{"paper_id":"f14f61f3-4a8e-4472-abc5-40b7280871ec","body_text":"Comparison of the effect of oestradiol, tamoxifen and\nraloxifene on nerve growth factor- /afii9825expression in\nspecific neonatal mouse uterine cell types using laser\ncapture microdissection\nA R Green , R E Edwards 1, P Greaves 1 and I N H White\nMRC Molecular Endocrinology Group, Department of Obstetrics and Gynaecology, Robert Kilpatrick Building, University of Leicester,\nLeicester LE2 7LX, UK\n1MRC Toxicology Unit, Hodgkin Building, University of Leicester, Leicester LE1 9HN, UK\n(Requests for offprints should be addressed to A R Green; Email: ag41@le.ac.uk)\nAbstract\nOral dosing of CD-1 mice on days 2–5 after birth with tamoxifen but not raloxifene disrupts the\ndevelopment of the myometrium, resulting in adult uterine adenomyosis. Using laser capture\nmicrodissection and RT-PCR we have investigated nerve growth factor (NGF) and cognate receptor\nexpression in uterine cells of 6-day-old pups that may be important in early developmental changes that\ngive rise to adenomyosis. NGF down-regulation is known to occur during terminal myogenic\ndifferentiation.\nNGF was found exclusively in endometrial luminal epithelium of controls. It was up-regulated 18-fold in\nthe luminal epithelium following dosing with tamoxifen but not raloxifene. Western blotting for NGF protein\nin the whole uterus showed a 25-fold increase after tamoxifen treatment. Expression of the low affinity\np75 neutrophin receptor (p75\nNTR) was twofold higher in the myometrium compared with luminal\nepithelium or stroma. This was not altered following tamoxifen treatment. There was no detectable\nexpression of high affinity tyrosine kinase receptor (trkA\nNGFR).\nThis study shows luminal epithelial cells of the endometrium primarily form NGF. This suggests that\nNGF normally regulates the differentiation of the mesenchyme into uterine myocytes through paracrine\nmechanisms and that an early disturbance of this process plays a key role in the subsequent\ndevelopment of adenomyosis.\nJournal of Molecular Endocrinology (2003) 30, 1–11\nIntroduction\nOral dosing of newborn mice with tamoxifen on\ndays 2–5 after birth results in a high incidence of\nadenomyosis, a benign condition characterised by\ningrowth of the endometrium into the uterine\nmusculature, sometimes associated with an over-\ngrowth of the latter (Parrott et al. 2001). This seems\nto be associated with defects in the formation of the\nmyometrium in the neonatal period. Using\nmicroarray analysis of RNA extracted from the\nwhole uterus we have previously identified several\ngenes which are modulated by tamoxifen during\nthis critical phase of uterine development (Parrott\net al. 2001). One key gene up-regulated in this tissue\nby tamoxifen is nerve growth factor (NGF)- /afii9825\n(Parrott et al. 2001). This may contribute to the\nrepression of myometrial di fferentiation in the\nuterus. Besides being a key neurotrophic factor\nin neuronal cells, NGF proteins have a role in\nnon-neuronal tissues, being mitogenic in both the\nhuman breast cancer MCF-7 cell line (Descamps\net al. 1998, Chiarenza et al. 2001) and prostate\ncancer cells (Djakiew et al. 1991). This e ffect\nappears to be mediated via a high a ffi nity tryrosine\nkinase receptor (trkA\nNGFR). Tamoxifen inhibits\nNGF-induced proliferation of MCF-7 cells and\nreceptor phosphorylation (Chiarenza et al. 2001).\nNGF can also interact with a low a ffi nity p75\nneurotrophin receptor (p75\nNTR) as an anti-\napoptotic factor (Descamps et al. 2001). The 7S\nNGF protein is a member of the neurotrophin\n1\nJournal of Molecular Endocrinology (2003) 30, 1–11\n0952–5041/03/030–001 © 2003 Society for Endocrinology Printed in Great Britain\nOnline version via http://www.endocrinology.org\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\npolypeptide family and consists of a complex of\n/afii9825NGF together with the active neurotrophic factor\n/afii9826NGF and /afii9828NGF (Bax et al. 1997). Although\ninactive, the subunits do however overlap the\nregions on the /afii9826NGF where it engages with the\nNGF receptor (Bax et al. 1997). The role of NGF in\nthe uterus remains to be elucidated.\nMany studies have used whole tissue to\ndetermine the e ffects of drugs on gene expression\nin tissues. However, like most organs, the uterus\nconsists of many cell types including the luminal\nepithelium, stroma and myometrium. It has long\nbeen recognised that both autocrine and paracrine\ninteractions can occur within the uterus and\ntherefore the study of separate cell populations\nis important (reviewed in Reis et al. 2000).\nHomogenisation of tissue results in the loss of the\nability to assess cell-specific gene expression. There\nis also a dilution e ffect of cells that are present in a\nlower number, e.g. uterine luminal epithelium\ncompared with stroma or myometrium (Martin\net al. 1973), making the detection of low copy\nnumber genes more di ffi cult. In situ hybridisation\ncan overcome some of these problems but at best\nonly gives a semi-quantitative analysis (Looi &\nCheah 1992).\nIn this paper we report using a combination of\nlaser capture microdissection (LCM) (EmmertBuck\net al. 1996) and RT-PCR to quantify gene\nexpression in specific cell types of the neonatal\nmouse uterus. LCM allows the isolation of specific\ncells from tissue sections, without contamination\nfrom other cell populations, that can be sub-\nsequently used for molecular analysis (Bonner et al.\n1997, Luo 1999, Sgroi et al. 1999, Shen et al. 2000).\nWe compared expression of NGF following\ntamoxifen administration with oestradiol as well as\nraloxifene, another anti-oestrogen which was\npreviously shown not to be associated with the\ndevelopment of adenomyosis in mice under similar\nconditions.\nMaterials and methods\nChemicals\n17/afii9826-Oestradiol benzoate was from Sigma Chemi-\ncal Co., Poole, Dorset, UK. Tamoxifen and\nraloxifene hydrochloride were gifts from Dr T C\nOrton, AstraZeneca, Macclesfield, Cheshire, UK.\nAnimals and treatments\nOvariectomised adult (3 months old, n=4) female\nCD-1 mice were from Charles River Ltd, Margate,\nKent, UK. Animals were housed in negative\npressure isolators with a 12 h light:12 h darkness\ncycle and allowed free access to RM1 diet (Special\nDiets Services UK Ltd, Witham, Essex, UK) and\nwater. The study was conducted under the\nauthority of the United Kingdom Home O ffi ce,\nAnimals (Scientific Procedures) Act 1986. Groups\nof three 6-day-old female CD-1 neonatal mice\n(pregnant mice were from Charles River Ltd) were\norally dosed on days 2–5 after birth (day of birth is\nday 1) with 5·3 nmol/kg oestradiol benzoate or\n2·7 µmol/kg tamoxifen or raloxifene suspended in\npeanut oil/lecithin/condensed milk mixture\n(2:0·2:3, by volume) at a dose volume of 5 µl/g\nbody weight. Controls received vehicle only. On\nday 6, mice were killed and uteri removed and\neither snap frozen in liquid nitrogen or fixed in\n3·7% neutral bu ffered formalin at 4 /p8C.\nMouse uterine sections\nParaffi n-embedded (5 µm) or frozen (8 µm) sections\nof mouse uterus were cut and mounted on clean\nglass slides. To minimise RNase action, all solutions\nwere made with 0·1% diethylpyrocarbonate-\ntreated water. Frozen sections were post-fixed in\n70% ethanol for 10 min at 4 /p8C. Slides were\nrehydrated in water, then washed in 70% ethanol,\nand industrial methylated spirits (three times) and\nfinally dehydrated in xylene for 10 min. Sections\nwere usually left unstained or occasionally, where\nindicated, counterstained with haematoxylin, 0·1%\nmethylene blue or Mayer’s haematoxylin using\nstandard procedures.\nLCM\nSeparate populations of fixed luminal epithelial,\nmyometrial or stromal cells were isolated from\nuterine sections using the PixCell II LCM System\n(Arcturus Engineering, Santa Clara, CA, USA).\nIdentification of specific cells from unstained\nsections was judged from parallel haematoxylin-\nstained sections. A 15 µm or 30 µm laser beam\n(with varying times of pulse power 20–100 mW)\nand pulse width (0·5–5·0 ms) was used. An average\nof 100 laser shots per sample were used to transfer\ncells onto a CapSure cap (Arcturus Engineering).\nA R GREEN and others · Effect of oestradiol and SERMs on uterine NGF2\nwww.endocrinology.orgJournal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nThis relates approximately to a tissue volume of\n1·12/p210/p17µm3, calculated by the Arcturus\nsoftware program on an estimated 90% transfer\nrate, yielding approximately 200–300 cells per cap.\nTotal RNA extraction\nTotal RNA was extracted from each CapSure cap\nusing the StrataPrep Total RNA MicroPrep Kit\n(Stratagene Europe, Amsterdam, The Netherlands)\nfollowing the manufacturer’s instructions, except\nthat a 10 µl volume of elution bu ffer was used\nwhich was passed through the column twice upon\nelution.\nReverse transcription\ncDNA was synthesised from total RNA using\nrandom hexamers (Promega, Southampton, Hants,\nUK) and Superscript II RNase H-reverse tran-\nscriptase (Life Technologies, Glasgow, Strathclyde,\nUK) according to the manufacturer’s instructions.\nNegative controls, where water was substituted for\nreverse transcriptase, were included.\nSemi-quantitative PCR\nThe expression of genes for cytokeratin 19 ( Krt19),\nglyceraldehyde-6-phosphate dehydrogenase (Gapdh),\n/afii9825NGF (Ng fa), p75NTR (Ng fr), smooth muscle /afii9825-actin\n(Acta), trkA NGFR (Trka) and ubiquitin ( Ub) were\ndetermined using semi-quantitative PCR by ampli-\nfying 1µl cDNA with the primer sequences shown\nin Table 1. Expression of each gene was amplified\nin duplicate in a total volume of 20 µl using either\nAmpliTaq Gold (Applied Biosystems, Warrington,\nCheshire, UK), FastStart Taq DNA polymerase\n(Roche, Lewes, E Sussex, UK), HotStarTaq DNA\npolymerase (Qiagen Ltd, Crawley, West Sussex,\nUK), JumpStart AccuTaq (Sigma Chemical Co.) or\nPlatinum Taq DNA polymerase (Life Technologies)\nfollowing the manufacturer’s instructions using a\nHybaid Touchdown thermal cycler (ThermoHybaid,\nTeddington, London, UK). An annealing tempera-\nture of 60 /p8C was used for all primers and the\nnumber of PCR cycles ranged from 30 to 40. A\nnegative control, where water was substituted for\ncDNA, was included in each PCR experiment. The\nresulting PCR products for each sample were\nelectrophoresed at 100 V for 30 min in duplicate\nand in parallel, with a 100 bp DNA ladder (Life\nTechnologies) as a size marker, through a 2%\nagarose gel in 1 /p2TBE with 5 ng/ml ethidium\nbromide (Sigma Chemical Co.) or 1 /p2Gelstar\nnucleic acid stain (Novara, Ashby-de-la-Zouch,\nLeics, UK) and visualised under u.v. The band\ndensities were determined using a Kodak Image\nStation 440CF (Eastman Kodak Company,\nRochester, NY, USA) and gene expression was\nnormalised against the density of the corresponding\nGapdh PCR product. No amplification was seen\nin the negative controls. Representative PCR\nproducts were verified by DNA sequencing.\nImmunocytochemistry\nFormalin-fixed, 5 µm para ffi n sections of 6-day-old\nmouse uterus were dewaxed and stained using\nspecific antibodies for cytokeratin 19 (Dako Ltd,\nEly, Cambs, UK) at a dilution of 1:100 or\nmonoclonal anti-mouse smooth muscle /afii9825-actin\n(Dako Ltd) at a dilution of 1:100 using methods\npreviously described (Parrott et al . 2001).\nWestern blotting analysis\nControl or tamoxifen-dosed 6-day-old mice uteri\n(n=4) were separately homogenised and lysed in\n10 µl/mg tissue ice-cold H8 bu ffer (20 mM Tris,\npH 7·4, 2 mM EDTA, pH 7·4, 2 mM EGTA,\npH 7·6), complete mini-protease inhibitor cocktail\n(Roche) and 30 µg/ml phenylmethylsulfonyl fluor-\nide (Sigma Aldrich Co.) and incubated on ice for\nTable 1 Mouse primer sequences for RT-PCR\nPrimer sequences (5′–3′)\nProduct\nsize\n(bp)\nGene\nActa AATGGCTCTGGGCTCTGTAAA 300\nGTTCAGTGGTGCCTCTGTCA\nGapdh ACCCAGAAGACTGTGGATGG 300\nGAGACAACCTGGTCCTCAG\nKrt19 CTGCTGTCTGGCAATGAAA 300\nCAAGGCGTGTTCTGTCTCAA\nNgfa AGCCTCCTGAATGAGCACAC 299\nTCCATCTCTCCTGCACACAG\nNgfr CAGTGGAGAGTGCTGCAAAG 295\nGGAGGACACGAGTCCTGAGC\nTrka GCATTCCCTTCTCTGTGGAC 298\nACTGGCGAGAAGGAGACAG\nUb GAGAGGCTTTGTCCGGTTC 113\nCGAAGATCTGCATTTTGACCT\nEffect of oestradiol and SERMs on uterine NGF ·\nA R GREEN and others 3\nwww.endocrinology.org Journal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\n15 min. The homogenate was transferred to a\nmicrofuge tube and centrifuged at 13 000 g for\n3 min at room temperature. The supernatant was\nremoved and heated to 100 /p8C for 5 min. After\ncooling, the lysate was loaded on a 10% SDS-\nPAGE gel. High precision prestained molecular\nweight markers (Biorad, Hemel Hempstead, Herts,\nUK) were also included. Gels were run at a constant\ncurrent of 20 mA at room temperature. The gel was\nblotted overnight at 50 mA onto hybond enhanced\nchemoluminescent (ECL) nitrocellulose membrane\n(Amersham International plc, Little Chalfont,\nBucks, UK). The membrane was blocked with 5%\ndefatted milk protein (Premier Brands UK Ltd,\nMoreton, Wirral, UK) in phosphate-bu ffered saline\n(PBS) containing 0·1% (v/v) Tween 20 for 1 h at\nroom temperature. It was then rinsed once in 0·1%\n(v/v) Tween 20 in PBS. Blots were hybridised with\npolyclonal IgG anti-mouse NGF (Santa Cruz\nBiotechnology, Santa Cruz, CA, USA) at a dilution\nof 1:1000 or monoclonal anti-mouse /afii9826-actin (Sigma\nAldrich Co.) at a 1:5000 dilution for 2 h at room\ntemperature. Following washing (three times) in\nPBS containing 0·1% (v/v) Tween 20 for 10 min,\nthe membrane was incubated with a secondary\nantibody of either anti-mouse-HRP (Sigma Aldrich\nCo.) at a dilution of 1:5000 for 1 h. The chemolumi-\nnescent signal was developed using an ECL Western\nblotting kit (Amersham International plc) according\nto the manufacturer’s instructions and quantitated\nover 5–10 min exposure using a Kodak Image\nStation 440CF.\nStatistical analysis\nDifferences between groups were tested using\nanalysis of variance with Fisher’s exact test for\nsignificance at the 5% level.\nResults\nLCM optimisation\nPreliminary results showed that RNA from cells\ncould be successfully isolated by LCM from\nsections fixed in 3·7% or 10% neutral bu ffered\nformalin, 70% or 90% ethanol or frozen. However,\nevaluating the e ffi ciency of total RNA extraction\nshowed cryostat sections resulted in the best\nquantity and quality of RNA, as judged by\nabsorbance at 260 nm and 280 nm (Fig. 1). When\nusing frozen sections, staining with methylene blue,\nhaematoxylin or Mayer’s haematoxylin resulted in\npoorer recovery of cells using LCM, compared with\nunstained sections run in parallel. Increasing laser\npulse power or width did not enhance cell recovery\nfrom the fixed stained sections (data not shown). It\nwas therefore concluded that the use of unstained\nfrozen sections was optimal for both LCM and\nsubsequent RNA extraction. The use of unstained\nsections also eliminates any possible interference\nof the counterstain with downstream molecular\nanalyses (Burton et al. 1998). Figure 2A shows a\nrepresentative haematoxylin-stained section of a\n6-day-old mouse uterus. The subsequent isolation\nof sub-populations of uterine cells by LCM onto\nCapSure caps is shown in Fig. 2B–D.\nSemi-quantitative RT-PCR optimisation\nThe successful amplification of Gapdh over 40 PCR\ncycles demonstrated su ffi cient quality and quantity\nof RNA extracted from LCM samples for detection\nusing gel electrophoresis. The addition of a\nnegative control, where water substituted the\nreverse transcriptase during cDNA synthesis,\nshowed no DNA contamination. The use of Gelstar\nnucleic acid stain resulted in fivefold greater\nsensitivity compared with ethidium bromide in\nagarose gels and therefore was used for all\nquantification by densitometry. The optimal\nnumber of cells from uterine tissue, i.e. LCM laser\nshots, needed in order to a fford amplification of\nFigure 1 Comparison of total RNA levels extracted from\nuterine sections either fixed in 3·7% or 10% neutral\nbuffered formalin or 70% or 90% ethanol or frozen in\nliquid nitrogen.\nA R GREEN and others · Effect of oestradiol and SERMs on uterine NGF4\nwww.endocrinology.orgJournal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nGapdh by RT-PCR was determined. Up to 100\nlaser shots/sample resulted in a detectable level of\nthe gene (Fig. 3A). To compare the e ffi ciency of\nseveral reverse transcriptases and Taq DNA\npolymerases, total RNA was extracted from an\nepithelial and stromal LCM sample of an\novariectomised adult mouse uterus and divided\nequally into three. cDNA synthesis was conducted\nusing three di fferent reverse transcriptases and\nGapdh was amplified using PCR in parallel with five\ndifferent Taq DNA polymerases, as listed in the\nFigure 3 Comparison of (A) Gapdh gene amplification\nby RT-PCR of tissue samples from frozen sections\ncollected with an increasing number of LCM laser shots\nand (B) reverse transcriptase and Taq DNA polymerase\nefficiency in RT-PCR of Gapdh over 40 cycles of mouse\nuterine luminal epithelium cells isolated by LCM up to\n100 shots). Lane 1=AmpliTaq Gold; 2=FastStart Taq\nDNA polymerase; 3=Platinum Taq DNA polymerase;\n4=HotStarTaq DNA polymerase; 5=JumpStart AccuTaq;\n6=100 bp ladder. (C) Representative gel-\nelectrophoresed genes amplified by RT-PCR from\nmouse uterine cells isolated using LCM. Lane\n1= Gapdh;2 = Ub;3 = Krt19;4 = Acta;5 = Ngfr;6 = Ngfa;\n7=100 bp ladder.\nFigure 2 Representative 8 µm frozen tissue sections of\na neonatal 6-day-old CD-1 mouse uterus. le, luminal\nepithelium; s, stroma; m, myometrium. (A) Stained with\nhaematoxylin. Visualisation of specific sub-populations\nof cells transferred onto CapSure caps using LCM.\n(B) Luminal epithelium, (C) stroma and (D) myometrium.\nOriginal magnification × 20.\nEffect of oestradiol and SERMs on uterine NGF ·\nA R GREEN and others 5\nwww.endocrinology.org Journal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nMaterials and methods, using 40 cycles. Gapdh gene\nexpression was amplified but with a varying degree\nof e fficiency when comparing both reverse tran-\nscriptases and Taq DNA polymerases (Fig. 3B).\nSuperscript II reverse transcriptase resulted in the\nhighest amplification of Gapdh with all DNA Taq\npolymerases except Jumpstart AccuTaq (Fig. 3B).\nThe combination of Superscript II reverse tran-\nscriptase and FastStart Taq DNA polymerase was\nsuperior in terms of amplification and specificity\nand therefore all subsequent PCR amplifications\nwere conducted using Superscript II reverse\ntranscriptase and FastStart Taq DNA polymerase.\nThe optimal number of PCR cycles needed for\nquantification (i.e. linear phase of amplification) of\nall gene targets was similar at 32 cycles using\nFastStart Taq DNA polymerase (data not shown).\nRepresentative amplified genes of interest using\nRT-PCR from uterine cells isolated by LCM and\nvisualised by agarose gel electrophoresis are shown\nin Fig. 3C.\nThere was no di fference in the amplitude of\nPCR product for the housekeeping Gapdh between\nthe uterine cell types. There was a relatively lower\ngene expression of Ub in the myometrium\n(Ub/Gapdh, 9%) compared with either the luminal\nepithelium (35%) or stroma (38%). It was therefore\ndecided to use Gapdh as the sole housekeeping gene\nfor gene quantification in the uterus.\nCell marker expression\nGene expression of cell markers for epithelial\n(Krt19; Bartek et al. 1986) and myometrial ( Acta;\nSkalli et al. 1987) cells was investigated to\ndemonstrate LCM selectivity in 6-day-old and\novariectomised adult mice uteri. The results\nshowed Krt19 to be higher in the luminal\nepithelium of both neonatal and adult mice\ncompared with the myometrium (Fig. 4A). As\nexpected, the majority of Acta expression was found\nin the myometrium (Fig. 4B). The pattern of Krt19\nand Acta expression was emulated with immuno-\nhistochemistry using specific antibodies (Fig. 5A\nand C).\nUterine gene expression and regulation by\noestrogen and SERMs\nUsing the system described above, expression for\ngenes for Krt19 and Ngfa was investigated in the\nspecific cell types of the 6-day-old mouse uterus in\nresponse to oestradiol, tamoxifen or raloxifene.\nCytokeratin 19\nFollowing tamoxifen treatment, Krt19 expression\nwas increased 4·6-fold in the luminal epithelium\nbut not in the other cell types compared with the\ncontrol (Fig. 6A). This change was emulated using\nFigure 4 Comparison of gene expression in uterine\ncell compartments of 6-day-old neonate (6d) and\novariectomised adult CD-1 mouse uterus. (A) Cytokeratin\n19 and (B) smooth muscle α-actin. Values are\nmeans ±\nS.E.M., n=3. *P<0·05 (compared with luminal\nepithelial cells). S, stroma; M, myometrium; LE, luminal\nepithelium.\nA R GREEN and others · Effect of oestradiol and SERMs on uterine NGF6\nwww.endocrinology.orgJournal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nFigure 5 Immunohistochemical localisation in 6-day-old neonate CD-1 mouse uterus of cytokeratin 19 in (A) control\nmice, (B) tamoxifen-treated mice and (C) smooth muscle α-actin in control mice; haematoxylin counterstain. Original\nmagnification × 25.\nEffect of oestradiol and SERMs on uterine NGF · A R GREEN and others 7\nwww.endocrinology.org Journal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nimmunohistochemistry (Fig. 5A and B). No\nsignificant change in expression of Krt19 was\nobserved with oestradiol or raloxifene.\nNGF\nExpression of Ngfa was exclusively found at a low\nlevel in the luminal epithelial cells of a 6-day-old\nmouse uterus (Fig. 6B). There was no expression of\nNgfa in either the stroma or myometrium. After\ndosing with oestradiol, expression of Ngfa could not\nbe detected in the luminal epithelium. In contrast,\nfollowing tamoxifen treatment there was a 17-fold\nincrease in Ngfa expression compared with the\ncontrols (Fig. 6B). Expression of Ngfa with\ntamoxifen treatment was also seen within the\nstromal layer. There was no change in Ngfa\nexpression after raloxifene treatment (Fig. 6B). In\nwhole uterus of the 6-day-old mouse, using an\nantibody directed at the mature NGF protein,\nWestern blots show a low expression of NGF (Fig.\n7). After tamoxifen treatment for 2–5 days after\nbirth, there was a marked increase (25-fold) of NGF\nprotein (Fig. 7).\nNGF receptor\nExpression of the low a ffi nity p75 NTR and high\naffi nity trkANGFR for NGF were determined in the\nseparate cell populations of 6-day-old mice uteri\nusing LCM and RT-PCR. The low affi nity p75\nNTR\nwas expressed in the luminal epithelium and\nstroma at similar levels ( Ngfr/Gapdh, 5%). The\nmyometrium expressed twice the level of receptor\nmRNA ( Ngfr/Gapdh, 10%). Upon tamoxifen treat-\nment, levels of p75\nNTR expression were not altered\nin any of the cell types of the 6-day-old mouse\nuterus compared with controls. No expression of\ntrkA\nNGFR mRNA could be detected in any of\nthe uterine cell types at 6 days although a PCR\nproduct was successfully amplified from the mouse\nsubmaxillary gland (data not shown).\nDiscussion\nIn this paper we describe the use of LCM to isolate\nluminal epithelium, stroma and myometrium from\ncryostat sections of newborn mice uterine tissue to\ndetermine the response of /afii9825NGF and other\noestrogen-regulated genes to tamoxifen compared\nFigure 6 Effect of pretreating newborn CD-1 mice with\noestradiol (E2) or SERMs (tamoxifen, Tam; raloxifene,\nRal) on gene expression in specific uterine cells isolated\nby LCM of (A) cytokeratin 19 and (B) αNGF. Values are\nmeans ±\nS.E.M., n=3. * P<0·05 (compared with control\n(Con)).\nFigure 7 Effect of pretreating newborn CD-1 mice with\ntamoxifen (Tam) in whole uterus on protein expression\nof NGF. Inset: representative Western blots. Values are\nmeans ±\nS.E.M., n=4. * P<0·05. Ctrl, control.\nA R GREEN and others · Effect of oestradiol and SERMs on uterine NGF8\nwww.endocrinology.orgJournal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nwith oestradiol or raloxifene. Since the introduction\nof LCM in 1996 (EmmertBuck et al . 1996), it is\nbecoming more widely used to isolate specific cell\ntypes from heterogeneous histological tissue sec-\ntions and has been well analysed and demonstrated\n(Kitahara et al. 2001, Mariani et al. 2001, Tanji et al.\n2001). Optimisation of tissue section preparation\nshowed frozen sections best for isolating RNA from\nthe mouse uterus, confirming a previous report\n(Goldsworthy et al. 1999). We found that nuclear\ncounterstaining of tissue sections hampered the\nlifting of cells by the LCM system. This could be a\nresult of further dehydration of the section causing\nit to adhere more firmly to the slide. Other fixatives\nand nuclear counterstaining may be more bene-\nficial in tissues where the composition of cells may\ndiffer and alternative downstream applications are\napplied (Kohda et al. 2000, Ehrig et al. 2001, Tanji\net al. 2001). The present results also showed there to\nbe a surprising di fference in the e ffi cacy of reverse\ntranscriptases and Taq DNA polymerases used in\nthe RT-PCR of the samples. The di fference in\noverall performance of the enzymes might be due\nto the original RNA template quality and quantity.\nWhile highly expressed mRNAs such as Ub and\nGapdh were readily determined from uterine cells\nisolated using LCM, the present study showed that\nrelatively weakly expressed genes including Ngfa\ncould also be detected and quantitated using\nRT-PCR. In this paper we further describe the use\nof LCM to isolate separate sub-populations of\nluminal epithelial, stromal and myometrial cells\nfrom both newborn and adult mice uterine tissue.\nSuch preparations have been used to determine\nexpression of several genes by RT-PCR in response\nto tamoxifen and raloxifene.\nThe development of adenomyosis at 3 months of\nage after dosing from 2–5 days after birth with\ntamoxifen suggests that key genetic changes occur\nduring these crucial days to permanently a ffect\nthe events downstream by tamoxifen, but not by\nraloxifene. We have previously identified several\ngene changes by microarray studies that are altered\nwith tamoxifen treatment in the whole uterus\n(Green et al. 2001, Parrott et al. 2001). We now\nfurther describe the specific cell distribution of\n/afii9825NGF and its response to oestradiol and SERMs in\nthe neonatal mouse uterus using LCM.\nThe expression of NGF in the uterus has\npreviously been described (Varol et al. 2000, Parrott\net al. 2001). In this paper, we have established the\nlocalisation of the expression of NGF protein and\nthe gene in the neonate mouse uterus and show it\nto be exclusively located in uterine luminal\nepithelial cells. The role of NGF in the uterus is\nunclear although it has been suggested that NGF is\nan important developmental regulator in the uterus\nand implicated in uterine reinnervation after\npregnancy (Brauer et al. 2000, Varol et al. 2000).\nThere is increasing evidence that NGF is under\nhormonal control in various tissues (Jehan et al.\n1993, Veenstra et al. 1998, Pan et al. 1999) and we\nfurther demonstrate this with oestradiol in the\nmouse uterus. Although NGF is under positive\ncontrol by oestradiol in the rat brain (Pan et al.\n1999), the present results show it not to be\nup-regulated by oestradiol in the mouse uterus.\nNGF is down-regulated during di fferentiation of\nmyotubes (Seidl et al. 1998) and therefore oestradiol\ncould be a critical factor during the di fferentiation\nprocess in the myometrium of the uterus.\nConversely, tamoxifen up-regulated NGF in the\nuterus of our mouse model, and continues up to 6\nweeks of age after birth (authors’ unpublished\nobservations). There is an AP1 enhancer element\nsituated on the NGF promoter sequence which\nmay be responsible for the NGF regulation by\noestradiol and tamoxifen (Veenstra et al. 1998).\nInterestingly, the fact that the /afii9825NGF gene was also\nexclusively up-regulated by tamoxifen in the\nluminal epithelium similar to that of cytokeratin 19\nand the AP1 sited on each gene promoter could\nsuggest a comparable mode of induction of these\ntwo genes by tamoxifen (Veenstra et al. 1998, Choi\net al. 2000). The mechanism of opposing actions of\noestradiol and tamoxifen is unknown but may be\ndue to oestrogen receptor (ER) levels; both ER /afii9825\nand ER /afii9826are expressed in the 6-day-old mouse\nuterus (Parrott et al. 2001), which can influence the\nstimulation or repression of gene expression via the\nAP1 site (Webb et al. 1995).\nTo understand the possible pathways of NGF\naction in the neonatal uterus, we investigated the\nexpression of the two receptors involved in NGF\nsignalling, p75\nNTR and trkA NGFR. Although\ntrkANGFR is found in the secretory phase of the\nhuman endometrium (Shibayama & Koizumi\n1996) and uterine carcinoma (Koizumi et al. 1998),\nwe found no evidence of expression of trkA\nNGFR in\nthe 6-day-old mouse uterus. p75 NTR expression\nwas shown in all cell types of the uterus. The\nhighest level of p75\nNTR was found in the\nEffect of oestradiol and SERMs on uterine NGF · A R GREEN and others 9\nwww.endocrinology.org Journal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nmyometrium, confirming a previous report\n(Lommatzsch et al. 1999). p75NTR is involved in the\nparacrine action of NGF in the prostate (Graham\net al. 1992) and our results suggest that a similar\naction could occur in the uterus. With the\nexpression of NGF in the luminal epithelium there\nis also a possibility of an autocrine loop existing. As\npreviously mentioned, the action of NGF depends\non receptor expression. NGF signals via P75\nNTR\nleading to either apoptosis or cell survival; a\npotential role in the uterus. Down-regulation of\nNGF and p75\nNTR occurs during terminal myo-\ngenic di fferentiation (Erck et al. 1998, Seidl et al.\n1998) and NGF enhances fibroblast migration\n(Micera et al. 2001).\nThe precise mechanism by which NGF is\nresponsible for adenomyosis is not yet fully\nclarified. It is clear from the present results that the\nNGF is produced primarily in the luminal epithelial\ncells and this action is up-regulated by certain ER\nmodulators such as tamoxifen. It is proposed that\nparacrine signalling prevents di fferentiation of\nuterine myocytes in the mesenchyme and, over a\nperiod of time, this may permit downgrowth of the\nendometrium into the myometrium.\nAcknowledgements\nWe would like to thank J Edwards, N Razvi and\nA Simpson for their expert technical assistance.\nReferences\nBartek J, Bartkova J, Taylor-Papadimitriou J, Rejthar J, Kovarik J,\nL u k a sZ&Vojtesek B 1986 Di fferential expression of keratin 19\nin normal human epithelial tissues revealed by monospecific\nmonoclonal antibodies. Histochemical Journal 18 565–575.\nBax B, Blundell TL, Murray-Rus tJ&M c D o n a l dN Q1997\nStructure of mouse 7S NGF: a complex of nerve growth factor\nwith four binding proteins. Structure˙ 5 1275–1285.\nBonner RF, Emmert-Buck M, Cole K, Pohida T, Chuaqui R,\nGoldsteinS&L iotta LA 1997 Laser capture microdissection:\nmolecular analysis of tissue. Science 278 1481–1483.\nBrauer MM, Shockley KP, Chavez R, Richeri A, Cowen T &\nCrutcher KA 2000 The role of NGF in pregnancy-induced\ndegeneration and regeneration of sympathetic nerves in the guinea\npig uterus. Journal of the Autonomic Nervous System 79 19–27.\nBurton MP, Schneider BG, Brown R, Escamilla-Ponc eN&G ulley\nML 1998 Comparison of histologic stains for use in PCR analysis\nof microdissected, para ffin-embedded tissues. Biotechniques 24\n86–92.\nChiarenza A, Lazarovici P, Lempereur L, Cantarella G, Bianchi A\n& Bernardini R 2001 Tamoxifen inhibits nerve growth factor-\ninduced proliferation of the human breast cancerous cell line\nMCF-7. Cancer Research 61 3002–3008.\nChoi I, Gudas LJ & Katzenellenbogen BS 2000 Regulation of\nkeratin 19 gene expression by estrogen in human breast cancer\ncells and identification of the estrogen responsive gene region.\nMolecular and Cellular Endocrinology 164 225–237.\nDescamps S, Lebourhis X, Delehedde M, Boill y B & Hondermarck H\n1998 Nerve growth factor is mitogenic for cancerous but not\nnormal human breast epithelial cells. Journal of Biological Chemistry\n273 16659–16662.\nDescamps S, Pawlowski V, Revillion F, Hornez L, Hebbar M, Boilly\nB, HondermarckH&P eyrat JP 2001 Expression of nerve growth\nfactor receptors and their prognostic value in human breast\ncancer. Cancer Research 61 4337–4340.\nDjakiew D, Delsite R, Pflug B, Wrathall J, Lynch JH & Onoda M\n1991 Regulation of growth by a nerve growth factor-like protein\nwhich modulates paracrine interactions between a neoplastic\nepithelial cell line and stromal cells of the human prostate. Cancer\nResearch 51 3304–3310.\nEhrig T, Abdulkadir SA, Dintzis SM, Milbrand tJ&W atson MA\n2001 Quantitative amplification of genomic DNA from\nhistological tissue sections after staining with nuclear dyes and\nlaser capture microdissection. Journal of Molecular Diagnosis 3 22–25.\nEmmertBuck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang ZP,\nGoldstein SR, Weiss RA & Liotta LA 1996 Laser capture\nmicrodissection. Science 274 998–1001.\nErck C, Meisinger C, Groth eC&S eidl K 1998 Regulation of nerve\ngrowth factor and its low-a ffinity receptor (p75 NTR) during\nmyogenic differentiation. Journal of Cellular Physiology 176 22–31.\nGoldsworthy SM, Stockton PS, Trempus CS, Foley JF & Maronpot\nRR 1999 E ffects of fixation on RNA extraction and amplification\nfrom laser capture microdissected tissue. Molecular Carcinogenesis 25\n86–91.\nGraham CW, Lynch JH & Djakiew D 1992 Distribution of nerve\ngrowth factor-like protein and nerve growth factor receptor in\nhuman benign prostatic hyperplasia and prostatic adenocarcinoma.\nJournal of Urology 147 1444–1447.\nGreen AR, Parrott EL, Butterworth M, Jones PS, Greaves P &\nWhite IN 2001 Comparisons of the e ffects of tamoxifen,\ntoremifene and raloxifene on enzyme induction and gene\nexpression in the ovariectomised rat uterus. Journal of Endocrinology\n170 555–564.\nJehan F, Neveu I, Naveilhan P, Brache tP&W i o nD1 9 9 3C o m p l e x\ninteractions among second messenger pathways, steroid hormones,\nand protooncogenes of the Fos and Jun families converge in the\nregulation of the nerve growth factor gene. Journal of Neurochemistry\n60 1843–1853.\nKitahara O, Furukawa Y, Tanaka T, Kihara C, Ono K, Yanagawa\nR, Nita ME, Takagi T, Nakamur aY&T s u n o d aT 2001\nAlterations of gene expression during colorectal carcinogenesis\nrevealed by cDNA microarrays after laser-capture microdissection\nof tumor tissues and normal epithelia. Cancer Research 61\n3544–3549.\nKohda Y, Murakami H, Moe OW & Star RA 2000 Analysis of\nsegmental renal gene expression by laser capture microdissection.\nKidney International 57 321–331.\nKoizumi H, Morita M, Mikami S, Shibayam aE&U chikoshi T\n1998 Immunohistochemical analysis of TrkA neurotrophin\nreceptor expression in human non-neuronal carcinomas. Pathology\nInternational 48 93–101.\nLommatzsch M, Braun A, Mannsfeldt A, Botchkarev VA,\nBotchkareva NV, Paus R, Fischer A, Lewin GR & Renz H 1999\nAbundant production of brain-derived neurotrophic factor by\nadult visceral epithelia. Implications for paracrine and\ntarget-derived neurotrophic functions. American Journal of Pathology\n155 1183–1193.\nLooi LM & Cheah PL 1992 In situ hybridisation: principles and\napplications. Malaysian Journal of Pathology 14 69–76.\nA R GREEN and others · Effect of oestradiol and SERMs on uterine NGF10\nwww.endocrinology.orgJournal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access\n\n\nLuo L 1999 Gene expression profiles of laser-captured adjacent\nneuronal subtypes. Nature Medicine 5 117–122.\nMariani L, McDonough WS, Hoelzinger DB, Beaudry C,\nKaczmarek E, Coons SW, Giese A, Moghaddam M, Seiler RW &\nBerens ME 2001 Identification and validation of P311 as a\nglioblastoma invasion gene using laser capture microdissection.\nCancer Research 61 4190–4196.\nMartin L, Finn CA & Trinder G 1973 Hypertrophy and hyperplasia\nin the mouse uterus after oestrogen treatment: an autoradiographic\nstudy. Journal of Endocrinology 56 133–144.\nMicera A, Vigneti E, Pickholtz D, Reich R, Pappo O, Bonini S,\nM a q u a r tF X ,A l o eL&Levi-Schaffer F 2001 Nerve growth factor\ndisplays stimulatory e ffects on human skin and lung fibroblasts,\ndemonstrating a direct role for this factor in tissue repair. PNAS\n98 6162–6167.\nPan Y, Anthony M & Clarkson TB 1999 E ffect of estradiol and soy\nphytoestrogens on choline acetyltransferase and nerve growth\nfactor mRNAs in the frontal cortex and hippocampus of female\nrats. Proceedings of the Society of Experimental Biology and Medicine 221\n118–125.\nParrott E, Butterworth M, Green A, White IN & Greaves P 2001\nAdenomyosis – a result of disordered stromal di fferentiation.\nAmerican Journal of Pathology 159 623–630.\nReis FM, Cobellis L, Luisi S, Driul L, Florio P, Falett iA&P etraglia\nF 2000 Paracrine/autocrine control of female reproduction.\nGynecological Endocrinology 14 464–475.\nSeidl K, Erck C & Buchberger A 1998 Evidence for the\nparticipation of nerve growth factor and its low-a ffinity receptor\n(p75 NTR) in the regulation of the myogenic program. Journal of\nCell Physiology 176 10–21.\nSgroi DC, Teng S, Robinson G, LeVangie R, Hudson JR Jr &\nElkahloun AG 1999 In vivo gene expression profile analysis of\nhuman breast cancer progression. Cancer Research 59 5656–5661.\nShen CY, Yu JC, Lo YL, Kuo CH, Yue CT, Jou YS,\nHuang CS, Lung JC & Wu CW 2000 Genome-wide search\nfor loss of heterozygosity using laser capture microdissected\ntissue of breast carcinoma: an implication for mutator\nphenotype and breast cancer pathogenesis. Cancer Research 60\n3884–3892.\nShibayama E & Koizumi H 1996 Cellular localization of the Trk\nneurotrophin receptor family in human non-neuronal tissues.\nAmerican Journal of Pathology 148 1807–1818.\nSkalli O, Vandekerckhov eJ&G a b b i a n iG1 9 8 7Actin-isoform\npattern as a marker of normal or pathological smooth-muscle and\nfibroblastic tissues. Differentiation 33 232–238.\nTanji N, Ross MD, Cara A, Markowitz GS, Klotman PE &\nD’Agati VD 2001 E ffect of tissue processing on the ability to\nrecover nucleic acid from specific renal tissue compartments\nby laser capture microdissection. Experimental Nephrology 9\n229–234.\nVarol FG, Duchemin AM, Ne ff NH & Hadjiconstantinou M 2000\nNerve growth factor (NGF) and NGF mRNA change in rat uterus\nduring pregnancy. Neuroscience Letters 294 58–62.\nVeenstra TD, Fahnestock M & Kumar R 1998 An AP-1 site in the\nnerve growth factor promoter is essential for\n1,25-dihydroxyvitamin D3-mediated nerve growth factor\nexpression in osteoblasts. Biochemistry 37 5988–5994.\nWebb P, Lopez GN, Uht RM & Kushner PJ 1995 Tamoxifen\nactivation of the estrogen receptor/AP-1 pathway: potential origin\nfor the cell-specific estrogen-like e ffects of antiestrogens. Molecular\nEndocrinology 9 443–456.\nReceived in final form 24 October 2002\nAccepted 30 October 2002\nEffect of oestradiol and SERMs on uterine NGF · A R GREEN and others 11\nwww.endocrinology.org Journal of Molecular Endocrinology (2003) 30, 1–11\nDownloaded from Bioscientifica.com at 06/12/2026 05:23:21PM\nvia free access","source_license":"CC0","license_restricted":false}