{"paper_id":"f2273e63-7683-473e-aa45-bb68a1600c48","body_text":"Cervical cancer remains a significant health concern, ranking among the most\nprevalent cancers affecting women worldwide. In 2020 alone, there were an estimated\n604,127 new cases and 341,831 deaths globally ( Singh\net al., 2023 ). While persistent infection with one of approximately 15\nhigh-risk human papillomavirus (hrHPV) types is a well-established cause of cervical\ncancer ( Bosch et al., 2002 ), increasing\nevidence suggests that some cervical tumors, particularly adenocarcinomas, may not\nbe linked to HPV infection ( Park, 2020 ). In\nthis sense, chronic inflammation of the cervix (cervicitis), can lead to several\nadverse outcomes, including pelvic inflammatory disease, endometriosis, infertility,\nand preterm birth. While cervicitis is often attributed to bacterial infections, the\npresence of hrHPV sequences has been detected in some cases. Women experiencing\ncervicitis concurrently with HPV infection appear to have an elevated risk of\ndeveloping low and high-grade squamous intraepithelial lesions (LSIL and HSIL,\nrespectively) and, ultimately, cervical cancer ( Koutsky et al., 1992 ;  Fernandes et al.,\n2015 ). Cancer-related chronic inflammation promotes the activation of\nintracellular signaling pathways, which in turn induce numerous transcription\nfactors, including NF-κB, STAT, and FOXO ( Zhao et\nal., 2021 ;  Kim et al., 2022 ).\nThese transcription factors modulate the expression of a wide range of genes,\nincluding those encoding orphan G protein-coupled receptors (oGPCRs). GPCRs are\ncell-surface receptors that transmit extracellular signals into intracellular\npathways by activating heterotrimeric G proteins. While the endogenous ligands for\nmany orphan GPCRs remain unidentified, their importance in various diseases,\nincluding cancer, has been clearly demonstrated ( Tang et al., 2012 ). For instance, GPR161, a negative regulator of Sonic\nhedgehog (Shh) signaling during neural tube development, has been shown to play a\nrole in medulloblastoma. In mouse neural stem cells, suppressing GPR161 increased\ndownstream Shh pathway activity, leading to increased granule cell generation and\nproliferation, ultimately contributing to higher tumor incidence and medulloblastoma\npathogenesis ( Shimada et al., 2018 ). GPR132\nfunctions as a key macrophage sensor, detecting elevated lactate levels within the\nacidic tumor microenvironment. This sensing plays a crucial role in mediating the\nreciprocal interactions between cancer cells and macrophages during breast cancer\nmetastasis ( Chen et al., 2017 ). Also, GPR20\nhas been identified as a non-tyrosine kinase target in gastrointestinal stromal\ntumor (GIST) ( Iida et al., 2021 ); meanwhile,\nthe GPR139 gene has been identified in glioblastoma multiforme samples ( Ren et al., 2021 ).\nTherefore, this study investigated the expression of the orphan GPR161, GPR132,\nGPR20, and GPR139 in samples of cervicitis, LSIL, and HSIL to elucidate their\npotential roles in the pathogenesis of cervical cancer. It is important to mention\nthat a significant portion of the tissue samples used to carry out this study were\npreviously used to analyze the expression of nuclear orphan receptors of the NR4A\nfamily and due to the results obtained by the working group, a search was carried\nout for other probable biological markers in the development of cervical cancer,\nobtaining new data and not published interesting results that will be analyzed and\ndiscussed in this article ( Cruz et al.,\n2024 ).\n\nThis study was approved by the Ethics and Research Committee of the Maternity\nHospital of Mexicali (registration number CDEI-0008-21). All participants\nprovided written informed consent before enrollment. Between January 2022 and\nJanuary 2023, 45 patients were recruited from the Medical Oncology Specialties\nUnit (UNEME) in Mexicali, Baja California, Mexico. Fresh cervical tissue samples\nwere collected during colposcopy. Each sample was divided, with one portion used\nfor histopathological analysis and the other stored at -80 °C for subsequent\ngene expression analysis ( Cruz et al.,\n2024 ).\nTotal RNA was extracted from the cervical tissue samples using TRIzol® Reagent\n(Thermo Fisher Scientific, USA) following the manufacturer’s protocol. The\nconcentration and purity of the RNA were determined by measurement of the\noptical densities at 260 nm and 280 nm using a NanoDrop 1000 spectrophotometer\n(Thermo Fisher Scientific, USA). An A260/A280 ratio of 1.8 or higher were\nconsidered acceptable for these studies. These RNA samples were then diluted to\na working concentration of 1 µg/mL in nuclease-free water supplemented with\nRNase inhibitor. For the reverse transcription synthesis of cDNA, the iScript\ncDNA synthesis kit (Bio-Rad, USA) was used according to the manufacturer’s\ninstructions ( Cruz et al., 2024 ).\nThe primers used for PCR targeted GPR161 , GPR132, GPR20, GPR139 \nand  GADPH  ( Table 1 ).\nRelative mRNA expression levels were determined using the comparative ΔΔCt\nmethod.\nTable 1 - Primer sequences used in this study . \n Receptor Primers Sequences Tm(°C) GPR20 Fw GTGTCTTTGCGCTGACTGTC 56.6 Rs ATGATGCGGCCGGTAAACA 57.5 GPR132 Fw CGGAAGACAAGGAGACCTGC 50.1 Rs CGGTCAACCTGGCGTAGTAG 50.3 GPR139 Fw ATTGCCAACATGCTAGCCCT 57.3 Rs GGAACCGCTTGCTGATGAAG 56.6 GPR161 Fw CCTTGGGAGCATGTCACTGT 57.4 Rs CTTGTCCTGGTGGCTGCATA 57.4 GAPDH Fw CATCCTGGGCTACACTGAGC 57.7 Rs GTCAAAGGTGGAGGAGTGGG 57.7\nThe RNA extracted from cervix was reverse transcribed and used for real-time PCR\nanalysis with the QuantStudioTM 1 system (Thermo Fisher Scientific, USA). The\nreaction mixture for PCR consisted of 5 µL of PanGreen Universal Master Mix\n(Bio-Helix Ltd, Taiwan), 0.3 µL of forward primer (Integrated DNA Technologies,\nUSA), 0.3 µL of reverse primer (Integrated DNA Technologies, USA), 3.4 µL of\nPCR-grade water, and 500 ng of cDNA template ( Cruz et al., 2024 ).\nResults are presented as mean ± standard error. Statistical analysis was\nperformed using the Kruskal-Wallis test. A p-value of less than 0.05 was\nconsidered statistically significant. All analyses were conducted using GraphPad\nPrism (version 8.0.1).\n\nIn this study, 45 tissue samples from cervices were collected from women who\nunderwent colposcopy and biopsy. The samples were collected from patients aged\nbetween 15 and 60 years, with an average age of 35 years. The average age of\nmenarche onset was 12 years ( Cruz et al.,\n2024 ). Regarding the beginning of sexual activity, it had occurred at\n17 years of age on average, and 22% of the women had reported more than three\nsexual partners ( Cruz  et al .,\n2024 ). The use of contraceptive methods, salpingoplasty and condoms\nwere the most used by patients ( Cruz  et\nal ., 2024 ). In addition, other important factors that\ncould have affected the health of the women in this study were the following:\nFive patients were smokers, 14 were alcoholics, and one patient had reported\ncocaine use. On the other hand, the body mass index indicated that 75.5% of them\nhad body mass indexes >30, which was compatible with overweight and obesity\n( Table 2 ) ( Cruz  et al ., 2024 ).\nTable 2 - Demographic and clinical characteristics. Variable n = 45 \n \n Age (years) \n Mean 35 \n Minimum 15 \n Maximum 60 \n \n Menarche \n Mean 12 \n Minimum 9 \n Maximum 17 \n \n Onset of active sexual life \n Mean 17 \n Minimum 15 \n Maximum 20 \n \n Sexual partners \n 1 to 3 35 \n > 3 10 \n \n Body mass index \n No. % Low weight 0 0 Normal 11 24.4 Overweight 10 22.2 Obesity 24 53.3 \n Contraceptive methods \n Hormonal 15 33.3 Condom 5 11.1 Salpingoplasty 25 55.5 \n Pap test \n ASCUS 13 28.8 CIN I 21 46.6 CIN II 1 2.2 CIN III 7 15.5 Other 3 6.6 \n Colposcopy \n Cervicitis 14 31.1 LSIL 18 40 HSIL 13 28.8 ASCUS = atypical squamous cells of undetermined significance; CIN\n= cervical intraepithelial neoplasia; LSIL = low-grade squamous\nintraepithelial lesions; HSIL = high-grade squamous\nintraepithelial lesions.\nASCUS = atypical squamous cells of undetermined significance; CIN\n= cervical intraepithelial neoplasia; LSIL = low-grade squamous\nintraepithelial lesions; HSIL = high-grade squamous\nintraepithelial lesions.\nThe results obtained from the cervical cytology were benign (atrophy or\ninflammation) in 6.6% of cases, ASCUS (atypical cells of uncertain significance)\nin 28.8%, cervical intraepithelial neoplasia 1(CIN I; low-grade dysplasia that\naffects up to one-third of the cervical lining) in 46.6%, cervical\nintraepithelial neoplasia 2(CIN II; moderate to marked dysplasia that affects up\nto two-thirds of the cervical lining) in 2.2%, and cervical intraepithelial\nneoplasia 3 (CIN III; severe dysplasia to carcinoma  in situ \nthat affects the full thickness of the cervical lining) in 15.5% of the\npatients. The tissue analysis of HSIL confirmed high-grade lesions, as indicated\nby the cytological findings, in five cases (CIN II or CIN III). ( Table 3 ). Cervical samples for one year,\n31.1% exhibited acute and chronic non-specific endocervicitis and exocervicitis,\n40% exhibited LSIL, and 28.8% HSIL ( Cruz et al.,\n2024 ).\nTable 3 - Cervical biopsy results related to cytology results. HPR Results of cervical cytology\n Benign findings ASCUS CIN I CIN II CIN III Cervicitis 12.5%  (n = 2) 37.5%  (n = 6) 50%  (n = 6) 0 0 LSIL 10.5%  (n = 1) 26.3%  (n = 5) 52.6%  (n=9) 0 10.5%  (n = 3) HSIL 0 10%  (n = 2) 70%  (n = 6) 10%  (n = 1) 10%  (n = 4) HPR = histopathological result; ASCUS = atypical squamous cells\nof undetermined significance; CIN = cervical intraepithelial\nneoplasia; LSIL = low-grade squamous intraepithelial lesions;\nHSIL = high-grade squamous intraepithelial lesions\n [13] .\nHPR = histopathological result; ASCUS = atypical squamous cells\nof undetermined significance; CIN = cervical intraepithelial\nneoplasia; LSIL = low-grade squamous intraepithelial lesions;\nHSIL = high-grade squamous intraepithelial lesions\n [13] .\nOrphan receptors were expressed in cervical samples; however, their expression\nchanged due to the development of cervicitis or LSIL/HSIL lesions. While mRNA\nexpression of GPR161 showed no statistically significant difference among the\nthree groups (p > 0.05), mRNA of GPR132 was increased in LSIL samples\ncompared to both cervicitis and HSIL patients (p < 0.05). Similarly, the mRNA\nof GPR20 was higher in the LSIL group compared to the cervicitis and HSIL groups\n(p < 0.05). Conversely, GPR139 had diminished expression in the LSIL group, a\ndifference that was statistically significant (p < 0.05) compared with the\nother two sample groups ( Figure 1 ).\nFigure 1 - mRNA expression of the oGPRs. (A) GPR161, (B) GPR132, (C) GPR20,\nand (D) GPR139 receptors in cervical biopsy samples: Cervicitis\n(n=14), LSIL (n=18) and HSIL (n=13). Data were represented as mean ±\nSEM. *p < 0.05.\n\nThe role of chronic inflammation in epithelial carcinogenesis is well-established.\nStudies have demonstrated a positive correlation between cervicitis and squamous\nintraepithelial lesions (SILs) ( Koutsky et al.,\n1992 ;  Castle et al., 2001 ). SILs\nare categorized into low-grade (LSIL) and high-grade lesions (HSIL), based on their\npotential for progression to carcinoma. While LSIL is generally considered a\nlow-risk precursor to cervical cancer, it is established that both low- and\nhigh-risk HPV can infect a broad range of cervical cell types, including columnar,\nreserve, mature, intermediate, and immature squamous cells ( Pinto et al., 2010 ), producing the progression from LSIL to\nHSIL, and later cervical cancer due to the interactions of several viral\noncoproteins that dysregulate cell signaling pathways involved in proliferation, DNA\ndamage, or repair mechanisms ( Manzo-Merino et al.,\n2014 ). Among the cellular changes observed in carcinogenesis, the\nmodification in the expression and activity of the GPCRs, including orphan\nreceptors, has been described. Although oGPCRs lack identified endogenous ligands\n( Jobe and Vijayan 2024 ), they exhibit\ntherapeutic potential in the treatment of metabolic disorders and autoimmune\ndiseases ( Jobe and Vijayan 2024 ). But,\nspecifically in cancer, they have been implicated in cellular growth and tumor\nprogression, making them promising targets for novel therapeutic interventions.\nTherefore, the present study aimed to examine the mRNA expression of selected oGPCRs\nthat have been previously implicated in other types of cancer, but whose role in\ncervicitis and SIL, precursors to cervical cancer, remains unexplored.\nOur results showed that mRNA of oGPCRs (GPR161, GPR132, GPR20, and GPR139) are\nexpressed in cervical tissue, but their expression differed across cervicitis, LSIL,\nand HSIL samples. Notably, GPR132 mRNA was significantly increased in LSIL samples\ncompared to both cervicitis and HSIL samples. This overexpression of GPR132 in LSIL\nsamples may represent an intrinsic compensatory mechanism to mitigate\nhyperactivation of the PI3K/AKT/mTOR pathway, given the role of GPR132 activation in\npromoting myeloid differentiation. Some experiments have demonstrated that the\nnatural agonist 8-gingerol activates the GPR132-Gs-PKA pathway, leading to the\ninhibition of mTOR signaling, a critical suppressor of cell differentiation in acute\nmyeloid leukemia (AML). This inhibition resulted in reduced tumor growth, increased\ncell differentiation, and extended mouse survival in an AML xenograft model ( Yi et al., 2022 ). While the PI3K/AKT/mTOR\npathway is crucial for physiological processes like cell survival and proliferation,\nits aberrant activation contributes to tumor development ( Lim et al., 2015 ). In cervical cancer, HPV oncoproteins E6 and\nE7 stimulate mTOR through the PI3K/Akt signaling cascade. This pathway exhibits a\nhigh mutation rate in the PIK3CA gene in samples of cervical cancer, adenocarcinoma,\nand squamous cell carcinomas. The loss of the phosphatase and tensin homolog (PTEN),\na key tumor suppressor and negative regulator of this pathway, frequently underlies\nthis dysregulation ( Bahrami et al., 2017 ).\nThis fact is particularly relevant considering the common progression from LSIL to\nHSIL and finally cervical cancer, a process influenced by the interactions of\nseveral viral oncoproteins that dysregulate cell signaling. This compensatory\nmechanism could be crucial in early-stage disease.\nAdditionally, our results demonstrated that the mRNA of GPR20 was expressed in\ncervical tissue, with higher expression levels observed in LSIL samples compared to\ncervicitis and HSIL samples. GPR20 is a ligand-independent oGPCR, 358 amino acids in\nlength, that exhibits constitutive activity and is coupled to Gi protein. Its\nexpression is controlled by the transcription factors Forkhead box F1 (FOXF1) and\nETS variant transcriptor factor 1 (ETV1) ( Iida et\nal., 2021 ). GPR20 is highly expressed in intestinal tissue and is found\nwith great abundance in gastrointestinal stromal tumors ( Iida  et al ., 2021 ). Molecular dynamics\nsimulations demonstrated that GPR20 exhibits high basal activity attributed to a\nnon-canonical conformation of transmembrane helix 7 (TM7); this conformation brings\nthe N-terminal cap into the helix center, promoting its self-interaction with Gi\nprotein, which makes it a highly stimulated receptor. Consequently, the N-terminal\ncap acts as an intrinsic agonist modulating the receptor’s signal transduction and\ndynamic behavior ( Zhang et al., 2025 ).\nAlthough GPR20 is a receptor that is highly expressed in GIST tumors, its role in\ncervical cancer is not known. However, it has already been seen that GPR20 does not\nhave an impact on the proliferation of GIST cells, but its blockade is a potential\ntherapeutic target for this disease ( Iida  et\nal ., 2021 ). Considering that GPR20 is regulated by ETV1, its\nlikely implication in cancer is related to angiogenesis, given that ETV1 belongs to\nthe ETS family of transcription factors, which contributes to cancer progression,\nactivating responses of promoters to the Ras/Raf7MEK/ERK1/2 pathways ( Dittmer 2015 ).\nContrarily, the mRNA expression of GPR139 was reduced in LSIL samples. GPR139\nactivates several G protein pathways, with Gq/11 being the most important. For this\nreceptor, it has been proposed that the aromatic amino acids L-Trp and L-Phe, as\nwell as ACTH/α-MSH-related peptides, are endogenous agonists ( Vedel et al., 2020 ). While the mRNA of GPR139 is predominantly\nexpressed in the central nervous system in humans, rats, and mice ( Wang et al., 2019 ), we detected its expression\nin human cervical tissue. GPR139 has been implicated in several central nervous\nsystem mechanisms, including opioid modulation by opposing μ-opioid receptor\nactivity ( Stoveken et al., 2020 ), and has\nbeen proposed as a therapeutic target for schizophrenia and drug addiction ( Mao et al., 2023 ). However, its role in cancer\nremains poorly understood, but it is already known that the activation of GPR139 is\ndependent on mitogen-activated protein kinase-ERK phosphorylation ( Liu  et al ., 2015 ), the key\nmechanism involved in the development of malignant tumors in cervical squamous\ncancer tissues ( Li  et al .,\n2020 ). Finally, despite we detected GPR161 mRNA in cervical tissue, we\nobserved no significant differences in its expression across cervicitis, LSIL, and\nHSIL samples. This suggests that GPR161 expression is not modulated during the\ndevelopment of these cervical lesions and may not contribute to their\nprogression.\n\nGPR132, GPR20, and GPR139 expression was modified in LSIL samples compared to\ncervicitis and HSIL samples. Given the involvement of the signalling pathway of\nthese receptors in several types of cancer, we proposed that their differential\nregulation in LSIL may represent a mechanism to prevent the progression to HSIL and\nlater cervical cancer. Therefore, further exploration of oGPCRs could be crucial for\nidentifying novel therapeutic targets for cervical cancer treatment.\n\nThe data that support the findings of this study are available from the\ncorresponding author [ARH] on reasonable request.","source_license":"CC-BY-4.0","license_restricted":false}