{"paper_id":"ec98f17b-1a3b-41cb-9e5a-08cf2452a7ab","body_text":"Endometriosis (ENDO) is a prevalent, chronic, estrogen-dependent gynaecological disorder affecting approximately 6–10% (~ 190 million) of reproductive-aged women globally 1 . It is marked by the presence and proliferation of viable ectopic endometrial-like tissue outside the uterus, commonly on the pelvic peritoneum or ovaries 2 . Often simplified as solely dysmenorrhea 3 . ENDO is an etiologically complex, multifaceted inflammatory condition. It is characterized by dysregulated cell proliferation, impaired hormonal signaling, chronic inflammation, immunological dysregulation, angiogenesis, neurogenic inflammation, and notably, epithelial-to-mesenchymal transition (EMT)-induced tissue remodeling and fibrosis 4 , 5 . ENDO is a major contributor to debilitating chronic pelvic pain (CPP) and infertility. The often underestimated distress of ENDO extends beyond pain, significantly impacting well-being and productivity 6 . Laparoscopically, lesions are classified by distribution, showing significant heterogeneity 7 . Histological diagnosis requires at least two of: endometrial epithelium, glands, stroma, nerve fibers/blood vessels, hemosiderin-laden macrophages, or fibrosis 7 . Despite its commonality, ENDO’s pathogenesis remains unclear, and therapeutic options are limited, emphasizing the need for research 8 .\nJohn Sampson’s 1927 “retrograde menstruation” theory is the most cited explanation for ectopic tissue implantation 9 , 10 . However, only a subset of women experiencing retrograde menstruation develop ENDO. This suggests additional mechanisms, including immune evasion, implantation, proliferation, peritoneal invasion, and neovascularization 11 , 12 . The inflammatory microenvironment, rich in alternatively activated macrophages and neutrophils, cytokines, chemokines, and growth factors, is increasingly recognized as a key driver of ENDO 13 . Notably, fibrosis, once viewed as secondary, is now considered a defining characteristic of ENDO 14 – 17 with growing support for its inclusion in diagnostic criteria 18 , 19 . The inflammatory milieu in ENDO is closely linked to fibrosis, as indicated by altered immune cell profiles and cytokine levels in peritoneal fluid 20 . Thus, ENDO can be considered both an inflammatory and a fibrotic disease 14 . However, the interplay between inflammation and the development of fibrotic endometriotic implants remains a critical research gap 21 .\nDeveloping effective ENDO therapies necessitates evaluation in animal models that accurately mimic the human disease. However, spontaneous ENDO is limited to menstruating species, with practical limitations 22 . Murine ENDO models are widely used due to their advantages 23  but rodents do not menstruate, making retrograde menstruation an unlikely mechanism 24 . Consequently, models involve surgical transplantation of uterine tissue or human endometriotic tissue into mice 25 – 28  often with estrogen supplementation 26 , 29 . While human tissue transplantation has benefits, it faces immune rejection issues 30 . Surgical models create lesions resembling clinical ENDO but can disrupt peritoneal immunity 26 . Intraperitoneal injection is also used but may not fully replicate human lesions 31 , 32 .\nDespite advancements in developing rodent models of ENDO, their ability to accurately replicate the progressive fibrosis characteristic of chronic human ENDO remains a significant limitation. Existing models often emphasize the initial formation of lesions and the accompanying immunological responses, largely neglecting the gradual and ongoing progression of fibrosis. This lack of a reliable model that recapitulates the fibrotic progression hinders the investigation of the underlying mechanisms of fibrogenesis and the preclinical evaluation of potential anti-fibrotic therapies. A key challenge lies in the insufficient representation of the progressive fibrotic process observed in human ENDO lesions. Furthermore, current models often provide an inadequate evaluation of key myofibroblast markers such as α-SMA, Collagen I, and Nestin, which are crucial for understanding fibrosis. Comprehensive data on ECM remodeling, with collagen deposition and tissue stiffness in rodents mirroring human fibrotic alterations, are absent. Finally, an over-reliance on in vitro model systems may not fully capture the complex cellular interactions and microenvironmental cues driving fibrosis in vivo. These shortcomings underscore the pressing need for an optimized mouse model that comprehensively replicates the progressive fibrotic aspects of human ENDO.\nTherefore, our study aims to establish and validate an experimental fibrotic syngeneic mouse model of ENDO by comparing C57BL/6J, BALB/c, and Swiss albino strains. We seek to identify the strain that most accurately replicates the inflammatory and fibrotic pathophysiology of ENDO by thoroughly characterizing the morphological, histological, and functional features of the generated model. This research provides a comprehensive framework for assessing inflammation and fibrosis in ENDO. We aim to select the optimal mouse strain for accurate disease modeling, addressing significant discrepancies between experimental models and clinical pathology, particularly concerning fibrosis.\n\nAll methods were carried out in accordance with relevant guidelines and regulations. All procedures were performed as described below.\nThis study involving human samples was approved by the Institutional Ethics Committee (IEC1: 94/2022), Kasturba Medical College and Kasturba Hospital, Manipal, adhering to the Helsinki Declaration of 1964 and its later amendments. Written informed consent was obtained from all patients. Lesions were collected through laparoscopic excision. While patient hormone status was not a primary focus of this study, standard clinical protocols were followed for all sample collection.\nThe Institutional Animal Ethics Committee at Kasturba Medical College, Manipal, approved the use of animals (Approval Number: C57BL/6J- IAEC/KMC/88/2024, BALB/c- IAEC/KMC/45/2022, Swiss albino- IAEC/KMC/56/2022). Institutional guidelines and the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA)were strictly followed for animal handling, and the reporting of animal experiments follows ARRIVE (Animal Research: Reporting of In vivo Experiments) guidelines. The study utilized adult inbred female mice (8–10 weeks, 23 ± 2 g) of three distinct strains: C57BL/6J, BALB/c, and Swiss albino. All the animals were procured from the Central Animal Research Facility, Manipal Academy of Higher Education. Mice were housed (6 per cage) in an environment-controlled setting (21 ± 2 °C, 50–55% humidity, 12–12 h light-dark cycle) at the Central Animal Research Facility, Manipal Academy of Higher Education, with ad libitum access to water and food.\nA total of C57BL/6J ( n  = 27), BALB/c ( n  = 24), and Swiss albino ( n  = 27) mice were used for ENDO induction. For each strain, recipient mice were assigned as follows: C57BL/6J ( n  = 14), BALB/c ( n  = 12), and Swiss albino ( n  = 14). Six control mice were included for each strain. The experimental protocol was adapted from a previously published method 33  with minor modifications. Syngeneic female donor and recipient mice of the three strains were allowed to acclimate for 5 days before the experimental procedures. During this acclimation period, the estrous cycle stages of each animal were monitored using the vaginal lavage method.\nFollowing confirmation of consistent estrous cycling, donor mice were primed with subcutaneous injections of estradiol benzoate (EB) (TCI chemicals, #E0329) (3 µg/mouse) for seven consecutive days to synchronize their estrous cycles and promote endometrial development. After priming, donor mice were euthanized, and their eutopic uterine horns were harvested. Excess fat and debris were carefully removed, and the uterine horns were rinsed with cold, sterile 1x Phosphate-Buffered Saline (PBS) containing penicillin (100 U/mL) and streptomycin (100 mg/mL) (Pen/strep) (ThermoFisher Scientific #15140122). The uterine tissue was then meticulously minced into small cell aggregation suspensions of uterine fragments (UFs < 0.1 mm) containing both eutopic endometrium and uterine muscle. These UF suspensions were divided into two equal portions, resuspended in 0.5 mL of PBS in a 1 mL syringe (Dispovan), and randomly injected I/P into recipient mice using an 18-gauge needle (0.5 mL per recipient). Thus, each recipient mouse received endometrial tissue from half of a donor uterus. Control mice received subcutaneous injections of estradiol benzoate and I/P injections of 0.5 mL of sterile 1x PBS(without pen/strep). No signs of distress or unusual pain behaviors were observed post-injection. Recipient animals received a single dose of EB before UF injection to synchronize their estrous cycles. Both the recipients and control animals were subsequently administered EB every two days until sacrifice to maintain uniform circulating estrogen levels (as depicted in Fig.  1 ).\nFig. 1 Experimental design and timeline of ENDO induction and behavioral assessments. UH from a single donor mouse were processed into small fragments (~ 1 mm) and equally distributed via I/P injection into two recipient mice to induce endometriosis. Behavioral assessments for pain (burrowing, von Frey) and exploratory behavior (OFT) were conducted between days 16–18 post-induction. Subsequent tissue collection for ELISA, flow cytometry (FC), histology (H&E), Masson’s trichrome staining (MTS), immunohistochemistry (IHC), qRT-PCR, and Western blot (WB) was performed. (Created in part with BioRender.com).\nExperimental design and timeline of ENDO induction and behavioral assessments. UH from a single donor mouse were processed into small fragments (~ 1 mm) and equally distributed via I/P injection into two recipient mice to induce endometriosis. Behavioral assessments for pain (burrowing, von Frey) and exploratory behavior (OFT) were conducted between days 16–18 post-induction. Subsequent tissue collection for ELISA, flow cytometry (FC), histology (H&E), Masson’s trichrome staining (MTS), immunohistochemistry (IHC), qRT-PCR, and Western blot (WB) was performed. (Created in part with BioRender.com).\nBehavioral assays were conducted to assess pain-like behavior and anxiety levels in ENDO-induced mice. All measurements were performed by the same investigator in a blinded manner to ensure consistency and minimize bias. After each test, mice were returned to their home cages.\nThe burrowing assay, standardized by Deacon with minor modifications 34  was performed between 16:00 and 18:00 h (3 h before the dark cycle). Control and recipient mice were individually housed in cages equipped with a burrow setup. Mice were initially acclimatized to the burrow tube (20 cm × 6 cm) filled with 200 g of chow diet for 30 min without food in the cage hopper. Water was provided ad libitum. The test was initiated after acclimatization to the laboratory setting with the burrow setup for at least one hour. Each mouse was placed in its cage-burrow setup for two hours. Subsequently, the amount of feed burrowed was measured by weighing the displaced amount in the morning.\nMechanical hyperalgesia was assessed using an electronic von Frey filament approach (Dynamic Plantar Aesthesiometer, Ugo Basile) based on methodologies described by Barrot and Gregory 35 , 36 . Mice were individually placed in Plexiglas chambers on a wire mesh floor and allowed to acclimate for 1 h until exploratory behavior ceased. A calibrated von Frey filament touch probe (Ugo Basile) applied a gradually increasing force (up to 10 g) to the abdomen. A definite withdrawal response (abdominal retraction, licking, or flinching), along with the corresponding filament force (grams) and duration (seconds), was recorded as the withdrawal threshold. An interval of at least 30 min was maintained between applications.\nExploratory behavior and anxiety levels were assessed 9 days post-UF injection using the OFT 37 . Control and ENDO mice were individually placed in the center of a transparent Plexiglas box (50 cm × 50 cm × 40 cm) with a clean floor. The box was virtually divided into central and peripheral zones. Each mouse was placed in a corner and allowed to explore for 15 min. The number of entries into the central and peripheral zones, as well as the time spent in them, were recorded using a video-tracking system (Logitech HD C930e webcam). Increased anxiety is indicated by more time spent in the peripheral zones and fewer entries into the central zone. The data were analyzed via ANY-maze 64-bit version 7.48 software.\nOn day 12 post-induction, all recipient mice were euthanized by cervical dislocation, and blood, peritoneal fluid (PF), and suspected ENDO-like lesions were collected.\nBlood and Serum: Blood was collected via cardiac puncture under Ketamine + Xylazine cocktail (0.1mL/20 g mouse wt. IP) anesthesia. Serum was separated by centrifugation at 3000 × g for 10 min at 4 °C and stored at −80 °C for ELISA-based cytokine analysis (IL-6, TNF-α, TGF-β, and Estrogen).\nThe PF was collected from the control and the recipient mice in individual tubes collected by peritoneal lavage with 2 mL of sterile 1x PBS. The fluid was treated with RBC lysis buffer(eBioscience™ 1X RBC Lysis Buffer Catalog number 00-4333-57) for 15 min and centrifuged to eliminate erythrocytes. The cells were subsequently resuspended in sterile 1x PBS for flow cytometry analysis of M1 and M2 macrophage populations.\nEctopic lesions were photographed for documentation using smart phone camera. Selected lesions were either fixed in Bouin’s solution for 24 h, then transferred to 70% ethanol and embedded in paraffin for histological and immunohistochemical (IHC) analyses, or flash-frozen in liquid nitrogen and stored at −80 °C for RNA (E-cadherin, N-cadherin, and S100A4) and protein (Cytokeratin, Snail, and Vimentin) analyses. Recipient mice without visible lesions were excluded from further investigation.\nThe overall success rate for each strain was calculated as the percentage of recipients with confirmed ectopic lesions. This was done by evaluating recipient mice for ENDO-like lesions based on gross morphology, histological analysis (H&E staining), and the presence of characteristic IHC markers such as Ki67 (proliferation), CD31 (neovascularization), and F4/80 (macrophages).\nSerum estradiol (E2) levels were quantified using a commercially available ELISA kit (ELK Biotechnology CO., LTD, #ELK8407) following the manufacturer’s instructions. Estradiol concentrations (pg/mL) were determined by comparing sample absorbance (450 nm) to a standard curve generated with serially diluted estradiol standards, analyzed in duplicate using a microplate reader (MultiSkan FC Microplate Photometer with SkanIt software).\nPF cells were collected and treated with RBC lysis buffer as described earlier. After washing, 1 × 10 6  cells were incubated with fluorophore-conjugated antibodies: anti-MO-CD11b-Alexa Fluor 488, anti-MO-CD86-APC, and anti-MO-CD206-PE (all from eBioscience). After incubation, cells were washed and resuspended in PBS. Flow cytometry analysis was performed using a BD Accuri™ C6 Plus flow cytometer, and data were analyzed using FlowJo software to determine the percentage of positive cells for each marker.\nEctopic ENDO lesions and control eutopic endometrium were fixed, embedded in paraffin, and sectioned (4 μm). Sections were deparaffinized, rehydrated, stained with hematoxylin (Sigma-Aldrich, #HX03021349) and eosin (Sigma-Aldrich, #1.15935), and mounted with DPX mountant (Sisco Research Laboratories Pvt Ltd, # 88147). Slides were examined using a bright-field microscope (Nikon Eclipse Ei 4 W), and representative images were captured. Histological assessment confirmed the presence of epithelial glands and stromal cells as previously described 38 . Samples not exhibiting endometrial morphology were excluded.\nParaffin-embedded ectopic lesions from all three mouse strains were immunostained with primary antibodies against Ki67 (proliferation), CD31 (blood vessels), and F4/80 (macrophages) (all from ThermoFisher Scientific). Briefly, sections were deparaffinized, rehydrated, and antigens were retrieved using sodium citrate buffer (Sigma-Aldrich, Missouri, USA #C7254). Sections were permeabilized with bovine serum albumin (BSA) (HiMedia, India #MB083) in Triton X-100 (Sisco Research Laboratories Pvt Ltd #2024271), and blocked with 5% goat serum (Genei, #163018010A) before overnight incubation with primary antibodies at 4 °C, followed by incubation with appropriate HRP-conjugated secondary antibodies Immunoreactive signals were visualized using 3,3′-Diaminobenzidine (DAB) (Sigmafast, Sigma-Aldrich, #D4293) (Sigma-Aldrich), and sections were counterstained with hematoxylin (Sigma-Aldrich, #HX03021349). Slides were mounted with DPX mountant, and representative images were captured using a Nikon microscope (Nikon Eclipse Ei 4 W, Nikon, Tokyo, Japan) and analyzed using ImageJ software. Antibody details are provided in Table  1 .\nCollagen deposition in ectopic lesions was assessed using MTS 39 . Sections were fixed, embedded, deparaffinized, and rehydrated. They were then sequentially stained with hematoxylin (Sigma-Aldrich #HX03021349), Biebrich scarlet-acid fuchsin solution(Loba chemie Pvt Ltd, #3855D), phosphomolybdic-phosphotungstic acid(Loba chemie Pvt Ltd, #05265)for 10–15 min, and, and aniline blue (Sisco Research Laboratories Pvt. Ltd.). After dehydration and mounting, slides were examined under a light microscope. The area of collagen deposition (blue staining) was quantified as a proportion of the total ectopic lesion area using ImageJ software.\nThe levels of Collagen Type I (COL1A1) in ectopic tissue lysates were quantified using a commercially available ELISA kit (Krishgen Biosystems, USA, #111111111). Lesions were homogenized in 1x PBS, centrifuged at 12,000 × g for 20 min at 4 °C, and the supernatant was collected. ELISA was performed according to the manufacturer’s instructions using 50 µL of lysate per sample, analyzed in duplicate. Optical density was measured at 450 nm, and COL1A1 concentrations were calculated using a standard curve.\nIron deposits in ectopic lesions were identified using Prussian blue staining based on Perls’ reaction 40 . Sections were treated with a freshly prepared mixture of 5% potassium ferrocyanide (Sigma Aldrich #244023) and hydrochloric acid (v/v), counterstained with nuclear fast red 41  dehydrated, and mounted. Images were captured using a Nikon microscope, and the area of iron deposition (blue staining) was measured using ImageJ software ( https://imagej.nih.gov/ij/download.html , RRID: SCR_003070).\nEpithelial-to-mesenchymal transition (EMT) status in ENDO lesions was assessed by immunostaining for Cytokeratin (epithelial marker), α-Smooth Muscle Actin (α-SMA, mesenchymal/fibrotic marker), and Nestin (marker of cellular plasticity/intermediate mesenchymal state) (all from Cell Signaling Technologies or ThermoFisher Scientific; details in Table  1 ). The immunostaining procedure was performed as described previously.\nTable 1 Antibodies used in the study primary antibodies. Primary antibodies Target Primary antibody Species raised in Dilution used (IHC/WB) Manufacturer & catalog number RRID  Proliferating cells (Ki67) Anti-Ki67 (Monoclonal) Rat 1:100 IHC ThermoFisher Scientific, #14-5698-82 AB_10854564  Blood vessels (CD31/PECAM) Anti-CD31 (Monoclonal) Rabbit 1:100 IHC ThermoFisher Scientific, #14-0311-81 AB_467201  Macrophages (F4/80) Anti-F4/80 (Monoclonal) Rat 1:50 IHC ThermoFisher Scientific, #14-4801-82 AB_467558  Pan-keratin (C11) mouse mAb Pan-keratin (Monoclonal) Mouse 1:500 IHC 1:1000 WB Cell Signaling TECHNOLOGIES #4545 -  αSMA Anti- αSMA (Monoclonal) Mouse 1:200 IHC ThermoFisher Scientific, #14-976080 AB_2572996  Nestin Anti- αSMA (Monoclonal) Mouse 1:200 IHC ThermoFisher Scientific, #14-584380 AB_1907436  Vimentin rabbit pAb Vimentin (Polyclonal) Rabbit 1:1000 WB ABclonal #A11952 AB_2861643  Snail rabbit pAb Snail (Polyclonal) Rabbit 1:1000 WB ABclonal #A5243 AB_2766076 Secondary antibodies for DAB IHC Target Secondary antibody Species raised in Dilution used Manufacturer & catalog number RRID Rat IgG (H + L) Goat anti-rat IgG (H + L) (HRP-conjugated) Goat 1:1000 IHC ThermoFisher Scientific, #A18865 AB_2535642 Mouse IgG Fc Goat anti-Mouse IgG Fc Secondary Antibody, HRP Goat 1:1000 IHC 1:10000 WB ThermoFisher Scientific, #A16084 AB_2534758 Rabbit IgG Fc Goat anti-Rabbit IgG Fc Secondary Antibody, HRP Goat 1:1000 IHC 1:10000 WB ThermoFisher Scientific, #A16116 AB_2534789 Antibodies used for flow cytometry Target Primary antibody Species raised in Dilution used Manufacturer & catalog number RRID CD 11b Mouse Anti-Mo-CD 11b-Alexa flour 488 Monoclonal Rat 0.5 µg/test eBioscience # 53-0112-80 AB_469901 CD 86 Mouse CD86 (B7-2) monoclonal antibody (GL1), APC-eFluor™ 780 Rat 0.06 µg/test eBioscience # 17-0862-81 AB_469418 CD 206 Mouse Anti-Mo-Cd206 (MMR) Monoclonal Antibody (MR6F3), PE Rat 0.125 µg/test eBioscience # 12-2061-80 AB_2637422 CD 68 Mouse Anti-Mo-CD68 (FA-11), PE Rat 0.25 μg/test eBioscience #12-0681-80 AB_2572569\nAntibodies used in the study primary antibodies.\n1:100\nIHC\n1:100\nIHC\n1:50\nIHC\n1:500\nIHC\n1:1000\nWB\nCell Signaling\nTECHNOLOGIES #4545\n1:200\nIHC\nAnti- αSMA\n(Monoclonal)\n1:200\nIHC\n1:1000\nWB\nABclonal\n#A11952\n1:1000\nWB\nABclonal\n#A5243\n1:1000\nIHC\nMouse\nIgG Fc\n1:1000\nIHC\n1:10000\nWB\n1:1000\nIHC\n1:10000\nWB\nCD 11b\nMouse\nAnti-Mo-CD 11b-Alexa flour 488\nMonoclonal\neBioscience\n# 53-0112-80\nCD 86\nMouse\neBioscience\n# 17-0862-81\nCD 206\nMouse\neBioscience\n# 12-2061-80\nCD 68\nMouse\neBioscience\n#12-0681-80\nSnap-frozen serum samples were thawed, and cytokine concentrations (IL-6 (ABclonal, #RK00008), TNF-α (ABclonal, #RK00027), and TGF-β (ABclonal, #RP01458), were measured using mouse-specific ELISA kits according to the manufacturer’s instructions. Serum from control mice was used to establish baseline cytokine levels. Standard curves were generated for each cytokine, and samples were analyzed ( n  = 6 per group). The detection limits for IL-6, TNF-α, and TGF-β were 7.2, 6.5, and 3.9 pg/mL, respectively.\nTotal RNA was extracted from frozen ENDO lesions ( n  = 3 biological replicates) using a Qiagen RNeasy Mini Kit (Qiagen, #74104). Complementary DNA (cDNA) was synthesized using the PrimeScript RT Reagent Kit (TaKaRa Bio Inc., #RR037A). qRT-PCR was performed using Sybr ®  Premix Ex Taq™ II (Tli RNase H Plus, TakaraBio, #RR820A) on a StepOne real-time PCR system (Applied Biosystems) to assess the gene expression of fibrotic markers: E-cadherin, N-cadherin, and S100A4, with GAPDH as an internal control. Primer efficiencies and specificities were confirmed to be between 90% and 110%. Reactions were performed in duplicate, and amplification included initial denaturation (98 °C, 2 min) followed by 40 cycles of denaturation (98 °C, 30 s), annealing (optimal temperature, 30 s), and extension (72 °C, 45 s). All samples were examined in triplicate. Primer sequences were custom-synthesized by Bioserve Biotechnologies (India) Pvt Ltd and are provided in Table  2 .\nTable 2 Primer sequences used in the experiments. Gene Oligonucleotide sequence (5′ to 3′) Product size (bp) GAPDH F- ATGGGACGATGCTGGTACTGA R- TGCTGACAACCTTGAGTGAAAT 117 E-cadherin F- AACCCAAGCACGTATCAGGG R- ACTGCTGGTCAGGATCGTTG 142 N-cadherin F- CACTGCCATTGATGCGGATG R- TGCCACAGTGATGATGTCCC 136 S100A4 F- TTGTGGTTGAGCTGTGGGAG R- GGTAACCGTTGAGACCCCTC 122\nPrimer sequences used in the experiments.\nF- ATGGGACGATGCTGGTACTGA\nR- TGCTGACAACCTTGAGTGAAAT\nF- AACCCAAGCACGTATCAGGG\nR- ACTGCTGGTCAGGATCGTTG\nF- CACTGCCATTGATGCGGATG\nR- TGCCACAGTGATGATGTCCC\nF- TTGTGGTTGAGCTGTGGGAG\nR- GGTAACCGTTGAGACCCCTC\nProtein profiling for fibrosis-associated markers was performed on ectopic lesions by western blotting. Snap-frozen ectopic lesions and corresponding eutopic endometrium were homogenized in RIPA lysis buffer with protease inhibitor cocktail (TCI chemicals, #P2976). Equivalent amounts of protein (30 µg) were separated by SDS-PAGE (10–12%) and blotted onto PVDF membranes. Membranes were blocked with 5% non-fat dry milk and incubated overnight at 4 °C with primary antibodies against Cytokeratin (ABclonal, #A5243), Snail (ABclonal, #A5243), and Vimentin (ABclonal, #A11952). After washing with TBST, membranes were incubated with appropriate secondary antibodies (1:10000) at RT for 1 h. Immunoreactive bands were visualized using enhanced chemiluminescence and a gel documentation system (GE healthCare Systems, Amersham Imager 600).\n\nStatistical analysis was performed using GraphPad Prism (version 10.2). Data from two groups were analyzed using Student’s t-test (unpaired, two-tailed, 95% CI, significance defined as  p  < 0.05). Ordinary one-way ANOVA was used for comparisons of three or more groups. Data are presented as mean ± standard error of the mean (SEM) of triplicate measurements. Significant differences are indicated by asterisks in figures (*  p  < 0.05, **  p  < 0.01, ***  p  < 0.001, ****  p  < 0.0001).\n\nThe burrowing assay, a measure of well-being and potential pain-related behavior, revealed a significant reduction in the amount of chow displaced by ENDO mice compared to their respective controls across all strains. Specifically, C57BL/6J ENDO mice displaced an average of 5.79 ± 7.30 g after 2 h and 19.02 ± 19.43 g overnight, significantly less than the control group (2 h: 12.9 ± 1.66 g; overnight: 153.38 ± 28.30 g) (Fig.  2 A). Similarly, BALB/c ENDO mice showed a substantial decrease in burrowing, with an average displacement of 31.94 ± 26.13 g at 2 h and 43.61 ± 32.93 g overnight, compared to controls (2 h: 103.99 ± 33.32 g; overnight: 150.63 ± 34.90 g)(Fig.  2 B). Swiss albino ENDO mice also exhibited reduced burrowing, displacing 12.94 ± 12.02 g at 2 h and 63.52 ± 51.92 g overnight, compared to controls (2 h: 50.13 ± 35.22 g; overnight: 157.67 ± 63.52 g) (Fig.  2 C).\nMechanical hypersensitivity, assessed using the electronic von Frey test, was significantly heightened in ENDO mice of all strains compared to their respective control groups (Fig.  2 D, E, F). This was evidenced by a markedly lower mechanical threshold (force in grams required to elicit a withdrawal response in ENDO mice, indicating an increased sensitivity to tactile abdominal stimulation.\nIn the OFT, used to evaluate exploratory behavior and anxiety levels, ENDO mice across all strains exhibited reduced exploratory activity. The trajectory plots (Fig.  2 G, H, I) visually confirmed the diminished overall movement in ENDO mice. This is indicated by a statistically significant decrease in the number of entries into the central and peripheral zones, as well as a shorter duration of time spent in the central, more exposed area of the arena (Fig.  2 J, K, L). Swiss albino mice showed similar trends but without statistical significance for central zone entries or time spent. The increased time spent in the peripheral zones further indicates heightened anxiety-like behavior in the ENDO groups, though this was not statistically significant in C57BL/6J mice.\nFig. 2 ( A ) C57BL/6J ENDO mice showed significantly reduced burrowing activity, heightened mechanical sensitivity (Von Frey), and altered Open Field Test (OFT) parameters (decreased central zone duration/entries, increased peripheral zone time) compared to controls, indicative of pain-related behavior. ( B ) BALB/c ENDO mice also exhibited significant impairment in burrowing, increased Von Frey sensitivity, and reduced central zone activity in OFT, suggesting persistent pain or anxiety-like behavior. ( C ) Swiss albino ENDO mice displayed diminished burrowing, heightened mechanical sensitivity, and decreased central zone activity in OFT, consistent with pain-related behavioral modifications observed in other strains. While no significant strain-specific differences were observed, BALB/c and C57BL/6J mice showed a tendency towards a more pronounced burrowing deficit. ( n  = 6 per control group,  n  = 14 per ENDO group for C57BL/6J and Swiss albino,  n  = 12 per ENDO group for BALB/c; *** P  < 0.001, **** P  < 0.0001). Trajectory plots for C57BL/6J ( G ), BALB/c ( H ), and Swiss albino ( I ) ENDO and control mice in the Open Field Test, visually confirming diminished overall movement in ENDO mice.( D ,  E ,  F ) Significantly heightened mechanical hypersensitivity in ENDO mice of all strains compared to their respective control groups. ( J ,  K ,  L ) Statistically significant decrease in the number of entries into the central and peripheral zones, a shorter duration of time spent in the central area, and increased time spent in the peripheral zones in the ENDO groups compared to the controls.\n( A ) C57BL/6J ENDO mice showed significantly reduced burrowing activity, heightened mechanical sensitivity (Von Frey), and altered Open Field Test (OFT) parameters (decreased central zone duration/entries, increased peripheral zone time) compared to controls, indicative of pain-related behavior. ( B ) BALB/c ENDO mice also exhibited significant impairment in burrowing, increased Von Frey sensitivity, and reduced central zone activity in OFT, suggesting persistent pain or anxiety-like behavior. ( C ) Swiss albino ENDO mice displayed diminished burrowing, heightened mechanical sensitivity, and decreased central zone activity in OFT, consistent with pain-related behavioral modifications observed in other strains. While no significant strain-specific differences were observed, BALB/c and C57BL/6J mice showed a tendency towards a more pronounced burrowing deficit. ( n  = 6 per control group,  n  = 14 per ENDO group for C57BL/6J and Swiss albino,  n  = 12 per ENDO group for BALB/c; *** P  < 0.001, **** P  < 0.0001). Trajectory plots for C57BL/6J ( G ), BALB/c ( H ), and Swiss albino ( I ) ENDO and control mice in the Open Field Test, visually confirming diminished overall movement in ENDO mice.( D ,  E ,  F ) Significantly heightened mechanical hypersensitivity in ENDO mice of all strains compared to their respective control groups. ( J ,  K ,  L ) Statistically significant decrease in the number of entries into the central and peripheral zones, a shorter duration of time spent in the central area, and increased time spent in the peripheral zones in the ENDO groups compared to the controls.\nI/P injection of minced donor uterine horn tissue fragments into the recipient animals was well-tolerated, with no significant mortality or adverse effects on the overall health and body weight of the recipient mice (Fig.  3 A). This resulted in the successful development of ectopic lesions across all three inbred strains after 12 days (Fig.  3 B). Macroscopic examination at necropsy revealed the presence of multiple ectopic lesions in all ENDO-induced mice, varying in size (small to moderate) and morphology (cystic or solid) with diverse coloration (white, brown, red, or black) (Fig.  3 C). The lesions were predominantly on peritoneal surfaces, adipose tissue, and pelvic organs.\nThe prevalence of endometriosis, defined as the percentage of recipient mice exhibiting visible ectopic lesions, demonstrated a significant strain-dependent variation (Fig.  3 D). The C57BL/6J strain showed the highest incidence at 92.85% (13 out of 14 mice), followed by BALB/c at 83.33% (10 out of 12 mice), and Swiss albino at 64.28% (9 out of 14 mice). Circulating serum estrogen levels, measured by ELISA, were significantly ( p  < 0.01) elevated in ENDO mice compared to their respective sham controls across all three strains, confirming the estrogen-dependent nature of the induced lesions (Fig.  3 E). To account for the impact of estrogen priming, the control animal animals were injected with EB every alternate day until sacrifice.\nFig. 3 General health, lesion distribution, incidence, and estrogen levels in the endometriosis mouse model. ( A ) Body Weight Monitoring: Cumulative mean ± SEM body weight of control and ENDO mice post-injection. No significant differences ( P  > 0.05) were observed between groups throughout the experimental period, indicating that ENDO induction did not compromise the general well-being of recipient mice despite a transient minor decrease in the ENDO group after day 7. ( B ) Ectopic Lesion Distribution: Representative illustration showing the common anatomical locations of ectopic lesions identified 12 days post-ENDO induction across all mouse strains, including adipose tissue, peritoneal layer, uterine horn, ovaries (adhesions), and internal organs (intestine). ( C ) Macroscopic Appearance of Ectopic Lesions: Representative in situ photographs of ectopic lesions observed across the three mouse strains. Lesions typically presented as superficial, white cystic or red nodules/lesions exhibiting varying degrees of inflammation. Control mice injected with 1× PBS did not develop any lesions. ( D ) Incidence of Endometriosis Across Strains: The incidence of ENDO varied significantly among strains, with C57BL/6J exhibiting the highest success rate (92.85%, 13/14), followed by BALB/c (83.33%, 10/12) and Swiss albino (64.28%, 9/14). ( E ) Circulating Estrogen Levels: ELISA analysis revealed significantly increased circulating estrogen levels in ENDO mice compared to their respective controls across all three strains ( p  < 0.01, unpaired t-test), indicating systemic estrogen dependence and hormonal dysregulation associated with the model. Data are presented as mean ± SEM.\nGeneral health, lesion distribution, incidence, and estrogen levels in the endometriosis mouse model. ( A ) Body Weight Monitoring: Cumulative mean ± SEM body weight of control and ENDO mice post-injection. No significant differences ( P  > 0.05) were observed between groups throughout the experimental period, indicating that ENDO induction did not compromise the general well-being of recipient mice despite a transient minor decrease in the ENDO group after day 7. ( B ) Ectopic Lesion Distribution: Representative illustration showing the common anatomical locations of ectopic lesions identified 12 days post-ENDO induction across all mouse strains, including adipose tissue, peritoneal layer, uterine horn, ovaries (adhesions), and internal organs (intestine). ( C ) Macroscopic Appearance of Ectopic Lesions: Representative in situ photographs of ectopic lesions observed across the three mouse strains. Lesions typically presented as superficial, white cystic or red nodules/lesions exhibiting varying degrees of inflammation. Control mice injected with 1× PBS did not develop any lesions. ( D ) Incidence of Endometriosis Across Strains: The incidence of ENDO varied significantly among strains, with C57BL/6J exhibiting the highest success rate (92.85%, 13/14), followed by BALB/c (83.33%, 10/12) and Swiss albino (64.28%, 9/14). ( E ) Circulating Estrogen Levels: ELISA analysis revealed significantly increased circulating estrogen levels in ENDO mice compared to their respective controls across all three strains ( p  < 0.01, unpaired t-test), indicating systemic estrogen dependence and hormonal dysregulation associated with the model. Data are presented as mean ± SEM.\nHistological evaluation of the ectopic lesions using H&E staining confirmed the presence of characteristic endometriotic features in all three strains (Fig.  4 B–D). These included the presence of endometrial glands with surrounding stroma, evidence of previous microhemorrhages indicated by hemosiderin-laden macrophages within the stroma, and the formation of new blood vessels. These histological features were consistent with the expected morphology of endometriotic lesions and resembled the structure of the control UH obtained from mice in the estrous phase (Fig.  4 A).\nIHC analysis of the lesions further characterized their cellular composition. Compared to the uterus (Fig.  4 E), there was a significant increase in the number of Ki67-positive cells in the ectopic lesions(Fig.  4 H), indicating enhanced cell proliferation. Similarly, compared to the control (Fig.  4 F), the density of CD31-positive endothelial cells, marking neovascularization, was significantly higher in the lesions (Fig.  4 I). Furthermore, relative to the control (Fig.  4 G) a substantial infiltration of F4/80-positive macrophages was evident in the stromal regions of the ectopic lesions across all strains (Fig.  4 J). Across all ENDO lesions analyzed by quantitative IHC (Fig.  4 K), we observed a high level of cell proliferation (65.18% Ki67+), significant vascularization (15.68% CD31+), and a notable presence of macrophages (41.67% F4/80+). While all strains exhibited these markers, visual inspection suggested potentially higher levels in C57BL/6J lesions, consistent with its heightened fibrotic and inflammatory profile.\nFig. 4 Histological confirmation and cellular characterization of ectopic endometriotic lesions. ( A ) Control uterine horn (UH) from healthy mice in the estrous stage displayed normal morphology (H&E,  n  = 6). ( B – D ) Ectopic lesions harvested at day 12 post-induction from C57BL/6J, BALB/c, and Swiss albino mice (H&E,  n  = 6 per group) exhibited characteristic endometriotic features, including singular or multi-layered epithelium, dense immune cell infiltration in the stroma, and the presence of endometrial glands. ( E – G ) Immunohistochemical analysis of control uterus sections ( E – G , Control) revealed ( H ) proliferating epithelial cells (Ki67+), ( I ) established vasculature (CD31/PECAM1+), and ( J ) a significant presence of macrophages (F4/80+). Representative images for ( H ,  I ,  J ) are shown from C57BL/6J ectopic lesions, and similar staining patterns were observed across all three strains. ( K ) Quantitative analysis of IHC staining across all ENDO lesions from all strains ( n  = 3 per group) indicated a high proliferative index (65.18% Ki67+), substantial vascularization (15.68% CD31+), and marked macrophage infiltration (41.67% F4/80+). (Magnification and scale bars to be consistently applied throughout the figure. Example: Magnification = 4x, scale bar = 40 μm; Magnification = 40x, Scale bar = 10 μm).\nHistological confirmation and cellular characterization of ectopic endometriotic lesions. ( A ) Control uterine horn (UH) from healthy mice in the estrous stage displayed normal morphology (H&E,  n  = 6). ( B – D ) Ectopic lesions harvested at day 12 post-induction from C57BL/6J, BALB/c, and Swiss albino mice (H&E,  n  = 6 per group) exhibited characteristic endometriotic features, including singular or multi-layered epithelium, dense immune cell infiltration in the stroma, and the presence of endometrial glands. ( E – G ) Immunohistochemical analysis of control uterus sections ( E – G , Control) revealed ( H ) proliferating epithelial cells (Ki67+), ( I ) established vasculature (CD31/PECAM1+), and ( J ) a significant presence of macrophages (F4/80+). Representative images for ( H ,  I ,  J ) are shown from C57BL/6J ectopic lesions, and similar staining patterns were observed across all three strains. ( K ) Quantitative analysis of IHC staining across all ENDO lesions from all strains ( n  = 3 per group) indicated a high proliferative index (65.18% Ki67+), substantial vascularization (15.68% CD31+), and marked macrophage infiltration (41.67% F4/80+). (Magnification and scale bars to be consistently applied throughout the figure. Example: Magnification = 4x, scale bar = 40 μm; Magnification = 40x, Scale bar = 10 μm).\nAnalysis of circulating pro-inflammatory cytokines in serum samples revealed a distinct strain-specific inflammatory response to ENDO induction (Fig.  5 A–C). C57BL/6J ENDO mice exhibited a marked and statistically significant elevation in IL-6 levels compared to controls, with modest but non-significant increases in TNF-α and TGF-β. In BALB/c ENDO mice, TNF-α levels were significantly increased compared to controls, with slight, non-significant increases in IL-6 and TGF-β. In contrast, Swiss albino ENDO mice did not show any statistically significant alterations in the circulating levels of these three cytokines.\nFlow cytometric analysis of peritoneal fluid macrophages revealed strain-specific patterns of M1 (CD86⁺CD11⁺) and M2 (CD206⁺CD11⁺) macrophage populations (Fig.  5 D–F). In the C57BL/6J strain, M1 and M2 macrophages were present at 26.5% and 27.2% of the CD11b + population, respectively, indicating a balanced and robust immune cell involvement. BALB/c mice showed M1 and M2 populations at 24.9% and 26.9%, respectively, suggesting a similarly active but slightly more M2-skewed profile. Swiss albino mice exhibited M1 and M2 populations at 20.7% and 25.3%, respectively, indicating a comparatively lower overall macrophage activation in the peritoneal fluid. These percentages represent average values from flow cytometry analysis across multiple mice for each strain ( n  = 3 for C57BL/6J, Swiss albino, and BALB/c). While M2 populations were numerically higher than M1 populations across all strains, suggesting a pro-fibrotic environment, statistical significance for this difference was not performed in this study.\nFig. 5 Strain-dependent systemic inflammation and peritoneal macrophage polarization in endometriosis. ( A ) Serum cytokine analysis in C57BL/6J ENDO mice revealed a significant increase in IL-6, with modest elevations in TNF-α and TGF-β. ( B ) BALB/c ENDO mice showed a prominent rise in TNF-α, accompanied by minor increases in IL-6 and TGF-β. ( C ) In contrast, Swiss albino ENDO mice exhibited no significant alterations in circulating levels of these cytokines. ( D – F ) Peritoneal fluid flow cytometry demonstrated the percentage of M1 (CD11b + CD86+) and M2 (CD11b + CD206+) macrophages in ENDO mice of each strain: ( D ) C57BL/6J showed a balanced M1/M2 population (26.5% vs. 27.2%), ( E ) BALB/c displayed similar M1 (24.9%) and M2 (26.9%) percentages, and ( F ) Swiss albino exhibited M1 (20.7%) and M2 (25.3%) populations.\nStrain-dependent systemic inflammation and peritoneal macrophage polarization in endometriosis. ( A ) Serum cytokine analysis in C57BL/6J ENDO mice revealed a significant increase in IL-6, with modest elevations in TNF-α and TGF-β. ( B ) BALB/c ENDO mice showed a prominent rise in TNF-α, accompanied by minor increases in IL-6 and TGF-β. ( C ) In contrast, Swiss albino ENDO mice exhibited no significant alterations in circulating levels of these cytokines. ( D – F ) Peritoneal fluid flow cytometry demonstrated the percentage of M1 (CD11b + CD86+) and M2 (CD11b + CD206+) macrophages in ENDO mice of each strain: ( D ) C57BL/6J showed a balanced M1/M2 population (26.5% vs. 27.2%), ( E ) BALB/c displayed similar M1 (24.9%) and M2 (26.9%) percentages, and ( F ) Swiss albino exhibited M1 (20.7%) and M2 (25.3%) populations.\nMasson’s trichrome staining, used to visualize collagen deposition, demonstrated a substantial presence of collagen-rich fibrotic areas (blue staining) in the stromal regions of ectopic lesions across all three strains (Fig.  6 A). Quantitative analysis revealed a significant increase in the collagen-positive area in C57BL/6J ENDO mice compared to controls and the other strains, indicating more pronounced fibrotic remodeling. While the numerical difference in percentage between C57BL/6J (69.95%) and BALB/c (69.05%) was small, C57BL/6J exhibited a statistically significant difference in collagen deposition when compared to Swiss albino (57.47%) and controls, indicating more pronounced fibrotic remodeling in C57BL/6J. Prussian blue staining revealed a considerable accumulation of iron deposits (blue staining) within the stroma of the ectopic lesions in all strains (Fig.  6 C) compared to the control horn(Fig.  6 B), suggesting chronic microhemorrhaging and inflammation within the lesions. ELISA of ectopic lesion lysates confirmed significantly elevated protein levels of Col1A1 in the lesions compared to control uterine tissues across all strains. The highest levels of this key component of the fibrotic extracellular matrix were observed in C57BL/6J mice (Fig.  6 D).\nFig. 6 Assessment of fibrosis and iron accumulation in ectopic lesions across strains. ( A ) Masson’s trichrome staining (MTS) revealed varying degrees of collagen deposition (blue) in ectopic lesions, with C57BL/6J exhibiting the most pronounced fibrosis, followed by substantial fibrosis in BALB/c (quantified at 69.95%), and the least in Swiss albino (57.47%). ( B ,  C ) Prussian blue staining showed strain-dependent iron deposition (blue precipitates, arrowheads) in the lesion stroma, with significant accumulation in C57BL/6J (score: 2.348), moderate in BALB/c (score: 1.208), and minimal in Swiss albino (score: 0.356, OD: 0.084). ( D ) Collagen Type I alpha 1 (Col1A1) ELISA indicated significant stromal fibrosis in C57BL/6J (* p  < 0.05), moderate fibrosis in BALB/c (lower than C57BL/6J but higher than Swiss albino), and mild fibrosis in Swiss albino. Data are mean ± SEM, * p  < 0.05 (unpaired t-test).\nAssessment of fibrosis and iron accumulation in ectopic lesions across strains. ( A ) Masson’s trichrome staining (MTS) revealed varying degrees of collagen deposition (blue) in ectopic lesions, with C57BL/6J exhibiting the most pronounced fibrosis, followed by substantial fibrosis in BALB/c (quantified at 69.95%), and the least in Swiss albino (57.47%). ( B ,  C ) Prussian blue staining showed strain-dependent iron deposition (blue precipitates, arrowheads) in the lesion stroma, with significant accumulation in C57BL/6J (score: 2.348), moderate in BALB/c (score: 1.208), and minimal in Swiss albino (score: 0.356, OD: 0.084). ( D ) Collagen Type I alpha 1 (Col1A1) ELISA indicated significant stromal fibrosis in C57BL/6J (* p  < 0.05), moderate fibrosis in BALB/c (lower than C57BL/6J but higher than Swiss albino), and mild fibrosis in Swiss albino. Data are mean ± SEM, * p  < 0.05 (unpaired t-test).\nImmunohistochemical analysis of fibrotic and EMT-related markers (α-SMA, Nestin, Cytokeratin) revealed minimal expression in control uterine tissues (Fig.  7 A). In contrast, C57BL/6J lesions showed strong expression of these markers (Fig.  7 B). BALB/c and Swiss albino lesions showed moderate and lower expression levels, respectively (Fig.  7 C, D). Notably, the staining patterns observed in our mouse model, particularly in C57BL/6J mice, qualitatively resembled those seen in human ENDO tissue (Fig.  7 E), suggesting potential translational relevance, though this comparison was not quantitatively analyzed for statistical significance. C57BL/6J lesions exhibited the highest percentage of positively stained cells for all three markers (α-SMA: 17.41%, Nestin: 8.28%, Cytokeratin: 10.08%), indicative of a significant fibrotic and EMT signature. Lesions used for immunostaining were collected at day 12 post-induction and represent various morphologies (cystic or solid) observed across the strains. Figure  7 F represents the average percentage of positively stained cells across the tissue field from multiple mice for each strain ( n  = 3 per group for IHC analysis).\nFig. 7 Strain-dependent expression of fibrotic markers in ectopic lesions and translational relevance to human endometriosis. ( A ,  E ) Control tissues exhibited negligible immunohistochemical staining for α-SMA, Nestin, and Cytokeratin (quantified as low percentages). ( B ,  E ) C57BL/6J ectopic lesions displayed the most pronounced fibrotic profile, characterized by the highest percentages of α-SMA, Nestin, and Cytokeratin positive cells. ( C ,  E ) BALB/c lesions showed intermediate expression levels of these markers, while ( D ,  E ) Swiss albino lesions exhibited the lowest expression. Data are presented as the percentage of positively stained cells across the tissue field. ( E ) Comparative IHC analysis of Cytokeratin, Vimentin, and Nestin in ectopic lesions from the mouse model and human endometriosis samples revealed similar patterns of marker localization and staining intensity, supporting the model’s translational significance. (DAB brown, Hematoxylin blue counterstain; Magnification: 40x, 100x, 1000x). ( F ) Percentage of positively stained cells for all three markers (α-SMA: 17.41%, Nestin: 8.28%, Cytokeratin: 10.08%.\nStrain-dependent expression of fibrotic markers in ectopic lesions and translational relevance to human endometriosis. ( A ,  E ) Control tissues exhibited negligible immunohistochemical staining for α-SMA, Nestin, and Cytokeratin (quantified as low percentages). ( B ,  E ) C57BL/6J ectopic lesions displayed the most pronounced fibrotic profile, characterized by the highest percentages of α-SMA, Nestin, and Cytokeratin positive cells. ( C ,  E ) BALB/c lesions showed intermediate expression levels of these markers, while ( D ,  E ) Swiss albino lesions exhibited the lowest expression. Data are presented as the percentage of positively stained cells across the tissue field. ( E ) Comparative IHC analysis of Cytokeratin, Vimentin, and Nestin in ectopic lesions from the mouse model and human endometriosis samples revealed similar patterns of marker localization and staining intensity, supporting the model’s translational significance. (DAB brown, Hematoxylin blue counterstain; Magnification: 40x, 100x, 1000x). ( F ) Percentage of positively stained cells for all three markers (α-SMA: 17.41%, Nestin: 8.28%, Cytokeratin: 10.08%.\nGene expression analysis using qRT-PCR revealed a classic EMT profile in C57BL/6J lesions, with a consistent downregulation of E-cadherin (0.52-fold change) and significant upregulation of mesenchymal markers N-cadherin (1.59-fold change) and S100A4 (42.66-fold change) (Fig.  8 A).BALB/c lesions also showed evidence of partial EMT, with a significant upregulation of S100A4, alongside reduced E-cadherin and low N-cadherin. Swiss albino lesions exhibited inconsistent E-cadherin levels and minimal mesenchymal marker expression. To validate mRNA expression patterns of C57BL/6j, protein levels of cytokeratin, snail, and vimentin were assessed through densitometric analysis of immunoreactive bands in ENDO lesions and corresponding control tissues from C57BL/6J mice ( n  = 3 per group). Snail expression was numerically higher in ENDO lesions (mean = 1.43 µg/mL) than in controls (mean = 0.99 µg/mL), suggesting the transcriptional activation of EMT pathways. Cytokeratin expression was also numerically elevated in lesions (mean = 1.35 µg/mL), indicating retention of epithelial characteristics. Vimentin levels were numerically diminished in ENDO lesions (mean = 0.82 µg/mL) relative to controls, potentially suggesting a potential divergence from the traditional EMT state (Fig.  8 B). These observations, while indicative of trends, did not reach statistical significance in this analysis.\nFig. 8 Differential EMT Marker expression at the transcriptional and translational levels in endometriotic lesions. ( A ) mRNA expression profiles of E-cadherin, N-cadherin, and S100A4 in ectopic lesions across three mouse strains. C57BL/6J lesions displayed a robust EMT signature with E-cadherin downregulation and significant upregulation of N-cadherin and S100A4 (** P  < 0.01, **** P  < 0.0001). BALB/c lesions showed evidence of partial EMT with reduced E-cadherin, low N-cadherin, and moderate S100A4. Swiss albino lesions exhibited inconsistent E-cadherin levels and minimal mesenchymal marker expression. ( B ) Western blot analysis in C57BL/6J mice ( n  = 3 per group) revealed increased protein levels of Snail (ENDO: 1.43 µg/mL, Control: 0.99 µg/mL) and Cytokeratin (ENDO: 1.35, Control: 0.98) in ENDO lesions, while Vimentin expression was reduced (ENDO: 0.82 µg/mL, Control: 1.11 µg/mL).\nDifferential EMT Marker expression at the transcriptional and translational levels in endometriotic lesions. ( A ) mRNA expression profiles of E-cadherin, N-cadherin, and S100A4 in ectopic lesions across three mouse strains. C57BL/6J lesions displayed a robust EMT signature with E-cadherin downregulation and significant upregulation of N-cadherin and S100A4 (** P  < 0.01, **** P  < 0.0001). BALB/c lesions showed evidence of partial EMT with reduced E-cadherin, low N-cadherin, and moderate S100A4. Swiss albino lesions exhibited inconsistent E-cadherin levels and minimal mesenchymal marker expression. ( B ) Western blot analysis in C57BL/6J mice ( n  = 3 per group) revealed increased protein levels of Snail (ENDO: 1.43 µg/mL, Control: 0.99 µg/mL) and Cytokeratin (ENDO: 1.35, Control: 0.98) in ENDO lesions, while Vimentin expression was reduced (ENDO: 0.82 µg/mL, Control: 1.11 µg/mL).\n\nOur study comprehensively characterizes a syngeneic mouse model of endometriosis across three commonly used inbred strains: C57BL/6J, BALB/c, and Swiss albino. We meticulously compared lesion development, behavioral alterations indicative of pain and anxiety, the inflammatory milieu, macrophage polarization, and the progression of fibrosis. The findings suggest the C57BL/6J strain as the most promising model for recapitulating the inflammatory and fibrotic pathophysiology of human ENDO, particularly its fibrotic component. This model was established through a straightforward, cost-effective, and short intraperitoneal injection protocol. The model effectively mimics key aspects of the human disease, like collagen deposition, pain-related behavioral changes, and the upregulation of crucial EMT biomarkers.\nThe behavioral assays provided compelling evidence for the development of pain and anxiety-like behaviors in the ENDO mice. Significant reduction in burrowing activity was observed across all strains. This aligns with findings in other animal models and symptomatic women with ENDO, where discomfort and pain often lead to decreased engagement 42 . The heightened mechanical hypersensitivity observed in the ENDO mice further supports the presence of endometriosis-associated hyperalgesia, a hallmark of the human condition 43 . The diminished exploratory behavior and increased time spent in the peripheral zones of the OFT suggest elevated anxiety levels, which are frequently comorbid with chronic pelvic pain in women with ENDO 23 . The C57BL/6J strain consistently exhibited the most pronounced behavioral alterations, making it suitable for investigating the mechanisms underlying ENDO-associated pain.\nThe successful induction of ectopic lesions in all ENDO-challenged mice, coupled with the absence of significant morbidity, underscores the feasibility and safety of our syngeneic model 31 . The elevated circulating estrogen levels were observed in all ENDO groups. This corroborates the well-established estrogen-dependent nature of endometriosis 29  and validates the hormonal milieu supporting lesion development in our model. The significantly higher prevalence of lesion formation in the C57BL/6J strain points towards inherent differences in immune responses or hormonal sensitivity.\nHistopathological analysis confirmed that the induced lesions in all strains displayed typical glandular and stromal components as observed in human ENDO 44 , 45 . There was increased cell proliferation, neovascularization, and macrophage infiltration within the lesions. This is characteristic of human endometriotic implants, highlighting the active and dynamic nature of these ectopic tissues 46 , 47 . The heightened angiogenic and macrophage infiltration observed in C57BL/6J lesions suggests a more active inflammatory and fibrotic environment in this strain.\nThe strain-dependent differences in systemic inflammation and macrophage polarization are noteworthy. The marked elevation of IL-6 in C57BL/6J mice and TNF-α in BALB/c mice suggests distinct inflammatory pathways are activated in response to ENDO in these strains 48 , 49 . The increased M2 macrophage population in the peritoneal fluid of all ENDO strains aligns with previous findings, indicating the pro-fibrotic environment of endometriosis 50 . The most dramatic alterations in pro-fibrotic immune subsets observed in C57BL/6J mice are consistent with its heightened fibrotic and inflammatory profile 51 .\nA key finding of our study is the significant increase in collagen deposition and Col1A1 protein levels in the ectopic lesions, particularly in the C57BL/6J strain. This robust fibrotic response in C57BL/6J mice mimics the excessive collagen deposition that defines fibrotic ENDO in humans 17 , 18 . The substantial iron deposits in the lesions further indicate chronic microhemorrhage and inflammation. Iron overload is known to contribute to fibrosis in various tissues 52 , 53 .\nThe immunohistochemical and molecular analyses of EMT and fibrotic markers provide strong evidence for the involvement of EMT in the fibrotic remodeling. The lesions in C57BL/6J showed high expression of α-SMA, Nestin, and Cytokeratin, resembling the patterns observed in human ENDO tissue. This underscores the activation of myofibroblasts and the ongoing tissue remodeling 54 . The gene expression data, showing a classical EMT signature in C57BL/6J mice (downregulated E-cadherin, upregulated N-cadherin, and S100A4), further supports this notion. The Western blot findings in C57BL/6J lesions showed elevated Snail and Cytokeratin and decreased Vimentin. This suggests a dynamic and potentially complex EMT process, warranting further investigation to fully understand its role in the fibrotic progression of endometriosis 55 .\nThis study provides a comprehensive characterization of syngeneic mouse models for endometriosis, but we acknowledge several limitations. Firstly, murine models do not naturally menstruate, making the widely accepted theory of retrograde menstruation not replicable in mice. The current model relies on the injection of uterine fragments, which may not fully mimic the complex clinical processes leading to human lesion establishment. Secondly, we have compared mouse lesions to human tissue samples to provide qualitative visual validation. This aspect was not quantitatively analyzed for statistical significance, therefore, direct translational comparability may be missing. Future studies using RNA sequencing or advanced proteomics for in-depth comparative analysis between mouse strains and human samples would provide further insights into the molecular similarities and differences. Additionally, while behavioral assays like burrowing used for the study are not specific to endometriosis-associated pain alone. Estrogen and inflammation are the two most prominent characteristics in endometriosis. In this work, we did not study the interplay of estrogen and inflammatory pathways. Future research could explore the local estrogen metabolism within the lesions.\nIn conclusion, our comprehensive comparison of three inbred mouse strains demonstrates that the C57BL/6J syngeneic model most accurately recapitulates the key pathological features of human endometriosis. The model showed behavioral alterations indicative of pain and anxiety, a pro-inflammatory and M2 macrophage-skewed immune environment, and a robust fibrotic response driven by EMT-related mechanisms. This model offers a significant ability to mimic the progressive fibrosis, a critical aspect of chronic ENDO. The C57BL/6J model is promising for future research. aimed at understanding molecular pathways of fibrosis in endometriosis and for the preclinical evaluation of novel anti-fibrotic strategies 56 . Using a traffic light-based classification 57  C57BL/6J receives the maximum green lights, indicating confirmation of the clinical phenotype (Fig.  9 ). BALB/c comes promising second in this classification. However, the Swiss albino strain showed inconsistent results across various parameters, making it unsuitable for ENDO modelling. Further investigations into strain-dependent variations observed in our study are warranted to enhance our understanding of endometriosis pathogenesis and to facilitate the development of more effective treatments 57 , 58 .\nFig. 9 Comparative performance of mouse strains in modeling syngeneic endometriosis. A traffic light rating system (Dorning et al. 2021) was used to compare the ability of C57BL/6J, BALB/c, and Swiss albino mice to model key characteristics of syngeneic endometriosis. Green indicates excellent, orange moderate, and red poor performance across defined parameters.\nComparative performance of mouse strains in modeling syngeneic endometriosis. A traffic light rating system (Dorning et al. 2021) was used to compare the ability of C57BL/6J, BALB/c, and Swiss albino mice to model key characteristics of syngeneic endometriosis. Green indicates excellent, orange moderate, and red poor performance across defined parameters.\n\nBelow is the link to the electronic supplementary material.\nSupplementary Material 1\nSupplementary Material 1","source_license":"CC0","license_restricted":false}