C, Dousset B, et al. \nAlteration of Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions \ngrowth and fibrogenesis in ectopic endometriosis. Free Radical Biology and \nMedicine. 2017 Sep 1;110:1–10.  \nMatarese G, De Placido G, Nikas Y, Alviggi C. Pathogenesis of endometriosis: \nnatural immunity dysfunction or autoimmune disease? Trends Mol Med. 2003 \nMay;9(5):223–8.  \nMathur SP. Autoimmunity in endometriosis: relevance to infertility. Am J Reprod \nImmunol. 2000 Aug;44(2):89–95.  \n\n83 \n \nMatsumoto M, Baba A, Yokota T, Nishikawa H, Ohkawa Y, Kayama H, et al. \nInterleukin-10-Producing Plasmablasts Exert Regulatory Function in \nAutoimmune Inflammation. Immunity. 2014 Dec 18;41(6):1040–51.  \nMattos LA, Goncalves MO, Andres MP, Young SW, Feldman M, Abrão MS, et al. \nStructured Ultrasound and Magnetic Resonance Imaging Reports for Patients \nwith Suspected Endometriosis: Guide for Imagers and Clinicians. J Minim \nInvasive Gynecol. 2019 Oct;26(6):1016–25.  \nMauri C, Gray D, Mushtaq N, Londei M. Prevention of Arthritis by Interleukin 10–\nproducing B Cells. Journal of Experimental Medicine. 2003 Feb 10;197(4):489 –\n501.  \nMauri C, Menon M. The expanding family of regulatory B cells. Int Immunol. 2015 \nOct;27(10):479–86.  \nMcKinnon B, Mueller  M, Montgomery G. Progesterone Resistance in \nEndometriosis: an Acquired Property? Trends Endocrinol Metab. \n2018;29(8):535–48.  \nMcLaren J. Vascular endothelial growth factor and endometriotic angiogenesis. \nHum Reprod Update. 2000 Feb;6(1):45–55.  \nMiklos D, Cutler CS, Arora M, Waller EK, Jagasia M, Pusic I, et al. Ibrutinib for \nchronic graft-versus-host disease after failure of prior therapy. Blood. 2017 Nov \n23;130(21):2243–50.  \nMizoguchi A, Mizoguchi E, Takedatsu H, Blumberg RS, Bhan AK. Chronic \nIntestinal Inflammatory Condition Generates IL- 10-Producing Regulatory B Cell \nSubset Characterized by CD1d Upregulation. Immunity. 2002 Feb 1;16(2):219–\n30.  \nMoretta A. Natural killer cells and dendritic cells: rendezvous in abused tissues. \nNat Rev Immunol. 2002 Dec;2(12):957–64.  \nNava-Loya G, Hernández -Guerrero C, Pérez -Ocharan M, Mojarra- Estrada JM, \nGonzález-Morales ME, Bustos -Lopez H, et al. [Peritoneal immune response in \nendometriosis]. Ginecol Obstet Mex. 1996 Apr;64:147–53.  \nNezhat C, Nezhat F, Nezhat C. Endometriosis: ancient disease, ancient \ntreatments. Fertility and Sterility. 2012 Dec 1;98(6, Supplement):S1–62.  \nNgô C, Chéreau C, Nicco C, Weill B, Chapron C, Batteux F. Reactive oxygen \nspecies controls endometriosis progression. Am J Pathol. 2009 Jul;175(1):225 –\n34.  \nNisolle M, Donnez J. Peritoneal endometriosis, ovarian endometriosis, and \nadenomyotic nodules of the rectovaginal septum are three different entities. Fertil \nSteril. 1997 Oct;68(4):585–96.  \n\n84 \n \nNomiyama M, Hachisuga T, Sou H, Nakamura K, Matsumoto Y, Iwasaka T, et al. \nLocal immune response in infertile patients with minimal endometriosis. Gynecol \nObstet Invest. 1997;44(1):32–7.  \nNothnick WB. Treating endometriosis as an autoimmune disease. Fertility and \nSterility. 2001 Aug 1;76(2):223–31.  \nNyhoff LE, Clark ES, Barron BL, Bonami RH, Khan WN, Kendall PL. Bruton’s \nTyrosine Kinase Is Not Essential for B Cell Survival beyond Early Developmental \nStages. The Journal of Immunology. 2018 Apr 1;200(7):2352–61.  \nO’Connor BP, Raman VS, Erickson LD, Cook WJ, Weaver LK, Ahonen C, et al. \nBCMA Is Essential for the Survival of Long- lived Bone Marrow Plasma Cells. J \nExp Med. 2004 Jan 5;199(1):91–8.  \nOdukoya O, Bansal A, Cooke I. Serum endometrial IgG antibodies and soluble \nCD23 concentrations in patients with endometriosis. Acta Obstetricia et \nGynecologica Scandinavica. 1996a;75(10):927–31.  \nOdukoya OA, Bansal A, Wilson AP, Weetman AP, Cooke ID. Serum -soluble \nCD23 in patients with endometriosis and the effect of treatment with danazol and \nleuprolide acetate depot injection. Hum Reprod. 1995 Apr 1;10(4):942–6.  \nOdukoya OA, Bansal A, Wilson P, Lim K, Weetman AP, Cooke ID. Soluble CD23 \nprotein in the peritoneal fluid of patients with endometriosis. Hum Reprod. 1996b \nSep;11(9):2018–21.  \nOosterlynck DJ, Cornillie FJ, Waer M, Koninckx PR. Immunohistochemical \ncharacterization of leucocyte subpopulations in endometriotic lesions. Arch \nGynecol Obstet. 1993a Dec 1;253(4):197–206.  \nOosterlynck DJ, Cornillie FJ, Waer M, Vandeputte M, Koninckx PR. Women with \nendometriosis show a defect in natural killer activity resulting in a decreased \ncytotoxicity to autologous endometrium. Fertil Steril. 1991 Jul;56(1):45–51.  \nOosterlynck DJ, Meuleman C, Waer M, Koninckx PR, Vandeputte M. \nImmunosuppressive activity of  peritoneal fluid in women with endometriosis. \nObstet Gynecol. 1993b Aug;82(2):206–12.  \nOral E, Arici A. Peritoneal growth factors and endometriosis. Semin Reprod \nEndocrinol. 1996 Aug;14(3):257–67.  \nOral E, Olive DL, Arici A. The peritoneal environment in endometriosis. Hum \nReprod Update. 1996 Oct;2(5):385–98.  \nOrecchioni M, Ghosheh Y, Pramod AB, Ley K. Macrophage Polarization: \nDifferent Gene Signatures in M1(LPS+) vs. Classically and M2(LPS –) vs. \nAlternatively Activated Macrophages. Front Immunol [Internet]. 2019 May 24 \n[cited 2021 Jan 27];10. Available from: \nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC6543837/ \n\n85 \n \nOsuga Y, Koga K, Hirota Y, Hirata T, Yoshino O, Taketani Y. Lymphocytes in \nendometriosis. Am J Reprod Immunol. 2011 Jan;65(1):1–10.  \nOsuga Y, Tsutsumi O, Okagaki R, Takai Y, Fujimoto A, Suenaga A, et al. \nHepatocyte growth factor concentrations are elevated in peritoneal fluid of \nwomen with endometriosis. Hum Reprod. 1999 Jun;14(6):1611–3.  \nOuYang Z, Hirota Y, Osuga Y, Hamasaki K, Hasegawa A,  Tajima T, et al. \nInterleukin-4 stimulates proliferation of endometriotic stromal cells. Am J Pathol. \n2008 Aug;173(2):463–9.  \nParry HM, Mirajkar N, Cutmore N, Zuo J, Long H, Kwok M, et al. Long- Term \nIbrutinib Therapy Reverses CD8+ T Cell Exhaustion in B Cell Chronic \nLymphocytic Leukaemia. Front Immunol. 2019;10:2832.  \nPaul Dmowski W, Braun DP. Immunology of endometriosis. Best Practice & \nResearch Clinical Obstetrics & Gynaecology. 2004 Apr 1;18(2):245–63.  \nde Paula Andres M, Borrelli GM, Kho RM, Abrão MS. T he current management \nof deep endometriosis: a systematic review. Minerva Ginecol. 2017 \nDec;69(6):587–96.  \nPayandeh Z, Bahrami AA, Hoseinpoor R, Mortazavi Y, Rajabibazl M, Rahimpour \nA, et al. The applications of anti-CD20 antibodies to treat various B cells disorders. \nBiomed Pharmacother. 2019 Jan;109:2415–26.  \nPaydas S. Management of adverse effects/toxicity of ibrutinib. Crit Rev Oncol \nHematol. 2019 Apr;136:56–63.  \nPodgaec S, Abrao MS, Dias JA, Rizzo LV, de Oliveira RM, Baracat EC. \nEndometriosis: an inflammatory disease with a Th2 immune response \ncomponent. Hum Reprod. 2007 May;22(5):1373–9.  \nPodgaec S, Rizzo LV, Fernandes LFC, Baracat EC, Abrao MS. CD4(+) \nCD25(high) Foxp3(+) cells increased in the peritoneal fluid of patients with \nendometriosis. Am J Reprod Immunol. 2012 Oct;68(4):301–8.  \nRamos-Casals M, Brito-Zerón P, Yagüe J, Akasbi M, Bautista R, Ruano M, et al. \nHypocomplementaemia as an immunological marker of morbidity and mortality in \npatients with primary Sjogren’s syndrome. Rheumatology (Oxford). 2005 \nJan;44(1):89–94.  \nRawlings DJ, Saffran DC, Tsukada S, Largaespada DA, Grimaldi JC, Cohen L, \net al. Mutation of unique region of Bruton’s tyrosine kinase in immunodeficient \nXID mice. Science. 1993 Jul 16;261(5119):358–61.  \nRay A, Dittel BN. Isolation of mouse peritoneal cavity cells. J Vis Exp. 2010 Jan \n28;(35).  \n\n86 \n \nRiccio L da GC, Santulli P, Marcellin L, Abrão MS, Batteux F, Chapron C. \nImmunology of endometriosis. Best Pract Res Clin Obstet Gynaecol. 2018 \nJul;50:39–49.  \nRiccio LGC, Baracat EC, Chapron C, Batteux F, Abrão MS. The role of the B \nlymphocytes in endometriosis: A systematic review. J Reprod Immunol. \n2017;123:29–34.  \nRiccio LGC, Jeljeli M, Santulli P, Chouzenoux S, Doridot L, Nicco C, et al. B \nlymphocytes inactivatio n by Ibrutinib limits endometriosis progression in mice. \nHum Reprod. 2019 Jul 8;34(7):1225–34.  \nRichter O, Mallmann P, van der Ven H, Krebs D. [TNF -alpha secretion by \nperitoneal macrophages in endometriosis]. Zentralbl Gynakol. 1998;120(7):332–\n6.  \nRier SE,  Zarmakoupis PN, Hu X, Becker JL. Dysregulation of interleukin- 6 \nresponses in ectopic endometrial stromal cells: correlation with decreased \nsoluble receptor levels in peritoneal fluid of women with endometriosis. J Clin \nEndocrinol Metab. 1995 Apr;80(4):1431–7.  \nRosser EC, Mauri C. Regulatory B cells: origin, phenotype, and function. \nImmunity. 2015 Apr 21;42(4):607–12.  \nRudensky AY. Regulatory T cells and Foxp3. Immunological Reviews. \n2011;241(1):260–8.  \nRushworth SA, Bowles KM, Barrera LN, Murray MY, Zaitseva L, MacEwan DJ. \nBTK inhibitor ibrutinib is cytotoxic to myeloma and potently enhances bortezomib \nand lenalidomide activities through NF-κB. Cell Signal. 2013 Jan;25(1):106–12.  \nSalles G, Barrett M, Foà R, Maurer J, O’Brien S, Valente N, et al. Rituximab in B-\nCell Hematologic Malignancies: A Review of 20 Years of Clinical Experience. Adv \nTher. 2017 Oct 1;34(10):2232–73.  \nSampson JA. Perforating Hemorrhagic (Chocolate) Cysts of the Ovary: Their \nImportance and Especially Their Relation to Pelvic Adenomas of Endometrial \nType (“Adenomyoma” of the Uterus, Rectovaginal Septum, Sigmoid, Etc.). 1921 \nSep 1 [cited 2020 Nov 6]; Available from: \nhttps://zenodo.org/record/1501763#.X6WVz2hKjIU \nSampson JA. Peritoneal endometriosis due to the menstrual dissemination of \nendometrial tissue into the peritoneal cavity. American Journal of Obstetrics and \nGynecology. 1927;14(4):422–69.  \nSantulli P, Borghese B, Chouzenoux S, Streuli I, Borderie D, de Ziegler D, et al. \nInterleukin-19 and interleukin- 22 serum levels are decreased in patients with \novarian endometrioma. Fertil Steril. 2013 Jan;99(1):219-226.e2.  \n\n87 \n \nSantulli P, Borghese B, Chouzenoux S, Vaiman D, Borderie D, Streuli I, et al. \nSerum and peritoneal interleukin- 33 levels are elevated in deeply infiltrating \nendometriosis. Hum Reprod. 2012 Jul;27(7):2001–9.  \nSantulli P, Marcellin L, Chouzenoux S, Boulard V, Just P -A, Nicco C, et al. Role \nof the protein kinase BRAF in the pathogenesis of endometriosis. Expert Opin \nTher Targets. 2016;20(8):1017–29.  \nSantulli P, Marcellin L, Tosti C, Chouzenoux S, Cerles O, Borghese B, et al. MAP \nkinases and the inflammatory signaling cascade as targets for the treatment of \nendometriosis? Expert Opin Ther Targets. 2015;19(11):1465–83.  \nScheerer C, Bauer P, Chiantera V, Sehouli J, Kaufmann A, Mechsner S. \nCharacterization of endomet riosis-associated immune cell infiltrates (EMaICI). \nArch Gynecol Obstet. 2016;294(3):657–64.  \nSchiemann B, Gommerman JL, Vora K, Cachero TG, Shulga- Morskaya S, \nDobles M, et al. An essential role for BAFF in the normal development of B cells \nthrough a BCMA-independent pathway. Science. 2001 Sep 14;293(5537):2111–\n4.  \nSchleicher U, Paduch K, Debus A, Obermeyer S, König T, Kling JC, et al. TNF -\nMediated Restriction of Arginase 1 Expression in Myeloid Cells Triggers Type 2 \nNO Synthase Activity at the Site of Infection. Cell Reports. 2016 May;15(5):1062–\n75.  \nSchutt SD, Fu J, Nguyen H, Bastian D, Heinrichs J, Wu Y, et al. Inhibition of BTK \nand ITK with Ibrutinib Is Effective in the Prevention of Chronic Graft-versus-Host \nDisease in Mice. PLoS One. 2015;10(9):e0137641.  \nSchwager K, Bootz F, Imesch P, Kaspar M, Trachsel E, Neri D. The antibody -\nmediated targeted delivery of interleukin-10 inhibits endometriosis in a syngeneic \nmouse model. Hum Reprod. 2011 Sep;26(9):2344–52.  \nSelam B, Kayisli UA, Garcia-Velasco JA, Arici A. Extracellular matrix-dependent \nregulation of Fas ligand expression in human endometrial stromal cells. Biol \nReprod. 2002 Jan;66(1):1–5.  \nSenturk LM, Arici A. Immunology of endometriosis. J Reprod Immunol. 1999 \nMay;43(1):67–83.  \nShifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, et al. Ovarian \nsteroid regulation of vascular endothelial growth factor in the human \nendometrium: implications for angiogenesis during the menstrual cycle and in the \npathogenesis of endometriosis. J Clin Endocrinol M etab. 1996 Aug;81(8):3112–\n8.  \nShinners NP, Carlesso G, Castro I, Hoek KL, Corn RA, Woodland RT, et al. \nBruton’s tyrosine kinase mediates NF-kappa B activation and B cell survival by B \ncell-activating factor receptor of the TNF -R family. J Immunol. 2007 Sep  \n15;179(6):3872–80.  \n\n88 \n \nSikora J, Ferrero S, Mielczarek -Palacz A, Kondera- Anasz Z. The Delicate \nBalance between the Good and the Bad IL- 1 Proinflammatory Effects in \nEndometriosis. Curr Med Chem. 2018;25(18):2105–21.  \nSmith CI, Baskin B, Humire -Greiff P, Zhou JN, Olsson PG, Maniar HS, et al. \nExpression of Bruton’s agammaglobulinemia tyrosine kinase gene, BTK, is \nselectively down-regulated in T lymphocytes and plasma cells. The Journal of \nImmunology. 1994 Jan 15;152(2):557–65.  \nSmith KA, Pearson CB, Hachey AM, X ia D -L, Wachtman LM. Alternative \nactivation of macrophages in rhesus macaques (Macaca mulatta) with \nendometriosis. Comp Med. 2012 Aug;62(4):303–10.  \nSofo V, Götte M, Laganà AS, Salmeri FM, Triolo O, Sturlese E, et al. Correlation \nbetween dioxin and endomet riosis: an epigenetic route to unravel the \npathogenesis of the disease. Arch Gynecol Obstet. 2015 Nov;292(5):973–86.  \nSolman IG, Blum LK, Hoh HY, Kipps TJ, Burger JA, Barrientos JC, et al. Ibrutinib \nrestores immune cell numbers and function in first -line and relapsed/refractory \nchronic lymphocytic leukemia. Leukemia Research. 2020 Oct 1;97:106432.  \nSomigliana E, Viganò P, Rossi G, Carinelli S, Vignali M, Panina- Bordignon P. \nEndometrial ability to implant in ectopic sites can be prevented by interleukin- 12 \nin a murine model of endometriosis. Human Reproduction. 1999 Dec \n1;14(12):2944–50.  \nSong M, Karabina SA, Kavtaradze N, Murphy AA, Parthasarathy S. Presence of \nendometrial epithelial cells in the peritoneal cavity and the mesothelial \ninflammatory response. Fertil Steril. 2003 Mar;79 Suppl 1:789–94.  \nStamenkovic I, Seed B. Analysis of two cDNA clones encoding the B lymphocyte \nantigen CD20 (B1, Bp35), a type III integral membrane protein. J Exp Med. 1988 \nJun 1;167(6):1975–80.  \nStartseva NV. [Clinical immunological aspects of genital endometriosis]. Akush \nGinekol (Mosk). 1980 Mar;(3):23–6.  \nStohl W, Metyas S, Tan S -M, Cheema GS, Oamar B, Xu D, et al. B lymphocyte \nstimulator overexpression in patients with systemic lupus erythematosus: \nlongitudinal observations. Arthritis Rheum. 2003 Dec;48(12):3475–86.  \nStory L, Kennedy S. Animal studies in endometriosis: a review. ILAR J. \n2004;45(2):132–8.  \nStraub RH. The complex role of estrogens in inflammation. Endocr Rev. 2007 \nAug;28(5):521–74.  \nTakamura M, Koga K, Izumi G, Hirata T, Harada M, Hirota Y, et al. Simultaneous \nDetection and Evaluation of Four Subsets of CD4+ T Lymphocyte in Lesions and \nPeripheral Blood in Endometriosis. Am J Reprod Immunol. 2015 Dec;74(6):480–\n6.  \n\n89 \n \nTakebayashi A, Kimura F, Kishi Y, Ishida M, Takahashi A, Yamanaka A, et al. \nSubpopulations of macrophages within eutopic endometrium of endometriosis \npatients. Am J Reprod Immunol. 2015 Mar;73(3):221–31.  \nTanaka Y, Mori T, Ito F, Koshiba A, Takaoka O, Kataoka H, et al. Exacerbation \nof Endometriosis Due To Regulatory T-Cell Dysfunction. J Clin Endocrinol Metab. \n2017 01;102(9):3206–17.  \nTang CPS, McMu llen J, Tam C. Cardiac side effects of bruton tyrosine kinase \n(BTK) inhibitors. Leuk Lymphoma. 2018;59(7):1554–64.  \nTarte K, Zhan F, De Vos J, Klein B, Shaughnessy J. Gene expression profiling of \nplasma cells and plasmablasts: toward a better understanding of the late stages \nof B-cell differentiation. Blood. 2003 Jul 15;102(2):592–600.  \nTedder TF, Streuli M, Schlossman SF, Saito H. Isolation and structure of a cDNA \nencoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl \nAcad Sci U S A. 1988 Jan;85(1):208–12.  \nThomas JD, Sideras P, Smith CI, Vorechovský I, Chapman V, Paul WE. \nColocalization of X-linked agammaglobulinemia and X -linked immunodeficiency \ngenes. Science. 1993 Jul 16;261(5119):355–8.  \nTirado-González I, Barrientos G, Tariverdian N, Arck PC, García MG, Klapp BF, \net al. Endometriosis research: animal models for the study of a complex disease. \nJ Reprod Immunol. 2010 Nov;86(2):141–7.  \nTomayko MM, Reynolds CP. Determination of subcutaneous tumor size in \nathymic (nude) mice. Cancer Chemother Pharmacol. 1989;24(3):148–54.  \nTomlinson MG, Kane LP, Su J, Kadlecek TA, Mollenauer MN, Weiss A. \nExpression and Function of Tec, Itk, and Btk in Lymphocytes: Evidence for a \nUnique Role for Tec. Mol Cell Biol. 2004 Mar;24(6):2455–66.  \nTosti C, Biscione A, Morgante G, Bifulco G, Luisi S, Petraglia F. Hormonal \ntherapy for endometriosis: from molecular research to bedside. Eur J Obstet \nGynecol Reprod Biol. 2017 Feb;209:61–6.  \nTosti C, Pinzauti S, Santulli P, Chapron C, Petraglia F. Pathogenetic Mechanisms \nof Deep Infiltrating Endometriosis. Reprod Sci. 2015 Sep;22(9):1053–9.  \nTuttlies F, Keckstein J, Ulrich U, Posso ver M, Schweppe KW, Wustlich M, et al. \n[ENZIAN-score, a classification of deep infiltrating endometriosis]. Zentralbl \nGynakol. 2005 Oct;127(5):275–81.  \nVan Duyne R, Pedati C, Guendel I, Carpio L, Kehn-Hall K, Saifuddin M, et al. The \nutilization of humanized mouse models for the study of human retroviral infections. \nRetrovirology. 2009 Aug 12;6:76.  \n\n90 \n \nVargas L, Hamasy A, Nore BF, Smith CIE. Inhibitors of BTK and ITK: state of the \nnew drugs for cancer, autoimmunity and inflammatory diseases. Scand J \nImmunol. 2013 Aug;78(2):130–9.  \nVercellini P, Fedele L, Aimi G, Pietropaolo G, Consonni D, Crosignani PG. \nAssociation between endometriosis stage, lesion type, patient characteristics and \nseverity of pelvic pain symptoms: a multivariate analysis of over 1000 patients. \nHum Reprod. 2007 Jan;22(1):266–71.  \nVercellini P, Somigliana E, Viganò P, Abbiati A, Barbara G, Crosignani PG. \nEndometriosis: current therapies and new pharmacological developments. Drugs. \n2009;69(6):649–75.  \nVercellini P, Viganò P, Somigliana E, Fedele L. Endometriosis: pathogenesis and \ntreatment. Nat Rev Endocrinol. 2014 May;10(5):261–75.  \nVerthelyi D. Sex hormones as immunomodulators in health and disease. \nInternational Immunopharmacology. 2001 Jun 1;1(6):983–93.  \nVetvicka V, Laganà AS, Salmeri FM, Triolo O, Palmara VI, Vitale SG, et al. \nRegulation of apoptotic pathways during endometriosis: from the molecular basis \nto the future perspectives. Arch Gynecol Obstet. 2016;294(5):897–904.  \nVigano P, Candiani M, Monno A, Giacomini E, Vercellini P, Somigliana E. Time \nto redefine endometriosis including its pro- fibrotic nature. Hum Reprod. 2018 \n01;33(3):347–52.  \nWalankiewicz M, Grywalska E, Polak G, Korona-Glowniak I, Witt E, Surdacka A, \net al. The Increase of Circulating PD -1- and PD-L1-Expressing Lymphocytes in \nEndometriosis: Correlation with Clinical and Laboratory Parameters. Mediators \nInflamm. 2018;2018:7041342.  \nWaller KG, Lindsay P, Curtis P, Shaw RW. The prevalence of endometriosis in \nwomen with infertile partners. Eur J Obstet Gynecol Reprod Biol. 1993 \nFeb;48(2):135–9.  \nWang ML, Rule S, Martin P, Goy A, Auer R, Kahl BS, et al. Targeting BTK with \nibrutinib in relapsed or refractory mantle-cell lymphoma. N Engl J Med. 2013 Aug \n8;369(6):507–16.  \nWeber ANR, Bittner Z, Liu X, Dang T -M, Radsak MP, Brunner C. Bruton’s \nTyrosine Kinase: An Emerging Key Player in Innate Immunity. Front Immunol. \n2017;8:1454.  \nWeed JC, Arquembourg PC. Endometriosis: can it produce an autoimmune \nresponse resulting in infertility? Clin Obstet Gynecol. 1980 Sep;23(3):885–93.  \nWicks MJ, Larson CP. Histologic criteria for evaluating endometriosis. Northwest \nMed. 1949 Sep;48(9):611–3.  \n\n91 \n \nWild RA, Shivers CA. Antiendometrial antibodies in patients with endometriosis. \nAm J Reprod Immunol Microbiol. 1985 Jul;8(3):84–6.  \nWilson TJ, Hertzog PJ, Angus D, Munnery L, Wood EC, Kola I. Decreased natural \nkiller cell activity in endometriosis patients: relationship to disease pathogenesis. \nFertil Steril. 1994 Nov;62(5):1086–8.  \nWitz CA, Montoya IA, Dey TD, Schenken RS. Characterization of lymphocyte \nsubpopulations and T cell activation in endometriosis. Am J Reprod Immunol. \n1994 Oct;32(3):173–9.  \nWoyach JA, Johnson AJ, Byrd JC. The B -cell receptor signaling pathway as a \ntherapeutic target in CLL. Blood. 2012 Aug 9;120(6):1175–84.  \nWu M-H, Shoji Y, Wu M-C, Chuang P-C, Lin C-C, Huang M-F, et al. Suppression \nof matrix metalloproteinase-9 by prostaglandin E(2) in peritoneal macrophage is \nassociated with severity of endometriosis. Am J Pathol. 2005 Oct;167(4):1061 –\n9.  \nWu MY, Yang JH, Chao KH, Hwang JL, Yang YS, Ho HN. Increase in the \nexpression of killer cell inhibitory receptors on peritoneal natural killer cells in \nwomen with endometriosis. Fertil Steril. 2000 Dec;74(6):1187–91.  \nXia S, Liu X, Cao X, Xu S. T-cell expression of Bruton’s tyrosine kinase promotes \nautoreactive T -cell activation and exacerbates aplastic anemia. Cellular & \nMolecular Immunology. 2020 Oct;17(10):1042–52.  \nYang JZ, Agarwal SK, Foster WG. Subchronic Exposure to 2,3,7,8-\nTetrachlorodibenzo-p-dioxin Modulates the Pathophysiology of Endometriosis in \nthe Cynomolgus Monkey. Toxicological Sciences. 2000 Aug 1;56(2):374–81.  \nYeol SG, Won YS, Kim YI, Lee JW, Choi YJ, Park DC. Decreased Bcl -6 and \nincreased Blimp-1 in the peritoneal cavity of patients with endometriosis. Clin Exp \nObstet Gynecol. 2015;42(2):156–60.  \nYuan M, Li D, An M, Li Q, Zhang L, Wang G. Rediscovering peritoneal \nmacrophages in a murine endometriosis model. Hum Reprod. 2017;32(1):94–\n102.  \nZarmakoupis PN, Rier SE, Maroulis GB, Becker JL. Inhibition of human \nendometrial stromal cell proliferation by interleukin 6. Hum Reprod. 1995 \nSep;10(9):2395–9.  \nZhang RJ, Wild RA, Ojago JM. Effect of tumor necrosis factor-alpha on adhesion \nof human endometrial stromal cells to peritoneal mesothelial cells: an in vitro \nsystem. Fertil Steril. 1993 Jun;59(6):1196–201.  \nZhang Z, Bridges SL. PATHOGENESIS OF RHEUMATOID ARTHRITIS: Role of \nB Lymphocytes. Rheumatic Disease Clinics of North America. 2001 May \n1;27(2):335–53. \n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \nAPPENDIXES \n\n5\nImmunology of endometriosis\nLuiza da Gama Coelho Riccio, MD a, c, *,\nPietro Santulli, MD, PhD b, c, Louis Marcellin, MD, PhD b, c,\nMauricio Sim ~oes Abr ~ao, MD, PhD, Professor a,\nFrederic Batteux, MD, PhD, Professor c, d,\nCharles Chapron, MD, PhD, Professor b, c\na Endometriosis Division, Obstetrics and Gynecology Department, Hospital das Clinicas, School of Medicine,\nUniversity of S ~ao Paulo (USP), S ~ao Paulo, Brazil\nb Universit/C19e Paris Descartes, Sorbonne Paris Cit /C19e, Facult /C19ed eM /C19edecine, Assistance Publique - H ^opitaux de\nParis (AP-HP), H ^opital Universitaire Paris Centre (HUPC), Centre Hospitalier Universitaire (CHU) Cochin,\nDepartment of Gynecology Obstetrics II and Reproductive Medicine, Paris, France\nc Department of Development, Reproduction and Cancer, Institut Cochin, INSERM U1016, Equipe Pr Batteux,\nUniversit/C19e Paris Descartes, Sorbonne Paris Cit /C19e, Paris, France\nd Department of Immunology, H ^opital Cochin, AP-HP, Paris, France\nKeywords:\nEndometriosis\nImmunology\nPathogenesis\nInflammation\nabstract\nThe pathophysiology of endometriosis is not completely under-\nstood, but an aberrant immune response in the peritoneal envi-\nronment seems to be crucial for the proliferation of ectopic\nendometrial cells e as those cells escape apoptosis and peritoneal\ncavity immunosurveillance. The growth of endometrial implants\nleads to the recruitment of a large number and diversity of im-\nmune cells and intense in flammation with increased pro-\ninflammatory cytokines, growth factors, and angiogenesis. There\nis substantial evidence of aberrant function of almost all types of\nimmune cells in women with endometriosis: decreased T cell\nreactivity and NK cytotoxicity, polyclonal activation of B cells and\nincreased antibody production, increased number and activation of\nperitoneal macrophages, and changes in in flammatory mediators.\nNew clinical treatments for endometriosis are an urgent need,\nespecially nonhormonal drugs. The study of immunology may\n* Corresponding author. Av. Dr. En /C19eas de Carvalho Aguiar, 255, Cerqueira C /C19esar CEP 05403-000, S ~ao Paulo, Brazil.\nE-mail addresses: luiza.riccio@gmail.com (L.G.C. Riccio), pietro.santulli@aphp.fr (P. Santulli), louis.marcellin@gmail.com\n(L. Marcellin), msabrao@mac.com (M.S. Abr ~ao), frederic.batteux@aphp.fr (F. Batteux), charles.chapron@aphp.frs (C. Chapron).\nContents lists available at ScienceDirect\nBest Practice & Research Clinical\nObstetrics and Gynaecology\njournal homepage: www.elsevier.com/locate/bpobgyn\nhttps://doi.org/10.1016/j.bpobgyn.2018.01.010\n1521-6934/© 2018 Elsevier Ltd. All rights reserved.\nBest Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49\n\nclarify its role in the pathogenesis of endometriosis and contribute\nto the development of new therapeutic strategies.\n© 2018 Elsevier Ltd. All rights reserved.\nEndometriosis is a hormono-dependent in flammatory gynecological disease whose pathophysi-\nology is not completely understood. A peritoneal environment that allows the proliferation of ectopic\nendometrial cells associated with an aberrant immune response seems to contribute to the develop-\nment of the disease. Although several immunological abnormalities have already been reported, the\nrole of the immune system in endometriosis is not well established [1].\nDisturbances in immune homeostasis are associated with increase in implantation, proliferation,\nand angiogenesis of the ectopic endometrial tissue [2]. However, it is not clear whether the modi fi-\ncations of the immune response lead to the development of the disease or if they are consequences of\nthe ectopic endometrial growth [3].\nThe study of immunological dysfunctions in the context of endometriosis may help in under-\nstanding its role in the pathogenesis of the disease and could contribute to the development of new\ntherapeutic strategies in the future.\nImmunosurveillance: importance of immunological disorders in the survival and proliferation\nof ectopic endometrial cells\nOne of the main theories of the pathogenesis of endometriosis is the retrograde menstruation e the\ndissemination of endometrial cells through the uterine tubes e first described by Sampson (1927) [4].\nHowever, it is known that this phenomenon occurs in most women of reproductive age, but not all of\nthem develop the disease. Once they reach the peritoneal cavity, the endometrial cells in healthy\nwomen do not implant and are eliminated by an “immunosurveillance” system through apoptosis [3].\nIt was proposed that, in women with endometriosis, changes in cell-mediated and humoral immunity\nmay contribute to the development of the disease [5]. These changes probably prevent the clearance of\nthe endometrial cells that reach the peritoneal cavity and allow their implantation and development[3].\nThe exact mechanisms of immunosurveillance evasion by ectopic endometrial cells remain unclear,\nand some hypotheses have been formulated to explain this phenomenon. The production of proteins\nby the implants e such as the soluble form of the ICAM (intercellular adhesion molecule)-1, the sICAM-\n1 e could interfere in their recognition by the leukocytes. It has been described that the expression of\nICAM-1 mRNA and the secretion of sICAM-1 are increased in endometriotic stromal cells compared to\nthose in stromal cells from eutopic endometrium. The circulating sICAM-1 binds to leukocyte function\nantigen-1 (LFA-1) and makes leukocytes less available to recognize the aberrant endometrial cells\nthrough their cell surface ICAM-1 [6].\nDysfunctional cells are eliminated by apoptosis in the normal endometrium as part of a tissue repair\nmechanism during each menstrual cycle. This normal mechanism of programmed cell death does not\noccur in ectopic endometrial cells that reach the peritoneal cavity. The overexpression of antiapoptotic\nfactors and decreased expression of proapoptotic factors [7] may interfere in peritoneal homeostasis\nand contribute to the development of the disease.\nThe Fas-FasL and TNF-\na apoptosis pathways seem to play a key role in the immunosurveillance of\nthe peritoneal microenvironment [8]. It was shown that the peritoneal environment in endometriosis\ninduces FasL expression in stromal cells, leading to a Fas-mediated apoptosis of activated immune cells\nthat express Fas (T cells and NK cells), as a mechanism of immunosurveillance escape [9]. The regu-\nlation of apoptosis can be a target for the treatment of endometriosis. It has been shown that the use of\nGnRH analogs increases the expression of the proapoptotic protein Bax and decreases the expression of\nthe antiapoptotic protein Bcl-2 [10].\nIt has been suggested that endometrial stromal cells are involved in cellular adhesion to the\nintraperitoneal surface, whereas glandular epithelial cells play a role in invasion and growth of the\nlesion [1 1]. Anomalous expressions of various matrix metalloproteinases seem to be responsible for an\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e4940\n\nincreased proteolytic capacity in endometriosis [1 1]. Genetic polymorphisms of matrix metal-\nloproteinase were associated with disease progression, as the combined polymorphisms of genes 12\nand 13 seem to protect from deep in filtrating endometriosis [12].\nThe growth of the ectopic endometrial implants leads to the recruitment of immune cells and an\nintense in flammatory response, with increased proin flammatory cytokines, growth factors, and\nangiogenesis. In addition, a mechanism of mobilization of fibroblasts and proliferation of connective\ntissue is activated to attempt to heal the injury [3].\nEndometriosis is a chronic in flammatory disease, and in flammation plays a key role through\nmitogen-activated protein kinase (MAPK) signaling pathways [13]. Increased cyclooxygenase-2 (COX-\n2), interleukins, and oxidative stress act through the MAPK pathways [13]. MAPK are dysregulated in\nendometriotic lesions, and it was shown that their inhibitors can control the disease progression both\nin vitro and in animal models [14]. However, the use of MAPK inhibitors in the treatment of endo-\nmetriosis is still limited owing to their teratogenicity and speci fic adverse side effects [13].\nThe MAPK pathway can increase in flammation and endometriosis clinic repercussion by recruit-\nment of immune cells and ampli fication of the in flammatory response [15], generation of an anti-\napoptotic signal [16], increased growth factor expression leading to angiogenesis [17], playing a role in\nthe development of pain and hypersensitivity to pain [18] or acting as intracellular and extracellular\nsignal transducers in endometriotic cells [13].\nFunctional changes in the immunological components of the peritoneal fluid of women with\nendometriosis have been described, such as in monocytes/macrophages, natural killer (NK) cells, T\nlymphocytes, B cells, and cytokines [19]. However, the role of these alterations in the development of\nthe disease has not been clari fied [20].\nInnate immunity: the role of macrophages and NK cells\nMacrophages\nIn the peritoneal fluid, macrophages are the most prevalent type of immune cells [19], and their\nnumber and activation are increased in endometriosis [21], as well as their production of cytokines\n[22,23].\nThe activated macrophages can regulate the peritoneal environment by phagocytosis that removes red\nblood cells, damaged tissue fragments, and cellular debris[22] or by the production of soluble mediators\nlike cytokines, prostaglandins, complement components, and enzymes. Through the secretion of these\nimmune mediators, the macrophages can induce inflammation, tissue repair, and neovascularization and\nmay favor the recruitment offibroblasts and endothelial cells[21,24]. The macrophage-derived cytokines\nstimulate the activation of other immune cells such as T and B lymphocytes.\nDespite the increased activation, the phagocytic activity of the macrophages is reduced in endo-\nmetriosis [22], as they fail to eliminate the ectopic endometrial cells that reach the cavity through\nretrograde menstruation. The phagocytosis is regulated through expression of CD36 receptor and\nactivation of matrix metalloproteinases, and both mechanisms are suppressed by prostaglandin E2,\nwhich are overexpressed in patients with endometriosis [25].\nThe scavenger function of the peritoneal macrophages depends on their attachment to extracellular\nmatrix components. Increased nonadherent macrophages have been described in the peritoneal fluid\nof women with endometriosis, suggesting a defective scavenger function that could lead to the survival\nof ectopic endometrial cells [23].\nIn addition to the reduction of phagocytosis ability of macrophages, the amount of regurgitated\nendometrial cells in the peritoneal cavity may be higher than the capacity of the macrophages to\nremove them. This factor could contribute to the adhesion and proliferation of these cells and devel-\nopment of the disease [2].\nMacrophages exhibit a phenotypic plasticity in their various microenvironments and are classi fied\nas two main groups, with different functions [26]: The M1 macrophages, which produce high quan-\ntities of inflammatory cytokines and are specialized in the elimination of microorganisms and defective\ncells, and the M2 macrophages, which modulate adaptive immune response, promote angiogenesis\nand tissue repair, and scavenge cellular debris.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49 41\n\nAn imbalance in M1 macrophages was shown in the eutopic endometrium of women with endo-\nmetriosis [27]. However, M2 CD163 þ/CD206þ macrophages are signi ficantly upregulated in the peri-\ntoneum and lesions of women [28] and rhesus macaques with the disease [29]. Experiments with\nmacrophage depletion further demonstrated the key role of M2 macrophages in endometriotic\ngrafting, development, and persistence [28,30]. In addition, selective adoptive transfer of M2 macro-\nphages indicated that they promote endometriosis progression [28].\nA recent study [31] evaluated the imbalance in macrophage subtypes in a murine model of endo-\nmetriosis, considering the classi fication in large peritoneal macrophages (LPMs) and small peritoneal\nmacrophages (SPMs). The authors have shown an increased proportion of SPMs and an opposite trend\nfor the LPMs. They proposed that this new classi fication of macrophages should be included in further\nstudies in endometriosis field.\nTo summarize, the macrophages play a key role in the development of endometriosis once they fail\nto eliminate the ectopic endometrial cells that reach the peritoneal cavity by retrograde menstruation.\nIn addition, production of in flammatory mediators by macrophages contributes to the implantation\nand proliferation of endometrial cells, resulting in the development of endometriotic lesions [32].\nNK cells\nNK cells are lymphocytes of the innate immune system that can kill an array of target cells and\nsecrete cytokines that participate in the shaping of the adaptive immune response and tissue repair. A\nfeature of NK cells resides in their capacity to distinguish stressed cells that have undergone some\ndegree of injuries from normal cells.\nThe NK cell detection system includes a variety of cell surface activating (KAR) and inhibitory (KIR)\nreceptors, the engagement of which regulates NK cell activities. Among the cell surface activating\nreceptors, two main receptors can be distinguished: NKG2D and CD16 (Fc gRIIIa). The latter has the\nability to bind and destroy immunoglobulin G (IgG)-coated stressed cells by a mechanism called\nantibody-dependent cell-mediated cytotoxicity. In addition, the cytotoxic activity of the NK cells can be\nincreased by cytokines such as interleukin-2 (IL-2) [3].\nEctopic endometrial cells that reach the peritoneal cavity achieve to escape the clearance and are not\ntargeted or removed by NK cells in a not completely understood mechanism called“immunoescaping” [8].\nA decreased NK cell cytotoxic activity against endometrial cells in women with endometriosis wasfirst\ndescribed by Oosterlynck et al. (1991) [33] and has been well established since then [34], and it is\ncorrelated to the advanced stages of the disease [35]. It is more evident for NK cells from the peritoneal\ncavity [35,36], of women with endometriosis but is also observed for NK cells in the peripheral blood[35].\nDespite the decreased NK cell function in endometriosis, the mechanisms of this suppression are\nnot clear. There is also no consensus regarding the percentage or number of NK cells in endometriosis\nboth in the blood and in the peritoneal cavity [33,37]. Qualitatively, an increased expression of KIR on\nperitoneal NK cells from women with endometriosis was reported, which could explain the decreased\nperitoneal NK cell activity in these patients [38].\nA decreased cytotoxic function of NK cells could explain the immunoescaping mechanism of\nendometrial cells, leading to their adhesion and proliferation and resulting in endometriotic lesions.\nHowever, it is also possible that this aberrant NK cell function is a consequence of the chronic in-\nflammatory environment provided by the disease [39,40].\nGonz/C19alez-Foruria et al. (2015) [41] evaluated ligands for NKG2D (a NK cell receptor that triggers a\ncytotoxic response that activates NK cells) in the peritoneal fluid of women with endometriosis. The\nauthors demonstrated a signi ficant increase in soluble NKG2D ligands, which means a lower expres-\nsion of these ligands in ectopic endometrial cell surface, and as these soluble NKG2D ligands act as\ndecoy receptors heading toward greater evasion from NK cell recognition.\nMacrophage-derived factors such as prostaglandins and cytokines produced in this environment\nmay also modulate NK activity. This hypothesis is corroborated by studies showing the suppression of\nNK cytotoxic activities by serum and peritoneal fluids of women with endometriosis compared to fluids\nfrom control patients [35].\nIt has been shown that NK cells are important for the interface between innate and adaptive im-\nmune response and that they have different subtypes. The NK T cells represent 15 e20% of these cells\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e4942\n\nand express T-cell receptor (TCR) eCD3 membrane complex, in addition to classical CD 16 expression.\nThey can both kill target cells and secrete cytokines such as IL-4 and IL-10 e which are important in the\ncontrol of autoimmunity [42].\nNK cells contribute to the balance of immune self-tolerance by targeting cells that present self-\nantigens. Therefore, their reduced activity in endometriosis could explain the increased autoim-\nmune reactivity observed in the disease [2].\nAdaptive immunity: T and B lymphocytes\nCell-mediated immunity: T lymphocytes\nThe B and T lymphocytes are essential subsets for adaptive immunity, which play an essential role in\nthe survival and proliferation of endometrial cells. Indeed, endometriosis is characterized by the\nreduced activity of cytotoxic T cells, the modulation of cytokine secretion by T helper cells, and\nautoantibody production by B lymphocytes [22,43].\nT lymphocytes are derived from stem cells in the bone marrow and in the fetal liver, and they\nmigrate to the thymus to complete their development. They are classi fied as several subtypes. The two\nmain groups are those that express the glycoproteins CD4 and CD8, which function as co-receptors for\nMHC class II and class I molecules, respectively [3,44].\nThe CD4 T cells can be classi fied in Th1 and Th2, with different functions: Th1 cells promote the\ndifferentiation of the CD8 cells and facilitate cell-mediated immunity by activating monocytes and\nmacrophages; Th2 cells lead to the differentiation of B cells into plasma cells that secrete antibodies.\nThe CD8 T cells can activate macrophages and kill cells that are infected by virus or intracellular\npathogens [3,44]. The two groups of lymphocytes secrete different cytokines: Th1: IL-2, IL-12, inter-\nferon (IFN)-g, tumor necrosis factor (TNF)- a and TNF-b; Th2: IL-4, IL-5, IL-6, IL-10, and IL-13 [20].\nStudies that have evaluated T lymphocytes in patients with endometriosis showed higher CD4/CD8\nratio and increased concentration of each subset in the peritoneal fluid of the patients, but with a\nrelative reduction in Th1 cells [36]. The endometriotic lesions showed higher concentration of T\nlymphocytes when compared to that in the eutopic endometrium, but with a similar CD4/CD8 ratio.\nThere were no changes in the peripheral blood [3,44]. Endometriotic lesions also showed higher Th1 7\nlymphocyte fraction when compared to eutopic endometrium [45].\nThe mechanism of implantation of the ectopic endometrial cells in the peritoneal cavity depends on\naltered macrophages. These cells also produce in flammatory cytokines that recruit and activate Th1\nand Th2 T cells [36].\nAnother important subset of the T lymphocytes is the regulatory T cells (Treg). They are potent\nsuppressors of in flammatory immune responses and are responsible for maintaining antigen-speci fic\nT-cell tolerance and immune homeostasis. A recent systematic review [46] evaluated the role of Treg in\nendometriosis. The authors concluded that in the peritoneal fluid and in the endometriotic lesions of\nwomen with endometriosis, there is a higher concentration of Treg cells and/or their expression\nmarkers, when compared with those in controls. However, there is no consensus about the concen-\ntration of Treg cells in the eutopic endometrium and peripheral blood of these patients.\nHumoral immunity: B lymphocytes and antibodies\nEven though immunosurveillance seems to have a defect in endometriosis, some aspects of the\nimmune system are upregulated, such as the widespread polyclonal activation of B cells [47]. B lym-\nphocytes produce antibodies against antigens, and they seem to contribute to the pathogenesis of\nendometriosis through secretion of autoantibodies [48].\nStartseva (1980) [44] first described an increased reactivity of B cells in endometriosis. The same\nyear, another study demonstrated IgG and complement deposits in the endometrium and decreased\nserum complement, suggesting an autoimmune response with complement consumption by the an-\ntigen-antibody complex in patients with endometriosis [49].\nA few years later, the presence of antiendometrial antibodies in the serum of women with endo-\nmetriosis was described [50]. Immunohistochemistry demonstrated that these antibodies could bind\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49 43\n\nto topic and ectopic endometrial tissues [51]. Bohler et al. (2007) [52] evaluated the presence and\nreactivity of IgG in the serum of women with endometriosis against antigens (derived from the\nmembrane, nucleus, and cytosol) from endometrial and ovarian cells. There was a signi ficantly higher\nlevel of autoantibodies in patients with endometriosis, when compared to that in controls, and the\nintensity of the reaction increased with disease progression.\nChishima et al. (2000) [53] proposed possible common alterations between endometriosis and\nautoimmune diseases: increased B-1 B cells in the peritoneal flu i da n dBc e l lp r o d u c t i o no f\nANA in the serum of women with endometriosis. However, despite the similarities, it is not\npossible to consider endometriosis as an autoi mmune disease yet. Even if there is a genetic\ncomponent in endometriosis, a speci fic association with HLA alleles has not been demonstrated\nso far [54],n o rt h es p e c i fic activation of complement in the endometrium of women with\nendometriosis [55].\nMoreover, polyclonal B cell activation, B-1 cell proliferation, and autoantibodies production may be\nassociated with infertility in these patients [53]. An increased number of B lymphocytes was also\nobserved in the follicular fluid of infertile patients with endometriosis, and it was suggested that this\ncould contribute to endometriosis-related infertility [56].\nSome authors have described increased B cells in patients with endometriosis with an inversed\ncorrelation with the severity of the disease, suggesting that mild endometriosis (Stages I and II) may be\nimmunologically more active than severe endometriosis (Stages III and IV) [57].\nHigh levels of cytokines that activate B cells were observed in endometriotic lesions, such as BLyS (B\nlymphocyte stimulator) [58]. This molecule is produced by macrophages and stimulates the devel-\nopment and differentiation of B lymphocytes into plasma cells [59]. Increased BLyS was also described\nin patients with autoimmune diseases and could be a target for therapeutic strategies for diseases with\nB cell defects [60]. Interestingly, heterozygosity for the BLyS 817C/T polymorphism was associated with\nreduced risk of deep in filtrating endometriosis [61].\nA recent review [62] evaluated 22 studies concerning the role of B lymphocytes in endometriosis,\nand almost all of them reported increased number and activation and/or production of antibodies by B\ncells. It seems that B cells play a role in the pathogenesis of endometriosis; however, further studies are\nnecessary to better understand this association.\nInflammatory mediators: cytokines, chemokines, and growth factors\nIncreased soluble factors such as autoantibodies, cytokines, growth factors, adhesion molecules,\nenzymes, hormones, prostaglandins, and reactive oxygen species [16,21,63e66], have been described\nin the blood, peritoneal fluid, and lesions of patients with endometriosis. This fact is probably a\nconsequence of the high number of leukocytes, macrophages, and other immune cells in the peritoneal\ncavity of these patients.\nThese proteins work as mediators of the immune system [67], regulating the proliferation and the\ndifferentiation of immune cells, the release of enzymes and acute phase proteins, immunoglobulin\nsecretion, and the cytotoxic activities of immune cells [20].\nStudies have shown that the higher concentration of inflammatory mediators in the peritoneal fluid\nin endometriosis has toxic effects on oocyte pick up by the fimbria, sperm eoocyte interaction, and\nembryo implantation, leading to an aberrant reproductive function in these women. These effects were\nreversed during hormonal treatment [3].\nMany cytokines e IL-1 [68,69], IL-4 [70], IL-6 [71], IL-8 [72,73], IL-10 [36], IL-33 [74], and TNFa [75] e\nand growth factors e transforming growth factor (TGF- b) [71], insulin-like growth factor (IGF-1)\n[76,77], hepatocyte growth factor (HGF) [78], epidermal growth factor (EGF) [79], platelet-derived\ngrowth factor (PDGF) [80,81], and vascular endothelial growth factor (VEGF) [24,82]e are signi fi-\ncantly increased in endometriosis [83]. In addition, studies have shown that there are changes in the\nTh1/Th2 balance toward Th2 in endometriosis [22,43].\nIn endometriotic lesions, VEGF induces angiogenesis and its immunostaining was observed in the\nepithelium of endometriotic implants [84], particularly in hemorrhagic red implants [85]. VEGF is also\nincreased in the peritoneal fluid of women with endometriosis [47]. However, is not yet clari fied\nwhether it is produced by endometriotic lesions [84,86], or by activated peritoneal macrophages [24].\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e4944\n\nInterleukin (IL)-6 is one of the main cytokines in the in flammatory cascade in endometriosis. It is\nelevated in the peritoneal cavity and blood of these patients, and it is correlated with disease activity\n[64,87]. IL-10 is also a potent modulator of in flammatory responses and immune cell function e as B\ncells and macrophages e so it is likely that both IL-6 and IL-10 are partially responsible for the aberrant\nimmune regulation observed in endometriosis [20].\nIL-6 can inhibit the proliferation of endometrial stromal cells [88], but it has been shown that in\nendometriotic lesions, these cells are resistant to IL-6, showing no inhibitory response [89,90]. This\ncytokine induces T cell activation and differentiation of B lymphocytes into antibody-producing plasma\ncells, and it can lead to polyclonal B cell stimulation in autoimmune diseases [3]. IL-1 is another\ncytokine that affects B cells and production of antibodies in addition to increasing prostaglandins,\ncollagen, and tissue repair [5,19].\nIL-1 and TNF- a usually initiate the cascade of cytokines and in flammatory response. TNF- a is\nincreased in the peritoneal fluid of women with endometriosis, and it has higher concentrations in the\nlater stages of the disease [91]. It has been suggested that it may contribute to the adhesion of\nendometrial cells to the peritoneal cavity [92].\nIL-8 is also increased in endometriosis [72,73]. IL-8 contributes to cell adhesion [65] and is a potent\nangiogenic factor [3]. IL-8 stimulates the growth of topic and ectopic endometrial cells [73], probably\nthrough TNF- a activation [93]. It is produced by the mesothelium as a response to proin flammatory\ncytokine stimuli. IL-8 levels can be correlated to the severity of the disease [72].\nConcerning the IL-10 family, it was demonstrated that IL-19 and IL-22 are both signi ficantly\ndecreased in the sera of women with ovarian endometrioma without deep in filtrating endome-\ntriosis [94]. In addition, there was a reverse correlation between levels of these cytokines and the\noccurrence of deep dyspareunia in those pati ents. The authors concluded that these anti-\ninflammatory cytokines exert immunosuppressive effects favorable to the development of\novarian endometrioma.\nIL-13 is another anti-inflammatory cytokine that was shown to be decreased in endometriosis. It is a\npotent regulator of macrophage activation; hence, its reduction in the peritoneal fluid of women with\nendometriosis could contribute to the pathogenesis of the disease [95].\nFig. 1. Immune response in endometriosis.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49 45\n\nThe cytokine production in the immune system works in a cascade mode, the biosynthesis of one\ntype of cytokine activates the production of a whole group of inflammatory mediators. In addition, each\ncytokine has different target tissues and biologic effects, which makes more dif ficult to clarify the role\nof a speci fic mediator in the development of endometriosis. It has also been shown that they can be\nproduced by endometriotic cells, mesothelium, and other resident cells in the peritoneal cavity [87,96].\nCytokines are also deregulated in the peripheral blood of women with endometriosis, suggesting a\nsystemic effect of the disease [3,94,97].\nSummary\nEven if the pathophysiology of endometriosis is not completely understood, it is well established\nthat the immune system plays a key role in this disease. There is substantial evidence of aberrant\nfunction of almost all types of immune cells in women with endometriosis with decreased T cell\nreactivity and NK cytotoxicity, polyclonal B cells activation and increased antibody production,\nincreased number and activation of peritoneal macrophages, and changes in in flammatory mediators\n(Fig. 1). In addition, some alterations are similar to those observed in autoimmune diseases [23].\nNew clinical treatments for endometriosis are an urgent need, especially nonhormonal drugs. Most\nof the current therapies are contraceptive, and women with endometriosis may have to choose be-\ntween managing the pain and trying to conceive [62].\nThe ability of ectopic endometrial cells to escape apoptosis and cell-mediated destruction to later\nachieve peritoneal adhesion and invasion may be a target to new nonhormonal therapies for endo-\nmetriosis. However, these mechanisms should be more deeply understood to make possible the design\ntherapeutic strategies [3].\nConflicts of interest\nThe authors certify that they have no af filiations with or involvement in any organization or entity\nwith any financial interest or non financial interest in the subject matter or materials discussed in this\nmanuscript.\nPractice points\n/C15 The physiopathology of endometriosis is not completely understood. There seems to be a\nperitoneal environment that allows the proliferation of ectopic endometrial cells associated\nwith an aberrant immune response.\n/C15 There is substantial evidence of aberrant function of almost all types of immune cells in\nwomen with endometriosis: decreased T cell reactivity and NK cytotoxicity; polyclonal acti-\nvation of B cells and increased antibody production; increased number and activation of\nperitoneal macrophages; and changes in inflammatory mediators.\n/C15 New clinical treatments for endometriosis are an urgent need, especially nonhormonal\ndrugs. The study of immunology may clarify its role in the pathogenesis of endometriosis\nand contribute to the development of new therapeutic strategies.\nResearch agenda\n/C15 Further studies of the immunology of endometriosis could help clarifying the pathophysi-\nology of the disease and lead to the development of new treatments.\n/C15 The ability of ectopic endometrial cells to escape apoptosis and cell-mediated destruction to\nlater achieve peritoneal adhesion and invasion may be a target to new nonhormonal ther-\napies for endometriosis. However, these mechanisms should be more deeply understood to\nmake possible the design of therapeutic strategies.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e4946\n\nAcknowledgements\nThe authors are grateful to all the members of the Obstetrics and Gynecology Department of\nUniversity of S ~ao Paulo, Brazil, and INSERM U1016-Batteux, Institut Cochin, France.\nReferences\n[1] Christodoulakos G, Augoulea A, Lambrinoudaki I, Sioulas V, Creatsas G. Pathogenesis of endometriosis: the role of\ndefective 'immunosurveillance'. Eur J Contracept Reprod Health Care 2007;12(3):194 e202.\n*[2] Matarese G, De Placido G, Nikas Y, Alviggi C. Pathogenesis of endometriosis: natural immunity dysfunction or autoim-\nmune disease? Trends Mol Med 2003;9(5):223 e8.\n*[3] Paul Dmowski W, Braun DP. Immunology of endometriosis. Best Pract Res Clin Obstet Gynaecol 2004;18(2):245 e63.\n[4] Sampson JA. Metastatic or embolic endometriosis, due to the menstrual dissemination of endometrial tissue into the\nvenous circulation. Am J Pathol 1927;3(2). 93 e110 4 3.\n[5] Senturk LM, Arici A. Immunology of endometriosis. J Reprod Immunol 1999;43(1):67 e83.\n[6] Vigano P, Gaffuri B, Somigliana E, Busacca M, Di Blasio AM, Vignali M. Expression of intercellular adhesion molecule\n(ICAM)-1 mRNA and protein is enhanced in endometriosis versus endometrial stromal cells in culture. Mol Hum Reprod\n1998;4(12):1 150e6.\n[7] Tosti C, Pinzauti S, Santulli P, Chapron C, Petraglia F. Pathogenetic mechanisms of deep in filtrating endometriosis. Reprod\nSci 2015;22(9):1053e9.\n[8] Vetvicka V, Lagana AS, Salmeri FM, Triolo O, Palmara VI, Vitale SG, et al. Regulation of apoptotic pathways during\nendometriosis: from the molecular basis to the future perspectives. Arch Gynecol Obstet 2016;294(5):897 e904.\n[9] Selam B, Kayisli UA, Garcia-Velasco JA, Arici A. Extracellular matrix-dependent regulation of Fas ligand expression in\nhuman endometrial stromal cells. Biol Reprod 2002;66(1):1 e5.\n[10] Bilotas M, Baranao RI, Buquet R, Sueldo C, Tesone M, Meresman G. Effect of GnRH analogues on apoptosis and expression\nof Bcl-2, Bax, Fas and FasL proteins in endometrial epithelial cell cultures from patients with endometriosis and controls.\nHum Reprod 2007;22(3):644 e53.\n*[1 1] Ahn SH, Monsanto SP, Miller C, Singh SS, Thomas R, Tayade C. Pathophysiology and immune dysfunction in endome-\ntriosis. BioMed Res Int 2015;2015:795976 .\n[12] Borghese B, Chiche JD, Vernerey D, Chenot C, Mir O, Bijaoui G, et al. Genetic polymorphisms of matrix metalloproteinase\n12 and 13 genes are implicated in endometriosis progression. Hum Reprod 2008;23(5):1207 e13.\n*[13] Santulli P, Marcellin L, Tosti C, Chouzenoux S, Cerles O, Borghese B, et al. MAP kinases and the in flammatory signaling\ncascade as targets for the treatment of endometriosis? Expert Opin Ther Targets 2015;19(1 1):1465 e83.\n[14] Leconte M, Santulli P, Chouzenoux S, Marcellin L, Cerles O, Chapron C, et al. Inhibition of MAPK and VEGFR by Sorafenib\ncontrols the progression of endometriosis. Reprod Sci 2015;22(9):1171 e80.\n[15] Kaminska B. MAPK signalling pathways as molecular targets for anti-in flammatory therapyefrom molecular mechanisms\nto therapeutic bene fits. Biochim Biophys Acta 2005;1754(1 e2):253e\n62.\n[16] Harada H, Quearry B, Ruiz-Vela A, Korsmeyer SJ. Survival factor-induced extracellular signal-regulated kinase phos-\nphorylates BIM, inhibiting its association with BAX and proapoptotic activity. Proc Natl Acad Sci U S A 2004;101(43):\n15313e7.\n[1 7] Hamden KE, Whitman AG, Ford PW, Shelton JG, McCubrey JA, Akula SM. Raf and VEGF: emerging therapeutic targets in\nKaposi's sarcoma-associated herpesvirus infection and angiogenesis in hematopoietic and nonhematopoietic tumors.\nLeukemia 2005;19(1):18e26.\n[18] Ji RR, Suter MR. p38 MAPK, microglial signaling, and neuropathic pain. Mol Pain 2007;3:33 .\n[19] Ho HN, Wu MY, Chao KH, Chen CD, Chen SU, Yang YS. Peritoneal interleukin-10 increases with decrease in activated CD4 þ\nT lymphocytes in women with endometriosis. Hum Reprod 1997;12(1 1):2528 e33.\n*[20] Gazvani R, Templeton A. Peritoneal environment, cytokines and angiogenesis in the pathophysiology of endometriosis.\nReproduction 2002;123(2):217e26.\n[21] Oral E, Olive DL, Arici A. The peritoneal environment in endometriosis. Hum Reprod Update 1996;2(5):385 e98.\n*[22] Kralickova M, Vetvicka V. Immunological aspects of endometriosis: a review. Ann Transl Med 2015;3(1 1):153 .\n*[23] Berkkanoglu M, Arici A. Immunology and endometriosis. Am J Reprod Immunol 2003;50(1):48 e59.\n[24] McLaren J. Vascular endothelial growth factor and endometriotic angiogenesis. Hum Reprod Update 2000;6(1):45 e55.\n[25] Wu MH, Shoji Y, Wu MC, Chuang PC, Lin CC, Huang MF, et al. Suppression of matrix metalloproteinase-9 by prostaglandin\nE(2) in peritoneal macrophage is associated with severity of endometriosis. Am J Pathol 2005;167(4):1061 e9.\n[26] Cominelli A, Gaide Chevronnay HP, Lemoine P, Courtoy PJ, Marbaix E, Henriet P. Matrix metalloproteinase-27 is expressed\nin CD163þ/CD206þ M2 macrophages in the cycling human endometrium and in super ficial endometriotic lesions. Mol\nHum Reprod 2014;20(8):767e75.\n[27] Takebayashi A, Kimura F, Kishi Y, Ishida M, Takahashi A, Yamanaka A, et al. Subpopulations of macrophages within\neutopic endometrium of endometriosis patients. Am J Reprod Immunol 2015;73(3):221 e31.\n[28] Bacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, Camisa B, et al. Macrophages are alternatively activated in\npatients with endometriosis and required for growth and vascularization of lesions in a mouse model of disease. Am J\nPathol 2009;175(2):547e56.\n[29] Smith KA, Pearson CB, Hachey AM, Xia DL, Wachtman LM. Alternative activation of macrophages in rhesus macaques\n(Macaca mulatta) with endometriosis. Comp Med 2012;62(4):303 e10.\n[30] Haber E, Danenberg HD, Koroukhov N, Ron-El R, Golomb G, Schachter M. Peritoneal macrophage depletion by liposomal\nbisphosphonate attenuates endometriosis in the rat model. Hum Reprod 2009;24(2):398 e407.\n[31] Yuan M, Li D, An M, Li Q, Zhang L, Wang G. Rediscovering peritoneal macrophages in a murine endometriosis model. Hum\nReprod 2017;32(1):94e102.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49 47\n\n[32] Haney AF, Muscato JJ, Weinberg JB. Peritoneal fluid cell populations in infertility patients. Fertil Steril 1981;35(6):696 e8.\n[33] Oosterlynck DJ, Cornillie FJ, Waer M, Vandeputte M, Koninckx PR. Women with endometriosis show a defect in natural\nkiller activity resulting in a decreased cytotoxicity to autologous endometrium. Fertil Steril 1991;56(1):45 e51.\n[34] Wilson TJ, Hertzog PJ, Angus D, Munnery L, Wood EC, Kola I. Decreased natural killer cell activity in endometriosis pa-\ntients: relationship to disease pathogenesis. Fertil Steril 1994;62(5):1086 e8.\n[35] Oosterlynck DJ, Meuleman C, Waer M, Koninckx PR, Vandeputte M. Immunosuppressive activity of peritoneal fluid in\nwomen with endometriosis. Obstet Gynecol 1993;82(2):206 e12.\n[36] Ho HN, Wu MY, Yang YS. Peritoneal cellular immunity and endometriosis. Am J Reprod Immunol 1997;38(6):400 e12.\n[37] Hsu CC, Lin YS, Wang ST, Huang KE. Immunomodulation in women with endometriosis receiving GnRH agonist. Obstet\nGynecol 1997;89(6):993e8.\n[38] Wu MY, Yang JH, Chao KH, Hwang JL, Yang YS, Ho HN. Increase in the expression of killer cell inhibitory receptors on\nperitoneal natural killer cells in women with endometriosis. Fertil Steril 2000;74(6):1 187 e91.\n[39] Hill JA. Immunology and endometriosis. Fertil Steril 1992;58(2):262 e4.\n[40] Kikuchi Y, Ishikawa N, Hirata J, Imaizumi E, Sasa H, Nagata I. Changes of peripheral blood lymphocyte subsets before and\nafter operation of patients with endometriosis. Acta Obstet Gynecol Scand 1993;72(3):157 e61.\n[41] Gonzalez-Foruria I, Santulli P, Chouzenoux S, Carmona F, Batteux F, Chapron C. Soluble ligands for the NKG2D receptor are\nreleased during endometriosis and correlate with disease severity. PLoS One 2015;10(3). e01 19961 .\n[42] Moretta A. Natural killer cells and dendritic cells: rendezvous in abused tissues. Nat Rev Immunol 2002;2(12):957 e64.\n*[43] Osuga Y, Koga K, Hirota Y, Hirata T, Yoshino O, Taketani Y. Lymphocytes in endometriosis. Am J Reprod Immunol 201 1;\n65(1):1e10.\n[44] Startseva NV. Clinical immunological aspects of genital endometriosis. Akush Ginekol (Mosk) 1980;(3):23 e6.\n[45] Takamura M, Koga K, Izumi G, Hirata T, Harada M, Hirota Y, et al. Simultaneous detection and evaluation of four subsets of\nCD4þ T lymphocyte in lesions and peripheral blood in endometriosis. Am J Reprod Immunol 2015;74(6):480 e6.\n[46] de Barros IBL, Malvezzi H, Gueuvoghlanian-Silva BY, Piccinato CA, Rizzo LV, Podgaec S. What do we know about regu-\nlatory T cells and endometriosis? A systematic review. J Reprod Immunol 2017;120:48 e55.\n*[47] Lebovic DI, Mueller MD, Taylor RN. Immunobiology of endometriosis. Fertil Steril 2001;75(1):1 e10.\n[48] Straub RH. The complex role of estrogens in in flammation. Endocr Rev 2007;28(5):521 e74.\n[49] Weed JC, Arquembourg PC. Endometriosis: can it produce an autoimmune response resulting in infertility? Clin Obstet\nGynecol 1980;23(3):885e93.\n[50] Wild RA, Shivers CA. Antiendometrial antibodies in patients with endometriosis. Am J Reprod Immunol Microbiol 1985;\n8(3):84e6.\n[51] Fernandez-Shaw S, Hicks BR, Yudkin PL, Kennedy S, Barlow DH, Starkey PM. Anti-endometrial and anti-endothelial auto-\nantibodies in women with endometriosis. Hum Reprod 1993;8(2):310 e5.\n[52] Bohler HC, Gercel-Taylor C, Lessey BA, Taylor DD. Endometriosis markers: immunologic alterations as diagnostic in-\ndicators for endometriosis. Reprod Sci 2007;14(6):595 e604.\n[53] Chishima F, Hayakawa S, Hirata Y, Nagai N, Kanaeda T, Tsubata K, et al. Peritoneal and peripheral B-1-cell populations in\npatients with endometriosis. J Obstet Gynaecol Res 2000;26(2):141 e9.\n[54] Maxwell C, Kilpatrick DC, Haining R, Smith SK. No HLA-DR speci ficity is associated with endometriosis. Tissue Antigens\n1989;34(2):145e7.\n[55] Isaacson KB, Galman M, Coutifaris C, Lyttle CR. Endometrial synthesis and secretion of complement component-3 by\npatients with and without endometriosis. Fertil Steril 1990;53(5):836 e41.\n[56] Lachapelle MH, Hemmings R, Roy DC, Falcone T, Miron P. Flow cytometric evaluation of leukocyte subpopulations in the\nfollicular fluids of infertile patients. Fertil Steril 1996;65(6):1 135 e40.\n[57] Odukoya O, Bansal A, Cooke I. Serum endometrial IgG antibodies and soluble CD23 concentrations in patients with\nendometriosis. Acta Obstet Gynecol Scand 1996;75(10):927 e31.\n[58] Hever A, Roth RB, Hevezi P, Marin ME, Acosta JA, Acosta H, et al. Human endometriosis is associated with plasma cells and\noverexpression of B lymphocyte stimulator. Proc Natl Acad Sci U S A 2007;104(30):12451 e6.\n[59] Schiemann B, Gommerman JL, Vora K, Cachero TG, Shulga-Morskaya S, Dobles M, et al. An essential role for BAFF in the\nnormal development of B cells through a BCMA-independent pathway. Science 2001;293(5537):21 1 1 e4.\n[60] Krivosikova M, Dallos T, Maslinski W, Buc M. B cell activating factor, its role in autoimmunity, and targeting in auto-\nimmune diseases. Bratisl Lek Listy 2009;1 10(3):137 e45.\n[61] de Graaff AA, Dunselman GA, Delvoux B, van Kaam KJ, Smits LJ, Romano A. B lymphocyte stimulator -81 7C >T promoter\npolymorphism and the predisposition for the development of deep in filtrating endometriosis. Fertil Steril 2010;94(3):\n110 8e10.\n*[62] Riccio LGC, Baracat EC, Chapron C, Batteux F, Abrao MS. The role of the B lymphocytes in endometriosis: a systematic\nreview. J Reprod Immunol 2017;123:29 e34.\n[63] Mathur SP. Autoimmunity in endometriosis: relevance to infertility. Am J Reprod Immunol 2000;44(2):89 e95.\n[64] Oral E, Arici A. Peritoneal growth factors and endometriosis. Semin Reprod Endocrinol 1996;14(3):257 e67.\n[65] Garcia-Velasco JA, Arici A. Chemokines and human reproduction. Fertil Steril 1999;71(6):983 e93.\n[66] Koninckx PR, Kennedy SH, Barlow DH. Endometriotic disease: the role of peritoneal fluid. Hum Reprod Update 1998;4(5):\n741e51.\n[67] Kayisli UA, Mahutte NG, Arici A. Uterine chemokines in reproductive physiology and pathology. Am J Reprod Immunol\n2002;47(4):213e21.\n[68] Hill JA, Anderson DJ. Lymphocyte activity in the presence of peritoneal fluid from fertile women and infertile women\nwith and without endometriosis. Am J Obstet Gynecol 1989;161(4):861 e4.\n[69] Mori H, Sawairi M, Nakagawa M, Itoh N, Wada K, Tamaya T. Peritoneal fluid interleukin-1 beta and tumor necrosis factor\nin patients with benign gynecologic disease. Am J Reprod Immunol 1991;26(2):62 e7.\n[70] Halme J, Becker S, Haskill S. Altered maturation and function of peritoneal macrophages: possible role in pathogenesis of\nendometriosis. Am J Obstet Gynecol 1987;156(4):783 e9.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e4948\n\n[71] Podgaec S, Rizzo LV, Fernandes LF, Baracat EC, Abrao MS. CD4( þ) CD25(high) Foxp3( þ) cells increased in the peritoneal\nfluid of patients with endometriosis. Am J Reprod Immunol 2012;68(4):301 e8.\n[72] Arici A, Tazuke SI, Attar E, Kliman HJ, Olive DL. Interleukin-8 concentration in peritoneal fluid of patients with endo-\nmetriosis and modulation of interleukin-8 expression in human mesothelial cells. Mol Hum Reprod 1996;2(1):40 e5.\n[73] Iwabe T, Harada T, Tsudo T, Tanikawa M, Onohara Y, Terakawa N. Pathogenetic signi ficance of increased levels of\ninterleukin-8 in the peritoneal fluid of patients with endometriosis. Fertil Steril 1998;69(5):924 e30.\n[74] Santulli P, Borghese B, Chouzenoux S, Vaiman D, Borderie D, Streuli I, et al. Serum and peritoneal interleukin-33 levels are\nelevated in deeply in filtrating endometriosis. Hum Reprod 2012;27(7):2001 e9.\n[75] Richter O, Mallmann P, van der Ven H, Krebs D. [TNF-alpha secretion by peritoneal macrophages in endometriosis].\nZentralbl Gynakol 1998;120(7):332 e6.\n[76] Chang SY, Ho YS. Immunohistochemical analysis of insulin-like growth factor I, insulin-like growth factor I receptor and\ninsulin-like growth factor II in endometriotic tissue and endometrium. Acta Obstet Gynecol Scand 1997;76(2):1 12 e7.\n[77] Kim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and\nIGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil Steril 2000;73(5):\n996e1000.\n[78] Osuga Y, Tsutsumi O, Okagaki R, Takai Y, Fujimoto A, Suenaga A, et al. Hepatocyte growth factor concentrations are\nelevated in peritoneal fluid of women with endometriosis. Hum Reprod 1999;14(6):161 1 e3.\n[79] Simms JS, Chegini N, Williams RS, Rossi AM, Dunn Jr WA. Identi fication of epidermal growth factor, transforming growth\nfactor-alpha, and epidermal growth factor receptor in surgically induced endometriosis in rats. Obstet Gynecol 1991;78(5\nPt 1):850 e7.\n[80] Halme J, White C, Kauma S, Estes J, Haskill S. Peritoneal macrophages from patients with endometriosis release growth\nfactor activity in vitro. J Clin Endocrinol Metab 1988;66(5):1044 e9.\n[81] Surrey ES, Halme J. Effect of platelet-derived growth factor on endometrial stromal cell proliferation in vitro: a model for\nendometriosis? Fertil Steril 1991;56(4):672 e9.\n[82] Mahnke JL, Dawood MY, Huang JC. Vascular endothelial growth factor and interleukin-6 in peritoneal fluid of women\nwith endometriosis. Fertil Steril 2000;73(1):166 e70.\n[83] Zeller JM, Henig I, Radwanska E, Dmowski WP. Enhancement of human monocyte and peritoneal macrophage chem-\niluminescence activities in women with endometriosis. Am J Reprod Immunol Microbiol 1987;13(3):78 e82.\n[84] Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, et al. Ovarian steroid regulation of vascular endothelial\ngrowth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and in the path-\nogenesis of endometriosis. J Clin Endocrinol Metab 1996;81(8):31 12 e8.\n[85] Donnez J, Smoes P, Gillerot S, Casanas-Roux F, Nisolle M. Vascular endothelial growth factor (VEGF) in endometriosis.\nHum Reprod 1998;13(6):1686e90.\n[86] Lebovic DI, Bentzien F, Chao VA, Garrett EN, Meng YG, Taylor RN. Induction of an angiogenic phenotype in endometriotic\nstromal cell cultures by interleukin-1beta. Mol Hum Reprod 2000;6(3):269 e75.\n[87] Harada T, Iwabe T, Terakawa N. Role of cytokines in endometriosis. Fertil Steril 2001;76(1):1 e10.\n[88] Zarmakoupis PN, Rier SE, Maroulis GB, Becker JL. Inhibition of human endometrial stromal cell proliferation by inter-\nleukin 6. Hum Reprod 1995;10(9):2395 e9.\n[89] Rier SE, Zarmakoupis PN, Hu X, Becker JL. Dysregulation of interleukin-6 responses in ectopic endometrial stromal cells:\ncorrelation with decreased soluble receptor levels in peritoneal fluid of women with endometriosis. J Clin Endocrinol\nMetab 1995;80(4):1431e7.\n[90] Tabibzadeh SS, Santhanam U, Sehgal PB, May LT. Cytokine-induced production of IFN-beta 2/IL-6 by freshly explanted\nhuman endometrial stromal cells. Modulation by estradiol-1 7 beta. J Immunol 1989;142(9):3134 e9.\n[91] Eisermann J, Gast MJ, Pineda J, Odem RR, Collins JL. Tumor necrosis factor in peritoneal fluid of women undergoing\nlaparoscopic surgery. Fertil Steril 1988;50(4):573 e9.\n[92] Zhang RJ, Wild RA, Ojago JM. Effect of tumor necrosis factor-alpha on adhesion of human endometrial stromal cells to\nperitoneal mesothelial cells: an in vitro system. Fertil Steril 1993;59(6):1 196 e201.\n[93] Iwabe T, Harada T, Tsudo T, Nagano Y, Yoshida S, Tanikawa M, et al. Tumor necrosis factor-alpha promotes proliferation of\nendometriotic stromal cells by inducing interleukin-8 gene and protein expression. J Clin Endocrinol Metab 2000;85(2):\n824e9.\n[94] Santulli P, Borghese B, Chouzenoux S, Streuli I, Borderie D, de Ziegler D, et al. Interleukin-19 and interleukin-22 serum\nlevels are decreased in patients with ovarian endometrioma. Fertil Steril 2013;99(1):219 e26.\n[95] Gallinelli A, Chiossi G, Giannella L, Marsella T, Genazzani AD, Volpe A. Different concentrations of interleukins in the\nperitoneal fluid of women with endometriosis: relationships with lymphocyte subsets. Gynecol Endocrinol 2004;18(3):\n144e51.\n[96] Song M, Karabina SA, Kavtaradze N, Murphy AA, Parthasarathy S. Presence of endometrial epithelial cells in the peri-\ntoneal cavity and the mesothelial in flammatory response. Fertil Steril 2003;79(Suppl. 1):789 e94.\n[97] Carmona F, Chapron C, Martinez-Zamora MA, Santulli P, Rabanal A, Martinez-Florensa M, et al. Ovarian endometrioma\nbut not deep in filtrating endometriosis is associated with increased serum levels of interleukin-8 and interleukin-6.\nJ Reprod Immunol 2012;95(1 e2):80e6.\nL.G.C. Riccio et al. / Best Practice & Research Clinical Obstetrics and Gynaecology 50 (2018) 39 e49 49\n\nContents lists available at ScienceDirect\nJournal of Reproductive Immunology\njournal homepage: www.elsevier.com/locate/jri\nReview article\nThe role of the B lymphocytes in endometriosis: A systematic review\nL.G.C. Riccio a,c, E.C. Baracat a, C. Chapron b,c, F. Batteux c,d, M.S. Abrão a,⁎\na School of Medicine, University of S ão Paulo, Endometriosis Division, Obstetrics and Gynecology Department, S ão Paulo, Brazil\nb Sorbonne Paris Cité, Faculté de Médecine, Assistance Publique – Hôpitaux de Paris (AP-HP), Groupe Hospitalier Universitaire (GHU) Ouest, Centre Hospitalier\nUniversitaire (CHU) Cochin, Department of Gynecology Obstetrics II and Reproductive Medicine, Université Paris Descartes, Paris, France\nc Department of Development, Reproduction and Cancer, Institut Cochin, INSERM U1016-Batteux, Université Paris Descartes, Sorbonne Paris Cité, Paris, France\nd Department of Immunology, Hôpital Cochin, AP-HP, Paris, France\nARTICLE INFO\nKeywords:\nB lymphocytes\nB cells\nAntibodies\nEndometriosis\nPathogenesis\nABSTRACT\nThe physiopathology of endometriosis is not completely understood and its progression is associated with a local\nand systemic infl ammatory reaction. It is important to clarify the potential role of the immune system to better\nunderstand its implication in the pathogenesis of endometriosis, which includes the study of the role of B cells\nand antibodies. The aim of this study was to review the literature about the role of B lymphocytes in en-\ndometriosis. A search for “endometriosis”, “B cells ” and “B lymphocytes ” in databases resulted in 140 citations;\nafter applying inclusion and exclusion criteria, a total of 22 studies were assessed. The analyzed samples in the\nstudies varied and di fferent markers and techniques were used by the authors to evaluate the direct or indirect\nrole of B lymphocytes in endometriosis. Most studies demonstrated increased number and/or activation of B cells\nwhile seven studies found no di fference and two studies showed decreased number of B cells. Increased B\nlymphocytes and excessive production of autoantibodies in endometriosis have been described in the literature,\nbut their role in the development of the disease is not well understood. Moreover, the association of these factors\nwith clinical symptoms, location and severity of the disease has not been investigated. Further studies are ne-\ncessary to clarify the role of B cells in the development of endometriosis and propose new therapeutic strategies\nsuch as the use of drugs that target these cells.\n1. Introduction\nEndometriosis is a benign gynecologic disease characterized by the\ngrowth of endometrial glands and stroma outside the uterine cavity\n(Giudice and Kao, 2004; Tosti et al., 2015 ). It a ffects 5– 15% of women\nin reproductive age ( Missmer and Cramer, 2003 ).\nThe physiopathology of endometriosis is not completely under-\nstood. There are many theories about its pathogenesis, including: a)\nretrograde menstruation ( Sampson, 1927 ); b) blood and lymphatic\ndissemination of endometrial cells ( Abrão et al., 2006); c) celomic\nmetaplasia (Bulun, 2009); d) endometrium-derived stem cells migrating\nto ectopic sites ( Hufnagel et al., 2015); e) epigenetic changes leading to\na pro-in flammatory microenvironment ( Laganà et al., 2017 ); f) en-\nvironmental toxicants acting as endocrine disrupters on the female re-\nproductive system ( Sofo et al., 2015). However, none of these theories\ncan explain the disease in all its aspects.\nMany important factors may contribute to the development of en-\ndometriosis, such as a welcoming environment for the proliferation of\nendometrial cells associated with an aberrant immune response. Many\nauthors have attempted to clarify the role of the immune system in\nendometriosis and several abnormalities have been reported\n(Christodoulakos et al., 2007 ).\nDisturbances in immune homeostasis can allow implantation, pro-\nliferation and angiogenesis of the ectopic endometrial tissue ( Matarese\net al., 2003). Despite the fact that there is probably a defect in the\nimmunosurveillance, some aspects of the immune response are in-\ncreased in endometriosis. A widespread polyclonal activation of B cells\nhas been identi fied ( Lebovic et al., 2001 ), as well as the presence of\nanti-endometrial autoantibodies ( Fernandez-Shaw et al., 1993; Wild\nand Shivers, 1985). The aim of this study was to review the literature on\nthe role of B lymphocytes in endometriosis to better understand their\nimpact in pathogenesis of the disease, which could lead to the future\ndevelopment of new therapeutic strategies.\n2. Material and methods\nThis review was conducted according to PRISMA statement\n(Liberati et al., 2009 ) at the Department of Obstetrics and Gynecology,\nhttp://dx.doi.org/10.1016/j.jri.2017.09.001\nReceived 24 May 2017; Received in revised form 1 August 2017; Accepted 6 September 2017\n⁎ Corresponding author at: Av. Dr. Enéas de Carvalho Aguiar, 255, Cerqueira César CEP 05403-000, São Paulo, Brazil.\nE-mail addresses: luiza.riccio@gmail.com (L.G.C. Riccio), edmund.baracat@hc.fm.usp.br (E.C. Baracat), charles.chapron@cch.aphp.fr (C. Chapron),\nfrederic.batteux@aphp.fr (F. Batteux), msabrao@mac.com (M.S. Abrão).\nJournal of Reproductive Immunology 123 (2017) 29–34\n0165-0378/ © 2017 Elsevier B.V. All rights reserved.\nMARK\n\nSchool of Medicine, University of São Paulo, Brazil and at INSERM\nU1016-Batteux, Institut Cochin, France. Studies were identi fied through\nsystematic searches in PubMed/MEDLINE and Lilacs, considering the\nkeywords: “endometriosis”; “B cells ” and “B lymphocytes ”. Articles\nwritten in English; Portuguese; French or Spanish were included. No\nlimits of date of publication were imposed and reviews were excluded.\nThe selection of the 22 studies assessed in this review is shown in Fig. 1.\nThere is no PROSPERO registration number.\n3. Results\nWe summarized the content of 22 selected studies in Table 1, or-\nganized by type of sample evaluated. Di fferent markers and samples\nwere assessed by the authors to analyze the direct or indirect role of B\nlymphocytes in endometriosis.\nMost studies demonstrated increased number and/or activation of B\ncells ( Antsiferova et al., 2005; Badawy et al., 1987, 1989; Berbic et al.,\n2013; Chishima et al., 2000; Gleicher et al., 1987; Hever et al., 2007;\nLachapelle et al., 1996; Odukoya et al., 1995, 1996a,b; Scheerer et al.,\n2016), seven studies found no di fference ( Christofolini et al., 2011;\nGebel et al., 1993; Klentzeris et al., 1995; Nava Loya et al., 1996;\nNomiyama et al., 1997; Witz et al., 1994; Yeol et al., 2015 ) and two\nstudies showed decreased number of B cells ( Oosterlynck et al., 1993;\nGagne et al., 2003 ).\n4. Discussion\n4.1. Di fferences among the evaluated studies\nSince the literature included in this review was published over a\nlong period of time − between 1987 ( Badawy et al., 1987 ) and 2016\n(Scheerer et al., 2016 ) − it should be considered that the methods have\nimproved in meantime. The authors used: Avidin-biotin im-\nmunoperoxidase technique (ABS), Immunobead rosette technique\n(IBT), Enzyme-linked immunosorbent assay (ELISA),\nImmunofluorescence (IF), Flow cytometry, Immunohistochemistry\n(IHC) and Protein chain reaction (PCR).\nSome techniques, such as IBT and ABS, were more frequently used\nin 1980s and 1990s; the markers and antibodies used in ELISA and IHC\nhave since improved and new target genes and primers have been de-\nveloped for the PCR evaluations.\nSince the most recent publication that evaluated B cells in en-\ndometriosis through flow cytometry ( Antsiferova et al., 2005), several\nnew phenotype markers have been used to study these cells in other\ndiseases ( Kaminski et al., 2012).\nB cells phenotypes have been analyzed through flow cytometry in\nchronic autoimmune diseases such as systemic lupus erythematosus\n(Bertsias et al., 2010 ); Sjögreńs syndrome ( Abdulahad et al., 2011 ) and\nrheumatoid arthritis ( Leandro et al., 2006 ). The B cells subsets include\ntransitional, mature-naïve, memory and antibody-secreting cells. The\ncurrent knowledge on these subsets o ffers\n different possibilities of\nprofiling that could help optimize diagnostic and therapeutic protocols\nfor many diseases in the future ( Kaminski et al., 2012).\nStudies have also evaluated di fferent types of samples from en-\ndometriosis patients and the results can represent di fferent aspects of\nthe disease: findings in blood/serum are systemic; the ectopic en-\ndometrium represents the endometriotic lesions directly; pelvic lymph\nnodes may account for the in fluence of a lymphatic spread of the en-\ndometrial cells; peritoneal fluid represents the peritoneal cavity en-\nvironment; and the follicular fluid could enable the assessment of in-\nfertility in the context of the disease. It is also important to study the\neutopic endometrium since its alteration in patients with endometriosis\nhas already been described.\nTo summarize, there are many di fferences between the studies in-\ncluded in this review, especially in the methods and samples, and\ntherefore it can be di ffi cult to compare their results. However, it is\npossible to consider their findings complementary in describing dif-\nferent aspects of the disease.\nFig. 1. Results of the search on the databases, 2017.\nL.G.C. Riccio et al. Journal of Reproductive Immunology 123 (2017) 29–34\n30\n\nTable 1\nStudies included on the role of B lymphocytes in endometriosis.\nSamples Study design Population Methods Markers B Lymphocytes in EDT References\nBlood/serum Case-control EDT x controls IBT Monoclonal antibodies Increased B cells Badawy et al. (1987)\nDescriptive 59 EDT ELISA FAN; IgG; IgM lupus\nanticoagulant\nAbnormal polyclonal B cells activation Gleicher et al. (1987)\nCase-control 19 EDT x 26 infertile IBT; ELISA B cells; IgA; IgG. Increased B cells and IgG Badawy et al. (1989)\nCase-control 42 EDT x 20 infertile x 22 controls In vitro stimulation with polyclonal B-\ncell activators\nIgG1; IgG2; IgG3 No di fference in B cells. ↓ polyclonal IgG2\nproduction in stages III and IV EDT.\nGebel et al. (1993)\nCase-control 21 EDT x 18 controls Chemiluminescent ELISA sCD23 Activation of B cells Odukoya et al. (1995)\nCase-control 25 EDT and idiopathic infertility Flow cytometry CD 19 No di fference Nava Loya et al. (1996)\nCase-control 57 EDT x 40 controls ELISA sCD23; IgG Increased amount and activation of B cells Odukoya et al. (1996a)\nCase-control 31 EDT x 14 controls Flow cytometry; IF CD5; ANA B cells are related to ANA production. Chishima et al. (2000)\nCase-control 175 EDT x 131 controls Flow cytometry CD 20 Decreased B cells Gagné et al. (2003)\nCase-control 15 EDT x 20 controls Flow cytometry CD 20; CD5 No di fference Antsiferova et al.\n(2005)\nCase-control 10 OMA x 10 adenomyosis x 10\nleiomyoma\nIHC; PCR; ELISA BLyS; Plasma cells Increased BLyS Hever et al. (2007)\nCase-control 87 EDT x 33 adenomyosis x 205\ncontrols\nPCR BLyS 817C/T polimorphism Heterozygosity ↓ risk of DIE; BLyS may play a role\nin the pathogenesis.\nde Graa ff et al. (2010)\nCase-control 165 infertile EDT x 83 idiopathic\ninfertility x 145 control\nPCR BLyS −817C⁄T polymorphism No di fference Christofolini et al.\n(2011)\nPeritoneal fluid Case-control EDT x controls IBT Monoclonal antibodies Increased B cells Badawy et al. (1987)\nCase-control 19 EDT x 26 infertile IBT; ELISA B cells; IgA; IgG. Increased B cells, IgA and IgG Badawy et al. (1989)\nCase-control 25 EDT and idiopathic infertility Flow cytometry CD 19 No di fference Nava Loya et al. (1996)\nCase- control 47 EDT x 35 controls Chemiluminescent ELISA sCD23 ↑ B cell activation; higher in stages I and II Odukoya et al. (1996b)\nCase-control 31 EDT x 14 controls Flow cytometry; IF CD5; ANA Increased B-1 cells Chishima et al. (2000)\nCase-control 46 EDT x 52 controls ELISA; PCR IgG; IgA; Bcl-6; Blimp-1 ↓ Bcl-6 and ↑ Blimp-1 No di fference in Ig Yeol et al. (2015)\nEutopic and ectopic\nendometrium\nDescriptive IHC CD 22 No di fference Witz et al. (1994)\nCase-control 30 infertile EDT x 10 controls IHC IgG No di fference Nomiyama et al. 1997\nCase-control 15 EDT x 20 controls Flow cytometry CD 20; CD5 ↑ amount in eutopic endometrium; ↑ amount and\nactivation in ectopic endometrium\nAntsiferova et al.\n(2005)\nCase-control\n10 OMA x 10 adenomyosis x 10\nleiomyoma\nIHC; PCR; ELISA BLyS; Plasma cells Increased BLyS and plasma cells. Hever et al. (2007)\nCase-control 48 EDT X 24 adenomyosis X 12\ncontrols\nIHC CD 20 ↑ amount in EDT lesions, adenomyosis and\nendometrium\nScheerer et al. (2016)\nDescriptive 15 EDT ABC; IHC anti-leu-12 Very few B cells in the lesions Oosterlynck et al.\n(1993)\nCase-control 87 EDT x 33 adenomyosis x 205\ncontrols\nPCR BLyS 817C/T polimorphism Heterozygosity ↓ risk of DIE; BLyS may play a role\nin the pathogenesis.\nde Graa ff et al. (2010)\nCase-control 21 infertile EDT x 18 controls IHC CD 22 No di fference in eutopic endometrium Klentzeris et al. (1995)\nFollicular fluid Case-control 12 infertile EDT x 35 tubal factor x\n13 idiopathic\nFlow cytometry CD3; CD4; CD8; CD14; CD20;\nCD45; CD56\nIncreased B cells Lachapelle et al. (1996)\nPelvic lymph nodes Case-control 7 EDT x 9 controls IHC CD 20; CD79; plasma cells ↑ in lymph nodes during proliferative phase Berbic et al. (2013)\nABC: avidin-biotin immunoperoxidase technique; ANA: antinuclear antibodies; Bcl-6: B cell leukemia lymphoma-6; Blimp-1: B lymphocyte inducer of maturation program-1; BLyS: B lymphocyte stimulator; DIE: deep in filtrating endometriosis; EDT:\nEndometriosis; ELISA: enzyme-linked immunosorbent assay; IBT: Immunobead rosette technique; IF: Immuno fluorescence; IHC: Immunohistochemistry; OMA: ovarian endometrioma; PCR: protein chain reaction.\nL.G.C. Riccio et al. Journal of Reproductive Immunology 123 (2017) 29–34\n31\n\n4.2. Importance of immunological disorders in survival and proliferation of\nectopic endometrial cells\nStudies have demonstrated the importance of the immune system in\nthe pathogenesis of endometriosis. In this context, ine ffi cient peritoneal\nimmunosurveillance and persistence of ectopic endometrial cells re-\nmain a crucial issue. This complex process could explain why although\nretrograde menstruation is a common phenomenon among women of\nreproductive age, not all of them develop endometriosis.\nThe role of apoptosis in normal endometrium is to eliminate the\ndysfunctional cells − a tissue repair mechanism during each menstrual\ncycle. In endometriosis, the cells regurgitated into the peritoneal cavity\ndo not exhibit normal mechanisms of programmed cell death.\nThe Fas-Fas-L and TNF- α apoptosis pathways play a key role in\nmodulating the peritoneal microenvironment ( Vetvicka et al., 2016 ).\nThe overexpression of anti-apoptotic factors and decreased expression\nof pro-apoptotic factors ( Tosti et al., 2015 ) may interfere in peritoneal\nhomeostasis and contribute to the development of the disease. There-\nfore, the regulation of apoptosis can be a target for the treatment of\nendometriosis. It has been shown that the use of GnRH analogues in-\ncreases the expression of the pro-apoptotic proteins Bax and FasL and\ndecreases the expression of the anti-apoptotic protein Bcl-2 ( Bilotas\net al., 2007).\nIn addition, endometrial cells in the peritoneal cavity are not tar-\ngeted and removed by phagocytes and NK cells, thereby escaping the\nclearance and surviving to invade the peritoneum, through a me-\nchanism called “immunoescaping” (Vetvicka et al., 2016 ). It is im-\nportant to study the role of these immune cells as well as their recently\ndescribed subsets, such as the Invariant Natural Killer T cells (iNKT) in\nthe pathogenesis of endometriosis ( Laganà et al., 2016 ).\nThe adhesion of the fragments of endometrium to the in-\ntraperitoneal surface probably involves the expression of extracellular\nmembrane molecules and their co-receptors ( Lebovic et al., 2001 ).\nCurrent knowledge suggests that endometrial stromal cells are involved\nin cellular adhesion, whereas glandular epithelial cells play a role in\ninvasion and growth of the lesion ( Ahn et al., 2015 ).\nIn endometriosis, the endometrium presents an increased proteo-\nlytic capacity. Anomalous expressions of plasminogen activator system\nproteins as well as various matrix metalloproteinases seem to be re-\nsponsible for this phenomenon ( Ahn et al., 2015; Gilabert-Estellés et al.,\n2003).\nOnce established, endometriotic lesions secrete various pro-in-\nflammatory molecules. There is evidence of peritoneal macrophages\nactivation with increased production of cytokines, though the phago-\ncytic activity is reduced ( Králíčková and Vetvicka, 2015 ).\n4.3. The role of B lymphocytes and immunoglobulins in the pathogenesis of\nendometriosis\nMany lymphocytes were identi fied in endometriotic implants, and\nthey may contribute to the progression of the disease. The immune cells\nof lymphoid lineage play an essential role in the survival and pro-\nliferation of endometrial cells ( Klein et al., 1992 ). There is an aberrant\nfunctioning of these immune cells in endometriosis: reduced activity of\ncytotoxic T cells and NK cells; secretion of cytokines by T helper cells\nand autoantibody production by B lymphocytes ( Králíčková and\nVetvicka, 2015; Osuga et al., 2011 ).\nB lymphocytes are responsible for the humoral immune response\nthrough the production of antibodies against antigens. In the patho-\ngenesis of endometriosis, these cells seem to contribute to the occur-\nrence of the disease by autoantibody secretion ( Straub, 2007 ).\nEndometriosis is an estrogen-dependent disease, and the role of\nestrogens in immunomodulation has been described as a paradox: they\ncan act both as anti-in flammatory\n and pro-in flammatory substances.\nThis may explain why women have a higher in flammatory response and\nan increased incidence of autoimmune diseases compared to men.\nEstrogen can stimulate antibody production by B cells, probably by\ninhibiting T cell suppression of these cells. In contrast, high con-\ncentrations of estrogens may lead to a suppression of B lymphocyte\nlineage precursors ( Straub, 2007 ).\nAn increase in the reactivity of B lymphocytes in endometriosis was\nfirst suggested in 1980 ( Startseva, 1980). The same year, another study\ndemonstrated IgG and complement deposits in the endometrium and\ndecreased serum complement, suggesting an autoimmune response\nwith complement consumption by the antigen-antibody complex ( Weed\nand Arquembourg, 1980 ).\nB lymphocytes seem to contribute to the pathogenesis of en-\ndometriosis by producing antibodies anti-endometrium and also anti-\nDNA, antiphospholipid and antinuclear antibodies (ANA), usually ob-\nserved in autoimmune diseases ( Osuga et al., 2011 ). These changes may\nbe related to speci fic genetic variants in autoimmune-related genes\n(Bianco et al., 2012 ).\nWild and Shivers (1985) first described by indirect immuno-\nfluorescence the presence of anti-endometrial antibodies in the serum\nof women with endometriosis. Immunohistochemical analysis revealed\nthat these anti-endometrial antibodies bind to endometrial glands and\nalso to the ectopic tissue ( Fernandez-Shaw et al., 1993 ). A subsequent\nwestern blot analysis demonstrated that autoantibodies react with\nmembrane proteins of the endometrial cells and that the im-\nmunoreactivity increases with disease progression ( Bohler et al., 2007).\nAlthough many studies have demonstrated an aberrant production\nof autoantibodies in endometriosis, there is no consensus about the\nconcentration of B lymphocytes and their role in this disease. Badawy\net al. (1987) reported increased B cells in blood and peritoneal fluid\nfrom patients with endometriosis. The same group later described in-\ncreased IgG and IgA in the peritoneal cell cultures and also an increased\nnumber of T cells, B cells, and increased ratio of CD4/CD8 lymphocytes\nin blood and peritoneal fluid. These findings suggest that im-\nmunoglobulin production by the activated B cells may be regulated by\nthe increased presence of T cells, and speci fically helper cells (CD4)\n(Badawy et al., 1989 ).\nSome studies have suggested that endometriosis has an autoimmune\netiology, presenting changes in both humoral and cellular immunity\n(Nothnick, 2001 ) that lead to in flammatory reactions and proliferation\nof endometriotic cells ( Osuga et al., 2011). Nothnick (2001) lists\ncommon characteristics between endometriosis and autoimmune dis-\neases: tissue injury, polyclonal activation of B cells, abnormalities of B\nand T lymphocytes, changes in apoptosis, association with other auto-\nimmune disorders, multiple organ involvement, familial occurrence and\npossible environmental and genetic factors associated.\nPossible common backgrounds of immune dysfunctions between\nautoimmune diseases and endometriosis were also proposed by\nChishima et al. (2000) . They reported that B cells are related to ANA\nproduction in the blood of patients with endometriosis and also found\nincreased B-1 cells in peritoneal exudate cells of these women. It is\nspeculated that the infertility associated endometriosis is partly due to\nautoantibody abnormalities regarded as the result of polyclonal B-cell\nactivation associated with B-l-cell proliferation.\nHever et al. (2007) analyzed signi ficantly\n upregulated genes in\nendometriosis versus control endometrium and concluded that 53 genes\nassociated with immune responses had altered expression.\nWhile evaluating the role of B cells through soluble CD23 and IgG\nautoantibodies, Odukoya et al. (1995, 1996a,b) demonstrated increased\namount and activation of B cells in the blood and peritoneal fluid of\nwomen with endometriosis. They also described higher concentration\nof soluble CD23 in patients with stage I and II endometriosis, suggesting\nthat mild endometriosis may be immunologically more active than se-\nvere endometriosis. Gebel et al. (1993) findings also agree with this\nstatement as they have reported reduced polyclonal IgG2 production in\nstage III and IV endometriosis.\nThrough the analysis of CD22+, Klentzeris et al. (1995) and Witz\net al. (1994) did not find any difference in B lymphocytes of eutopic and\nL.G.C. Riccio et al. Journal of Reproductive Immunology 123 (2017) 29–34\n32\n\nectopic endometrium of patients with endometriosis compared to\ncontrols. However, Klentzeris et al. (1995) concluded that functional\ndifferences between leukocytes could not be excluded and, therefore,\nthe analysis of cytokines secreted by these cells would be helpful.\nThere was also no di fference in CD29+ cells analyzed by flow cy-\ntometry in the blood and peritoneal fluid of women with endometriosis\ncompared to those with idiopathic infertility ( Nava Loya et al., 1996 ).\nOosterlynck et al. (1993) , through the IHC analysis of anti-leu-12, re-\nported very few B cells in the ectopic endometrium of 15 women with\nendometriosis.\nNomiyama et al. (1997) analyzed the concentration of im-\nmunoglobulins in eutopic and ectopic endometrium of infertile women\nwith endometriosis and found no di fference with controls. They con-\ncluded that the di fference in local immune response in endometrial\nimplants did not a ffect systemic immunity.\nLymphocyte subsets were evaluated in the blood of 306 patients and\nCD20+ B cells were decreased, as well as subsets of CD20 cells co-\nexpressing either HLADR or high level of CD44 molecules in women\nwith endometriosis ( Gagné et al., 2003). The authors concluded that\nalthough some speci fic B-cell clones are activated to produce auto-\nantibodies, the relative number of total B lymphocytes expressing either\nHLADR or CD44 molecules is downregulated in the blood of patients\nwith endometriosis.\nHigher IgG and IgA concentrations in the peritoneal fluid of patients\nwith endometriosis were reported by Yeol et al. (2015) , but the dif-\nferences were not statistically signi ficant. They also evaluated the\ntranscriptional factors that play a key role in B cells function: B lym-\nphocyte inducer of maturation program (Blimp)-1 − a crucial regulator of\nplasma cell di fferentiation − and its antagonist B cell leukemia lym-\nphoma (Bcl)-6. Blc-6 mRNA level was signi ficantly lower and Blimp-1\nmRNA level was signi ficantly higher in the endometriosis group, with\nsignificant correlations among transcriptional factors, immunoglobulins\nand cytokines.\nIncreased B cells were described in the follicular fluid of infertile\npatients with endometriosis ( Lachapelle et al., 1996 ), suggesting that\nthis could be one of the factors impairing their fertility.\nDuring the proliferative phase of the menstrual cycle, B lympho-\ncytes were also increased in pelvic lymph nodes of women with en-\ndometriosis. This finding may support the theory of a lymphatic spread\nof endometriosis ( Berbic et al., 2013).\nImmune cells in filtrates of lesions, myometrium and endometrium\nof women with endometriosis and adenomyosis showed increased\nCD20+ B cells in IHC ( Scheerer et al., 2016 ).\nEndometriotic lesions show high levels of cytokines that activate B\ncells,\nsuch as BLyS (B lymphocyte stimulator) ( Hever et al., 2007). This\ncytokine is produced by macrophages and plays an important role in the\nnormal development of B cells and their di fferentiation into plasma\ncells ( Schiemann et al., 2001 ). High levels of BLyS were also identi fied\nin the plasma of patients with autoimmune diseases, and it is a potential\ntarget in the treatment of diseases with B cell defects (Krivosikova et al.,\n2009).\nAnother study ( de Graa ff et al., 2010 ) evaluated the BLyS 817C/T\npolymorphism in women with endometriosis, adenomyosis and con-\ntrols. They observed a reduced risk of deep in filtrating endometriosis\nassociated with heterozygosity and concluded that BLyS may play a role\nin the pathogenesis of the disease. Christofolini et al. (2011) analyzed\nthe same polymorphism in a speci fic group of infertile women with\nendometriosis and did not find any di fference.\nAntsferova et al. (2005) observed increased B cells in eutopic and\nectopic endometrium and activated B cells in the lesions of patients\nwith endometriosis in flow cytometry. They concluded that the devel-\nopment of peritoneal lesions is associated with the activation of sys-\ntemic and local humoral reactions due to an increase in the amount of\nTh2 lymphocytes.\nThe importance of the immune system in the pathogenesis of en-\ndometriosis supports the idea of using therapeutic strategies involving\ndrugs that modulate speci fically the functions of immune cells ( Osuga\net al., 2011 ). There is an urgent need for new approaches to the medical\ntreatment of endometriosis, especially non-hormonal therapies since\nmost of the drugs currently used are contraceptives and women may\nhave to choose between managing painful symptoms and trying to\nconceive. An increased understanding of the immune aspects of en-\ndometriosis would be bene ficial in the search for novel treatment\nstrategies.\n5. Conclusion\nThe pathogenesis of endometriosis is multifactorial. Many studies\nhave explored the role of genetics, environmental factors and the im-\nmune system in the development of the disease. Several authors have\nattempted to clarify the role of the immune system in endometriosis and\nvarious abnormalities have been detected in this association, including\nincreased B lymphocytes and excessive production of autoantibodies.\nAlthough there is evidence of abnormal production of autoantibodies in\npatients with endometriosis, their role in the development of the dis-\nease and the concentration of B cells in this context are not well un-\nderstood.\nThe use of flow cytometry techniques with new subset markers\ncould be a valuable tool to evaluate di fferent B cells phenotypes in\nendometriosis. Moreover, the association of these factors with clinical\nsymptoms, location and severity of the disease has not been in-\nvestigated. Further studies are necessary to clarify the role of B cells and\nantibodies in the development of endometriosis and propose new\ntherapeutic strategies such as the use of drugs that target these cells.\nFunding\nThis research did not receive any speci fic grant from funding\nagencies in the public, commercial, or not-for-pro fit sectors.\nAcknowledgements\nThe authors are grateful to all the members of the Department of\nObstetrics and Gynecology of University of São Paulo, Brazil, and\nINSERM U1016-Batteux, Institut Cochin, France. The authors are\nthankful to Olivier Cerles, PhD, for his assistance in revising English\nlanguage.\nReferences\nAbdulahad, W.H., Meijer, J.M., Kroese, F.G., Meiners, P.M., Vissink, A., Spijkervet, F.K.,\net al., 2011. B cell reconstitution and T helper cell balance after rituximab treatment\nof active primary Sjogren ’s syndrome: a double-blind, placebo-controlled study.\nArthritis Rheum. 63, 1116 –1123.\nAbrão, M.S., Podgaec, S., Dias Jr., J.A., et al., 2006. Deeply in filtrating endometriosis\naffecting the rectum and lymph nodes. Fertil. Steril. 86 (3), 543 –547.\nAhn, S.H., Monsanto Miller, C., Singh, S.S., Thomas, R., Tayade, C., 2015.\nPathophysiology and immune dysfunction in endometriosis. BioMed. Res. Int. 2015,\n795976 (Epub 2015 Jul 12) .\nAntsiferova, Y.S., Sotnikova, N.Y., Posiseeva, L.V., Shor, A.L., 2005. Changes in the T-\nhelper cytokine pro file and in lymphocyte activation at the systemic and local levels\nin women with endometriosis. Fertil. Steril. 84 (December (6)), 1705 –1711.\nBadawy, S.Z., Cuenca, V., Stitzel, A., Tice, D., 1987. Immunerosettes of T and B lym-\nphocytes in infertile women with endometriosis. J. Reprod. Med. 32, 194 –197.\nBadawy, S.Z., Cuenca, V., Kaufman, L., Stitzel, A., Thompson, M., 1989. The regulation of\nimmunoglobulinproduction by B cells in patients with endometriosis. Fertil. Steril.\n51, 770 –773.\nBerbic, M., Ng, C.H., Black, K., Markham, R., Russell, P., Basten, A., Fraser, I.S., Hey-\nCunningham, A.J., 2013. A novel pilot study of endometrial stromal cells and im-\nmune cell populations in sentinel uterine-draining lymph nodes during the menstrual\ncycle and in endometriosis. Reprod. Sci. 20 (November (1)), 1339 –1348.\nBertsias, G.K., Salmon, J.E., Boumpas, D.T., 2010. Therapeutic opportunities in systemic\nlupus erythematosus: state of the art and prospects for the new decade. Ann. Rheum.\nDis. 69, 1603 –1611.\nBianco, B., André, G.M., Vilarino, F.L., Peluso, C., Mafra, F.A., Christofolini, D.M.,\nBarbosa, C.P., 2012. The possible role of genetic variants in autoimmune-related\ngenes in the development of endometriosis. Hum. Immunol. 73 (March (3)), 306 –315\n(Epub 2011 Dec 11) .\nL.G.C. Riccio et al.\nJournal of Reproductive Immunology 123 (2017) 29–34\n33\n\nBilotas, M., Barañao, R.I., Buquet, R., Sueldo, C., Tesone, M., Meresman, G., 2007. E ffect\nof GnRH analogues on apoptosis and expression of Bcl-2, Bax, Fas and FasL proteins\nin endometrial epithelial cell cultures from patients with endometriosis and controls.\nHum. Reprod. 22 (March (3)), 644 –653.\nBohler, H.C., Gercel-Taylor, C., Lessey, B.A., Taylor, D.D., 2007. Endometriosis markers:\nimmunologic alterations as diagnostic indicators for endometriosis. Reprod. Sci. 14,\n595–604.\nBulun, S.E., 2009. Endometriosis. N. Engl. J. Med. 360 (3), 268 –279.\nChishima, F., Hayakawa, S., Hirata, Y., Nagai, N., Kanaeda, T., Tsubata, K., Satoh, K.,\n2000. Peritoneal and peripheral B-1-cell populations in patients with endometriosis.\nJ. Obstet. Gynaecol. Res. 26 (April (2)), 141 –149.\nChristodoulakos, G., Augoulea, A., Lambrinoudaki, I., Sioulas, V., Creatsas, G., 2007.\nPathogenesis of endometriosis: the role of defective ‘immunosurveillance. Eur. J.\nContracept. Reprod. Health Care 12, 194 –202 (Review) .\nChristofolini, D.M., Cavalheiro, C.M., Teles, J.S., Lerner, T.G., Brandes, A., Bianco, B.,\nBarbosa, C.P., 2011. Promoter −817C > T variant of B lymphocyte stimulator gene\n(BLyS) and susceptibility to endometriosis-related infertility and idiopathic infertility\nin Brazilian population. Scand. J. Immunol. 74 (December (6)), 628 –631.\nde Graa ff, A.A., Dunselman, G.A., Delvoux, B., van Kaam, K.J., Smits, L.J., Romano, A.,\n2010. B. lymphocyte stimulator −817C > T promoter polymorphism and the pre-\ndisposition for the development of deep in filtrating endometriosis. Fertil. Steril. 94\n(August (3)), 1108 –1110 (Epub 2009 Dec 11) .\nFernandez-Shaw, S., Hicks, B.R., Yudkin, P.L., Kennedy, S., Barlow, D.H., Starkey, P.M.,\n1993. Anti-endometrial and antiendothelial auto-antibodies in women with en-\ndometriosis. Hum. Reprod. 8, 310 –315.\nGagné, D., Rivard, M., Pagé, M., Shazand, K., Hugo, P., Gosselin, D., 2003. Blood leu-\nkocyte subsets are modulated in patients with endometriosis. Fertil. Steril. 80 (July\n(1)), 43 –53.\nGebel, H.M., Braun, D.P., Rotman, C., Rana, N., Dmowski, W.P., 1993. Mitogen induced\nproduction of polyclonal IgG is decreased in women with severe endometriosis. Am.\nJ. Reprod. Immunol. 29 (March (2)), 124 –130.\nGilabert-Estellés, J., Estellés, A., Gilabert, J., Castelló, R., España, F., Falcó, C., Romeu, A.,\nChirivella, M., Zorio, E., Aznar, J., 2003 Jul. Expression of several components of the\nplasminogen activator and matrix metalloproteinase systems in endometriosis. Hum.\nReprod. 18 (7), 1516 –1522.\nGiudice, L.C., Kao, L.C., 2004. Endometriosis. Lancet 364, 1789 –1799.\nGleicher, N., el-Roeiy, A., Con fino, E., Friberg, J., 1987. Is endometriosis an autoimmune\ndisease. Obstet. Gynecol. 70, 115 –122.\nHever, A., Roth, R.B., Hevezi, P., Marin, M.E., Acosta, J.A., Acosta, H., Rojas, J., Herrera,\nR., Grigoriadis, D., White, E., Conlon, P.J., Maki, R.A., Zlotnik, A., 2007. Human\nendometriosis is associated with plasma cells and overexpression of B lymphocyte\nstimulator. Proc. Natl. Acad. Sci. U. S. A. 104 (July (30)), 12451 –12456.\nHufnagel, D., Li, F., Cosar, E., Krikun, G., Taylor, H.S., 2015. The role of stem cells in the\netiology and pathophysiology of endometriosis. Semin. Reprod. Med. 33 (September\n(5)), 333 –340 (Epub 2015 Sep 16) .\nKaminski, D.A., Wei, C., Qian, Y., Rosenberg, A.F., Sanz, I., 2012. Advances in human B\ncell\nphenotypic pro filing. Front. Immunol. 10 (October (3)), 302 .\nKlein, N.A., Montoya, I.A., Schenken, R.S., 1992. Characterization of the resident lym-\nphoid cell population in endometriosis. In: SocGynecol InvestAbst #518, 39th Annual\nMeeting. San Antonio, TX .\nKlentzeris, L.D., Bulmer, J.N., Liu, D.T., Morrison, L., 1995. Endometrial leukocyte sub-\npopulations in women with endometriosis. Eur. J. Obstet. Gynecol. Reprod. Biol. 63\n(November (1)), 41 –47.\nKrálíčková, M., Vetvicka, V., 2015. Immunological aspects of endometriosis: a review.\nAnn. Transl. Med. 3 (July (11)), 153 .\nLachapelle, M.H., Hemmings, R., Roy, D.C., Falcone, T., Miron, P., 1996. Flow cytometric\nevaluation of leukocyte subpopulations in the follicular fluids of infertile patients.\nFertil. Steril. 65 (June (6)), 1135 –1140.\nLaganà, A.S., Triolo, O., Salmeri, F.M., Granese, R., Palmara, V.I., Ban Frange ž, H.,\nVrtčnik Bokal, E., Sofo, V., 2016. Natural Killer T cell subsets in eutopic and ectopic\nendometrium: a fresh look to a busy corner. Arch. Gynecol. Obstet. 293 (May (5)),\n941–949 (Epub 2016 Jan 6) .\nLaganà, A.S., Vitale, S.G., Salmeri, F.M., Triolo, O., Ban Frange ž, H., Vrta čnik-Bokal, E.,\nStojanovska, L., Apostolopoulos, V., Granese, R., Sofo, V., 2017. Unus pro omnibus,\nomnes pro uno. A novel, evidence-based, unifying theory for the pathogenesis of\nendometriosis. Med. Hypotheses 103 (June), 10 –20 (Epub 2017 Mar 31) .\nLeandro, M.J., Cambridge, G., Ehrenstein, M.R., Edwards, J.C., 2006. Reconstitution of\nperipheral blood B cells after depletion with rituximab in patients with rheumatoid\narthritis. Arthritis Rheum. 54, 613 –620.\nLebovic, D.I., Mueller, M.D., Taylor, R.N., 2001. Immunobiology of endometriosis. Fertil.\nSteril. 75 (January (1)), 1 –10 (Review) .\nLiberati, A., Altman, D.G., Tetzla ff, J., Mulrow, C., Gøtzsche, P.C., Ioannidis, J.P., et al.,\n2009. The PRISMA statement for reporting systematic reviews and meta-analyses of\nstudies that evaluate healthcare interventions: explanation and elaboration. BMJ\n339, b2700 .\nMatarese, G., De Placido, G., Nikas, Y., Alviggi, C., 2003. Pathogenesis of endometriosis:\nnatural immunity dysfunction or autoimmune disease? Trends Mol. Med. 9, 223 –228\n(Review).\nMissmer, S.A., Cramer, D.W., 2003. The epidemiology of endometriosis. Obstet. Gynecol.\nClin. North Am. 30, 1 –19 (Review).\nNava Loya, G., Hernández Guerrero, C., Pérez Ocharan, M., Mojarra Estrada, J.M.,\nGonzález Morales, M.E., Bustos López, H., Alvarado Durán, A., Vadillo Ortega, F.,\n1996. Respuesta inmune peritoneal en endometriosis/Peritoneal immune response in\nendometriosis. Ginecol. Obstet. Mex. 64 (4), 147 –153 (abr.) .\nNomiyama, M., Hachisuga, T., Sou, H., Nakamura, K., Matsumoto, Y., Iwasaka, T.,\nSugimori, H., 1997. Local immune response in infertile patients with minimal en-\ndometriosis. Gynecol. Obstet. Invest. 44 (1), 32 –37.\nNothnick, W.B., 2001. Treating endometriosis as an autoimmune disease. Fertil. Steril. 76\n(August (2)), 223 –231 (Review) .\nOdukoya, O.A., Bansal, A., Wilson, A.P., Weetman, A.P., Cooke, I.D., 1995. Serum-soluble\nCD23 in patients with endometriosis and the e ffect of treatment with danazol and\nleuprolide acetate depot injection. Hum. Reprod. 10 (April (4)), 942 –946.\nOdukoya,\nO.A., Bansal, A., Cooke, I., 1996a. Serum endometrial IgG antibodies and so-\nluble CD23 concentrations in patients with endometriosis. Acta Obstet. Gynecol.\nScand. 75 (November (10)), 927 –931.\nOdukoya, O.A., Bansal, A., Wilson, P., Lim, K., Weetman, A.P., Cooke, I.D., 1996b. Soluble\nCD23 protein in the peritoneal fluid of patients with endometriosis. Hum. Reprod. 11\n(September (9)), 2018 –2021.\nOosterlynck, D.J., Cornillie, F.J., Waer, M., Koninckx, P.R., 1993. Immunohistochemical\ncharacterization of leucocyte subpopulations in endometriotic lesions. Arch. Gynecol.\nObstet. 253 (4), 197 –206.\nOsuga, Y., Koga, K., Hirota, Y., Hirata, T., Yoshino, O., Taketani, Y., 2011. Lymphocytes in\nendometriosis. Am. J. Reprod. Immunol. 65 (January (1)), 1 –10.\nSampson, J.A., 1927. Peritoneal endometriosis due to the menstrual dissemination of\nendometrial tissue into the peritoneal cavity. Am. J. Obstet. Gynecol. 14, 422 –469.\nScheerer, C., Bauer, P., Chiantera, V., Sehouli, J., Kaufmann, A., Mechsner, S., 2016.\nCharacterization of endometriosis-associated immune cell in filtrates (EMaICI). Arch.\nGynecol. Obstet. 294 (September (3)), 657 –664.\nSchiemann, B., Gommerman, J.L., Vora, K., Cachero, T.G., Shulga-Morskaya, S., Dobles,\nM., Frew, E., Scott, M.L., 2001. An essential role for BAFF in the normal development\nof B cells through a BCMA-independent pathway. Science 293, 2111 –2114.\nSofo, V., Götte, M., Laganà, A.S., Salmeri, F.M., Triolo, O., Sturlese, E., Retto, G., Alfa, M.,\nGranese, R., Abrão, M.S., 2015. Correlation between dioxin and endometriosis: an\nepigenetic route to unravel the pathogenesis of the disease. Arch. Gynecol. Obstet.\n292 (November (5)), 973 –986 (Epub 2015 Apr 29) .\nStartseva, N.V., 1980. Clinical immunological aspects of genital endometriosis. Akush\nGinekol (Mosk) 3, 23 –26 (51) .\nStraub, R.H., 2007. The complex role of estrogens in in flammation. Endocr. Rev. 28\n(August (5)), 521 –574 (Epub 2007 Jul 19.).\nTosti, C., Pinzauti, S., Santulli, P., Chapron, C., Petraglia, F., 2015. Pathogenetic me-\nchanisms of deep in filtrating endometriosis. Reprod. Sci. 22 (September (9)),\n1053–1059 (Epub 2015 Jul 12) .\nVetvicka, V., Laganà, A.S., Salmeri, F.M., Triolo, O., Palmara, V.I., Vitale, S.G., Sofo, V.,\nKrálíčková, M., 2016. Regulation of apoptotic pathways during endometriosis: from\nthe molecular basis to the future perspectives. Arch. Gynecol. Obstet. 294 (5),\n897–904 (Epub 2016 Sep 15) .\nWeed, J.C., Arquembourg, P.C., 1980. Endometriosis: can it produce an autoimmune\nresponse resulting in infertility. Clin. Obstet. Gynecol. 23, 885 –893.\nWild, R.A., Shivers, C.A., 1985. Antiendometrial antibodies in patients with en-\ndometriosis. Am. J. Reprod. Immunol. Microbiol. 8, 84 –86.\nWitz, C.A., Montoya, I.A., Dey, T.D., Schenken, R.S., 1994. Characterization of lympho-\ncyte subpopulations and T cell activation in endometriosis. Am. J. Reprod. Immunol.\n32 (October (3)), 173 –179.\nYeol, S.G., Won, Y.S., Kim, Y.I., Lee, J.W., Choi, Y.J., Park, D.C., 2015. Decreased Bcl-6\nand increased Blimp-1 in the peritoneal cavity of patients with endometriosis. Clin.\nExp. Obstet. Gynecol. 42 (2), 156 –160.\nL.G.C.\nRiccio et al. Journal of Reproductive Immunology 123 (2017) 29–34\n34\n\n†L.G.C.R., M.J., C.C. and F.B. contributed equally to this work.\n© The Author(s) 2019. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.\nFor permissions, please e-mail: journals.permissions@oup.com\nHuman Reproduction, pp. 1–10, 2019\ndoi:10.1093/humrep/dez071\nORIGINAL ARTICLEGynaecology\nB lymphocytes inactivation by\nIbrutinib limits endometriosis\nprogression in mice\nL.G.C.Riccio1,2,4,†,M.Jeljeli 1,2,†,P.Santulli1,2,S.Chouzenoux 1,\nL.Doridot1,C.Nicco 1,F .M.Reis1,M.S.Abrão 4,C.Chapron 1,3,†,and\nF.Batteux1,5,†,*\n1Département ‘Développement, Reproduction et Cancer’, Institut Cochin, Institut National de la Santé et de la Recherche Médicale U1016,\nUniversité Paris Descartes, Sorbonne Paris Cité, 75679 Paris, France2Faculté de Médecine, Sorbonne Paris Cité, Université Paris Descartes,\n75679 Paris, France3Département de Gynécologie Obstétrique II et Médecine de la Reproduction, Assistance Publique-Hôpitaux de Paris,\nHôpital Universitaire Paris Centre, Centre Hospitalier Universitaire Cochin, 75679 Paris, France4Faculty of Medicine, Endometriosis\nDivision, Obstetrics and Gynecology Department, University of São Paulo, Av. Dr. Enéas de Carvalho Aguiar, 255, Cerqueira César\n05403-000, São Paulo, Brazil\n5Service d’Immunologie Biologique, Assistance Publique-Hôpitaux de Paris, Hôpital Universitaire Paris Centre,\nCentre Hospitalier Universitaire Cochin, 75679 Paris, France\n*Correspondence address. Service d’Immunologie Biologique, Hôpital Cochin, 75679 Paris cedex 14, France. Tel:+33-1-58-41-20-07;\nFax: +33-1-58-41-20-08; E-mail: frederic.batteux@cch.aphp.fr\nSubmitted on July 28, 2018; resubmitted on April 14, 2019; editorial decision on April 22, 2019\nSTUDY QUESTION:What are the effects of B lymphocyte inactivation or depletion on the progression of endometriosis?\nSUMMARY ANSWER:SkewingactivatedBcellstowardregulatoryBcells(Bregs)byBruton’styrosinekinase(Btk)inhibitionusingIbrutinib\nprevents endometriosis progression in mice while B cell depletion using an anti-CD20 antibody has no effect.\nWHATISKNOWNALREADY: Apolyclonalactivationof Bcellsandthepresenceof anti-endometrialautoantibodieshavebeendescribed\nin a large proportion of women with endometriosis though their exact role in the disease mechanisms remains unclear.\nSTUDY DESIGN, SIZE, DURATION:This study included comparison of endometriosis progression for 21 days in control mice versus\nanimals treated with the anti-CD20 depleting antibody or with the Btk inhibitor Ibrutinib that prevents B cell activation.\nPARTICIPANTS/MATERIALS, SETTING, METHODS:After syngeneic endometrial transplantation, murine endometriotic lesions\nwere compared between treated and control mice using volume, weight, ultrasonography, histology and target genes expression in lesions.\nPhenotyping of activated and regulatory B cells, T lymphocytes and macrophages was performed by flow cytometry on isolated spleen and\nperitoneal cells. Cytokines were assayed by ELISA.\nMAIN RESULTS AND THE ROLE OF CHANCE: Btk inhibitor Ibrutinib prevented lesion growth, reduced mRNA expression of\ncyclooxygenase-2, alpha smooth muscle actin and type I collagen in the lesions and skewed activated B cells toward Bregs in the spleen and\nperitoneal cavity of mice with endometriosis. In addition, the number of M2 macrophages decreased in the peritoneal cavity of Ibrutinib-\ntreatedmice comparedtoanti-CD20and controlmice. Depletion of Bcellsusingananti-CD20 antibody hadnoeffect onactivity and growth\nof endometriotic lesions and neither on the macrophages, compared to control mice.\nLARGE SCALE DATA:N/A.\nLIMITATIONS, REASONS FOR CAUTION:It is still unclear whether B cell depletion by the anti-CD20 or inactivation by Ibrutinib can\nprevent establishment and/or progression of endometriosis in humans.\nWIDER IMPLICATIONS OF THE FINDINGS:Further investigation may contribute to clarifying the role of B cell subsets in human\nendometriosis.\nSTUDY FUNDING/COMPETING INTEREST(S):This research was supported by a grant of Institut National de la Santé et de la\nRecherche Médicale and Paris Descartes University. None of the authors has any conflict of interest to disclose.\nKey words:endometriosis / B lymphocytes / Ibrutinib / Btk inhibitor / anti-CD20 / regulatory B cells / macrophages / mice\n...\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\n2 Riccio et al.\nIntroduction\nEndometriosis is a gynecological disorder characterized by the\npresence and growth of endometrial tissue outside the uterine\ncavity (Giudice and Kao, 2004 ). It affects ∼5–15% of women\nin reproductive age, causing chronic pelvic pain and infertility\n(Giudice and Kao, 2004). Menstrual regurgitation and implantation of\nendometrial fragments (Sampson, 1927) remain the most accepted\ntheory to explain the initiation of the disease while decreased\nperitoneal immunosurveillance (Matarese et al., 2003), hormonal,\ninflammatoryandfibroticfactorsareimplicatedinthedevelopmentof\nendometriotic lesions (D’Hooghe and Debrock, 2002; Vigano et al.,\n2017).\nEndometriosis is associated with an imbalance toward pro-\ninflammatory cytokines mainly produced by innate immune cells\nlike macrophages and natural killer cells (Beste et al., 2014). More-\nover, inflammation induces reactive oxygen species production in\nendometriotic cells that stimulates lesion growth and neoangiogen-\nesis through activation of various tyrosine kinases ( Santulli et al.,\n2015).\nInadditiontoinnateimmunity,cellsfromadaptiveimmunityalsoplay\na role in endometriosis (Riccio et al., 2018). Activation of CD4\n+ T\ncells has been described with an imbalance toward a T helper 2 (Th2)\nphenotype that drives the fibrosis of lesions (Chen et al., 2016), and\na combined increase in T helper 17 cells maintains the inflammatory\nprocess (Gogacz et al., 2016).\nB cells are important players of innate and adaptive immune\nresponses and their number is increased in the blood and peritoneal\ncavity of patients with endometriosis ( Riccio et al., 2017). A\npolyclonal activation of B cells and the presence of anti-endometrial\nautoantibodies (Wild and Shivers, 1985; Fernández-Shaw et al., 1993)\nhave been described in women with endometriosis though their exact\nrole in the disease mechanisms remains unclear.\nThus, in this report, we hypothesized that B cell depletion with\nanti-CD20antibodyorinactivationwithBruton’styrosinekinase(Btk)\ninhibitor Ibrutinib interfere with endometriosis progression. We have\ntestedthishypothesisinarelevantmousemodeltobettercharacterize\nthe role of B cells on this disease.\nMaterials and Methods\nMice\nSix-week-old BALB/c female mice (Charles River Laboratories,\nL’Arbresle, France) weighing 16–20 g were used, 10 animals per\nexperimental group for each independent experiment. Animals\nreceived humane care in compliance with institutional guidelines\nand were housed in autoclaved cages under standard 12 h pho-\ntoperiod with food and water available ad libitum . The study was\napproved by the Ethics Committee of Paris Descartes Univer-\nsity (CEEA 34), Paris (PROJET N\no 2016040716219897 – V6 –\nAPAFiS # 7283).\nMice model of endometriosis\nEndometriosiswassurgicallyinducedinmicebysyngeneictransplanta-\ntion of uterine tissue as previously described byMarcellin et al. (2017)\n(Supplementary Fig. S1).\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\nIn vivo treatment of the operated mice\nThe operated mice were randomly separated into three groups: Ibru-\ntinib, Anti-CD20 and Control. The Ibrutinib Group was treated with\n15 mg/kg/day (Honigberg et al., 2010) of Ibrutinib (Pharmacyclics,\nSunnyvale, USA). The drug was diluted in 0.06% carboxymethyl\ncellulose/H\n2O and administered by oral gavage with sesame oil\ndaily, for 21 days, starting on the day of the surgery. The Anti-\nCD20 Group received an intraperitoneal 100 μg single dose of\nanti-CD20 antibody (clone 5D2, isotype IgG2a, kindly provided by\nGenentech, USA) the day after the surgery. The Control Group\nreceived vehicle by daily oral gavage for 21 days. Twenty-one days\nafter implantation, animals were sacrificed by cervical dislocation, and\nretro-orbitalbloodsamplewascollected.Peritonealcavitywashingwas\nperformedwithinfusionandaspirationof 10mLof phosphatebuffered\nsaline (PBS) to extract peritoneal cells, and spleens were surgically\nremoved. Endometriotic implants were also collected, weighed and\nmeasured using a rule caliper. Tumors’ volume (TV) were calculated\nas follows: TV (mm\n3) =(L×W2)/2, where L is the longest and W is\nthe shortest measure of the lesion in mm (Tomayko and Reynolds,\n1989). The right side implant of each mouse was fixed with 10%\nformaldehydeforsubsequenthistologicalanalyses.Theleftsideimplant\nwas frozen in liquid nitrogen for further RNA extraction and reverse\ntranscription followed by Quantitative real-time PCR (RT-qPCR)\nanalyses.\nUltrasonography to evaluate implants size\nTheendometrioticimplantsweremeasuredatDay7andDay20after\nthe surgery through serial ultrasonography as previously described by\nSantulli et al. (2016)( Supplementary Fig. S2).\nHistology\nImplants fixed with 10% formaldehyde were set in paraffin. Serial\n4 μm sections were prepared and stained with hematoxylin & eosin\n(H&E) and Sirius Red (SR) prior to histological examination by light\nmicroscopy. Stained tissue sections were examined by pathologists\nexperienced in endometriosis (P.S. and F.B.).\nRNA extraction and reverse transcription\nfollowed by RT-qPCR\nTotal RNA extraction was performed with Trizol Reagent (Invitrogen,\nCarlsbad, USA), according to the manufacturer’s instructions, and\nit was followed by reverse transcription quantitative PCR reaction\nusing Qiagen one-step kit. Eight target genes—Cyclooxygenase-2\n(COX-2), alpha smooth muscle actin (ASMA), type I Collagen, CD3,\nCD19, inducible nitric oxide synthase (iNOS), CD86 and Found in\ninflammatory zone 1 (Fizz-1)—and one reference gene, Beta-actin\n(B-actin) as internal control, were analyzed by RT-qPCR (primers are\nlisted inSupplementary Table SI).\nCell stimulation and flow cytometry\nSplenocytes and peritoneal cells were isolated and stained for\nsurface receptors using standard flow cytometric protocols. Flow\ncytometry was performed using a FACS Fortessa II flow cytometer\n(BD Biosciences, USA) according to standard techniques, and data\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\nB lymphocytes inactivation limits endometriosis 3\nwere analyzed with FlowJo software (TreeStar, Ashland, USA). The\npanel of antibodies used for cell surface staining and the FACS gating\nstrategies are described inSupplementary Figs. S3-S5.\nELISA assays\nSerum and supernatant from cultured peritoneal cells were diluted\n(1:4) in ELISA/ELISPOT diluent 1 × before being distributed on\nELISA 96-well plates specific of tumor necrosis factor alpha (TNFA),\ninterleukin 1 beta (IL-1B), interleukin 4 (IL-4), interleukin 6 (IL-6),\ninterleukin 10 (IL-10), interleukin 13 (IL-13) and interferon gamma\n(IFNG) (Mouse ELISA Ready-SET-Go! eBioscience, Austria). Con-\n....\n.\n...\n...\n...\n.\n...\n...\n...\ncentrations were calculated from a standard curve according to the\nmanufacturer’s protocol.\nStatistical analysis\nAll data were analyzed using GraphPad Prism 5 software (GraphPad\nSoftware Inc., California, USA). A one-way analysis of variance\n(ANOVA)wasperformedtocomparethethreeexperimentalgroups.\nWhen group means were significantly different using the one-way\nANOVA, pairwise comparisons were performed using Student–\nNewman–Keuls (SNK) post hoc test. The results from experiments\ncomparingonlytwogroups(ControlandIbrutinib)wereanalyzedwith\nFigure 1 Effects of B cell modulating treatment on endometriotic implants development in mice.(a) Macroscopic view of the\nimplants. (b) Ultrasonography images of peritoneal implants in mice on Day 20. (c) Coloration with H&E of implants at Day 21. (d) Coloration with\nSR of implants at Day 21. (e) Volume of the endometriotic implants on Day 21. (f) Weight of the implants on Day 21. (g) Ratio of the implants\nvolume evaluated through ultrasound between Day 20 (D20) and Day 7 (D7). Data are mean±SEM. Each group hadn =10 mice. The one-way\nANOVA was performed to detect significant differences among the three groups and further pairwise comparisons were performed using SNK test.\nNS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001. Scale bar, 100 μm.\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\n4 Riccio et al.\nFigure 2 B cell phenotype analysis in spleen and peritoneal cavity of endometriotic mice.Frequency of B cells (B220+CD19+)i n\nspleen (a) and peritoneal cavity (d) of mice. Data represent mean±SEM. Surface CD40 expression in B cells (activated B cells) in spleen (b)a n d\nperitonealcavity( e).DatarepresenttheMFIof CD40expression ±SEM.Frequencyof Breg(B220 +CD19+CD5+CD1dhigh)inspleen( c)andperitoneal\ncavity (f). Data represent mean±SEM. Gating strategy for identification of B regulatory cell frequency in Control Group (g) and Ibrutinib Group (h).\nEach group hadn =10 mice. The one-way ANOVA was performed to detect significant differences among the three groups and further pairwise\ncomparisons were performed using SNK test. NS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001.\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\nB lymphocytes inactivation limits endometriosis 5\nthe Mann–Whitney test. In the figures, the error bars represent the\nstandard error of the mean (SEM). AP-value of <0.05 was accepted\nas significant.\nResults\nEffects of B cells treatments on\nendometriotic implants development\nin mice\nAfter 21 days of treatment, the Btk inhibitor Ibrutinib was effective in\nreducing the development of endometriosis in mice (Fig. 1). Animals\nin this group had smaller and less active implants (no fresh blood, no\nangiogenesisandfewglands),whereasControlandAnti-CD20Groups\nshowedpersistent,largerandmoreactivelesionsthroughmacroscopic\n(Fig. 1a) and microscopic (Fig. 1cand d) evaluations. Implant volume\n(Fig. 1e) and weight (Fig. 1f) from Ibrutinib Group were significantly\nreduced at Day 21 compared to Control and Anti-CD20 Groups. An\nultrasoundimaginganalysisof theimplantswasalsoperformedatDay\n7andatDay20aftertheprocedure( Fig. 1b),demonstratingareduced\nvolume in the Ibrutinib Group compared to Control and Anti-CD20\nGroups (Fig. 1g).\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n..\nFlow cytometry analysis of B\ncells populations\nAnti-CD20treatmentdepletedallBcells(definedasB220 +CD19+)in\nthe spleen and peritoneum compared to Control Group (Fig. 2) while\nIbrutinib treatment did not affect the percentage of splenic (Fig. 2a)\nor peritoneal B cells (Fig. 2d). Activation of B cells was assessed\nby mean fluorescence intensity (MFI) of the co-stimulatory CD40\nmarker expression within the B cell population. Ibrutinib treatment\ndecreasedBcellsactivationinthespleen( Fig. 2b)andperitonealcavity\n(Fig. 2e) compared to Control Group. When gating (Fig. 2gand h)\non the CD19\n+CD5+CD1dhigh subset, known as regulatory B cells\n(Bregs) (Rosser and Mauri, 2015), we observed a total depletion with\nthe Anti-CD20 treatment. Interestingly, Ibrutinib treatment induced\nan important increase in the frequency of splenic Breg population\ncompared to the Control Group (Fig. 2c). No significant difference\nwas observed in the Breg population in the peritoneal cavity between\nIbrutinib and Control Groups (Fig. 2f).\nB cell blockade impacted the distribution\nof M1 and M2 macrophage subsets\nConcerning macrophage distribution, Ibrutinib treatment induced, in\nthe spleen, an important decrease in the frequency of the M1 subset\nFigure 3 Macrophage M1/M2 distribution in spleen and peritoneal cavity in endometriotic mice.Macrophages were gated on\nCD11b+F4/80+ cellsisolatedfromspleen( aandb)andfromtheperitonealcavity( dande).M1macrophages( aandd)werefurthercharacterizedas\nCD43+ andLy6Chigh andM2macrophages( bande)asCD206 + andLy6Clow.Theratioof M1/M2populationwascalculated( candf).Datarepresent\nmean ±SEM. Each group hadn =10 mice. The one-way ANOVA was performed to detect significant differences among the three groups and further\npairwise comparisons were performed using SNK test. NS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001.\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\n6 Riccio et al.\n(Fig. 3a) and a significant increase in the M2 subset (Fig. 3b) compared\nto Control and Anti-CD20 Groups, resulting in a decreased M1/M2\nratio (Fig. 3c). An opposite variation was observed in the peritoneal\ncavity, where Ibrutinib increased the frequency of M1 (Fig. 3d) while\nreducing M2 (Fig. 3e) compared to Control and Anti-CD20 Groups,\nresulting in an increased M1/M2 ratio (Fig. 3f). There was no sig-\nnificant difference in M1 or M2 frequency or M1/M2 ratio in the\nspleen(Fig. 3a–c)betweenAnti-CD20andControlGroups.However,\nin the peritoneal cavity, an increased M1 frequency (Fig. 3d) was\nobserved in Anti-CD20 Group compared to Controls, leading to a\nsignificant difference in the M1/M2 ratio (Fig. 3f) between the two\ngroups.\nEffects of Ibrutinib in quantitative expression\nof genes in endometriotic implants of mice\nIbrutinib Group showed a 5-fold reduction of mRNA expression of\nCOX-2inthelesionscomparedtoControlGroup( Fig. 4a).Theeffects\nof Ibrutinib treatment on fibrosis were assessed by ASMA (Fig. 4b)\nand type I collagen (Fig. 4c) mRNA expression in the implants, and\nboth were significantly reduced in this group, compared to controls.\nThere were no differences in these inflammatory and fibrotic markers\nbetween the Anti-CD20 Group and the controls. To evaluate the\nimmune cells infiltration in the implants, we have analyzed the mRNA\nexpression of the following markers as a proxy: CD19 (for B cells,\nFig. 4d), iNOS and CD86 expression (for M1 macrophages,Fig. 4e\nand f, respectively) were increased in the Ibrutinib Group while Fizz-1\nexpression (for M2 macrophages,Fig. 4g) was decreased in Ibrutinib\nGroup, compared to Control Group. CD3 expression (for T lym-\n..\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\nphocytes, Fig. 4h) was not significantly different between Ibrutinib and\nControl groups.\nEffects of Ibrutinib on T lymphocytes\nTherewerenosignificantdifferencesinTlymphocytessubsetsnumber\nor activation. Indeed, the total number or proportion of naïve\n(definedasCD62L\nhigh CD44low)ormemory(CD62L low CD44high)CD4 +\nand CD8+ T cells were not significantly different in the peritoneum\nor in the spleen of mice between Ibrutinib and Control Group\n(Supplementary Fig. S6).\nIbrutinib treatment effects in cytokine\nbalance\nWe have measured cytokine concentration in the serum (Fig. 5) and\nperitoneal fluid (Fig. 6) of endometriotic mice. In the sera, treatment\nof animals with Ibrutinib decreased TNFA (Fig. 5a) and IL-6 con-\ncentrations (Fig. 5b) and increased IL-10 levels compared to Con-\ntrol Group (Fig. 5c); no significant difference was observed for IL-13\nlevels (Fig. 5d). In the peritoneal fluid, Ibrutinib treatment increased\nIFNG concentration (Fig. 6d) and decreased IL-13 (Fig. 6e) and IL-4\nconcentrations (Fig. 6f) when compared to controls. No differences\nin peritoneal concentrations of TNFA (Fig. 6a), IL-6 (Fig. 6b), IL-10\n(Fig. 6c) or IL-1B (Fig. 6g) were observed with Ibrutinib treatment\ncompared to controls.\nDiscussion\nMany studies have attempted to clarify the role of the immune system\ninendometriosisandvariousabnormalitieshavebeendetected,includ-\nFigure 4 Effects of Ibrutinib in quantitative expression of genes in endometriotic implants of mice.(a)C O X - 2 ;(b)A S M A ;(c)T y p e\n1 collagen; (d) CD19 (for B lymphocytes); (e) iNOS (for M1 macrophages); (f)C D 8 6( f o rM 1m a c r o p h a g e s ) ;(g)F i z z - 1( f o rM 2m a c r o p h a g e s )a n d\n(h) CD3 (for T lymphocytes) mRNA levels. Data are normalized to the reference gene (B-actin) and are expressed as ratio versus Control Group.\nEach group hadn =10 mice. Mean values were compared by using the Mann–Whitney test. NS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001.\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\nB lymphocytes inactivation limits endometriosis 7\nFigure 5 Effects of Ibrutinib on systemic cytokines of endometriotic mice.(a)T N F A ;(b)I L - 6 ;(c)I L - 1 0a n d(d) IL-13 concentrations in\ntheseraof micemeasuredbyELISA.Datarepresentmean ±SEM.Eachgrouphad n =10mice.TheMann–Whitneytestwasusedtodetectsignificant\ndifferences. NS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001.\nFigure 6 Effects of Ibrutinib on peritoneal cytokines of endometriotic mice.(a)T N F A ;(b)I L - 6 ;(c) IL-10; (d)I F N G ;(e) IL-13; (f)I L - 4\nand (g) IL-1B concentrations in peritoneal fluid of mice measured by ELISA. Data represent mean±SEM. Each group hadn =10 mice. The Mann–\nWhitney test was used to detect significant differences. NS, non-significant;∗P ≤ 0.05; ∗∗P ≤ 0.01; ∗∗∗P ≤ 0.001.\ning increased B lymphocytes number and activation with excessive\nproductionof autoantibodies.Inordertoevaluatetheroleof Bcellson\nendometriosis we have used a dual strategy: a complete depletion of\nB cells using anti-CD20 treatment or an immunomodulatory strategy\nusing a Btk inhibitor that blocks B cells activation.\nIn this report, we have shown that anti-CD20 had no impact on\nthe course of the disease with no differences in the size of lesions\ndespite a confirmed complete B cells depletion, maintained 3 weeks\nafter the injection of the antibody. Anti-CD20-mediated depletion of\nB cells has been widely used in humans for the treatment of both B\ncell malignancies and autoimmune and systemic inflammatory diseases\n(Edwards et al., 2004;Harrison, 2012).\nBy contrast, treatment with Ibrutinib reduced the size and the\nactivity of the lesions, as well as the expression of inflammatory\nand fibrotic markers. Progression of endometriotic lesions has been\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n..\nassociated with chronic inflammation and fibrosis leading to an altered\ntissue function. COX-2 produces prostaglandins and is involved in the\ninflammatory response that contributes to lesion activity and growth\ninendometriosis( Santulli et al.,2016).Moreover,increasedexpression\nof typeIcollagenandASMA,markingmyofibroblastdifferentiation,has\nalso been associated with severe forms of endometriosis (González–\nForuria et al., 2017; Vigano et al., 2017).\nIbrutinib is a selective covalent and irreversible inhibitor of Btk, a\nnon-receptor kinase essential for B cells development and function\nof mature B cells. Shortly after its discovery, Btk was placed in the\nsignaltransductionpathwaydownstreamof theBcellantigenreceptor\nand was found to have a major role in the control of B cell activation\n(Herman et al., 2011). Many in vitro and in vivo studies confirm the\nspecific activity of Ibrutinib against Btk-restricted targets (Honigberg\net al., 2010; Woyach et al., 2012). Inhibitors of Btk have shown\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\n8 Riccio et al.\nFigure 7 Summary of Ibrutinib effects that controlled endometriosis progression in mice.\nanti-tumor activity, first in animal models and subsequently in the\nclinics, with durable remissions against a variety of B cell malignancies\n(Harrison, 2012).\nThe role of Btk in the development of Bregs is unclear (Rosser\nand Mauri, 2015). However, in mice lacking B cell linker, a Btk\nadaptor molecule also implicated in B cell signaling; the percentages\nof CD1d\nhiCD5+ Bregs were markedly increased (Jin et al., 2013)\nas observed in the present study in Ibrutinib-treated endometriotic\nmice.\nTheeffectof Ibrutinibonthecourseof endometriosiscomparedto\nanti-CD20treatmentledustoinvestigateextraBcell-mediatedeffects\nof Btk. Growing evidence also suggests roles for Btk in mononuclear\ncells of the innate immune system, especially macrophages (Weber\net al., 2017). Macrophages play a central role in the orchestration\nof inflammation and fibrosis in endometriosis and undergo equally\npolarized activation into the M1 (classically) and M2 (alternatively)\nactivated subsets (Bacci et al., 2009). Btk has been shown to regulate\nmacrophage polarization in response to various stimuli with a skew\nfrom M1 to M2 macrophages (Ní Gabhannet al., 2014).\nThe discrepancy between the profile of macrophages in the spleen\nand in the peritoneal cavity can be related to the role of Btk in cellular\nmigration (de Gorter et al., 2007). Btk combines with Rac to mod-\nulate actin polymerization and cytoskeleton rearrangement, impact-\ning on inflammatory mast cells or neutrophils recruitment (Kuehn\net al.,2010),throughmacrophage-1antigen(MAC-1)activation.Since\nMAC-1 is also expressed on macrophages, such phenomenon may\nexplain the inhibition of M2 cells migration into the peritoneal cavity\ninendometrioticmicetreatedwithIbrutinib.Interestingly,theincrease\nintheperitonealM1/M2ratiomayparticipateof thetherapeuticeffect\nof Ibrutinib. Bacci et al. (2009) have shown a correlation between\nactive endometriosis and an increased number of M2 cells in the\nperitoneal cavity of women and mice and that early injections of\nM2 cells aggravate endometriosis in mice while injections of M1 cells\nprevent it.\n....\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n..\nT lymphocytes play an important role in the development of\nendometriosis (Riccio et al., 2018). In the present study, Ibrutinib\nhad no effect on peritoneal or splenic T lymphocytes number or\nactivation, and there was no difference in CD3 gene expression in\nthe endometriotic implants from endometriotic mice treated or not\nwith ibrutinib. Ibrutinib impacts mainly B cell through interaction with\nBtk, but investigators (Kokhaei et al., 2016; Long et al., 2017)h a v e\ndescribed Ibrutinib also as an Interleukin-2-inducible T-cell kinase (Itk)\ninhibitor, subverting Th2 immunity and potentializing T helper 1-based\nimmune responses (Dubovsky et al., 2013). However, the affinity of\nIbrutinib for Btk is 20 times higher than the one for Itk (Honigberg\net al., 2010), and the double Btk–Itk inhibition was achieved with\na 25 mg/kg/day dose (Dubovsky et al., 2014), much higher than\nthe one used in our study. Thus, the findings of effective control\nof endometriosis progression by Ibrutinib seem to be due to its\nBtk inhibition pathway and to its effects on Bregs rather than its\nrole on T cells. The use of a more selective Btk inhibitor such as\nAcalabrutinib could confirm the mechanisms behind Ibrutinib’s effects\non endometriosis progression.\nRegarding cytokine production, B cells overexpressing wild-type Btk\nwere selectively hyper responsive to B cell receptor stimulation and\nshowed enhanced Ca\n2+ influx, nuclear factor-κB activation, resistance\nto Fas-mediated apoptosis and defective elimination of self-reactive\nB cellsin vivo, consistent with the pro-inflammatory and autoimmune\nrole of Btk (Kil et al., 2012). As a result, the high production of IL-6\nby B cells from CD19-hBtk transgenic mice (Corneth et al., 2016) fits\nwith the decrease in inflammatory cytokines IL-6 and TNFA induced\nby Ibrutinib in our experiments. The role of Btk in IL-10 production\nis more complex as Btk\n−/− mice have been shown to overproduce\nIL-10 but not IL-6 upon allergic challenge. That means that Btk may\nsupport IL-10 secretion upon an immuno-inflammatory challenge as\nobserved in Ibrutinib-treated endometriotic mice, further supporting\nthe anti-inflammatory role of this molecule (Lundy et al., 2005). In\nendometriosis, decreased levels of IL-6 and increased IL-10 have been\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\nB lymphocytes inactivation limits endometriosis 9\nassociated with an amelioration of endometriosis as observed in our\nmodel (Schwager et al., 2011).\nTreatment of endometriotic animals with Ibrutinib led to high con-\ncentration of peritoneal IFNG and low concentrations of peritoneal\nIL-4andIL-13comparedtocontrols.Thoseresultsarecompatiblewith\ntheM1/M2macrophagesfindingsasM1macrophagesemergefroman\nenvironmentrichinIFNGandM2macrophagesproducehighamounts\nof IL-4 and IL-13 (Ní Gabhannet al., 2014).\nStrengths and limitations\nInfertilityisoneof themainissuesof endometriosis;however,mostof\nthe non-surgical treatment options available are contraceptive, leaving\nwomen affected by the disease with the difficult choice between\ncontrolling the pain and trying to conceive. Many studies have demon-\nstrated the important role of the immune system in the progression\nof endometriosis, so this could be a main target for the development\nof new non-hormonal therapeutic strategies. In the present study we\nhavetestedadrugapprovedbytheFoodandDrugAdministrationthat\ntargetimmunecellsanditwaseffectiveincontrollingthedisease’spro-\ngression in mice. The effects of Ibrutinib’s treatment are summarized\nin Fig. 7. This study has the limitations of using an animal model and\nperhapsnotcompletelyclarifyingthemechanismsandpathwaysof the\ndrug efficacy observed. There is still a long path before applying these\nfindingsforhumantreatment;however,theycanopenadoortofurther\nstudies and the development of new immunoregulatory therapeutic\nstrategies for endometriosis.\nConclusion\nWe conclude that Btk inhibitor Ibrutinib controlled endometriosis\nprogression in mice while total B cell depletion using an anti-CD20\nantibody had no effect on the course of the disease. In addition,\nour findings suggest that Bregs might help blocking the development\nof lesions, as these cells were depleted by anti-CD20 antibody and\npreserved by Ibrutinib. The use of Ibrutinib to skew activated B\ncells toward Bregs and increase the M1/M2 ratio into the peritoneal\ncavity opens new perspectives in both understanding and treating\nendometriosis.\nSupplementary data\nSupplementary data are available atHuman Reproduction online.\nAcknowledgements\nThe authors are grateful to all the members of INSERM U1016-\nBatteux,InstitutCochin,FranceandEndometriosisDivisionof Obstet-\nrics and Gynecology Department of University of São Paulo, Brazil.\nThe authors are also thankful to Olivier Cerles, PhD for his assistance\nin revising English language.\nAuthors’ roles\nF.B.andC.C.conceivedanddesignedthestudy.L.G.C.R.,M.J.,S.C.and\nP.S.executedtheexperiments.Alltheauthorsanalyzedandinterpreted\nthe data. P.S., L.D., M.S.A. and F.B. supervised and reviewed the\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\nstatistical analysis. S.C. and L.D. contributed to the data collection.\nL.G.C.R., M.J., F.B., F.R., P.S., M.S.A. and C.C. drafted the manuscript.\nAll the authors read and approved the final version of the manuscript.\nFunding\nInstitut National de la Santé et de la Recherche Médicale; University\nParis Descartes.\nConflict of interest\nThe authors state no conflict of interest.\nReferences\nBacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, Camisa B,\nMariani M, Brignole C, Ponzoni M, Ferrari S,et al. Macrophages are\nalternatively activated in patients with endometriosis and required\nfor growth and vascularization of lesions in a mouse model of\ndisease. Am J Pathol 2009;175:547–556.\nBesteMT,Pfäffle-DoyleN,PrenticeEA,MorrisSN,LauffenburgerDA,\nIsaacsonKB,GriffithLG.Molecularnetworkanalysisof endometrio-\nsisrevealsaroleforc-Jun-regulatedmacrophageactivation. Sci Transl\nMed 2014;6:222ra16.\nChen P, Wang DB, Liang YM. Evaluation of estrogen in endometriosis\npatients: regulation of GATA-3 in endometrial cells and effects on\nTh2 cytokines.J Obstet Gynaecol Res 2016;42:669–677.\nCornethOB,deBruijnMJ,RipJ,AsmawidjajaPS,KilLP,HendriksRW.\nEnhanced expression of Bruton’s tyrosine kinase in B cells drives\nsystemic autoimmunity by disrupting T cell homeostasis.J Immunol\n2016;197:58–67.\nde Gorter DJ, Beuling EA, Kersseboom R, Middendorp S, van Gils\nJM, Hendriks RW, Pals ST, Spaargaren M. Bruton’s tyrosine kinase\nand phospholipase Cgamma2 mediate chemokine-controlled B cell\nmigration and homing.Immunity 2007;26:93–104.\nD’Hooghe TM, Debrock S. Endometriosis, retrograde menstruation\nand peritoneal inflammation in women and in baboons.Hum Reprod\nUpdate2002;8:84–88.\nDubovsky JA, Beckwith KA, Natarajan G, Woyach JA, Jaglowski\nS, Zhong Y, Hessler JD, Liu TM, Chang BY, Larkin KM,\net al. Ibrutinib is an irreversible molecular inhibitor of ITK driv-\ning a Th1-selective pressure in T lymphocytes. Blood 2013;122:\n2539–2549.\nDubovsky JA, Flynn R, Du J, Harrington BK, Zhong Y, Kaffenberger B,\nYangC,TownsWH,LehmanA,JohnsonAJ, et al.Ibrutinibtreatment\nameliorates murine chronic graft-versus-host disease.J Clin Invest\n2014;124:4867–4876 Epub 2014 Oct 1.\nEdwards JC, Szczepanski L, Szechinski J, Filipowicz-Sosnowska A,\nEmeryP,CloseDR,StevensRM,ShawT.Efficacyof B-cell-targeted\ntherapywithrituximabinpatientswithrheumatoidarthritis. NE n g lJ\nMed 2004;350:2572–2581.\nFernández-Shaw S, Hicks BR, Yudkin PL, Kennedy S, Barlow DH,\nStarkey PM. Anti-endometrial and anti-endothelial auto-antibodies\nin women with endometriosis.Hum Reprod 1993;8:310–315.\nGiudice LC, Kao LC. Endometriosis.Lancet2004;364:1789–1799.\nGogacz M, Winkler I, Bojarska-Junak A, Tabarkiewicz J, Semczuk A,\nRechberger T, Adamiak A. Increased percentage of Th17 cells in\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019\n\n\n10 Riccio et al.\nperitonealfluidisassociatedwithseverityof endometriosis. J Reprod\nImmunol 2016;117:39–44.\nGonzález-ForuriaI,SantulliP,ChouzenouxS,CarmonaF,ChapronC,\nBatteuxF.Dysregulationof theADAM17/Notchsignallingpathways\nin endometriosis: from oxidative stress to fibrosis.Mol Hum Reprod\n2017;23:488–499.\nHarrison C. Trial watch: BTK inhibitor shows positive results in B cell\nmalignancies. Nat Rev Drug Discov 2012;11:96.\nHermanSE,GordonAL,HertleinE,RamanunniA,ZhangX,Jaglowski\nS, Flynn J, Jones J, Blum KA, Buggy JJ,et al. Bruton tyrosine kinase\nrepresents a promising therapeutic target for treatment of chronic\nlymphocyticleukemiaandiseffectivelytargetedbyPCI-32765. Blood\n2011;117:6287–6296.\nHonigberg LA, Smith AM, Sirisawad M, Verner E, Loury D, Chang\nB, Li S, Pan Z, Thamm DH, Miller RA,et al. The Bruton tyrosine\nkinase inhibitor PCI-32765 blocks B-cell activation and is efficacious\nin models of autoimmune disease and B-cell malignancy.Proc Natl\nAcad Sci U S A 2010;107:13075–13080.\nJin G, Hamaguchi Y, Matsushita T, Hasegawa M, Le Huu D, Ishiura\nN, Naka K, Hirao A, Takehara K, Fujimoto M. B-cell linker protein\nexpression contributes to controlling allergic and autoimmune dis-\neases by mediating IL-10 production in regulatory B cells.J Allergy\nClin Immunol 2013;131:1674–1682.\nKil LP, de Bruijn MJ, van Nimwegen M, Corneth OB, van Hamburg JP,\nDingjanGM,ThaissF,RimmelzwaanGF,ElewautD,DelsingD, et al.\nBtklevelssetthethresholdforB-cellactivationandnegativeselection\nof autoreactive B cells in mice.Blood 2012;119:3744–3756.\nKokhaeiP,Jadidi-NiaraghF,SotoodehJahromiA,OsterborgA,Mellst-\nedt H, Hojjat-Farsangi M. Ibrutinib—a double-edge sword in cancer\nand autoimmune disorders.J Drug Target 2016;24:373–385.\nKuehn HS, Rådinger M, Brown JM, Ali K, Vanhaesebroeck B, Beaven\nMA, Metcalfe DD, Gilfillan AM. Btk-dependent Rac activation\nand actin rearrangement following FcepsilonRI aggregation pro-\nmotes enhanced chemotactic responses of mast cells. J Cell Sci\n2010;123:2576–2585.\nLong M, Beckwith K, Do P, Mundy BL, Gordon A, Lehman AM,\nMaddocksKJ,CheneyC,JonesJA,FlynnJM, et al.Ibrutinibtreatment\nimproves T cell number and function in CLL patients.J Clin Invest\n2017;127:3052–3064.\nLundySK,BerlinAA,MartensTF,LukacsNW.Deficiencyof regulatory\nB cells increases allergic airway inflammation.Inflamm Res 2005;54:\n514–521.\nMarcellin L, Santulli P, Chouzenoux S, Cerles O, Nicco C, Dousset B,\nPallardyM,Kerdine-RömerS,JustPA,ChapronC, et al.Alterationof\nNrf2 and glutamate cysteine ligase expression contribute to lesions\n..\n...\n...\n.\n...\n...\n...\n.\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n...\n...\n...\n.\n..\ngrowthandfibrogenesisinectopicendometriosis. Free Radic Biol Med\n2017;110:1–10.\nMatarese G, De Placido G, Nikas Y, Alviggi C. Pathogenesis of\nendometriosis: natural immunity dysfunction or autoimmune dis-\nease? Trends Mol Med 2003;9:223–228.\nNí Gabhann J, Hams E, Smith S, Wynne C, Byrne JC, Brennan K,\nSpenceS,KissenpfennigA,JohnstonJA,FallonPG, et al.Btkregulates\nmacrophagepolarizationinresponsetolipopolysaccharide. PLoS One\n2014;9:e85834.\nRiccio LDGC, Santulli P, Marcellin L, Abrão MS, Batteux F, Chapron\nC.Immunologyof endometriosis. Best Pract Res Clin Obstet Gynaecol\n2018;50:39–49.\nRiccioLGC,BaracatEC,ChapronC,BatteuxF,AbrãoMS.Theroleof\nthe B lymphocytes in endometriosis : a systematic review.J Reprod\nImmunol 2017;123:29–34.\nRosser EC, Mauri C. Regulatory B cells: origin, phenotype, and func-\ntion. Immunity 2015;42:607–612.\nSampson JA. Peritoneal endometriosis due to premenstrual dissemi-\nnation of endometrial tissue into the peritoneal cavity.Am J Obstet\nGynecol1927;14:422–469.\nSantulli P, Marcellin L, Chouzenoux S, Boulard V, Just PA, Nicco C,\nChereauC,TostiC,ChapronC,BatteuxF.Roleof theproteinkinase\nBRAFinthepathogenesisof endometriosis. Expert Opin Ther Targets\n2016;20:1017–1029.\nSantulli P, Marcellin L, Tosti C, Chouzenoux S, Cerles O, Borghese B,\nBatteux F, Chapron C. MAP kinases and the inflammatory signaling\ncascade as targets for the treatment of endometriosis?Expert Opin\nTher Targets2015;19:1465–1483.\nSchwager K, Bootz F, Imesch P, Kaspar M, Trachsel E, Neri D.\nThe antibody-mediated targeted delivery of interleukin-10 inhibits\nendometriosis in a syngeneic mouse model.Hum Reprod 2011;26:\n2344–2352.\nTomayko MM, Reynolds CP. Determination of subcutaneous tumor\nsize in athymic (nude) mice.Cancer Chemother Pharmacol 1989;24:\n148–154.\nVigano P, Candiani M, Monno A, Giacomini E, Vercellini P, Somigliana\nE. Time to redefine endometriosis including its pro-fibrotic nature.\nHum Reprod 2017;1:1–6.\nWeber ANR, Bittner Z, Liu X, Dang TM, Radsak MP, Brunner C.\nBruton’s tyrosine kinase: an emerging key player in innate immunity.\nFront Immunol 2017;8:1454.\nWild RA, Shivers CA. Antiendometrial antibodies in patients with\nendometriosis. Am J Reprod Immunol Microbiol 1985;8:84–86.\nWoyachJA,JohnsonAJ,ByrdJC.TheB-cellreceptorsignalingpathway\nas a therapeutic target in CLL.Blood 2012;120:1175–1184.\nDownloaded from https://academic.oup.com/humrep/advance-article-abstract/doi/10.1093/humrep/dez071/5523893 by INSERM user on 28 June 2019","source_license":"CC0","license_restricted":false}