{"paper_id":"e857e2b3-0f47-4957-b7c8-2f207790266e","body_text":"Epithelial ovarian cancer covers approximately 90% of all ovarian cancers and is the most common cause of mortality in women with gynecologic cancers. Five histological subtypes have been defined for epithelial ovarian cancers: high-grade serous, low-grade serous, clear cell, mucinous, and endometrioid [ 1 ,  2 ]. Although each subtype has unique molecular and clinical features, all epithelial ovarian subtypes are still treated similarly, consisting of de-bulking surgery in combination with platinum-based chemotherapy. Ovarian clear cell carcinoma (OCCC), the second most common subtype, appears to have a worse prognosis than the more common high-grade serous carcinoma, suggesting that current treatments are ineffective for OCCC, especially related to a poor response to platinum-based chemotherapy. Therefore, new treatment strategies for OCCC are urgently needed [ 3 ]. Development of OCCC has been linked to endometriosis and is characterized by a high mutation frequency of  ARID1A  (>50%), a subunit of the SWI/SNF chromatin remodeling complex [ 4 ,  5 ]. Given the nature of the mutations it is generally accepted that ARID1A functions as a tumor suppressor gene. The SWI/SNF chromatin-remodeling complex regulates the dynamic repositioning of nucleosomes, therefore the loss of  ARID1A  could globally impact gene expression through deregulated transcription [ 6 ]. Since  ARID1A  mutations have been identified in pre-neoplastic lesions it is suspected that ARID1A loss is an early event in the development of OCCC [ 4 ]. Possibly, loss of ARID1A activates major signaling pathways that confer an advantage to the tumor cells through enhanced proliferation and/or survival. Given that  ARID1A  is inactivated by mutation in OCCC, we pursued a synthetic lethal screening strategy to identify druggable targets in OCCC. We performed lethal kinome short hairpin (shRNA) screens in the largest panel of OCCC cell lines established to date having different  ARID1A  mutation status. Here, we report the identification of  BRD2 , a member of the BET (bromodomain and extra terminal domain) family, whose knockdown resulted in enhanced toxicity predominantly in  ARID1A  mutant cell lines. Importantly, our data demonstrate enhanced sensitivity of  ARID1A  mutated cells to the BET inhibitors JQ1 and iBET-762. Furthermore, the in vitro drug sensitivity data presented here were validated both in OCCC cell line xenografts and in OCCC patient-derived xenograft (PDX) models. Collectively, our data suggest a new treatment option for  ARID1A  mutant OCCC that warrants clinical exploration.\n\nTo investigate which vulnerabilities exist in  ARID1A  mutant OCCC lines we collected a very sizeable and unique set of OCCC cell lines and validated their ARID1A status by both  ARID1A  sequencing and ARID1A protein expression analysis. We screened in total 14 OCCC cell lines (5  ARID1A  wildtype and 9  ARID1A  mutant, Fig.  1a ) with a lentiviral shRNA library covering the human kinome to search for kinases whose suppression is specifically lethal in an  ARID1A  mutant context. We have previously described kinome-centered screening approaches using this library [ 7 ,  8 ]. In short, each cell line was infected with the kinome shRNA library in triplicate, selected for presence of viral integration, cells were harvested at timepoint zero ( T 0) and the remainder was replated and cultured. After two to three weeks, cells were collected for timepoint one ( T 1). Genomic DNA was isolated from both populations, and the relative abundance of the short hairpin sequences was determined by deep sequencing (Fig.  1b ). For the selection of synthetic lethal genes, we set several criteria to ensure identification of hits with significant toxicity and with multiple hairpins (see Methods). Following these criteria, we generated ranked lists for the lethal kinases per cell line (Figure  S1  and  S2 ). By analyzing these cell-specific ranked lists we could identify common lethal kinases ( PLK1 ,  CHEK1 ,  CDC2L1 ,  TRRAP , and  TAF1 ) and kinases that were more often lethal in the  ARID1A  mutant cell lines ( BRD2 ,  PRPF4B ,  MYO3B ,  PKN1 , and  PRKCQ ) (Fig.  1c ). The lethal kinases that were exclusively selected in the  ARID1A  mutant lines ( BRD2  and  PRPF4B)  were further validated. We subsequently observed that  PRP4FB  loss was lethal in all the OCCC cell lines tested (data not shown), so toxicity appeared independent of  ARID1A  mutation status. Interestingly,  BRD2  depletion using two independent shRNA sequences (validated on protein levels Figure  S3A ) recapitulated the screening data more convincingly (Fig.  2a , Figure  S3B ). Especially in those  ARID1A  mutant lines where  BRD2  was previously identified as lethal hit (TOV21G, OVTOKO, HAC2, SMOV2, and OVMANA), significant killing with two sh BRD2  constructs was observed (with one sh BRD2  resulting in at least 70% cell number reduction) and  BRD2  was therefore considered as the only hit from our ARID1A synthetic-lethal screens. Validation of BRD2 depletion in the complete OCCC panel identified the cell line RMGI as one notable outlier, as  BRD2  knockdown appeared to be toxic in this cell line whereas BRD2 was not identified as a lethal hit in the RMGI screen. Possibly, during validation  BRD2  shRNAs were introduced at higher titer compared to screening conditions leading to better knockdown and toxicity during validation procedure. Of note, we identified comparable BRD2 and BRD4 protein and RNA levels across the OCCC cell line panel indicating that different sensitivities towards  BRD2  knockdown cannot be explained by the BRD2 and BRD4 status of the individual cell line (Figure  S4A, B, C ). Fig. 1 TRC kinome screen in OCCC cell panel.  a  ARID1A protein expression levels of the OCCC panel were measured by Western blot analysis. HSP90 was used as a loading control.  b  Each cell line from the OCCC panel was infected in triplicate with the lentiviral TRC kinome library with a multiplicity of infection below 0.5 and with cell amounts ensuring 1000× coverage of the library. Upon stable selection of the library timepoint zero ( T 0) was collected, followed by culturing of the cells for an additional two weeks, after which timepoint one ( T 1) was harvested. The relative abundance of the hairpins in  T 0 versus  T 1 was determined by deep sequencing.  c  Ranked lists for the lethal kinases were generated for every OCCC line based on three criteria (fold depletion, Geometric mean value of all hairpins and Second-best gene rank according to RIGER) as outlined in the methods section. From these ranked hit lists we determined which genes were lethal upon knockdown in all cell lines (common lethal hits) or preferentially in the  ARID1A  mutant lines ( ARID1A  specific lethal hits) and a top 5 is shown Fig. 2 BRD2 validates as  ARID1A  mutant specific lethal hit.  a  The functional phenotypes of non-overlapping lentiviral sh BRD2  vectors (#2 and #5) in the OCCC cell line panel were measured in a long-term colony formation assay. Cells expressing a mixture of nonfunctional scrambled hairpins (SCR) were used as control. The cells were fixed, stained and photographed after 10–12 days. In the cell lines labeled with an asterisk (*)  BRD2  was identified as lethal hit.  b  The indicated  ARID1A  wildtype and mutant OCCC cell lines were plated in 6-well plates (10,000 cells per well) and exposed to increasing JQ1 (0, 125, 250, and 500 nM) concentrations in triplicate. The cells were fixed, stained with crystal violet and photographed after 10 days.  c  Colony formation assays (CFA) from  b  were quantified by crystal violet dye extraction. Shown is relative reduction in crystal violet staining compared to untreated control. Colony formation assays were performed in triplicate. Error bars denote SD. The dotted line denotes the cut-off used (below 0.5 at 250 nM JQ1 concentration) to qualify cell lines as “JQ1 sensitive”. A Fisher Exact test with the abovementioned cutoff at 250 nM JQ1 gave the statistic value of 0.09.  P -values (only shown for the “JQ1 sensitive” lines) were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal\nTRC kinome screen in OCCC cell panel.  a  ARID1A protein expression levels of the OCCC panel were measured by Western blot analysis. HSP90 was used as a loading control.  b  Each cell line from the OCCC panel was infected in triplicate with the lentiviral TRC kinome library with a multiplicity of infection below 0.5 and with cell amounts ensuring 1000× coverage of the library. Upon stable selection of the library timepoint zero ( T 0) was collected, followed by culturing of the cells for an additional two weeks, after which timepoint one ( T 1) was harvested. The relative abundance of the hairpins in  T 0 versus  T 1 was determined by deep sequencing.  c  Ranked lists for the lethal kinases were generated for every OCCC line based on three criteria (fold depletion, Geometric mean value of all hairpins and Second-best gene rank according to RIGER) as outlined in the methods section. From these ranked hit lists we determined which genes were lethal upon knockdown in all cell lines (common lethal hits) or preferentially in the  ARID1A  mutant lines ( ARID1A  specific lethal hits) and a top 5 is shown\nBRD2 validates as  ARID1A  mutant specific lethal hit.  a  The functional phenotypes of non-overlapping lentiviral sh BRD2  vectors (#2 and #5) in the OCCC cell line panel were measured in a long-term colony formation assay. Cells expressing a mixture of nonfunctional scrambled hairpins (SCR) were used as control. The cells were fixed, stained and photographed after 10–12 days. In the cell lines labeled with an asterisk (*)  BRD2  was identified as lethal hit.  b  The indicated  ARID1A  wildtype and mutant OCCC cell lines were plated in 6-well plates (10,000 cells per well) and exposed to increasing JQ1 (0, 125, 250, and 500 nM) concentrations in triplicate. The cells were fixed, stained with crystal violet and photographed after 10 days.  c  Colony formation assays (CFA) from  b  were quantified by crystal violet dye extraction. Shown is relative reduction in crystal violet staining compared to untreated control. Colony formation assays were performed in triplicate. Error bars denote SD. The dotted line denotes the cut-off used (below 0.5 at 250 nM JQ1 concentration) to qualify cell lines as “JQ1 sensitive”. A Fisher Exact test with the abovementioned cutoff at 250 nM JQ1 gave the statistic value of 0.09.  P -values (only shown for the “JQ1 sensitive” lines) were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal\nTo further validate whether  BRD2  depletion caused proliferation defects predominantly in an  ARID1A  mutant context, we targeted BRD2 function with the use of BET inhibitors. Selective inhibitors targeting BET proteins BRD2, BRD3, BRD4 as well as BRDT, have been described to exhibit antineoplastic activity [ 9 ]. BET inhibitors are currently in clinical trials for various hematological malignancies and solid tumors. BET inhibitors bind to acetylated lysine recognition motifs on the thereby preventing binding of BET proteins to the chromatin, resulting in disruption of subsequent chromatin remodeling and gene expression [ 10 ]. First, we tested the BET inhibitor JQ1 on our OCCC panel using a long-term proliferation assay. Interestingly, JQ1 sensitivity closely matched the  BRD2  knockdown lethality across the OCCC cell line panel (Fig.  2a, b ). Thus,  ARID1A  mutant cells appear more sensitive to BET inhibition than  ARID1A  wildtype cell lines. From the JQ1 colony formation assays we conclude that, based on a cutoff of 50% growth reduction at 250 nM JQ1, 1 out of 5  ARID1A  wildtype cell lines and 7 out of 9  ARID1A  mutant cell lines are sensitive to the BET inhibitor (Fig.  2c ). Collectively, these findings demonstrate that  BRD2  knockdown lethality closely resembles JQ1 sensitivity in OCCC lines, and that  ARID1A  mutant lines are most sensitive to BET inhibition.\nThe genetic heterogeneity of the OCCC cell line panel poses a possible limitation in determining a genotype-specific toxicity. To firmly establish  ARID1A  mutation as a direct cause of enhanced BET inhibitor sensitivity, we chose to test our findings further in OCCC isogenic cell line pairs. For this, we generated  ARID1A  knockout subclones from the  ARID1A  wildtype cell lines ES2 and OVCA429 using CRISPR/Cas9 targeting. In both a polyclonal ES2 cell line having significant ARID1A reduction as well as a full knockout ES2 single cell clone, we observed that loss of  ARID1A  significantly sensitized to BET inhibition by JQ1 (Fig.  3a, b ). Similarly, the  ARID1A  knockout OVCA429 subclones acquired enhanced sensitivity to JQ1 inhibition (Fig.  3c, d ). These findings demonstrate a direct causal link between loss of ARID1A function and sensitivity towards BET inhibitors. We noted that the  ARID1A  knockout clones adapted upon prolonged culturing (within months) in such a way that they gradually lost their enhanced sensitivity towards JQ1 inhibition (data not shown). This gradual adaptation to a drug-tolerant state has been observed before in other cell models [ 11 ]. Although speculative, we hypothesize that tumor-derived  ARID1A  mutant OCCC lines may have acquired additional genetic alterations causing a more stable phenotype compared to cell lines generated by CRISPR/Cas9 mediated  ARID1A  manipulation. Fig. 3 ARID1A  loss induces sensitivity towards BET inhibitors.  a ,  c  ES2 and OVCA429  ARID1A  knockout cell lines were generated with a dual vector doxycycline inducible CRISPR/Cas9 vector system. For ES2, wildtype (wt) cells, one polyclonal knockout line ( ARID1A  kopc) and one monoclonal knockout line ( ARID1A  ko#2) and for OVCA429, wt cells and two monoclonal knockout lines ( ARID1A  ko#12 and #37) were tested for JQ1 sensitivity in a 384 well 6-day cell viability assay using CellTiter Blue (CTB) as a readout. CTB measurements were normalized to untreated controls. Error bars denote SD.  P -values were calculated with 2-way ANOVA, asterisk denote the number of digits after the decimal.  b ,  d  ARID1A Western blot analysis of ARID1A protein levels in the ES2 polyclonal  ARID1A  knockout clone and ES2/OVCA429 monoclonal  ARID1A  knockout clones.  e ,  f  The indicated two  ARID1A  wildtype and  ARID1A  mutant lines were exposed to increasing doses of BET inhibitors JQ1 and iBET762. After 10–12 days cells were stained and photographed.  g ,  h  ES2 and OVCA429 cell lines were stably infected with the indicated shRNA constructs targeting  ARID1A  and plated in 384 well plates. Confluency was monitored in the absence and presence of the BET inhibitor iBET762 (800 nM). Shown are Incucyte confluency measurements relative to untreated cells from three independent experiments. Error bars denote SD.  P -values were calculated with multiple t-tests, asterisk denote the number of digits after the decimal.  i ,  j  Western blots were performed on the ES2 and OVCA429 cell lines stably infected with the indicated sh ARID1A  constructs to monitor efficiency of  ARID1A  knockdown. HSP90 served as a loading control\nARID1A  loss induces sensitivity towards BET inhibitors.  a ,  c  ES2 and OVCA429  ARID1A  knockout cell lines were generated with a dual vector doxycycline inducible CRISPR/Cas9 vector system. For ES2, wildtype (wt) cells, one polyclonal knockout line ( ARID1A  kopc) and one monoclonal knockout line ( ARID1A  ko#2) and for OVCA429, wt cells and two monoclonal knockout lines ( ARID1A  ko#12 and #37) were tested for JQ1 sensitivity in a 384 well 6-day cell viability assay using CellTiter Blue (CTB) as a readout. CTB measurements were normalized to untreated controls. Error bars denote SD.  P -values were calculated with 2-way ANOVA, asterisk denote the number of digits after the decimal.  b ,  d  ARID1A Western blot analysis of ARID1A protein levels in the ES2 polyclonal  ARID1A  knockout clone and ES2/OVCA429 monoclonal  ARID1A  knockout clones.  e ,  f  The indicated two  ARID1A  wildtype and  ARID1A  mutant lines were exposed to increasing doses of BET inhibitors JQ1 and iBET762. After 10–12 days cells were stained and photographed.  g ,  h  ES2 and OVCA429 cell lines were stably infected with the indicated shRNA constructs targeting  ARID1A  and plated in 384 well plates. Confluency was monitored in the absence and presence of the BET inhibitor iBET762 (800 nM). Shown are Incucyte confluency measurements relative to untreated cells from three independent experiments. Error bars denote SD.  P -values were calculated with multiple t-tests, asterisk denote the number of digits after the decimal.  i ,  j  Western blots were performed on the ES2 and OVCA429 cell lines stably infected with the indicated sh ARID1A  constructs to monitor efficiency of  ARID1A  knockdown. HSP90 served as a loading control\nTo further validate our findings, we tested another BET inhibitor, iBET762. First, we compared the inhibitors JQ1 and iBET762 in a long-term proliferation assay in two  ARID1A  wildtype (ES2 and OVCA429) and two  ARID1A  mutant (SMOV2 and HAC2) OCCC lines. The  ARID1A  mutation dependent toxicity of BET inhibition appeared extremely similar for JQ1 and iBET762 in these cell lines (Fig.  3e, f ). Next, iBET762 was tested on both ES2 (Fig.  3g ) and OVCA429 (Fig.  3h ) wildtype and  ARID1A  knockdown clones. Knockdown efficiencies for two independent sh ARID1A  constructs were checked at the protein level (Fig.  3i, j ). Upon  ARID1A  knockdown, both OCCC lines displayed increased iBET762 lethality in these experiments (Fig.  3g, h ). Collectively, we conclude that BET inhibition by the addition of either JQ1 or iBET762 is more toxic in  ARID1A  mutant lines, further validating our  BRD2  screen hit.\nWe next sought to investigate why  ARID1A  deficient cells exhibit an enhanced sensitivity towards BET inhibition. BET inhibitors likely exert a broad effect on transcription. A recent study identified  ARID1B , a SWI/SNF member mutually exclusive with  ARID1A  in this complex, as a gene critically required for the survival of  ARID1A  mutant cell lines [ 12 ]. Based on this we tested whether BET inhibition had an impact on ARID1B expression. First, we tested the effect of increasing amounts of JQ1 on  ARID1B  expression in the OVCA429  ARID1A  wildtype and knockout cell lines. The differential sensitivity of these isogenic lines towards JQ1 was already demonstrated in Fig.  3 . We indeed observed a concentration-dependent downregulation of  ARID1B  expression both at RNA (Fig.  4a ) and protein levels (Fig.  4b ). MYC protein levels were included as a positive control for effective inhibition. Similar results were obtained in the ES2  ARID1A  wildtype and knockout cell lines (data not shown). Second, we observed that  BRD2  knockdown resulted in reduced ARID1B protein levels, directly implicating BRD2 in the regulation of  ARID1B  expression (Fig.  4c ). Moreover, after knockdown of  ARID1B  expression in several OCCC lines, we observed toxicity only in an  ARID1A  mutant background, in agreement with earlier published experiments (Fig.  4d, e ). Of note, when testing the  ARID1A  mutant lines in which  BRD2  was not identified as a hit (KOC7C, OVAS, RMGII and TUOC1), we observed significant toxicity of  ARID1B  knockdown in those lines that also displayed significant BETi toxicity (OVAS, RMGII, and TUOC1), suggesting that  BRD2  was probably not identified as a hit due to our hit-selection criteria or technical variations during screening procedures (Figure  S4D,E ). We noted that exogenous  ARID1B  overexpression could not rescue JQ1 mediated growth inhibition (data not shown) suggesting that multiple factors may be involved in JQ1 mediated cell toxicity. In accordance with previous studies [ 13 ], we noticed significant toxicity upon  ARID1B  overexpression, which complicated these rescue experiments considerably. Collectively, our findings suggest that down-modulation of  ARID1B  by BET inhibitors contribute to the  ARID1A  mutant specific vulnerability in OCCC cell lines, but likely is not solely responsible for the observed growth defects. Fig. 4 BET inhibition reduces ARID1B levels.  a  OVCA429  ARID1A  knockout cell lines were generated with a dual vector doxycycline inducible CRISPR/Cas9 vector system. Wildtype cells, one polyclonal knockout line ( ARID1A  kopc) and two monoclonal knockout lines ( ARID1A  ko#12 and #37) were exposed to increasing amounts of JQ1 as indicated. After 48 h drug exposure  ARID1B  RNA analysis was performed. mRNA levels were normalized to expression of GAPDH. Error bars denote SD.  P -values were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal.  b  The OVCA429 cells described in  a  were subjected to Western blot analysis for the indicated proteins. ACTIN served as a loading control.  c  Western blot analysis of ARID1B and BRD2 in OVCA429 cells stably infected with lentiviral shRNA vectors targeting  BRD2 . ACTIN served as a loading control.  d  Doxycycline inducible lentiviral  ARID1B  shRNA vectors #3 and #5 were introduced in two  ARID1A  wildtype and two  ARID1A  mutant OCCC lines. After stable selection cells were plated in a long-term proliferation assay in the presence of doxycycline. Cells expressing a mixture of nonfunctional scrambled hairpins (SCR) were used as control. The cells were fixed, stained and photographed after 10–14 days.  e \n ARID1B  mRNA expression analysis by qRT-PCR in ES2, OVCA429, SMOV2 and HAC2 cells stably expressing the two doxycycline-inducible sh ARID1B  vectors. mRNA levels were normalized to expression of GAPDH. Error bars denote SD.  P -values were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal\nBET inhibition reduces ARID1B levels.  a  OVCA429  ARID1A  knockout cell lines were generated with a dual vector doxycycline inducible CRISPR/Cas9 vector system. Wildtype cells, one polyclonal knockout line ( ARID1A  kopc) and two monoclonal knockout lines ( ARID1A  ko#12 and #37) were exposed to increasing amounts of JQ1 as indicated. After 48 h drug exposure  ARID1B  RNA analysis was performed. mRNA levels were normalized to expression of GAPDH. Error bars denote SD.  P -values were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal.  b  The OVCA429 cells described in  a  were subjected to Western blot analysis for the indicated proteins. ACTIN served as a loading control.  c  Western blot analysis of ARID1B and BRD2 in OVCA429 cells stably infected with lentiviral shRNA vectors targeting  BRD2 . ACTIN served as a loading control.  d  Doxycycline inducible lentiviral  ARID1B  shRNA vectors #3 and #5 were introduced in two  ARID1A  wildtype and two  ARID1A  mutant OCCC lines. After stable selection cells were plated in a long-term proliferation assay in the presence of doxycycline. Cells expressing a mixture of nonfunctional scrambled hairpins (SCR) were used as control. The cells were fixed, stained and photographed after 10–14 days.  e \n ARID1B  mRNA expression analysis by qRT-PCR in ES2, OVCA429, SMOV2 and HAC2 cells stably expressing the two doxycycline-inducible sh ARID1B  vectors. mRNA levels were normalized to expression of GAPDH. Error bars denote SD.  P -values were calculated with multiple  t -tests, asterisk denote the number of digits after the decimal\nWhen analyzing RNAseq data from OVCA429  ARID1A  wildtype and knockout cells exposed to JQ1, we observed that BET inhibition resulted in transcriptional repression of several SWI/SNF family members besides  ARID1B , including  SMARCC2  and  SMARCE1  (data not shown). As such, BET inhibition may interfere with SWI/SNF function by affecting the transcription of multiple components of this multi-protein complex. To examine the generality of this observation we tested the effect of JQ1 exposure on gene expression of the SWI/SNF members  ARID1B ,  SMARCC2  and  SMARCE1  in the complete OCCC panel.  MYC  was taken along as a control. Indeed, JQ1 treatment of the complete OCCC cell line panel resulted in a robust downregulation of the indicated SWI/SNF RNA levels, demonstrating a general effect of BET inhibition on the gene expression of SWI/SNF members (Fig.  5a, b ). Notably,  MYC  RNA levels were downregulated by JQ1 exposure only in a subset of OCCC cell lines, suggesting that  MYC  repression by bromodomain inhibition is not a general phenomenon in OCCC cell lines. Fig. 5 BET inhibitors target multiple SWI/SNF members.  a ,  b  ARID1A wildtype ( a ) and ARID1A mutant ( b ) OCCC lines were exposed for 40 h to 500 nM JQ1 and were subjected to mRNA expression analysis with qRT-PCR. mRNA levels were normalized to expression of GAPDH and displayed is the relative expression of the indicated mRNAs to untreated cells. Error bars denote SD\nBET inhibitors target multiple SWI/SNF members.  a ,  b  ARID1A wildtype ( a ) and ARID1A mutant ( b ) OCCC lines were exposed for 40 h to 500 nM JQ1 and were subjected to mRNA expression analysis with qRT-PCR. mRNA levels were normalized to expression of GAPDH and displayed is the relative expression of the indicated mRNAs to untreated cells. Error bars denote SD\nInterestingly, chromatin immunoprecipitation experiments demonstrated specific BRD2 binding to various SWI/SNF member promoter regions, including  ARID1A ,  ARID1B ,  SMARCE1 , and  SMARCC2 , both in  ARID1A  wildtype (OVCA429) and  ARID1A  mutant (HAC2) cell lines (Fig.  6a ). Furthermore, JQ1 treatment efficiently inhibited BRD2 chromatin binding in OVCA429 and HAC2 (Fig.  6b, c , Figure  S5 ). The BRD2 ChIP sequencing data were verified by qPCR of the  ARID1B  promoter region (Fig.  6d ). Of note, in this experiment we also included a BRD4 ChIP and observed no binding of BRD4 to the same  ARID1B  promoter region (Fig.  6e ). These observations suggest that the effects of BRD2 inhibition on  ARID1B  expression and other SWI/SNF members are specific and direct. Fig. 6 Direct binding of BRD2 in  ARID1B  locus.  a  The  ARID1A  wildtype line OVCA429 and the  ARID1A  mutant line HAC2 were cultured for 24 h in 500 nM JQ1 or DMSO vehicle control and subjected to chromatin immunoprecipitation with BRD2 and control antibodies. ChIP sequences were generated by Illumina Hiseq 2000 genome analyzer and aligned to the Human Reference Genome (assembly hg38) and visualized in IGV. Displayed are IGV snapshots of the Transcriptional Start Sites (TSS) of the indicated SWI/SNF members  ARID1A ,  ARID1B ,  SMARCE1  and  SMARCC2 .  b ,  c  Displayed are the average profiles of ChIP-seq signal for the indicated cell lines in absence and presence of JQ1 at transcriptional start site regions (+/−3 kb) ( n  = 66035). Shading indicates standard error of average read count profiles.  d ,  e  qRT-PCR amplification was performed with primers located in the  ARID1B  gene. Shown is the percentage of the BRD2 ( d ) and BRD4 ( e ) and control IgG chromatin immunoprecipitations over chromatin input qRT-PCR amplification. Error bars denote SD over  n  = 4 ( d ) and  n  = 3 ( e ) experiments.  P -values were calculated with multiple t-tests, asterisk denote the number of digits after the decimal. Primer location is visualized in red in the gene map displayed underneath the graph\nDirect binding of BRD2 in  ARID1B  locus.  a  The  ARID1A  wildtype line OVCA429 and the  ARID1A  mutant line HAC2 were cultured for 24 h in 500 nM JQ1 or DMSO vehicle control and subjected to chromatin immunoprecipitation with BRD2 and control antibodies. ChIP sequences were generated by Illumina Hiseq 2000 genome analyzer and aligned to the Human Reference Genome (assembly hg38) and visualized in IGV. Displayed are IGV snapshots of the Transcriptional Start Sites (TSS) of the indicated SWI/SNF members  ARID1A ,  ARID1B ,  SMARCE1  and  SMARCC2 .  b ,  c  Displayed are the average profiles of ChIP-seq signal for the indicated cell lines in absence and presence of JQ1 at transcriptional start site regions (+/−3 kb) ( n  = 66035). Shading indicates standard error of average read count profiles.  d ,  e  qRT-PCR amplification was performed with primers located in the  ARID1B  gene. Shown is the percentage of the BRD2 ( d ) and BRD4 ( e ) and control IgG chromatin immunoprecipitations over chromatin input qRT-PCR amplification. Error bars denote SD over  n  = 4 ( d ) and  n  = 3 ( e ) experiments.  P -values were calculated with multiple t-tests, asterisk denote the number of digits after the decimal. Primer location is visualized in red in the gene map displayed underneath the graph\nTo test the  ARID1A  dependent sensitivity towards BET inhibition in vivo, we used NSG mice xenografted with OCCC cell lines. Unfortunately, engraftment efficiency of OCCC cells appeared rather low since from the tested ES2, SMOV2, TUOC1, and HAC2 cell lines, only ES2 and SMOV2 grew in mice. For the  ARID1A  wildtype ES2 xenograft cohorts, we did not observe a significant growth difference between the vehicle and JQ1 treated tumors (Fig.  7a ). In contrast, the  ARID1A  mutant SMOV2 xenografts were significantly growth impaired upon JQ1 treatment (Fig.  7b ). In agreement with this, the tumor weights of excised tumors were not significantly reduced in JQ1 treated ES2 xenografts (Fig.  7c ) but significantly declined in the JQ1 treated SMOV2 xenografts (Fig.  7d ). Furthermore, Western blot analysis of SMOV2 tumor lysates demonstrated a significant reduction of ARID1B expression upon JQ1 treatment compared to DMSO vehicle control (Figure  S6A ). Thus, upon prolonged exposure in an in vivo model, BET inhibition downregulates ARID1B, likely contributing to the enhanced sensitivity of these tumor xenografts to JQ1. Given the low engraftment efficiencies of the OCCC cell lines, we reasoned that OCCC PDX models could provide an alternative strategy to further validate our results in vivo. F3 tumor pieces from an  ARID1A  wildtype and an  ARID1A  mutant (homozygous  ARID1A  1148* stop-gained mutation) PDX model (Figure  S6B ), were subcutaneously implanted in NSG mice, and were randomized into vehicle control and JQ1 treatment groups. For the PDX- ARID1A -wildtype cohort, JQ1 treatment did not significantly impair tumor growth compared to vehicle control treatment (Fig.  7e ). Importantly, tumor growth in the PDX- ARID1A -mutant cohort was greatly impaired by JQ1 treatment (Fig.  7f ). Thus, in agreement with the OCCC cell line xenograft experiments,  ARID1A  mutant PDX tumors are sensitive to JQ1, whereas  ARID1A  wildtype PDX tumors are unaffected by JQ1 treatment. Of note, Ki67 staining was stronger reduced upon JQ1 treatment in the  ARID1A  mutant PDX tumors, whereas Cleaved Caspase3 staining of the JQ1 treated tumors revealed a small but significant increase in apoptotic cells in the  ARID1A  mutant PDX tumors (Figure  S6C, D ). Collectively, these observations support the notion that BET inhibitors are potentially useful for the treatment of  ARID1A  mutant OCCC. Fig. 7 JQ1 specifically inhibits in vivo growth of  ARID1A  mutant OCCC xenografts and PDX models.  a ,  b \n ARID1A  wildtype ES2 cells (5 × 10 6  in PBS) were subcutaneously injected in the flank of 8–10-weeks-old NSG mice. For the  ARID1A  mutant SMOV2 xenograft experiments, successfully established SMOV2 engraftments (see methods) were dissected, and tumor pieces were subcutaneously propagated in the flank of new mice. When tumors reached ~200 mm 3 , mice were randomized into vehicle (DMSO) control or treatment (JQ1) groups ( n  = 6 mice/group). ES2 xenografts reached the 1500 mm 3  endpoint after 14 days of JQ1 administration, SMOV2 xenografts were treated with JQ1 for 21 days.  c ,  d  Displayed are the tumorweights of the indicated excised tumors after vehicle or JQ1 treatments.  e ,  f \n ARID1A  wildtype ( e ) and mutant ( f ) PDX F3 tumors were established (see methods) and tumor pieces were subcutaneously implanted in the flank of NSG mice. When tumors demonstrated sustained growth, mice were randomized into vehicle (DMSO) control or treatment (JQ1) groups. Treatment with JQ1 was continued for 21 days. For all in vivo experiments, JQ1 (50 mg/kg) or DMSO vehicle were administered intraperitoneally daily and tumor growth was quantified by caliper measurements. Tumor growth was determined as tumor volume treatment day/ tumor volume start treatment. Statistical significance for tumor growth was determined using two-way ANOVA with Bonferoni post-hoc test correction. Error bars denote standard error of mean\nJQ1 specifically inhibits in vivo growth of  ARID1A  mutant OCCC xenografts and PDX models.  a ,  b \n ARID1A  wildtype ES2 cells (5 × 10 6  in PBS) were subcutaneously injected in the flank of 8–10-weeks-old NSG mice. For the  ARID1A  mutant SMOV2 xenograft experiments, successfully established SMOV2 engraftments (see methods) were dissected, and tumor pieces were subcutaneously propagated in the flank of new mice. When tumors reached ~200 mm 3 , mice were randomized into vehicle (DMSO) control or treatment (JQ1) groups ( n  = 6 mice/group). ES2 xenografts reached the 1500 mm 3  endpoint after 14 days of JQ1 administration, SMOV2 xenografts were treated with JQ1 for 21 days.  c ,  d  Displayed are the tumorweights of the indicated excised tumors after vehicle or JQ1 treatments.  e ,  f \n ARID1A  wildtype ( e ) and mutant ( f ) PDX F3 tumors were established (see methods) and tumor pieces were subcutaneously implanted in the flank of NSG mice. When tumors demonstrated sustained growth, mice were randomized into vehicle (DMSO) control or treatment (JQ1) groups. Treatment with JQ1 was continued for 21 days. For all in vivo experiments, JQ1 (50 mg/kg) or DMSO vehicle were administered intraperitoneally daily and tumor growth was quantified by caliper measurements. Tumor growth was determined as tumor volume treatment day/ tumor volume start treatment. Statistical significance for tumor growth was determined using two-way ANOVA with Bonferoni post-hoc test correction. Error bars denote standard error of mean\n\nThrough loss of function genetic screens in a large panel of OCCC cell lines, we identify  BRD2  loss as an  ARID1A  mutation-specific dependency in OCCC cell lines. BRD2 is a member of the BET family of proteins consisting of BRD2, BRD3, BRD4, and BRDT. Bromodomain proteins are epigenetic readers, that play a role in transcriptional regulation through binding of hyperacetylated chromatin. BET proteins have also been reported to act as protein kinases, explaining their presence in the kinome library [ 14 ]. Importantly, inhibiting BRD2 function resulted in enhanced sensitivity of the  ARID1A  mutant OCCC lines. Of note,  BRD4  loss appeared to be toxic in various OCCC lines independent of  ARID1A  status, whereas  BRD3  and  BRDT  were not selected as lethal hits in our screens (Figs.  S1 , 2 ). Presumably, the BET family members exert diverse and only partially overlapping functions in OCCC cell lines causing only loss of the BET member  BRD2  to be synthetic lethal with  ARID1A  mutation. In line with this assumption, a recent study reported a very different genome-wide occupancy of BRD2 and BRD4, suggesting non-redundant genomic functions [ 15 ]. Our observation that specifically BRD2, and not BRD4, binds to the  ARID1B  promoter region suggests that BRD2 knockdown may have different effects on residual SWI/SNF function in  ARID1A  mutant OCCC lines than  BRD4  knockdown. Furthermore, gene essentiality data generated for luminal breast cancer cell lines recently uncovered a BET-independent requirement for BRD4, demonstrating that  BRD4  knockdown lethality not always coincides with JQ1 sensitivity [ 16 ]. Indeed, also in our OCCC cell lines  BRD4  knockdown lethality could not predict JQ1 response. However, more detailed information on the inhibitory efficiencies of both JQ1 and iBET762 on the different bromodomain family members in OCCC lines will be required to support this hypothesis. Interestingly, we show that  ARID1A  depletion directly sensitized OCCC lines to BET inhibition, further strengthening the notion that  ARID1A  loss is critical to the observed phenotype. Currently, we have no indications that  ARID1A  loss sensitizes other cancer types to BET inhibition, suggesting an OCCC-specific context dependency for the findings we report here.\nOur data suggest that  ARID1B  transcriptional down-modulation by BET inhibition contributes to the  ARID1A  mutant dependent toxicity. However, we cannot rule out that other (SWI/SNF) factors regulated by members of the BET domain family contribute to the observed phenotypes. It has been stated previously that ARID1B may be a potential therapeutic target for  ARID1A  mutant cancers [ 12 ]. Importantly, we here demonstrate that BET inhibition may provide a way to target ARID1B indirectly, which could be explored further therapeutically. In that light, it is encouraging that the  ARID1A  dependent sensitivity to BET inhibitors was also observed in OCCC xenografted mice treated with the BET inhibitor JQ1. Unfortunately, more extensive in vivo cell line validation experiments were complicated by the low tumor-take rate of xenografted OCCC cell lines. Therefore, the OCCC PDX experiments reported here provide important additional evidence that BET inhibition imposes an  ARID1A  mutant dependent toxicity in an in vivo model.\nIt has been reported that inhibition of the methyltransferase EZH2 may represent a novel treatment strategy for  ARID1A  mutant cancers [ 17 ]. Furthermore, recent studies have demonstrated a specific sensitivity of  ARID1A  mutant OCCC cells to either dasatinib [ 18 ] or to the HDAC6 inhibitor ACY1215 [ 19 ]. For future studies it will be of interest to test these different synthetic lethal interactions together with our present findings to compare their ability to specifically target  ARID1A  mutant OCCC in vivo. Of note, the OCCC cell line panel used in our study to search for  ARID1A  mutation dependency is the largest reported to date, thereby most closely reflecting the mutation spectrum (e.g., concurrent hotspot mutations in  PIK3CA, KRAS ) found in OCCC patients [ 20 ]. As might be expected from such a heterogeneous group of cell lines, there was not a perfect separation between  ARID1A  mutant and wildtype cell lines in terms of BET inhibitor response. However, we believe that the remarkable sensitivity of the majority of  ARID1A  mutant OCCC lines for the BET inhibitors warrants further (pre)-clinical exploration.\nIn summary, we report here an unexpected and new synthetic lethal interaction between  BRD2  loss and  ARID1A  mutation. We suggest that the inhibitory effects on residual SWI/SNF function, specifically via reduced  ARID1B  expression, may explain the enhanced sensitivity of  ARID1A  mutant cells to BET inhibitors. Our data imply that patients with  ARID1A  mutant OCCC may benefit from BET domain inhibitors added to their treatment regimen.\n\nTOV21G was obtained from ATCC; OVTOKO, RMGI, RMGII, OVMANA, HAC2 from JCRB Cell Bank; JHOC5 from RIKEN Cell Bank; OVCA429 from Cell Biolabs; TUOC1, OVAS, SMOV2, and KOC7C were kindly provided by Hiroaki Itamochi; ES2 was a kind gift from Els Berns and OV207 was a kind gift from Vijayalakshmi Shridhar. All cells were maintained in RPMI supplemented with 10% Fetal Calf Serum and 100 µg/ml Penicilin/Streptomycin and 2 mM  l -Glutamine and tested negative for mycoplasma contamination. The Haloplex sequencing custom platform from Agilent was used to determine  ARID1A  mutation status, with the target region design based on  NM_139135  and  NM_006015 . OCCC cells were classified as “ ARID1A  mutant” when homozygous frameshift and/ or nonsense  ARID1A  mutations were detected in combination with no detectable ARID1A protein on Western.\nA kinome-centered short hairpin RNA (shRNA) library targeting 535 human kinases was assembled from the TRC human genome-wide shRNA collection (TRCHs1.0). Each OCCC line was stably transduced by lentiviral infection in triplicate with a multiplicity of infection (MOI) below 0.5 and sufficient number of cells to ensure a 1000-fold library coverage. A  T 0 time point sample was taken from the cells stably expressing the shRNA library and the remainder of the cells was cultured for 2–3 weeks after which  T 1 was harvested. The relative abundance of each shRNA comparing  T 1 to  T 0 was determined using the R/Bioconductor package DESeq [ 21 ]. Kinases were considered as lethal hits when the  P  value calculated using DESeq was lower than 0.1 and the following three criteria were fulfilled: (1) at least one hairpin with a Fold Change below 0.3 (to ensure significant toxicity), (2) a geometric mean of all the hairpins below 0.8 (to ensure that the majority of hairpins have a similar effect, reducing false-positive results), (3) a top 100 ranking according to the Second Best Gene Rank in RIGER (a method to rank genes by the rank of the second best scoring hairpin of that gene, ensuring selection of genes with at least two functional hairpins) [ 22 ]. The DESeq screening data for the 14 OCCC lines are enlisted in Supplementary Data file  S1 .\nThe following TRC pLKO.1 shRNA vectors were used for validation:  BRD2 #2: TRCN0000006309;  BRD2 #5: TRCN0000006312. The lentiviral vector pLKO.1-Scramble shRNA was obtained from Addgene (#1864). A doxycycline inducible lentiviral shRNA vector (GINSENG) [ 23 ] was modified as described [ 24 ] and was used to express the  ARID1B  hairpins (#3: GGAAGATTAGAGGGTCACATA and #5: GCCGAATTACAAACGCCATAT) under the control of doxycycline.  ARID1A  knockout cell lines were generated with a dual vector doxycycline inducible CRISPR/Cas9 vector system (iKRUNC) as described [ 25 ] using the gRNA sequence targeting  ARID1A : AGGATGAGTCACGCCTCCAT. pLKO was used to express the  ARID1A  shRNA hairpins with RNAi target sequences  ARID1A #2: AGTTGAAGTTCTGATGAA,  ARID1A #3: GAGAAGTTGTATAGCACTA and  ARID1A #4: GTGTAGACCCTTTCATGTA.\nFor Western blotting primary antibodies against ARID1A (PSG3), ACTIN (C2), HSP90 (H-114), CMYC (N-262), BRD4 (H-250) were obtained from Santa Cruz Biotechnology; BRD2 (A302-582A) from Bethyl; ARID1B (AB57461) and Histone-H3(trimethylK27) (AB6002) from Abcam. Immunohistochemical analysis of paraffin-embedded xenograft slices were performed as described [ 26 ], using antibodies against Cleaved-Caspase3 from Cell Signaling (#9661); Ki67 from DAKO (M7240) and ARID1A from Sigma (HPA005456). iBET762 was obtained from Xcess Biosciences. JQ1 for the cell line experiments was kindly provided by the Bradner lab (Dana-Farber Cancer Institute, Boston, USA) [ 9 ] and later purchased from Axon Medchem (axon 1989); both batches had similar activity. JQ1 (HY-13030) used in the xenograft experiments was purchased from MedChem Express. Before use in animals, the in vitro activity of JQ1 (HY-13030) was compared to the activity of JQ1 obtained from Axon Medchem.\nThe 7500 Fast Real-Time PCR System from Applied Biosystems was used to measure mRNA levels which were normalized to expression of  GAPDH . Each QRT-PCR experiment included technical replicates and were repeated at least once. The following primer sequences were used in the SYBR® Green master mix (Roche):  GAPDH _Forward, AAGGTGAAGGTCGGAGTCAA;\nGAPDH _Reverse, AATGAAGGGGTCATTGATGG;\nBRD2 _Forward, GAGGTGTCCAATCCCAAAAAGC;\nBRD2 _Reverse, ATGCGAACTGATGTTTCCACA;\nBRD4_ Forward, AATGAGCTACCCACAGAAGAAAC;\nBRD4_ Reverse, GAGTCGATGCTTGAGTTGTGTT;\nARID1B _Forward, CAAGGGGATCAGAGCAACCC;\nARID1B _Reverse, CTACCTGGGATACTTGCAGGA;\nSMARCC2 _Forward, TACTCTTGGGGGTTCAGTCG;\nSMARCC2 _Reverse, TCTTCAACGGCAAGAACAAG;\nSMARCE1 _Forward, AACAACTACAGGCTGGGAGG;\nSMARCE1 _Reverse, CGGCTTATCTGGTGGCTTT.\nFor long-term colony formation assays, cells were cultured in 6-well plates and medium was refreshed every 3 days. After 10 days cells were fixed with 4% formaldehyde and stained with 0.1% crystal violet and subsequently scanned. Colony formation assay quantification was performed by optical density measurements of extracted dye at 590 nM. Proliferation assays were repeated at least three times, within one assay three technical replicates were performed. Representative stainings and quantifications are shown. Six-day growth assays were performed in quadruple in 384-well plates and were quantified with the cell viability assay CellTiter-Blue (Promega) or by confluency monitoring in an IncuCyte Zoom live cell imaging system (Essen BioScience). Measurements were normalized to untreated controls.\nChromatin Immunoprecipitation (ChIP) was performed as described [ 27 ]. For each ChIP 4 µg anti-BRD2 (A302-583A) or anti-BRD4 (A301-985A) from Bethyl Laboratories and control Rabbit IgG SC-2027 from Santa Cruz Biotechnology were used. ChIP sequences were generated with the use of the Illumina Hiseq 2000 genome analyzer. Mapped reads were visualized in heatmaps and profiles using deepTools2 v2.4.0 with the UCSC hg38 refGene coordinates. QPCR of the  ARID1B  region was performed with ARID1B1.1_Forward, CGCCCACAATGTGCTTTAACGG; ARID1B1.1_Reverse, AGGAAAAACCCACTCGCTTGTC.\nAll animal experiments were approved by the Institutional Animal Care and Use Committee of the University of Groningen and carried out in accordance with the approved guidelines. For the xenografts, ES2 cells (5 × 10 6  in PBS) and SMOV2 cells (5 × 10 6  in 50% PBS/50% Matrigel) were subcutaneously injected in the flank of 8 to 10 weeks old NOD.CB17-Prkdcscid/NCrHsd (NSG) mice. Due to the long latency time (on average 75 days), we used successfully established SMOV2 xenografts for subsequent experiments. For this, SMOV2 xenografts were dissected, and 3 × 3 × 3 mm 3  pieces were subcutaneously propagated in the flank of new mice. STR profiling was used to confirm SMOV2 identity of established xenografts. Thus, ES2 cells were injected and SMOV2 tumor pieces were transplanted in the flanks of NSG mice, and as soon as tumors reached the threshold size of 200 mm 3 , mice were randomized into vehicle control or treatment groups ( n  = 6 mice/group). JQ1 (50 mg/kg in 10% DMSO, 9% (2hydroxypropyl)-β-cyclodextrin) or vehicle (10% DMSO, 9% (2hydroxypropyl)-β-cyclodextrin) was daily administered intraperitoneally. Treatment with JQ1 was continued for 21 days as described in previous studies [ 28 ,  29 ]. Based on the time to reach the humane endpoint for tumor size in mice (~1500 mm 3 ), ES2 tumor-bearing mice had to be euthanized after 14 days of JQ1 treatment.\nOCCC PDX models were established as described previously [ 26 ]. Briefly, all patients gave written informed consent and tumor specimens were obtained during surgery. Clinical characteristics of the patient from which  ARID1A  mutant OCCC PDX was established, were FIGO stage IIIC, no response to carboplatin/paclitaxel chemotherapy and a 9 months disease specific survival.  ARID1A  wildtype PDX was established from an OCCC patient FIGO stage IIB that showed a full response to carboplatin/paclitaxel chemotherapy and no relapse after 13 months. OCCC PDX models were sequenced using Haloplex (Agilent technologies) to determine  ARID1A  mutation status. F3 tumor pieces from an  ARID1A  wildtype and  ARID1A  mutant PDX model were cut into 3 × 3 × 3 mm 3  pieces and subcutaneously implanted in NSG mice. When tumors demonstrated sustained growth ( ARID1A  wildtype PDX on average 26 days,  ARID1A  mutant PDX on average 34 days), mice were randomized into vehicle control or treatment groups ( n  = 5 mice/group). JQ1 (50 mg/kg in 10% DMSO, 9% (2hydroxypropyl)-β-cyclodextrin) or vehicle (10% DMSO, 9% (2hydroxypropyl)-β-cyclodextrin) was daily administered intraperitoneally. Treatment with JQ1 was continued for 21 days.\nSample size for mouse experiments were calculated to be four mice per group (using significance level alpha of 5%, power 80%, estimated effect in growth reduction 50% and coefficient variation of 25%). 1–2 additional mice per group were added in case of dropouts. Animals were excluded when no initial tumor growth was detected before treatment start or animals had >20% weight loss or died during treatment course. Variances between the groups being compared were similar.\n\nFigure S1. TRC kinome lethal hitlists for the ARID1A wildtype lines \n Figure S2. TRC kinome lethal hitlists for the ARID1A mutant lines \n Figure S3. BRD2 knockdown in the OCCC cell line panel \n Figure S4. BRD2 and BRD4 status OCCC cell line panel \n Figure S5. BRD2 ChIP-seq heatmaps at TSS for OVCA429 and HAC2 \n Figure S6. ARID1B protein analysis and H&E/ Cleaved-caspase3 staining of JQ1 treated tumors \n Suppl Data file\nFigure S1. TRC kinome lethal hitlists for the ARID1A wildtype lines\nFigure S2. TRC kinome lethal hitlists for the ARID1A mutant lines\nFigure S3. BRD2 knockdown in the OCCC cell line panel\nFigure S4. BRD2 and BRD4 status OCCC cell line panel\nFigure S5. BRD2 ChIP-seq heatmaps at TSS for OVCA429 and HAC2\nFigure S6. ARID1B protein analysis and H&E/ Cleaved-caspase3 staining of JQ1 treated tumors\nSuppl Data file","source_license":"CC-BY-4.0","license_restricted":false}