{"paper_id":"ea5965f0-ff2d-4642-99d5-7279f0e97b83","body_text":"Stress urinary incontinence (SUI) is one of the leading disorders affecting the female population, featured by involuntary urinary leakage induced by elevated intraabdominal pressure due to various factors such as exertion, coughing, or sneezing [ 1 ]. SUI is also more prevalent in women undergoing the first pregnancy or childbearing, while imposing negative psychological and physical consequences to the patients in the process [ 2 ]. Meanwhile, a plethora of factors including aging, delivery, excessive smoking, cognitive function failure, obesity, and pharmacotherapy, are known to contribute to SUI [ 3 ]. Moreover, the process of mechanical injury-induced extracellular matrix (ECM) degradation is known to augment reproductive tract dysfunction, elastic fiber structure destruction, and pelvic damages in SUI patients [ 4 ]. Furthermore, impairment of fibroblast function is associated with ECM metabolic disorder, also leading to exacerbation of SUI [ 5 ]. Currently, SUI is diagnosed by cystoscopy or urodynamics, while treatment strategies include the use of pelvic floor training, conservative therapies, sub-urethral sling treatment, and reconstructive surgery [ 6 ]. Despite the advancements made during the past decades, there is still a lack of widely accepted approaches for SUI treatment due to the limitation of medical tools, consensual standards and validated therapeutic managements [ 7 ]. In lieu of this predicament, it would be prudent to advance the search for reliable biomarkers to improve the efficacy of SUI treatment.\nNicotinamide phosphoribosyltransferase (Nampt), a key NAD biosynthetic enzyme, serves as a critical participator in the modulation of cell metabolic activities, senescence, apoptosis, and reprogramming, in a wide range of conditions [ 8 ]. Although the role of Nampt in SUI is seldom studied, a number of authors have come across the detrimental effects of Nampt in a host of diseases. For instance, a prior study indicated that over-expression of Nampt could predict ventilator-triggered damages and elicit vascular remodeling in severe pulmonary arterial hypertension [ 9 ]. On the other hand, Nampt silencing was previously associated with mitigatory inflammatory infiltration and concordant matrix degradation and synthesis in intervertebral disc degeneration [ 10 ]. Meanwhile, the study performed by Muraoka  et al . highlighted the pathogenic effect of Nampt on diabetic nephropathy due to its ability to regulate epigenetic gene variance and strengthen fibrosis, collagen deposition, and ECM metabolism [ 11 ]. In addition, Nampt down-regulation was accompanied by elevated cellular viability, suppressed apoptosis, and degraded ECM metabolism in the context of osteoarthritis [ 12 ]. All of the aforementioned evidence is suggestive of the positive correlation between Nampt and ECM production. Accordingly, we hypothesized that Nampt might affect ECM degradation of SUI fibroblasts. It is also noteworthy that Nampt is implicated in various immune conditions and nerve injuries due to its ability to manipulate apoptosis, metabolic activities, and autophagy [ 13 ]. Similarly, another study documented that inhibition of Nampt led to attenuation of inflammatory symptoms in sepsis by virtue of enhancing autophagy [ 14 ]. Meanwhile, existing evidence further suggests that ECM remodeling is down-regulated when autophagy is elevated in patients with pulmonary fibrosis and treated with effective drugs [ 15 ]. Likewise, a prior study revealed that conjunctival fibrosis augmented by ECM production could be reversed by autophagy [ 16 ]. In a word, Nampt might participate in SUI by modulating ECM degradation and autophagy. Consequently, the current study aimed to investigate the effect of Nampt on ECM metabolism of SUI fibroblasts. Herein, we speculated whether Nampt could affect ECM degradation in SUI fibroblasts  via  regulation of autophagy, in an effort to provide new theoretical insight for SUI treatment.\n\nThe current study was approved and supervised by the Ethics committee of Zhengzhou Central Hospital Affiliated to Zhengzhou University, and conformed to the guidelines published in Declaration of Helsinki. Signed informed consents were obtained from all participants prior to specimen collection. Animal experimentation protocols were also approved by the Institutional Animal Care and Use Committee of Zhengzhou Central Hospital Affiliated to Zhengzhou University and  Guidelines for the Care and Use of Laboratory Animals  proposed by the National Institutes of Health [ 17 ]. Extensive efforts were made to minimize the number and suffering of the experimental animals.\nFirstly, anterior vaginal wall tissues were collected from 30 SUI patients (calculated mean age of 47.6 ± 8.4 years) who underwent surgery at the Zhengzhou Central Hospital Affiliated to Zhengzhou University; simultaneously, anterior vaginal wall tissues were also collected from 30 patients (calculated mean age of 46.6 ± 9.9 years) undergoing hysterectomy for other surgeries during the same period as the controls. None of the patients in both groups were complicated with connective tissue-related diseases such as endometriosis, gynecological malignancies, chronic obstructive pulmonary emphysema, or rheumatoid arthritis, and none had undertaken treatment with sex hormones within 3 months before the surgery. The anterior vaginal wall tissue specimens were isolated at 1–2 cm from the cervix and each sample was divided into two parts; one part of the tissue was fixed with 10% neutral buffered formalin at 25°C for 12–24 h and then paraffin-embedded for immunofluorescence analyses, while the other part was stored at −80°C for reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis. Additionally, anterior vaginal wall tissues from 3 controls (47.3 ± 7.6 years) at the same duration were selected for fibroblast isolation, rinsed with phosphate buffer saline (PBS), sliced into small pieces, and then detached with collagenase for cell culture and subsequent experimentation.\nFemale Sprague-Dawley rats [aged 8 weeks old, weighing 280–330 g, Beijing Vital River Laboratory Animal Technology Co., Ltd, Beijing, China, SYXK (Beijing), 2017–0033] were raised under conditions with constant temperature (20°C-26°C) and humidity (40%-60%) under 12 h light/dark cycles, with  ad libitum  access to water and food. SUI rat modeling was carried out according to a previous study [ 18 ]. Briefly, the acclimatized rats were intraperitoneally anaesthetized with ketamine (50 mg/kg), and the forelimbs were fixed and then dragged into a cage in a supine position. Subsequently, a catheter was inserted 2–3 cm into the rat’s vagina and fixed with a single 3–0 surgical needle. The balloon was then inflated with 5 mL sterile saline. The catheter was then suspended from the cage without touching the surface. The end of the catheter was equipped with a water sac weighing approximately 0.3 kg. Traction was imposed parallel on the vagina for 8 h as described above. Maximum bladder volume (MBV) and abdominal leak point pressure (ALPP) were measured after 1 week of the injury to ensure whether the SUI model was successfully established. At the end of detection, all rats were intraperitoneally euthanized with sodium pentobarbital (800 mg/kg) to collect the anterior vaginal wall tissues for subsequent analysis.\nAs previously reported [ 18 ], the urethral orifice of rats was disinfected with iodophor, and an epidural catheter coated with paraffin oil was inserted 2–3 cm into the bladder  via  the urethra. The experimenter placed a finger on the upper edge of the pubic symphysis of rats to prevent the catheter from passing through the bladder wall. After the rat’s bladder was drained, a syringe was attached to the epidural catheter, and methylene blue sterile saline solution was injected into the bladder at 10 mL/h using a micro-pump (Medical Instruments of Zhejiang University, Hangzhou, Zhejiang, China). Subsequently, MBV was recorded when the blue liquid overflowed from the urethra. After another draining of the rat’s bladder, the syringe was disconnected from the catheter and a sterile saline injection was adjusted into half of MBV. Next, a whisker was cut off from the rat and inserted into the rat’s nostril to stimulate sneezing. Blue fluid from the urethral orifice was regarded as a positive result of the sneezing test. Each SUI rat was anaesthetized and placed in a supine position to make a median incision. Following bladder exposure, an apex with a diameter of 1.5 mm was made in the bladder dome. An epidural catheter (0.5–1 cm) was implanted into the bladder. Afterward, the catheter was sutured and secured with a 5–0 suture. Methylene blue saline (37°C) was injected into the bladder  via  a micro-pump. Finally, the pressure in the bladder was measured with the help of a pressure transducer.\nAnterior vaginal wall tissues (0.5 × 0.5 × 1.0 cm) in the control group were rinsed with PBS and sliced into small pieces [ 19 ]. Subsequently, the tissues were centrifuged at 250  g  at 25°C for 5 min, followed by detachment with collagenase for 120 min and DNase I for 20 min. Subsequently, the cells were rinsed with PBS again, and then cultured in Dulbecco’s modified Eagle’s medium/high glucose (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) comprising of 20% bovine serum (HyClone). After 3–5 days of primary culture, fibroblasts were detached with trypsin for 2 min and passaged in culture flasks.\nPassage 3 fibroblasts (density of 1 × 10 5  cells/well) were seeded into 12-well plates pre-coated with coverslips for 48 h [ 19 ]. Cells on the glass were fixed with 4% paraformaldehyde for 10–15 min, followed by 3 PBS rinses and treatment with 0.5% Triton X-100 for 10 min. Subsequently, the cells were incubated with 3% hydrogen peroxide for 5 min, immersed in PBS, blocked with goat serum at room temperature for 10 min, and then cultivated with primary antibodies Pan-CK (ab215838; Abcam Inc., Cambridge, MA, USA) and Vimentin (ab8978, Abcam) at 4°C overnight. The following day, the cells were rewarmed at 37°C for 30 min, soaked in PBS, cultivated with the secondary antibody (ab205719, Abcam) at 37°C for 15 min, developed with 2,4-diaminobutyric acid (ZSGB-BIO, Beijing, China), sealed with neutral resins and observed under an optical microscope (OLYMPUS Optical Co., Ltd, Tokyo, Japan).\nFibroblasts were treated with various concentrations (0, 0.5, 1, 5, 10 ng/mL) of interleukin (IL)-1β (Peprotech, Rocky Hill, NJ, USA) or 10 mmol/L 3-methyladenine (3-MA) (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 24 h [ 20 ]. In order to down-regulate the Nampt expression in fibroblasts, the following 3 kinds of lentivirus (LV)-packaged short hairpin (sh) RNAs (all procured from Shanghai Genechem Co., Ltd., Shanghai, China) were employed: Nampt shRNA 1#, Nampt shRNA 2#, and Nampt shRNA 3# were constructed, with LV-packaged scramble-negative shRNA as the control. Cells (1 × 10 5  cells/well) were seeded in 6-well plates 24 h prior to transfection. Subsequently, the cells were incubated to reach approximately 50% confluence and transfected with LV in the polybrene medium (5 μg/mL, multiplicity of infection = 10) for 12 h. Afterward, the medium containing LV was replaced with 4 mL fresh medium. Cells were re-screened with the medium containing puromycin (4 μg/mL Gibco, Grand Island, NY, USA) after 72 h to generate stable cell lines.\nThe effects of different concentrations of IL-1β on cell viability were evaluated with the help of CCK-8 kit (Dojindo Laboratories, Kumamoto, Japan), using the manufacturer’s instructions [ 21 ]. Briefly, cells (2000 cells/well) were cultured in 96-well plates for 8 h. The medium was then replaced with a mixture of fresh medium (100 μL) and CCK-8 solution (10 μL). One h later, the optical density at a wavelength of 450 nm was detected using an Epoch Microplate spectrophotometer (BioTek, Winooski, VT, USA).\nMDC is a type of fluorescent dye that acts as a specific marker for autophagy vacuoles. Accordingly, a MDC staining assay was carried out as previously described [ 20 ]. Briefly, fibroblasts in 6-well plates were treated with glucosamine, incubated with 0.05 mM MDC for 30 min, and then rinsed with PBS thrice. Afterward, the fluorescence intensity was measured using a fluorescence microscope (BX51, Olympus, Japan).\nIn accordance with previous literature [ 22 ], anterior vaginal wall tissue sections (5 μm) were obtained and baked in an oven at 60°C for 1 h. Next, the sections were deparaffinized with water, xylene, and various concentrations of ethanol (100%, 90%, 80%, and 70%), and then subjected to antigen extraction using microwave or citric acid antigen extraction solution. Subsequently, the sections were rinsed with PBS thrice, blocked with 5% bovine serum albumin in PBS for 30 min, and then incubated with anti-Nampt antibody (ab236874, Abcam) at 4°C overnight. The following day, the sections were incubated with goat anti-rabbit immunoglobulin G (IgG) (Alexa Fluor® 488, ab150077, Abcam) at room temperature for 1 h. Next, 4, 6-diamidino-2-phenylindole (DAPI, ready-to-use, Servicebio, Wuhan, Hubei, China) was adopted for cell nucleus staining. Following staining, images were captured using an LSM-710 laser scanning confocal microscope (Garl Zeiss, Jena, Germany). The area fraction of the fluorescent signal was determined with the help of the ImageJ software (version 1.50i, National Institutes of Health, Bethesda, MD, USA).\nFibroblasts were seeded in 6-well plates, and collected upon reaching 70% cell density [ 21 ]. After 3 PBS rinses, the cells were fixed with 4% formaldehyde for 15 min, permeabilized with 0.5% Triton X-100 for 5 min, and then blocked with 5% goat serum for 30 min. Subsequently, the cells were incubated with the following primary antibodies: collagen type I (COL1A) (ab96723, Abcam), aggrecan (ACAN) (MA3-16888, Thermo Fisher Scientific Inc., Waltham, MA, USA), and light chain 3 (LC3) (ab192890, Abcam) at 4°C overnight. Following clearing, the cells were incubated with secondary antibodies goat anti-rabbit IgG H&L (ab150077, Abcam) or goat anti-mouse IgG H&L (ab150113, Abcam). Afterward, the cell nuclei were stained with DAPI, and the slides were fixed and imaged using a confocal microscope and analyzed with the ImageJ software.\nAs previously described [ 23 ], total RNA content was extracted from the anterior vaginal wall tissues and fibroblasts using the TRIzol reagent (Invitrogen Inc., Carlsbad, CA, USA). PrimeScript TM  RT reagent kits (TaKaRa Biotech, Dalian, China) were adopted to synthesize the total RNA into the cDNA. Subsequently, qPCR was carried out with the help of SYBRR Premix Ex Taq TM  II kit (TaKaRa). SYBR green real-time fluorescence quantification PCR mixture (7.5 μM each of forward and reverse primers) was employed for PCR, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the internal reference. The relative expression of genes was calculated using the 2 −ΔΔCt  method [ 24 ]. The primers used are shown in  Table 1 . Table 1. Primer sequence of RT-qPCR Name of primer Sequence (5ʹ-3ʹ) Nampt (Rat) F: GAGATGAATGCTGCGGCAGAAG R: CTAGTGAGGCGCCACATCCTGC Nampt (Human) F: ATGAATCCTGCGGCAGAAGC R: CTAATGATGTGCTGCTTCCAG TIMP-1 (Human) F: ACCATGGCCCCCTTTGAGCC R: TCAGGCTATCTGGGACCGCAG COL1A (Human) F: GACATGTTCAGCTTTGTGGACC R: TTACAGGAAGCAGACAGGGCCA ACAN (Human) F: ACTATGACCACTTTACTCTGGGT R: CTCTTCTCAGTGGGCTGTGCT MMP-2 (Human) F: ATGCAATACCTGAACACCTT R: TCAGCAGCCTAGCCAGTCGGAT MMP-9 (Human) F: ATGAGCCTCTGGCAGCCCCT R: CTAGTCCTCAGGGCACTGCAGG GAPDH (Rat) F: ATGGTGAAGGTCGGTGTGAACG R: TTACTCCTTGGAGGCCATGTAG GAPDH (Human) F: ATGGTTTACATGTTCCAATATGA R: TTACTCCTTGGAGGCCATGTGG RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Nampt, nicotinamide phosphoribosyltransferase; TIMP-1, tissue inhibitor of metalloproteinase 1; COL1A, collagen type I; ACAN, aggrecan; MMP, matrix metalloproteinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse.\nPrimer sequence of RT-qPCR\nRT-qPCR, reverse transcription-quantitative polymerase chain reaction; Nampt, nicotinamide phosphoribosyltransferase; TIMP-1, tissue inhibitor of metalloproteinase 1; COL1A, collagen type I; ACAN, aggrecan; MMP, matrix metalloproteinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse.\nTotal protein content was extracted from the anterior vaginal wall tissues and fibroblasts using radio-immunoprecipitation assay buffer solution containing phenylmethylsulfonyl fluoride [ 23 ]. Protein denaturation was then carried out at 95°C following detection of total protein concentration with bicinchoninic acid kits (Beyotime Biotechnology Co., Ltd, Shanghai, China). Subsequently, the proteins were separated from samples using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then transferred onto polyvinylidene fluoride membranes. The membranes were then blocked and incubated with the following primary antibodies (all procured from Abcam): Nampt (ab236874, dilution ratio of 1: 1000), tissue inhibitor of metalloproteinase 1 (TIMP-1, ab211926, dilution ratio of 1: 1000), COL1A (ab96723, dilution ratio of 1: 500), ACAN (ab3778, dilution ratio of 1 μg/mL), matrix metalloproteinase-2 (MMP-2, ab92536, dilution ratio of 1: 1000), MMP-9 (ab76003, dilution ratio of 1: 1000), LC3 (ab192890, dilution ratio of 1: 2000), Beclin-1 (ab210498, dilution ratio of 1: 1000) and β-actin (ab8227, dilution ratio of 1:1000) at 4°C overnight. Afterward, the membranes were rinsed with tris-buffered saline-tween thrice, followed by incubation with the secondary antibodies (ab6721 or ab6789, dilution ratio of 1:2000, Abcam) for 2 h. Immunoreaction of chemiluminescence membranes was detected using enhanced chemiluminescence assay kits (EMD Millipore, Billerica, MA, USA). The relative expression was reflected by the gray value and the relative expression of the protein was analyzed using the Image J software (NIH), with β-actin serving as the internal reference.\nThe SPSS 21.0 software (IBM Corp. Armonk, NY, USA) was adopted for data analyses, and the GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA) was employed for graphing. All measurement data were inspected for normality distribution and homogeneity test of variance. Pairwise comparisons were carried out with the  t -test, while one-way or two-way analysis of variance (ANOVA) was used for comparison analysis among multiple groups, whereas Tukey’s multiple comparisons test or Sidak’s multiple comparisons test was adopted for posttest of data. The  p  value was attained using a two-tailed test and a value of  p  < 0.05 was regarded statistically significant.\n\nThe current study set out to investigate the role of Nampt in ECM metabolism in SUI fibroblasts. Firstly, Nampt expression patterns were analyzed in SUI patients and rats. In addition, we investigated the mechanism by which Nampt regulates ECM metabolism in fibroblasts  in vitro . The obtained findings validated that Nampt was over-expressed in SUI, whereas Nampt silencing could inhibit SUI fibroblast ECM degradation. Furthermore, we also validated that Nampt silencing could inhibit SUI fibroblast ECM degradation  via  enhancing autophagy.\nAging, vaginal delivery, and declining hormonal levels (menopause) are regarded as the chief risk factors for SUI [ 25–27 ]. Meanwhile, Nampt is implicated in various physiological processes, such as cell differentiation, senescence, and apoptosis [ 28 , 29 ]. Accordingly, aiming to elucidate the role of Nampt in SUI, we collected anterior vaginal wall tissues from SUI patients and non-SUI patients to examine Nampt expression patterns in the tissues. The results of RT-qPCR and Western blot analysis illustrated that Nampt was highly-expressed in the tissues from SUI patients compared to that in non-SUI patients ( p  < 0.01,  Figure 1a-b ). In addition, immunofluorescence results illustrated that the fluorescence signal of Nampt was over-expressed in SUI patients relative to that in non-SUI patients ( p  < 0.01,  Figure 1c ). Overall, these findings indicated that Nampt was highly-expressed in SUI patients.\n Figure 1. Nampt is overexpressed in SUI patients. Anterior vaginal wall tissues were extracted from SUI and non-SUI patients. (a), mRNA level of Nampt in tissues was examined by RT-qPCR. (b), Protein level of Nampt in tissues was tested by Western blot analysis. (c), Nampt fluorescence signal in tissues was assessed by immunofluorescence assay. N = 30. Measurement data in panels (b and c) were presented as mean ± standard deviation. The  t -test was used to analyze the data in panels (a, b and c). **  p  < 0.01.\nNampt is overexpressed in SUI patients. Anterior vaginal wall tissues were extracted from SUI and non-SUI patients. (a), mRNA level of Nampt in tissues was examined by RT-qPCR. (b), Protein level of Nampt in tissues was tested by Western blot analysis. (c), Nampt fluorescence signal in tissues was assessed by immunofluorescence assay. N = 30. Measurement data in panels (b and c) were presented as mean ± standard deviation. The  t -test was used to analyze the data in panels (a, b and c). **  p  < 0.01.\nSUI rat models were established using the vaginal dilatation method (VD) and establishment of the same was confirmed through ALPP and MBV detection [ 18 ]. It was found that VD treatment brought about an evident reduction in ALPP and MBV in rats ( p  < 0.01,  Figure 2a-b ), which were indicative of successful SUI rat modeling. Nampt expression patterns in the obtained rat anterior vaginal wall tissues were further examined by RT-qPCR and Western blot analysis, the results of which demonstrated that VD treatment led to up-regulation of Nampt in the tissues ( p  < 0.01,  Figure 2c-d ), and immunofluorescence findings illustrated that VD treatment resulted in intensification of Nampt fluorescence signal in mouse tissue ( p  < 0.01,  Figure 2e ). Collectively, these findings suggested that Nampt was highly-expressed in SUI rat models.\n Figure 2. Nampt is overexpressed in SUI rat model. SUI rat model was established by VD treatment, and 1 week later, model establishment was verified by ALPP (a) and MBV (b) in rats. (c, d and e), Nampt expression in rat anterior vaginal wall tissues was examined by RT-qPCR (c), Western blot analysis (d) and immunofluorescence assay (e). N = 6. Measurement data in panels A, B, D and E were presented as mean ± standard deviation. The  t -test was used to analyze the data in panels A, B, C, D and E. **  p  < 0.01.\nNampt is overexpressed in SUI rat model. SUI rat model was established by VD treatment, and 1 week later, model establishment was verified by ALPP (a) and MBV (b) in rats. (c, d and e), Nampt expression in rat anterior vaginal wall tissues was examined by RT-qPCR (c), Western blot analysis (d) and immunofluorescence assay (e). N = 6. Measurement data in panels A, B, D and E were presented as mean ± standard deviation. The  t -test was used to analyze the data in panels A, B, C, D and E. **  p  < 0.01.\nFibroblast dysfunction is well-established as a major causative factor of SUI pathogenesis and development [ 21 , 30 ]. Accordingly, we isolated and incubated fibroblasts from non-SUI patients. As illustrated by immunocytochemistry analyses, the cells were positive for vimentin, a fibroblast indicator, while being negative for keratin, a myoepithelial cell indicator ( Figure 3a ). Moreover, existing literature suggests that Nampt is involved in the process of IL-1β-induced matrix degradation [ 31 , 32 ]. Thereafter, we treated fibroblasts with different concentrations of IL-1β, and found that the higher the concentration of IL-1β, the greater the reduction of cell activity ( p  < 0.05,  Figure 3b ). Besides, IL-1β treatment brought about up-regulated Nampt levels in cells in a concentration-dependent manner ( p  < 0.05,  Figure 3c-d ). In summary, these findings indicated that IL-1β treatment up-regulated Nampt expression in fibroblasts and correlated with concentration. Furthermore, a dosage of 10 ng/mL of IL-1β was selected for subsequent experiments.\n Figure 3. Nampt expression is upregulated in IL-1β-treated fibroblasts. Fibroblasts are isolated and cultured from anterior vaginal wall tissues of non-SUI patients. (a), Expression of vimentin (the left panel) and keratin (Pan-CK; the right panel) was determined by immunocytochemistry, with blue representing nuclei and brown representing positive vimentin, a fibroblast indicator, and fibroblasts were treated with IL-1β at different concentrations. (b), Effect of IL-1β on cell viability was evaluated by CCK-8 method. (c and d), Effect of IL-1β on Nampt expression was assessed by RT-qPCR (c) and Western blot analysis (d). The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels B, C and D. Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\nNampt expression is upregulated in IL-1β-treated fibroblasts. Fibroblasts are isolated and cultured from anterior vaginal wall tissues of non-SUI patients. (a), Expression of vimentin (the left panel) and keratin (Pan-CK; the right panel) was determined by immunocytochemistry, with blue representing nuclei and brown representing positive vimentin, a fibroblast indicator, and fibroblasts were treated with IL-1β at different concentrations. (b), Effect of IL-1β on cell viability was evaluated by CCK-8 method. (c and d), Effect of IL-1β on Nampt expression was assessed by RT-qPCR (c) and Western blot analysis (d). The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels B, C and D. Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\nAn increasing number of studies have confirmed that mechanical injury-induced ECM remodeling might be implicated in the pathogenesis of SUI [ 4 , 33 ], while ECM metabolism is known to be mediated by fibroblasts [ 34 ]. To further elucidate the role of Nampt in ECM degradation, 3 pieces of LV-packed Nampt shRNAs were infected into 10 ng/mL IL-1β-treated fibroblasts to reduce Nampt mRNA levels in cells, with Nampt shRNA 2# exhibiting the most profound interference efficiency ( p  < 0.01,  Figure 4a ), and thus LV-packed Nampt shRNA 2# (LV-sh-Nampt) was selected for subsequent analyses. In addition, it was found that infection with LV-sh-Nampt resulted in decreased protein levels of Nampt in cells ( p  < 0.05,  Figure 4b ). Moreover, examination of ECM-associated protein expressions revealed that the expression levels of COL1A, ACAN, and TIMP-1 were all reduced, while those of MMP-2 and MMP-9 were increased upon IL-1β treatment, whereas the opposite trends were observed upon Nampt silencing (all  p  < 0.01,  Figure 4c-d ). Besides, results of the immunofluorescence assay illustrated that IL-1β treatment down-regulated the fluorescence intensity of COL1A and ACAN, whereas Nampt silencing brought about the opposite effects (all  p  < 0.01,  Figure 4e ). Altogether, these findings indicated Nampt silencing inhibited IL-1β-induced fibroblast ECM degradation.\n Figure 4. Nampt silencing inhibits IL-1β-induced SUI fibroblast ECM degradation. Fibroblasts treated by IL-1β (10 ng/mL) was transfected with 3 pieces of LV-packed Nampt shRNAs, respectively, with NC shRNA transfection as the control. (a), mRNA level of Nampt was examined by RT-qPCR. (b), Protein level of Nampt was examined by Western blot analysis. (c and d), Levels of COL1A, ACAN, TIMP-1, MMP-2 and MMP-9 were tested by RT-qPCR (c) and Western blot analysis (d). (e), Fluorescence intensity of COL1A and ACAN was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels (a and b). Two-way ANOVA was used to analyze the data in panels (c, d and e) Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\nNampt silencing inhibits IL-1β-induced SUI fibroblast ECM degradation. Fibroblasts treated by IL-1β (10 ng/mL) was transfected with 3 pieces of LV-packed Nampt shRNAs, respectively, with NC shRNA transfection as the control. (a), mRNA level of Nampt was examined by RT-qPCR. (b), Protein level of Nampt was examined by Western blot analysis. (c and d), Levels of COL1A, ACAN, TIMP-1, MMP-2 and MMP-9 were tested by RT-qPCR (c) and Western blot analysis (d). (e), Fluorescence intensity of COL1A and ACAN was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels (a and b). Two-way ANOVA was used to analyze the data in panels (c, d and e) Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\nPrevious studies have also suggested that Nampt can influence autophagy [ 13 , 14 ], while changes in autophagy levels are known to affect ECM metabolism [ 16 , 35 ]. Therefore, we speculated that Nampt affected ECM metabolism by modulating autophagy, and subsequently examined the effects of Nampt on autophagy. It was found that IL-1β treatment led to decreased autophagy levels, as evidenced by decreased number of autophagosomes, declined ratio of LC3 II/I, and the downregulated expression of Beclin-1 ( p  < 0.01,  Figure 5a-b ), whereas LC3 and Beclin-1 are established as indicators of promoted autophagy [ 27 , 28 ]. Besides, immunofluorescence assay confirmed that IL-1β treatment brought about a reduction in LC3 fluorescence intensity in cells ( p  < 0.01,  Figure 5c ). On the other hand, enhanced autophagy levels were documented following Nampt silencing ( p  < 0.01,  Figure 5a-c ). Collectively, these findings indicated Nampt silencing evoked IL-1β-treated SUI fibroblast autophagy.\n Figure 5. Nampt silencing elicits IL-1β-treated SUI fibroblast autophagy. (a), Number of autophagosomes was evaluated by MDC method. (b), Ratio of LC3 II/I and expression of Beclin-1 were assessed by Western blot analysis. (c), Fluorescence intensity of LC3 was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels (b and c). Tukey’s multiple comparisons test was applied for post hoc test. **  p  < 0.01.\nNampt silencing elicits IL-1β-treated SUI fibroblast autophagy. (a), Number of autophagosomes was evaluated by MDC method. (b), Ratio of LC3 II/I and expression of Beclin-1 were assessed by Western blot analysis. (c), Fluorescence intensity of LC3 was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panels (b and c). Tukey’s multiple comparisons test was applied for post hoc test. **  p  < 0.01.\nLastly, to verify the role of autophagy in the mechanism of Nampt in regulating ECM degradation in SUI fibroblasts, we employed 3-MA to inhibit fibroblast autophagy in the LV-sh-Nampt group. As revealed by the results of RT-qPCR and Western blot analysis, following inhibition of autophagy, the expression levels of COL1A, ACAN, and TIMP-1 were all decreased in cells, while those of MMP-2 and MMP-9 were increased ( p  < 0.05,  Figure 6a-b ). Results of immunofluorescence assay further illustrated the fluorescence intensity of COL1A and ACAN were both decreased when autophagy was down-regulated ( p  < 0.01,  Figure 6c ). Altogether, these findings confirmed that inhibition of autophagy reversed the inhibitory effect of Nampt silencing on IL-1β-induced ECM degradation in SUI fibroblasts.\n Figure 6. Nampt silencing inhibits IL-1β-induced SUI fibroblast ECM degradation by inducing autophagy. 3-MA was employed to treat fibroblast in the LV-sh-Nampt group, with PBS treatment as the control. (a and b) Levels of COL1A, ACAN, TIMP-1, MMP-2 and MMP-9 were tested by RT-qPCR (a) and Western blot analysis (b). (c), Fluorescence intensity of COL1A and ACAN was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. Two-way ANOVA was used to analyze the data in panels (a, b and c). Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\nNampt silencing inhibits IL-1β-induced SUI fibroblast ECM degradation by inducing autophagy. 3-MA was employed to treat fibroblast in the LV-sh-Nampt group, with PBS treatment as the control. (a and b) Levels of COL1A, ACAN, TIMP-1, MMP-2 and MMP-9 were tested by RT-qPCR (a) and Western blot analysis (b). (c), Fluorescence intensity of COL1A and ACAN was assessed by immunofluorescence assay. The independent cell experiments were repeated 3 times. Measurement data were presented as mean ± standard deviation. Two-way ANOVA was used to analyze the data in panels (a, b and c). Tukey’s multiple comparisons test was applied for post hoc test. *  p  < 0.05, **  p  < 0.01.\n\nStress urinary incontinence (SUI) is regarded as an intractable disorder precipitated by the failure of urethral closure function, and exerts a tremendous burden on populations and healthcare facilities across the world [ 36 ]. Alteration of ECM production is a critical candidate for SUI incidence and prevalence [ 37 ]. Meanwhile, the hard-done work of our peers has shown the involvement of Nampt in a plethora of diseases due to its ability to regulate inflammatory reactions, immune behaviors, cell metabolism, and gene activity [ 38 ]. Interestingly, Nampt over-expression was previously indicated to enhance ECM degradation, thereby promoting pathological injuries [ 39 ]. In the current study, we elucidated that Nampt silencing enhanced SUI fibroblast autophagy and inhibited ECM degradation. Our study is the first-of-its-kind to shed a light on the effect of Nampt silencing on the inhibition of ECM degradation in SUI fibroblasts by enhancing autophagy. Furthermore, we employed a novel approach to explore the regulatory factors and their downstream mechanisms in SUI fibroblasts, aiming to improve diagnostic and therapeutic approaches against SUI.\nSenescence, the process of aging, is well established as one of the causative factors of SUI [ 40 ]. Meanwhile, Nampt is also known to participate in senescence-related diseases due to its effects on the mediation of cellular metabolic behaviors, cell death, and re-programming [ 41 ]. Herein our study, we noticed that Nampt was highly-expressed in SUI patients and VD-induced SUI rat models. We further isolated fibroblasts from non-SUI patients and treated them with IL-1β to explore the specific role of Nampt in SUI, and uncovered that Nampt was over-expressed in IL-1β-treated fibroblasts. On a separate note, IL-1β activated Nampt expressions were previously indicated to retard articular chondrocyte differentiation and augment osteoarthritis development [ 42 ]. Similarly, another study demonstrated that Nampt induced by IL-1β treatment was overexpressed in fibroblasts of periodontitis, and further conferred a promotive effect on inflammatory reaction and alveolar bone disruption [ 32 ]. All in all, these evidences are suggestive of the negative effects of Nampt on SUI fibroblasts.\nRecent investigations have illustrated that ECM degradation and production can exacerbate SUI through destroying cellular construction and energy metabolic behaviors [ 19 ]. Moreover, Nampt is known to regulate cellular biological behaviors and enhance ECM remodeling, which augment endothelial injury to the cardiovascular system [ 43 ]. Accordingly, to further elucidate the role of Nampt in ECM degradation of SUI fibroblasts, we injected LV-sh-Nampt into IL-1β-treated fibroblasts to down-regulate the Nampt expression, and found that Nampt silencing brought about increased expressions of COL1A, ACAN, and TIMP-1 and declined MMP-2 and MMP-9 expressions. Consistently, another prior study came indicated that Nampt depletion was associated with TIMP-1 activation, and could be further used to predict retarded ECM production of fibroblasts in diabetic nephropathy [ 11 ]. Further in line with our findings, the investigation performed by Peiro C  et al . illustrated that Nampt could augment MMP-2 and MMP-9 expressions, while discouraging TIMP-1 levels to sabotage ECM metabolism and defenses in hypertensive patients during pregnancy [ 44 ]. Collectively, these findings and evidences indicate that silencing of Nampt can inhibit the IL-1β-induced SUI fibroblast ECM degradation.\nOn the other hand, Nampt exhaustion is also associated with enhanced autophagy, which results in decreased sepsis-induced acute lung injury [ 45 ]. The self-degradation mechanism of autophagy is involved in various pathologies by virtue of catalyzing aging cell loss and eliminating surplus or injured genes [ 46 ]. In addition, autophagy was previously associated with limited ECM production and promoted anti-senescent function in intervertebral disc degeneration [ 47 ]. Accordingly, we explored the mechanism underlying Nampt-regulation of autophagy in SUI fibroblasts, and discovered that Nampt silencing resulted in improved autophagy as evidenced by elevated LC3 II/I ratio and Beclin-1 expression levels. Similarly, prior studies have noted that suppression of Nampt protein levels brought about elevated LC3 levels, a well-known indicator of autophagy [ 48 ]. Moreover, Nampt knockdown was previously revealed to enhance autophagy by improving Beclin-1 levels, which is much in accordance with our findings [ 49 ]. Altogether, the aforementioned evidences indicated that Nampt silencing exerted a diminishing effect on IL-1β-treated SUI fibroblast autophagy. Additionally, to verify the role of autophagy in the mechanism of Nampt in regulating ECM degradation in SUI fibroblasts, autophagy was inhibited with help of 3-MA in fibroblasts with Nampt silencing treatment, which revealed that inhibition of autophagy was associated with decreased expressions of COL1A, ACAN, and TIMP-1 in cells, and increased expressions of MMP-2 and MMP-9. Moreover, another investigation highlighted that during conditions of promoted autophagy, COL2A and ACAN expressions were accordingly activated, which underscores the positive association between COL2A, ACAN expressions and autophagy [ 50 ]. Meanwhile, in subjects suffering from endometriosis, reduced levels of autophagy were accompanied by elevated MMP-2 expressions [ 51 ]. It is also noteworthy that Nampt was previously shown to enhance the expression of ECM degradation proteins and decelerate autophagy [ 20 ]. In a word, it would be plausible to suggest that inhibition of autophagy attenuates the inhibitory effects of Nampt silencing on IL-1β-induced ECM degradation in SUI fibroblasts. However, being the first study to explore the role of Nampt in SUI, vast majority of our experiments were performed at a cellular level, and lacked histological detection of autophagy. In addition, we did not perform enough gain/loss-of-function assays. Nevertheless, we will thrive to define the role of Nampt in SUI with the help of  in vivo  experiments in our future endeavors.\n\nAltogether, findings obtained in our study elucidated that Nampt was over-expressed in SUI, while silencing of Nampt enhanced SUI fibroblast autophagy, thereby inhibiting ECM degradation. We hope our findings offer novel insight into the therapeutic potential of Nampt against SUI. In the future, we shall further elaborate the underlying mechanism involvement in SUI and the potential therapeutic implications. However, our preclinical research has its own set of limitations. For instance, we solely disclosed the mechanism of autophagy in ECM degradation, while it remains to be investigated whether Nampt mediates ECM degradation  via  other molecular pathways. Moreover, other functions and effects of Nampt in SUI also requires further exploration, while the experiment results and effective application of Nampt silencing into clinical practice also needs further investigation. Nevertheless, we hope our findings can contribute some novel implications into SUI research.","source_license":"CC-BY-4.0","license_restricted":false}