{"paper_id":"e849ae0d-a6e7-4a54-9d06-08d45cc0d785","body_text":"Deregulation of cellulose synthesis by site-directed mutagenesis of cellulose synthase leads to heightened bacterial cellulose production | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Deregulation of cellulose synthesis by site-directed mutagenesis of cellulose synthase leads to heightened bacterial cellulose production Daniel J. Upton, Heather Eastmond, Angharad Gatenby, Alexandra Lanot, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4418931/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Bacterial cellulose produced via fermentation is a promising alternative to plant-derived cellulose with the potential to provide a sustainable source of cellulose with a significantly lower environmental footprint than unsustainable sources of cellulose such as wood pulp. Optimisation of the production system is needed to raise productivity and achieve commercial viability. The organism used is a key component of this system and a key target for optimisation by strain development procedures. Wild strains of cellulose-producing bacteria regulate their cellulose synthesis in response to the environment. Deregulation of cellulose synthesis is necessary to achieve higher yields. A key regulatory target for strain engineering is the post-translational deregulation of cellulose synthase that is regulated by cyclic-di-GMP. It has been demonstrated in vitro that mutating the N-terminal arginine residue of the RXXXR motif creates a constitutively active cellulose synthase, but its in vivo effect has not yet been explored. Results In this study, we investigate the effect of mutating the N-terminal arginine residue of the RXXXR motif in vivo with a wild strain of cellulose-producing bacteria isolated in this work. We show heightened bacterial cellulose production in both static and shake flask fermentation when mutated cellulose synthase is expressed compared to when native cellulose synthase is expressed. Conclusions Our work shows for the first time to our knowledge the in vivo effect when the deregulated mutant variant of cellulose synthase is expressed. This work builds on previous studies and furthers progress towards the goal of creating an optimised cellulose-producing strain capable of commercially viable bacterial cellulose production. The work also highlights the importance of elucidating and disrupting the regulatory mechanisms that govern cellulose synthesis, and the challenging nature of this field. bacterial cellulose cellulose synthase BcsAB Novacetimonas hansenii fermentation cyclic-di-GMP Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Cellulose is a naturally occurring abundant polymer produced by both plants and bacteria with widespread applications including textiles, packaging, paper, and pharmaceuticals [ 1 ]. Currently, these applications of cellulose are dominated by plant-derived cellulose, a source of cellulose that often requires significant land and water use and expensive treatments to purify [ 2 , 3 , 4 , 5 , 6 ], albeit with some more environmentally friendly exceptions [ 7 , 8 ]. In a world that has become dependent on many established practices that are harming the planet, there is urgent need to replace these unsustainable technologies with sustainable ones that are harmonious to the environment. Cellulose sourced from bacteria via fermentation is a promising alternative to unsustainable sources of plant-derived cellulose such as wood pulp, with the potential to significantly reduce the associated footprint and provide a sustainable source of cellulose for the various applications that depend upon it including the textile industry. The textile industry is currently responsible for 8–10% of global carbon emissions [ 9 , 10 ] as well as 20% of global wastewater [ 10 ], and has attracted major concerns due to unsustainable practices associated with textile manufacturing. Consequently, the sector has begun transitioning toward more circular and sustainable economic principles, facilitated by the use of man-made cellulosic fibres (MMCFs) [ 11 ]. MMCFs are regenerated fibres such as viscose or lyocell that are typically made from cellulose extracted from wood [ 11 , 12 ]. MMCF production is forecasted to grow due to the potential to become a sustainable alternative to cotton or fossil-derived synthetic fibres [ 11 , 12 ]. Increased MMCF production from wood pulp is putting pressure on ancient and endangered forests therefore most of the major MMCF manufacturers have made significant commitments to use alternative sources of cellulose [ 11 , 12 ]. Bacterial cellulose produced via fermentation has potential to be used in the production of MMCFs at a lower footprint, as has been demonstrated by Nanollose Ltd in the production of the MMCF Nullarbor™ that was used to produce a garment [ 13 ]. Recently, bacterial cellulose has been used to make new materials for products including shoes [ 14 ]. Bacterial cellulose already has established niche applications in the food, cosmetic, paper and medical industries [ 13 , 15 , 16 ], and has also been applied as an acoustic membrane in speakers [ 16 ]. However, current processes to produce bacterial cellulose lack the efficiency needed to achieve the necessary levels of productivity to meet the demands of various industries. Bacterial cellulose has the potential to be produced via processes that can operate at scale and achieve the commercial viability needed. Key components of the production system are the organism used, the fermentation medium, and the fermentor, all of which interrelate and need to be optimised in tandem to reduce costs and increase yield. Notable examples where microorganisms are used industrially to produce high demand products by fermentation are the production of bioethanol by Saccharomyces cerevisiae [ 17 , 18 ] and the production of citric acid by Aspergillus niger [ 19 , 20 , 21 ]. Both of these originate from natural processes similarly to bacterial cellulose, and required optimisation to achieve commercial viability. Wild strains are typically sub-optimal as these have naturally evolved to produce only what is needed in response to the environment. Regulatory mechanisms are often present in wild strains that limit yields and make these strains unsuitable for industrial application. These are therefore a key target in strain optimisation work that is performed via genetic engineering when targets are known or via random mutagenesis coupled with selection and screening techniques when targeted engineering is unsuitable. In recent years, genetic engineering tools have become available for the most prolific species of cellulose-producing bacteria (belonging to the genera of Komagataeibacter and Novacetimonas ) [ 22 , 23 , 24 ] that open up the possibility of strain optimisation by targeted engineering in order to increase fermentation productivity. Efforts have been made to increase cellulose production through genetic engineering, including knock-out of glucose dehydrogenase that was reported to eliminate gluconic acid production and increase cellulose production up to 2.3-fold [ 25 ]. In another study, two genes ( bcsC and bcsD ) of the bacterial cellulose synthase ( bcs ) operon were overexpressed, resulting in ≈ 3-fold increase in cellulose yield [ 26 ]. These examples demonstrate the potential for optimisation of this organism. A key regulatory target is the post-translational regulation of cellulose synthase by cyclic-di-GMP (c-di-GMP). In wild strains where cellulose production is under regulatory control, cellulose synthase is inactive in the absence of the positive regulator c-di-GMP and depends on its presence for activity. Initial insights into the mechanism of c-di-GMP regulation of cellulose synthesis came from an early study that identified a protein that binds c-di-GMP and associates with cellulose synthase [ 27 ]. A subsequent study showed the c-di-GMP binding functionality to be associated with the PilZ domain of cellulose synthase [ 28 ]. A further study identified lysine and arginine residues beside the RXXXR motif to be involved in binding c-di-GMP [ 29 ]. The mechanism of cellulose synthase regulation by c-di-GMP was further elucidated by an in vitro study that demonstrated constitutively active cellulose synthase in vitro when the arginine residue at the beginning of the RXXXR motif is mutated to alanine [ 30 ]. This was shown to disrupt a salt bridge that forms between the arginine residue and a glutamate residue, that acts to tether a gating loop and block access to the active site in the absence of c-di-GMP. This salt bridge is broken upon c-di-GMP binding, causing a conformational change that unblocks the active site. The reported study revealed a key target: site-directed mutagenesis of the N-terminal arginine of the RXXXR motif to alanine to deregulate cellulose synthase at the post-translational level and enable constitutive activity regardless of c-di-GMP concentration. However, its demonstration was limited to in vitro . In this study, we isolated a cellulose-producing strain named NhDJU16 belonging to the species Novacetimonas hansenii and engineered it to express cellulose synthase (BcsAB) with and without the arginine to alanine mutation previously demonstrated in vitro to enable activity in the absence of c-di-GMP. We show in vivo the effect of this mutation on bacterial cellulose production in both static and shake flask culture, and perform a time-course comparison of engineered strains expressing either native BcsAB or mutated BcsAB. Results Determination of relative protein abundance of BcsAB to confirm expression in transformants To confirm BcsAB expression at the protein-level in transformant strains, we determined the relative protein abundance of BcsAB in the wild-type and in transformants expressing native or mutated BcsAB (+/- R557A mutation). The bcsAB gene already exists in the wild-type genome as part of the bacterial cellulose synthase operon, and BcsAB was detected in the wild-type protein extract, as expected. In comparison with the wild-type, we found the relative protein abundance of BcsAB to be ≈ 16.5-fold higher for the transformant expressing native BcsAB, and ≈ 11.4-fold higher for the transformant expressing mutated BcsAB (Fig. 1 ). We considered this to be sufficient evidence to show successful BcsAB expression from the plasmid constructs present in the transformant strains. Any additional BcsAB present in the transformant expressing the mutated gene beyond the wild-type level must be the mutated version. BcsAB relative abundance was ≈ 1.5-fold higher when expressed from the native gene compared to the mutated gene, which may be due to suboptimal expression of the mutated gene due to the choice of codon for the mutated residue or due to regulatory mechanisms that compensate for the heightened activity of mutated BcsAB. Comparing transformants expressing BcsAB +/- R557A mutation to determine effect on bacterial cellulose production To determine the in vivo effect of the R557A mutation, we compared transformants expressing native or mutated BcsAB in both static and shake flask fermentation and obtained data on both cellulose yield and cell dry weight. To capture any variation between different transformants, we tested three independent transformant strains for both native (bcsAB 1–3) and mutated (bcsABm 1–3) BcsAB. Overall, we found that independent transformants behaved similarly. Cellulose yield was significantly higher in both static and shake flask fermentation when mutated BcsAB was expressed compared to the native version (Fig. 2 A, Fig. 3 A). When mutated BcsAB was expressed, cellulose yield was ≈ 33% higher in static fermentation and ≈ 46% higher in shake flask fermentation. The greater difference in cellulose yield observed in shake flask fermentation between transformants expressing mutated and native BcsAB is of interest and may be due to the higher aeration in shake flask fermentation compared with static fermentation. In addition to cellulose yield, we also determined the levels of cell dry weight at the end of fermentation to see if these were affected by expression of mutated BcsAB. No difference in cell dry weight was observed at the end of static or shake flask fermentation when mutated BcsAB was expressed compared to native BcsAB (Fig. 2 B, Fig. 3 B). This suggests that the higher cellulose yield was specifically due to enhanced cellulose synthesis due to the presence of mutated BcsAB rather than a secondary effect that could be caused by increased bacterial growth. It should be noted that a negative effect on cellulose yield was observed when native BcsAB was expressed in comparison to the wild-type strain (≈ 70% of wild-type level). Time-course fermentation to compare transformants expressing BcsAB +/- R557A mutation To compare transformants expressing native and mutated BcsAB more closely, we performed a time-course fermentation with selected transformants (bcsAB 1 and bcsABm 1) and monitored the changes in cellulose production, cell dry weight, and glucose concentration over time (Fig. 4 ). The transformant expressing mutated BcsAB showed at least two-fold higher cellulose between days 1.5 and 2.5, however, this reduced to ≈ 30% more cellulose at later time-points. A significant difference in cell dry weight was also observed early on (around two-fold greater at day 2 when mutated BcsAB was expressed), and reduced to no difference towards the end of fermentation. The two transformants showed no significant difference in rate of glucose consumption despite different levels of cellulose production, suggesting that the flux of glucose to cellulose was higher when mutated BcsAB was expressed. Discussion To achieve commercially viable bacterial cellulose production necessitates the disruption of regulatory mechanisms that otherwise limit cellulose yields. In this study, we expressed a deregulated variant of cellulose synthase (BcsAB) in a wild strain of cellulose-producing bacteria and observed heightened bacterial cellulose production. Activity of native cellulose synthase is dependent on the presence of the positive regulator c-di-GMP, while activity of the deregulated cellulose synthase was previously demonstrated to be constitutive when tested in vitro [ 30 ]. Our in vivo findings are consistent with in vitro ones; however, the percentage increase in final cellulose yield we observed seemed relatively low (30–40%) suggesting that further interventions are needed to fully deregulate cellulose synthesis and achieve optimum productivity. Larger increases in cellulose yield were reported when the genes bcsC and bcsD were overexpressed (≈ 3-fold increase) [ 26 ] and when glucose dehydrogenase was knocked out (≈ 2-fold increase) [ 25 ]. We did, however, see ≈ 2-fold higher rate of cellulose production at earlier time-points (before day 2.5), therefore expression of mutated BcsAB significantly increased the rate of cellulose production leading to shorter fermentation time. The effect of expression of deregulated cellulose synthase reported in this study may be limited by an imbalance of Bcs components with abundance of BcsAB being too high due to overexpression, and subsequently this may have a negative effect by disrupting formation of complete Bcs complexes. Indeed, we observed a negative effect on cellulose yield when overexpressing native bcsAB in comparison with the wild-type. Editing of the bcs operon to mutate the bcsAB gene may achieve a more pronounced effect on cellulose yield as the balance of Bcs components would remain unperturbed. This study highlights the importance of understanding the regulation of cellulose synthesis, and the need to target regulatory mechanisms in order to engineer an optimised strain. c-di-GMP is a key player in the regulation of cellulose production that may operate on other Bcs components and not solely the catalytic component BcsAB. It has been shown in Escherichia coli that the component BcsE binds c-di-GMP [ 31 ] and has a regulatory role in the assembly of the Bcs complex [ 32 ]; however, this component has not been shown to exist in cellulose-producing species belonging to the Komagataeibacter and Novacetimonas genera and is limited to the type II bcs operon present in E. coli [ 33 ]. Further research on the regulation of cellulose synthesis and secretion may reveal additional targets to increase fermentation productivity. Conclusions In this study, we built on existing mechanistic understanding of cellulose synthase regulation by c-di-GMP that showed site-directed mutagenesis of BcsAB to be a clear target for deregulating cellulose synthesis. Previous studies showed mutated BcsAB to be constitutively active when tested in vitro . We determined the effect in vivo when mutated BcsAB is expressed and showed around two-fold increase in rate of cellulose production early in fermentation with final cellulose yield being at least 30% higher compared to when native BcsAB is expressed. Our work emphasises the need to understand the regulatory system that controls bacterial cellulose production, so that this can be effectively engineered to create an optimised cellulose-producing strain that can achieve commercially viable yields of bacterial cellulose. Methods Preparation of HS media HS medium [ 34 ] was used for growth of cellulose-producing bacteria and in fermentation experiments. HS medium in this study was composed of 5 g/L yeast extract, 5 g/L bacteriological peptone, 20 g/L glucose (unless described otherwise), 2.7 g/L Na 2 HPO 4 anhydrous, and 1.5 g/L citric acid monohydrate. HS-agar medium was prepared by inclusion of 15 g/L agar in HS medium. Isolation of cellulose-producing NhDJU16 strain The cellulose-producing bacterial strain NhDJU16 was isolated from rotting apple. A sample of rotting apple was collected in a 50 mL Falcon tube by using a scalpel and spatula (sterilised by wiping with 70% ethanol). The sample was stored at 4°C until use. To isolate the strain from rotting apple, an enrichment culture was performed by adding 20 mL selective medium to a 100 mL sterile shake flask to provide the necessary conditions to prevent the growth of competing microorganisms. Selective medium was prepared by adding 4% ethanol, 1% acetic acid, and 100 mg/L natamycin to HS medium. Ethanol and acetic acid were added after autoclaving from filter sterile stocks, and natamycin was added prior to autoclaving. Selective medium was wrapped in foil to protect from light and stored at 4°C. A piece of rotting apple was placed in the flask containing selective medium. The enrichment culture was incubated at 30°C with agitation at 200 rpm for 12 days. Bacterial cellulose was observed growing around the piece of rotting apple. Bacterial cellulose was extracted from the enrichment culture and transferred to a 7 mL Bijou tube. 75 µl filter sterile cellulase (C2730-50ML, Merck) was then added to hydrolyse the cellulose and release bacteria into a cell suspension. The Bijou tube was incubated at 30°C 200 rpm for 4 hours with the lid on loose but secure. The resulting cell suspension was used to prepare glycerol stocks by mixing equal volumes of 50% glycerol (filter sterile) and cell suspension. Glycerol stocks were stored at − 70°C. To purify and isolate the NhDJU16 strain, one glycerol stock aliquot was thawed and diluted 1:10 with sterile dH 2 O. 100 µl of diluted glycerol stock was plated on HS-agar (+ 1% acetic). The plate was incubated at 30°C for 3 days. A single colony was picked from the plate using a sterile P10 tip and swirled in 1.5 mL HS medium (+ 1% acetic) in a 12-well plate to propagate the isolate and confirm its ability to produce bacterial cellulose. The 12-well plate was incubated at 30°C for 3 days. Bacterial cellulose was visible at the surface of the culture. The contents of the well were transferred to a 7 mL Bijou tube. 75 µl filter sterile cellulase (C2730-50ML, Merck) was then added and the tube was incubated at 30°C 200 rpm for 3 hours with the lid on loose but secure. Equal volumes of 50% glycerol (filter sterile) and resulting cell suspension were mixed to make glycerol stock aliquots in sterile 1.5 mL Eppendorf tubes, which were stored at − 70°C. Species identification of NhDJU16 The NhDJU16 strain was identified as Novacetimonas hansenii . Species identification was performed by sequence comparisons of the PCR amplified 16S-23S ITS region using genomic DNA as template. Genomic DNA (gDNA) was extracted from 2 mL NhDJU16 glycerol stock using the Wizard® Genomic DNA purification kit (Promega) according to manufacturer's instructions. Centrifugation steps were performed at 16000 g and the DNA pellet was rehydrated by the addition of 100 µl nuclease free water. The 16S-23S ITS region was amplified by PCR using primers its1 and its2 (Table 1 ) in a 50 µl reaction containing 1 U Phusion DNA polymerase, 200 µM dNTPs, HF buffer, 0.5 µM primers, and 1 µl gDNA. The PCR reaction was run on the following programme: 98°C 2 minutes, then 30 cycles of 98°C 10 seconds, 65°C 10 seconds, 72°C 15 seconds, then 72°C 7 minutes, 10°C forever. PCR clean-up was performed using the NucleoSpin® PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. PCR product was sequenced by Eurofins (LightRun Tube service) using the its1 primer. The DNA sequence provided was blasted against known 16S-23S ITS sequences of Komagataeibacter spp. and gave a top hit against N. hansenii (formerly K. hansenii ) (99% identity, E-value 0). Construction of pKoma-bcsAB and pKoma-bcsABm expression vectors The expression vector (J23104-mRFP1-331Bb, Addgene plasmid #78274) developed as part of a genetic engineering toolkit for K. rhaeticus [ 22 ] was used in this study. This plasmid contains the constitutive promoter J23104 and mRFP reporter gene, and was named pKoma-mRFP in this work. The plasmid was received as a bacterial stab culture which was used to inoculate 5 mL LB containing 50 µg/mL chloramphenicol in a 30 mL universal container. The culture was incubated at 37°C 200 rpm overnight (≈ 16 hours). Wizard® Plus SV minipreps DNA purification kit (Promega) was used to isolate and purify the plasmid from the culture, according to the manufacturer's instructions. Inverse PCR was used to amplify the plasmid with the exclusion of mRFP. Prior to using the plasmid as template in inverse PCR, the plasmid was linearised by digestion with HpaI (NEB) in a 50 µl reaction containing 500 ng pKoma-mRFP plasmid, rCutSmart buffer, and 5 U HpaI in a PCR tube. The reaction was incubated at 37°C for 1 hour. The digested plasmid was purified using the NucleoSpin® PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. Inverse PCR was performed in a 50 µl reaction containing 1 U Phusion DNA polymerase, 200 µM dNTPs, HF buffer, 0.5 µM primers (pKoma_inv_fw and pKoma_inv_rv), and 3 ng HpaI-digested pKoma-mRFP plasmid as template. The inverse PCR reaction was run on the following programme: 98°C 2 minutes, then 30 cycles of 98°C 10 seconds, 63°C 10 seconds, 72°C 100 seconds, then 72°C 7 minutes, 10°C forever. PCR clean-up was performed using the NucleoSpin® PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. The PCR product was subsequently used in In-Fusion® HD cloning (Clontech) to construct the pKoma-bcsAB and pKoma-bcsABm vectors. The bcsAB gene was cloned from NhDJU16 gDNA in two fragments (bcsAB_1 and bcsAB_2) that were subsequently joined by overlap extension (OE) PCR. Outer primers contained 15 bp tails (underlined) for In-Fusion® HD cloning (Clontech), and inner primers contained 30 bp tails (underlined) for OE PCR. Site-directed mutagenesis was performed by using mutagenic inner primers (mutated bases in bold) to generate fragments bcsABm_1 and bcsABm_2 containing the desired mutation. bcsAB_1 and bcsABm_1 were amplified using the outer primer bcsAB_1_fw and the inner primers bcsAB_1_rv and bcsABm_1_rv respectively. bcsAB_2 and bcsABm_2 were amplified using the outer primer bcsAB_2_rv and the inner primers bcsAB_2_fw and bcsABm_2_fw respectively. 50 µl PCR reactions contained 1 U Phusion DNA polymerase, 200 µM dNTPs, HF buffer (for bcsAB_1 and bcsABm_1) or GC buffer (for bcsAB_2 and bcsABm_2), 0.5 µM primers, 5% DMSO (for bcsAB_2 and bcsABm_2 only), and 50 ng NhDJU16 gDNA. The reactions were run on the following programme: 98°C 2 minutes, then 30 cycles of 98°C 10 seconds, 60°C 10 seconds (for bcsAB_1 and bcsABm_1) or 65°C 30 seconds (for bcsAB_2 and bcsABm_2), 72°C 60 seconds (for bcsAB_1 and bcsABm_1) or 72°C 100 seconds (for bcsAB_2 and bcsABm_2), then 72°C 7 minutes, 10°C forever. PCR clean-up was performed as described previously. 50 µl OE PCR reactions contained 1 U Phusion DNA polymerase, 400 µM dNTPs, GC buffer, 100 ng bcsAB_1 or bcsABm_1 fragment, 172.5 ng bcsAB_2 or bcsABm_2 fragment, and 5% DMSO. The reactions were run on the following programme: 94°C 5 minutes, then 30 cycles of 94°C 30 seconds, 72°C 130 seconds, then 72°C 7 minutes, 10°C forever. PCR clean-up was performed as described previously. The purified PCR products bcsAB and bcsABm were then used in In-Fusion® HD cloning (Clontech) to construct the pKoma-bcsAB and pKoma-bcsABm vectors. Transformation was performed using StrataClone SoloPack competent cells (Agilent Technologies) according to the manufacturer's instructions. Transformed cells were plated on LB containing 50 µg/mL chloramphenicol. Transformant colonies were grown in 5 mL LB containing 50 µg/mL chloramphenicol in 30 mL universal containers. Transformants were screened by PCR using primers pKoma-bcsAB_fw and pKoma-bcsAB_rv in 10 µl PCR reactions containing 0.2 U Phusion DNA polymerase, 200 µM dNTP, HF buffer, 0.5 µM primers, and 1 µl culture (diluted 1:50). The reactions were run on the following programme: 98°C 2 minutes, then 30 cycles of 98°C 10 seconds, 65°C 10 seconds, 72°C 15 seconds, then 72°C 7 minutes, 10°C forever. Plasmid was isolated and purified from positive transformants using the Wizard® Plus SV minipreps DNA purification kit (Promega), according to the manufacturer's instructions. Plasmid integrity was confirmed by whole plasmid sequencing (Plasmidsaurus). Table 1 Primers used in this work. Primer name Primer sequence its1 5'-ACCTGCGGCTGGATCACCTCC-3' its2 5'-CCGAATGCCCTTATCGCGCTC-3' pKoma_inv_fw 5'-ATCGCTACTAGAGCCAGGCA-3' pKoma_inv_rv 5'-TCACTAGTAGCTAGCACAATACCT-3' bcsAB_1_fw 5'- GCTAGCTACTAGTGA TTATGCCAGAGGTTCGGTCG-3' bcsAB_1_rv 5'- TTCCACCGGGATAGTTGCGGGGATGCGATG ACTGTTGCGTTTCTGCTGTG-3' bcsABm_1_rv 5'- TTCCACCGGGATAGTTGCGGGGATGCGATG ACTGTTG GC TTTCTGCTGTG-3' bcsAB_2_fw 5'- GGGCGTGAAACACAGCAGAAACGCAACAGT CATCGCATCCCCGCAACTAT-3' bcsABm_2_fw 5'- GGGCGTGAAACACAGCAGAAA GC CAACAGT CATCGCATCCCCGCAACTAT-3' bcsAB_2_rv 5'- GGCTCTAGTAGCGAT GCAGGTCGTTGCGAGAAGA-3' pKoma-bcsAB_fw 5'-GTCGGCCTGTTGGGATGTAT-3' pKoma-bcsAB_rv 5'-GGAACCTCTTACGTGCCGAT-3' Transformation of NhDJU16 by electroporation NhDJU16 was transformed with plasmids pKoma-bcsAB and pKoma-bcsABm by electroporation using an established protocol [ 22 ] with modifications. Electrocompetent cells were prepared by growing bacteria on HS-agar (+ 1% acetic acid) in the presence of cellulase. One plate was inoculated with 100 µl glycerol stock in one spot, and 140 µl sterile dH 2 O plus 10 µl filter sterile cellulase (C2730-50ML, Merck) in another spot. These were mixed together with a spreader and spread evenly. The plate was incubated at 30°C for 1 day. Bacteria were harvested by using sterile cotton wool buds. Buds covered in bacteria were dipped in 14 mL 1 mM filter sterile HEPES buffer (pH 7) in a 15 mL Falcon tube, and were pressed against the sides of the tube to release bacteria into suspension. The resulting cell suspension was centrifuged at 4600 rpm 5 minutes in a Multifuge 3 SR benchtop centrifuge (Heraeus). The supernatant was discarded and the cells were resuspended in 1 mL 15% glycerol (filter sterile), and then diluted with 15% glycerol to an OD 600 of 2.8. The resulting cell suspension was split into 100 µl aliquots in sterile 1.5 mL Eppendorf tubes and these were stored at − 70°C. For electroporation, plasmids and electrocompetent cells were thawed at room temperature. 2 µl plasmid was added to 100 µl electrocompetent cells and mixed by swirling using a sterile P10 tip, then transferred to a 2 mm electrocuvette (FB102, Fisher Scientific). The electroporator (Gene Pulser II with the Pulse Controller PLUS and Capacitance Extender PLUS modules, Bio-Rad) was configured to 2.5 kV, 400 Ohm resistance, and 25 µF capacitance. One pulse lasting ≈ 10 ms was applied to each electrocuvette. 800 µl HS medium and 1.6 µl filter sterile cellulase (C2730-50ML, Merck) (pre-mixed in a 15 mL Falcon tube) were then added to the electrocuvette, mixed by pipetting up and down, and transferred to a 15 mL Falcon tube. 15 mL Falcon tubes containing electroporated cells were incubated at 30°C 140 rpm overnight (≈ 17 h) with lids on loose but secure. Overnight cultures were centrifuged at 4600 rpm 5 minutes in a Multifuge 3 SR benchtop centrifuge (Heraeus). Supernatant was discarded and cells were resuspended in 200 µl sterile dH 2 O. 100 µl was plated on HS-agar containing 340 µg/mL chloramphenicol. Plates were incubated at 30°C for 3 days. Transformant colonies were picked using sterile P200 tips and placed in 100 µl sterile dH 2 O in sterile 1.5 mL Eppendorf tubes, then mixed up and down by pipetting. The resulting cell suspensions were diluted 1:1000 with sterile dH 2 O and 100 µl was then plated on HS-agar (+ 1% acetic acid, + 340 µg/mL chloramphenicol). Plates were incubated at 30°C for 3 days. Purified transformant colonies were picked and resuspended in sterile dH 2 O as described previously. The resulting cell suspensions were plated on HS-agar (+ 1% acetic acid, + 340 µg/mL chloramphenicol) to which cellulase was added as described previously. Plates were incubated at 30°C for 2 days. Bacteria were harvested from plates using sterile cotton wool buds as described previously. Cells were released into 1 mL sterile dH 2 O in sterile 1.5 mL Eppendorf tubes, from which glycerol stocks were prepared as described previously. Determination of relative protein abundance of BcsAB To determine the relative protein abundance of BcsAB and compare between wild-type and transformant strains, samples of protein extract were prepared from bacterial cellulose grown in static fermentation. 10 mL static fermentations were performed in 25 cm 2 cell culture flasks (430639, Corning®). 10 mL HS medium containing 40 g/L glucose was added to each flask, to which acetic and chloramphenicol (in ethanol) were added to give final concentrations of 1% and 340 µg/mL respectively. In the case of the wild-type, chloramphenicol was omitted and ethanol was added instead to a final concentration of 1% to match the ethanol concentration in cultures containing chloramphenicol. The flasks were inoculated to give an OD 600 of 0.01, and were incubated at 30°C for 3 days. 25 µl filter sterile cellulase (C2730-50ML, Merck) was then added, followed by incubation at 30°C 140 rpm for 90 minutes to hydrolyse cellulose and release cells into suspension. Cell suspension was then transferred to 15 mL Falcon tubes and centrifuged at 3900 rpm 5 minutes in a benchtop centrifuge (Centrifuge 5810 R; Eppendorf). Cells were resuspended in 10 mL of 100 mM Tris.HCl buffer (pH 7.5), then centrifuged again. Washed cells were resuspended in 10 mL lysis buffer containing 510 g/L urea, 0.2% SDS, 2% Triton-X-100, 10 g/L dithiothreitol (DTT), 2% Pharmalyte® 3–10 (Cytiva), and cOmplete™ mini protease inhibitor cocktail (Roche) (one tablet per 10 mL) in Milli-Q® water. Cells were incubated in lysis buffer for 20 minutes at room temperature, then centrifuged 3500 rpm 5 minutes. 1 mL of supernatant was transferred to a 1.5 mL Eppendorf tube and stored at − 20°C. Samples were sent to the University of York Technology Facility for determination of relative protein abundance. In brief, samples were digested with Glu-C protease using an S-trap mediated protocol. Resulting peptides were analysed by PASEF-DIA using an EvoSep One UPLC for peptide separation with a 15 cm Performance C18 column and a 30 SPD gradient. Data were acquired on a TimsTOF-HT mass spectrometer, using a 1.1 s cycle and 25 m/z windows between 400–1201 m/z for DIA. Data were searched against NhDJU16 protein sequences including native BcsAB and mutated BcsAB. Static and shake flask fermentation to produce bacterial cellulose 10 mL static fermentations were performed in 25 cm 2 cell culture flasks (430639, Corning®) and 20 mL shake flask fermentations were performed in 100 mL shake flasks. HS medium containing 40 g/L glucose and 1% acetic acid was used except in the time-course fermentation where glucose concentration was reduced to 20 g/L. For transformant strains, chloramphenicol (in ethanol) was added to a final concentration of 340 µg/mL. For the wild-type, ethanol was added to a final concentration of 1% to match the ethanol present in cultures containing chloramphenicol. Inoculum was added to give an OD 600 of 0.01. Fermentations were incubated at 30°C. Shake flask fermentations were agitated at 250 rpm. Determination of cellulose, cell dry weight, and glucose Flask contents were transferred to 50 mL Falcon tubes and centrifuged at 3900 rpm 5 minutes (Centrifuge 5810 R; Eppendorf). Supernatant for glucose measurement was transferred to a 1.5 mL Eppendorf tube, diluted 1:100 with sterile dH 2 O, and stored at − 20°C. Glucose was determined using an enzymatic assay kit (K-GLUC; Megazyme). Remaining supernatant in 50 mL Falcon tubes was discarded, and bacterial cellulose samples were then subjected to a wash cycle (up to 40 mL with dH 2 O, incubation at 30°C 140 rpm 30 minutes with tubes horizontal, centrifugation at 3900 rpm 5 minutes, discarding of supernatant). The wash cycle was performed 4–6 times in order to remove any residual medium leaving only cellulose and bacteria. The washed bacterial cellulose samples were dried at 70°C to constant weight (2–3 days) and weighed on a fine balance to determine the weight of cellulose + bacteria. 50 mL Falcon tubes containing dried bacterial cellulose were then made up to 50 mL with 0.1 M NaOH and incubated at 70°C for 1 day to remove bacteria. The NaOH was then discarded and NaOH-treated cellulose samples were subjected to a wash cycle (up to 40 mL with dH 2 O, incubation at 30°C 140 rpm 30 minutes with tubes horizontal, discarding of wash) two times, followed by drying at 70°C to constant weight. Dried cellulose samples were weighed on a fine balance to determine the weight of cellulose. Cell dry weight was determined by subtracting the weight of cellulose from the weight of cellulose + bacteria. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and material The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the Biotechnology and Biological Sciences Research Council (BBSRC) [Grant Number BB/T017023/1], the Engineering and Physical Sciences Research Council (EPSRC) [Grant Number EP/V011766/1] through the Textiles Circularity Centre, and the University of York through an EPSRC IAA award. Authors' contributions DJU conceptualised the study, performed the experiments, and wrote the original draft of the manuscript. HE assisted with establishing the methodology to transform cellulose-producing bacteria by electroporation. AG helped in molecular biology work to construct the plasmids. AL and NCB supervised the work, and reviewed and edited the manuscript. All authors read and approved the final manuscript. Acknowledgements We are thankful to Simon McQueen-Mason (deceased) for obtaining the funding to support this work, and for his early supervision of the work. References Gupta PK, Raghunath SS, Prasanna DV, Venkat P, Shree V, Chithananthan C, Choudhary S, Surender K, Geetha K. An update on overview of cellulose, its structure and applications. Cellulose. 2019;201:84727. Chen S, Zhu L, Sun L, Huang Q, Zhang Y, Li X, Ye X, Li Y, Wang L. A systematic review of the life cycle environmental performance of cotton textile products. Sci Total Environ. 2023;24:163659. Shen L, Worrell E, Patel MK. Environmental impact assessment of man-made cellulose fibres. Resour Conserv Recy. 2010;55:260-74. Van Oel PR, Hoekstra AY. Towards quantification of the water footprint of paper: a first estimate of its consumptive component. Int Ser Prog Wat Res. 2012;26:733-49. Sun M, Wang Y, Shi L. Environmental performance of straw-based pulp making: A life cycle perspective. Sci Total Environ. 2018;616:753-62. Mukherjee S. Environmental and social impact of fashion: Towards an eco-friendly, ethical fashion. Int J Interdiscip. 2015;2:22-35. Delate K, Heller B, Shade J. Organic cotton production may alleviate the environmental impacts of intensive conventional cotton production. Renew Agr Food Syst. 2021;36:405-12. Guo S, Li X, Zhao R, Gong Y. Comparison of life cycle assessment between lyocell fiber and viscose fiber in China. Int J Life Cycle Ass. 2021;26:1545-55. Leal Filho W, Perry P, Heim H, Dinis MA, Moda H, Ebhuoma E, Paço A. An overview of the contribution of the textiles sector to climate change. Front Environ Sci. 2022;10:973102. Bailey K, Basu A, Sharma S. The environmental impacts of fast fashion on water quality: a systematic review. Water-Sui. 2022;14:1073. Frazier RM, Vivas KA, Azuaje I, Vera R, Pifano A, Forfora N, Jameel H, Ford E, Pawlak JJ, Venditti R, Gonzalez R. Beyond Cotton and Polyester: An Evaluation of Emerging Feedstocks and Conversion Methods for the Future of Fashion Industry. J Bioresour Bioprod. 2024;4. Gschwandtner C. Outlook on Global Fiber Demand and Supply 2030. Growth. 2022;65:113. Zhong C. Industrial-scale production and applications of bacterial cellulose. Front Bioeng Biotechnol. 2020;8:605374. Melton L. Cellulose shoes made by bacteria. Nat Biotechnol. 2022;40:1163. Blanco Parte FG, Santoso SP, Chou CC, Verma V, Wang HT, Ismadji S, Cheng KC. Current progress on the production, modification, and applications of bacterial cellulose. Crit Rev Biotechnol. 2020;40:397-414. Mohite BV, Patil SV. A novel biomaterial: bacterial cellulose and its new era applications. Biotechnol Appl Bioc. 2014;61. Jacobus AP, Gross J, Evans JH, Ceccato-Antonini SR, Gombert AK. Saccharomyces cerevisiae strains used industrially for bioethanol production. Essays Biochem. 2021;65:147-61. Tse TJ, Wiens DJ, Reaney MJ. Production of bioethanol—A review of factors affecting ethanol yield. Fermentation. 2021;7:268. Cairns TC, Barthel L, Meyer V. Something old, something new: challenges and developments in Aspergillus niger biotechnology. Essays Biochem. 2021;65:213-24. Książek E. Citric Acid: Properties, Microbial Production, and Applications in Industries. Molecules. 2023;29:22. Upton DJ, McQueen-Mason SJ, Wood AJ. An accurate description of Aspergillus niger organic acid batch fermentation through dynamic metabolic modelling. Biotechnol Biofuels. 2017;10:1-4. Florea M, Hagemann H, Santosa G, Abbott J, Micklem CN, Spencer-Milnes X, de Arroyo Garcia L, Paschou D, Lazenbatt C, Kong D, Chughtai H. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain. P Natl Acad Sci USA. 2016;113:E3431-40. Liu LP, Yang X, Zhao XJ, Zhang KY, Li WC, Xie YY, Jia SR, Zhong C. A lambda Red and FLP/FRT-mediated site-specific recombination system in Komagataeibacter xylinus and its application to enhance the productivity of bacterial cellulose. ACS Synth Biol. 2020;9:3171-80. Goosens VJ, Walker KT, Aragon SM, Singh A, Senthivel VR, Dekker L, Caro-Astorga J, Buat ML, Song W, Lee KY, Ellis T. Komagataeibacter tool kit (KTK): a modular cloning system for multigene constructs and programmed protein secretion from cellulose producing bacteria. ACS Synth Biol. 2021;10:3422-34. Kuo CH, Teng HY, Lee CK. Knock-out of glucose dehydrogenase gene in Gluconacetobacter xylinus for bacterial cellulose production enhancement. Biotechnol Bioproc E. 2015;20:18-25. Yang L, Zhu X, Chen Y, Wang J. Enhanced bacterial cellulose production in Gluconacetobacter xylinus by overexpression of two genes ( bscC and bcsD ) and a modified static culture. Int J Biol Macromol. 2024;260:129552. Weinhouse H, Sapir S, Amikam D, Shilo Y, Volman G, Ohana P, Benziman M. c‐di‐GMP‐binding protein, a new factor regulating cellulose synthesis in Acetobacter xylinum . FEBS Lett. 1997;416:207-11. Ryjenkov DA, Simm R, Römling U, Gomelsky M. The PilZ domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria. J Biol Chem. 2006;281:30310-4. Fujiwara T, Komoda K, Sakurai N, Tajima K, Tanaka I, Yao M. The c-di-GMP recognition mechanism of the PilZ domain of bacterial cellulose synthase subunit A. Biochem Bioph Res Co. 2013;431:802-7. Morgan JL, McNamara JT, Zimmer J. Mechanism of activation of bacterial cellulose synthase by cyclic di-GMP. Nat Struct Mol Biol. 2014;21:489-96. Fang X, Ahmad I, Blanka A, Schottkowski M, Cimdins A, Galperin MY, Römling U, Gomelsky M. GIL, a new c‐di‐GMP‐binding protein domain involved in regulation of cellulose synthesis in enterobacteria. Mol Microbiol. 2014;93:439-52. Zouhir S, Abidi W, Caleechurn M, Krasteva PV. Structure and multitasking of the c-di-GMP-sensing cellulose secretion regulator BcsE. Mbio. 2020;11:10-128. Römling U, Galperin MY. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions. Trends Microbiol. 2015;23:545-57. Hestrin S, Schramm MJ. Synthesis of cellulose by Acetobacter xylinum . 2. Preparation of freeze-dried cells capable of polymerizing glucose to cellulose. Biochem J. 1954;58:345. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4418931\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":304981235,\"identity\":\"eb5fcda1-7af3-4796-b88f-046bd85c2b19\",\"order_by\":0,\"name\":\"Daniel J. Upton\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYDCCAwfAlBw/iEwoIFYLEBlLNoC0GBClBYITN4BtI0YL38EzZo8/VNxJ3Hx+deKHBwYM8vxiB/BrkTxwxtzgwJlnxttuvN0sAXSY4czZCfi1AJWbSRxsOyy77cbZDSAtCQa3idTCuHnG2c0/SNKiuIG/dxtxtkgeOFZucObMYWOJG7zbLBIMJAj7he/G4W0PKioOy/H3n91880eFjTy/NAEtDBIH2KAMsEoJAspBgL8BqoX/ABGqR8EoGAWjYEQCADDFUbhQVlhuAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"CNAP, University of York\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Daniel\",\"middleName\":\"J.\",\"lastName\":\"Upton\",\"suffix\":\"\"},{\"id\":304981237,\"identity\":\"ab1674fa-41a2-420a-a1cd-2ba51a3799e9\",\"order_by\":1,\"name\":\"Heather Eastmond\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CNAP, University of York\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Heather\",\"middleName\":\"\",\"lastName\":\"Eastmond\",\"suffix\":\"\"},{\"id\":304981238,\"identity\":\"1a3afefd-dca2-4cec-b5f0-8003a3b4cf99\",\"order_by\":2,\"name\":\"Angharad Gatenby\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CNAP, University of York\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Angharad\",\"middleName\":\"\",\"lastName\":\"Gatenby\",\"suffix\":\"\"},{\"id\":304981239,\"identity\":\"02518abc-830c-445c-8e2e-e7bf16971807\",\"order_by\":3,\"name\":\"Alexandra Lanot\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CNAP, University of York\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alexandra\",\"middleName\":\"\",\"lastName\":\"Lanot\",\"suffix\":\"\"},{\"id\":304981241,\"identity\":\"65c55b1d-b271-4b4b-9766-5764e4eeba44\",\"order_by\":4,\"name\":\"Neil C. Bruce\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CNAP, University of York\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Neil\",\"middleName\":\"C.\",\"lastName\":\"Bruce\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-05-14 11:48:19\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4418931/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4418931/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":56954046,\"identity\":\"a5ead323-7603-419c-b926-e8a2c464ef59\",\"added_by\":\"auto\",\"created_at\":\"2024-05-22 15:26:00\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":119500,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRelative protein abundance of BcsAB in wild-type and selected transformants expressing BcsAB without mutation (bcsAB 1) and with mutation (bcsABm 1). Data plotted are mean averages of four biological replicates and error bars represent standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4418931/v1/c77cd3f891fb1d9114493988.png\"},{\"id\":56954051,\"identity\":\"fdd47356-634e-4386-964e-6c148947555c\",\"added_by\":\"auto\",\"created_at\":\"2024-05-22 15:26:02\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":184840,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComparison of transformants expressing BcsAB +/- R557A mutation\\u003cem\\u003e \\u003c/em\\u003ein static fermentation. (A) Cellulose (g/L) produced at day 5 of static fermentation. (B) Cell dry weight (g/L) produced at day 5 of static fermentation. bcsAB 1-3 correspond to three independent transformants expressing native BcsAB from the pKoma-bcsAB plasmid construct. bcsABm 1-3 correspond to three independent transformants expressing mutated BcsAB from the pKoma-bcsABm plasmid construct. Data plotted are mean averages of four biological replicates and error bars represent standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4418931/v1/fac00457d5ab579a68b061d5.png\"},{\"id\":57083918,\"identity\":\"83899b9a-801b-47bd-aacc-0f5537df1e2c\",\"added_by\":\"auto\",\"created_at\":\"2024-05-24 11:18:35\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":223743,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComparison of transformants expressing BcsAB +/- R557A mutation\\u003cem\\u003e \\u003c/em\\u003ein shake flask fermentation. (A) Cellulose (g/L) produced at day 5 of shake flask fermentation. (B) Cell dry weight (g/L) produced at day 5 of shake flask fermentation. bcsAB 1-3 correspond to three independent transformants expressing native BcsAB from the pKoma-bcsAB plasmid construct. bcsABm 1-3 correspond to three independent transformants expressing mutated BcsAB from the pKoma-bcsABm plasmid construct. Data plotted are mean averages of three biological replicates and error bars represent standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3image.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4418931/v1/a290baca52546b48c82c23ad.png\"},{\"id\":56954047,\"identity\":\"9f816383-11cd-4b6a-aa73-c1a01cd0ae3c\",\"added_by\":\"auto\",\"created_at\":\"2024-05-22 15:26:00\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":220313,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTime-course comparison of selected transformants expressing BcsAB +/- R557A mutation in static fermentation. (A) Change in cellulose (g/L) over time. (B) Change in cell dry weight (g/L) over time. (C) Change in external glucose concentration (g/L) over time. Green dots correspond to the transformant expressing native BcsAB. Purple triangles correspond to the transformant expressing mutated BcsAB. Data plotted are mean averages of four biological replicates and error bars represent standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4418931/v1/b3c60b272c9b5bf4a833dd3d.png\"},{\"id\":58221182,\"identity\":\"b65c36b1-7f72-4e11-897d-f4c83e9abcde\",\"added_by\":\"auto\",\"created_at\":\"2024-06-12 16:20:33\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1290381,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4418931/v1/342a25cb-6d52-4bb7-9e56-61a7b8da278b.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Deregulation of cellulose synthesis by site-directed mutagenesis of cellulose synthase leads to heightened bacterial cellulose production\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eCellulose is a naturally occurring abundant polymer produced by both plants and bacteria with widespread applications including textiles, packaging, paper, and pharmaceuticals [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Currently, these applications of cellulose are dominated by plant-derived cellulose, a source of cellulose that often requires significant land and water use and expensive treatments to purify [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e], albeit with some more environmentally friendly exceptions [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. In a world that has become dependent on many established practices that are harming the planet, there is urgent need to replace these unsustainable technologies with sustainable ones that are harmonious to the environment. Cellulose sourced from bacteria via fermentation is a promising alternative to unsustainable sources of plant-derived cellulose such as wood pulp, with the potential to significantly reduce the associated footprint and provide a sustainable source of cellulose for the various applications that depend upon it including the textile industry.\\u003c/p\\u003e \\u003cp\\u003eThe textile industry is currently responsible for 8\\u0026ndash;10% of global carbon emissions [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e] as well as 20% of global wastewater [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], and has attracted major concerns due to unsustainable practices associated with textile manufacturing. Consequently, the sector has begun transitioning toward more circular and sustainable economic principles, facilitated by the use of man-made cellulosic fibres (MMCFs) [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. MMCFs are regenerated fibres such as viscose or lyocell that are typically made from cellulose extracted from wood [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. MMCF production is forecasted to grow due to the potential to become a sustainable alternative to cotton or fossil-derived synthetic fibres [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Increased MMCF production from wood pulp is putting pressure on ancient and endangered forests therefore most of the major MMCF manufacturers have made significant commitments to use alternative sources of cellulose [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Bacterial cellulose produced via fermentation has potential to be used in the production of MMCFs at a lower footprint, as has been demonstrated by Nanollose Ltd in the production of the MMCF Nullarbor\\u0026trade; that was used to produce a garment [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Recently, bacterial cellulose has been used to make new materials for products including shoes [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Bacterial cellulose already has established niche applications in the food, cosmetic, paper and medical industries [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e], and has also been applied as an acoustic membrane in speakers [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. However, current processes to produce bacterial cellulose lack the efficiency needed to achieve the necessary levels of productivity to meet the demands of various industries.\\u003c/p\\u003e \\u003cp\\u003eBacterial cellulose has the potential to be produced via processes that can operate at scale and achieve the commercial viability needed. Key components of the production system are the organism used, the fermentation medium, and the fermentor, all of which interrelate and need to be optimised in tandem to reduce costs and increase yield. Notable examples where microorganisms are used industrially to produce high demand products by fermentation are the production of bioethanol by \\u003cem\\u003eSaccharomyces cerevisiae\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e] and the production of citric acid by \\u003cem\\u003eAspergillus niger\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Both of these originate from natural processes similarly to bacterial cellulose, and required optimisation to achieve commercial viability. Wild strains are typically sub-optimal as these have naturally evolved to produce only what is needed in response to the environment. Regulatory mechanisms are often present in wild strains that limit yields and make these strains unsuitable for industrial application. These are therefore a key target in strain optimisation work that is performed via genetic engineering when targets are known or via random mutagenesis coupled with selection and screening techniques when targeted engineering is unsuitable.\\u003c/p\\u003e \\u003cp\\u003eIn recent years, genetic engineering tools have become available for the most prolific species of cellulose-producing bacteria (belonging to the genera of \\u003cem\\u003eKomagataeibacter\\u003c/em\\u003e and \\u003cem\\u003eNovacetimonas\\u003c/em\\u003e) [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e] that open up the possibility of strain optimisation by targeted engineering in order to increase fermentation productivity. Efforts have been made to increase cellulose production through genetic engineering, including knock-out of glucose dehydrogenase that was reported to eliminate gluconic acid production and increase cellulose production up to 2.3-fold [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. In another study, two genes (\\u003cem\\u003ebcsC\\u003c/em\\u003e and \\u003cem\\u003ebcsD\\u003c/em\\u003e) of the bacterial cellulose synthase (\\u003cem\\u003ebcs\\u003c/em\\u003e) operon were overexpressed, resulting in \\u0026asymp;\\u0026thinsp;3-fold increase in cellulose yield [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. These examples demonstrate the potential for optimisation of this organism.\\u003c/p\\u003e \\u003cp\\u003eA key regulatory target is the post-translational regulation of cellulose synthase by cyclic-di-GMP (c-di-GMP). In wild strains where cellulose production is under regulatory control, cellulose synthase is inactive in the absence of the positive regulator c-di-GMP and depends on its presence for activity. Initial insights into the mechanism of c-di-GMP regulation of cellulose synthesis came from an early study that identified a protein that binds c-di-GMP and associates with cellulose synthase [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. A subsequent study showed the c-di-GMP binding functionality to be associated with the PilZ domain of cellulose synthase [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. A further study identified lysine and arginine residues beside the RXXXR motif to be involved in binding c-di-GMP [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. The mechanism of cellulose synthase regulation by c-di-GMP was further elucidated by an \\u003cem\\u003ein vitro\\u003c/em\\u003e study that demonstrated constitutively active cellulose synthase \\u003cem\\u003ein vitro\\u003c/em\\u003e when the arginine residue at the beginning of the RXXXR motif is mutated to alanine [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. This was shown to disrupt a salt bridge that forms between the arginine residue and a glutamate residue, that acts to tether a gating loop and block access to the active site in the absence of c-di-GMP. This salt bridge is broken upon c-di-GMP binding, causing a conformational change that unblocks the active site. The reported study revealed a key target: site-directed mutagenesis of the N-terminal arginine of the RXXXR motif to alanine to deregulate cellulose synthase at the post-translational level and enable constitutive activity regardless of c-di-GMP concentration. However, its demonstration was limited to \\u003cem\\u003ein vitro\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we isolated a cellulose-producing strain named NhDJU16 belonging to the species \\u003cem\\u003eNovacetimonas hansenii\\u003c/em\\u003e and engineered it to express cellulose synthase (BcsAB) with and without the arginine to alanine mutation previously demonstrated \\u003cem\\u003ein vitro\\u003c/em\\u003e to enable activity in the absence of c-di-GMP. We show \\u003cem\\u003ein vivo\\u003c/em\\u003e the effect of this mutation on bacterial cellulose production in both static and shake flask culture, and perform a time-course comparison of engineered strains expressing either native BcsAB or mutated BcsAB.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetermination of relative protein abundance of BcsAB to confirm expression in transformants\\u003c/h2\\u003e \\u003cp\\u003eTo confirm BcsAB expression at the protein-level in transformant strains, we determined the relative protein abundance of BcsAB in the wild-type and in transformants expressing native or mutated BcsAB (+/- R557A mutation). The \\u003cem\\u003ebcsAB\\u003c/em\\u003e gene already exists in the wild-type genome as part of the bacterial cellulose synthase operon, and BcsAB was detected in the wild-type protein extract, as expected. In comparison with the wild-type, we found the relative protein abundance of BcsAB to be \\u0026asymp;\\u0026thinsp;16.5-fold higher for the transformant expressing native BcsAB, and \\u0026asymp;\\u0026thinsp;11.4-fold higher for the transformant expressing mutated BcsAB (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). We considered this to be sufficient evidence to show successful BcsAB expression from the plasmid constructs present in the transformant strains. Any additional BcsAB present in the transformant expressing the mutated gene beyond the wild-type level must be the mutated version. BcsAB relative abundance was \\u0026asymp;\\u0026thinsp;1.5-fold higher when expressed from the native gene compared to the mutated gene, which may be due to suboptimal expression of the mutated gene due to the choice of codon for the mutated residue or due to regulatory mechanisms that compensate for the heightened activity of mutated BcsAB.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eComparing transformants expressing BcsAB +/- R557A mutation to determine effect on bacterial cellulose production\\u003c/h2\\u003e \\u003cp\\u003eTo determine the \\u003cem\\u003ein vivo\\u003c/em\\u003e effect of the R557A mutation, we compared transformants expressing native or mutated BcsAB in both static and shake flask fermentation and obtained data on both cellulose yield and cell dry weight. To capture any variation between different transformants, we tested three independent transformant strains for both native (bcsAB 1\\u0026ndash;3) and mutated (bcsABm 1\\u0026ndash;3) BcsAB. Overall, we found that independent transformants behaved similarly. Cellulose yield was significantly higher in both static and shake flask fermentation when mutated BcsAB was expressed compared to the native version (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). When mutated BcsAB was expressed, cellulose yield was \\u0026asymp;\\u0026thinsp;33% higher in static fermentation and \\u0026asymp;\\u0026thinsp;46% higher in shake flask fermentation. The greater difference in cellulose yield observed in shake flask fermentation between transformants expressing mutated and native BcsAB is of interest and may be due to the higher aeration in shake flask fermentation compared with static fermentation. In addition to cellulose yield, we also determined the levels of cell dry weight at the end of fermentation to see if these were affected by expression of mutated BcsAB. No difference in cell dry weight was observed at the end of static or shake flask fermentation when mutated BcsAB was expressed compared to native BcsAB (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). This suggests that the higher cellulose yield was specifically due to enhanced cellulose synthesis due to the presence of mutated BcsAB rather than a secondary effect that could be caused by increased bacterial growth. It should be noted that a negative effect on cellulose yield was observed when native BcsAB was expressed in comparison to the wild-type strain (\\u0026asymp;\\u0026thinsp;70% of wild-type level).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTime-course fermentation to compare transformants expressing BcsAB +/- R557A mutation\\u003c/h2\\u003e \\u003cp\\u003eTo compare transformants expressing native and mutated BcsAB more closely, we performed a time-course fermentation with selected transformants (bcsAB 1 and bcsABm 1) and monitored the changes in cellulose production, cell dry weight, and glucose concentration over time (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). The transformant expressing mutated BcsAB showed at least two-fold higher cellulose between days 1.5 and 2.5, however, this reduced to \\u0026asymp;\\u0026thinsp;30% more cellulose at later time-points. A significant difference in cell dry weight was also observed early on (around two-fold greater at day 2 when mutated BcsAB was expressed), and reduced to no difference towards the end of fermentation. The two transformants showed no significant difference in rate of glucose consumption despite different levels of cellulose production, suggesting that the flux of glucose to cellulose was higher when mutated BcsAB was expressed.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eTo achieve commercially viable bacterial cellulose production necessitates the disruption of regulatory mechanisms that otherwise limit cellulose yields. In this study, we expressed a deregulated variant of cellulose synthase (BcsAB) in a wild strain of cellulose-producing bacteria and observed heightened bacterial cellulose production. Activity of native cellulose synthase is dependent on the presence of the positive regulator c-di-GMP, while activity of the deregulated cellulose synthase was previously demonstrated to be constitutive when tested \\u003cem\\u003ein vitro\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Our \\u003cem\\u003ein vivo\\u003c/em\\u003e findings are consistent with \\u003cem\\u003ein vitro\\u003c/em\\u003e ones; however, the percentage increase in final cellulose yield we observed seemed relatively low (30\\u0026ndash;40%) suggesting that further interventions are needed to fully deregulate cellulose synthesis and achieve optimum productivity. Larger increases in cellulose yield were reported when the genes \\u003cem\\u003ebcsC\\u003c/em\\u003e and \\u003cem\\u003ebcsD\\u003c/em\\u003e were overexpressed (\\u0026asymp;\\u0026thinsp;3-fold increase) [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e] and when glucose dehydrogenase was knocked out (\\u0026asymp;\\u0026thinsp;2-fold increase) [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. We did, however, see\\u0026thinsp;\\u0026asymp;\\u0026thinsp;2-fold higher rate of cellulose production at earlier time-points (before day 2.5), therefore expression of mutated BcsAB significantly increased the rate of cellulose production leading to shorter fermentation time. The effect of expression of deregulated cellulose synthase reported in this study may be limited by an imbalance of Bcs components with abundance of BcsAB being too high due to overexpression, and subsequently this may have a negative effect by disrupting formation of complete Bcs complexes. Indeed, we observed a negative effect on cellulose yield when overexpressing native \\u003cem\\u003ebcsAB\\u003c/em\\u003e in comparison with the wild-type. Editing of the \\u003cem\\u003ebcs\\u003c/em\\u003e operon to mutate the \\u003cem\\u003ebcsAB\\u003c/em\\u003e gene may achieve a more pronounced effect on cellulose yield as the balance of Bcs components would remain unperturbed.\\u003c/p\\u003e \\u003cp\\u003eThis study highlights the importance of understanding the regulation of cellulose synthesis, and the need to target regulatory mechanisms in order to engineer an optimised strain. c-di-GMP is a key player in the regulation of cellulose production that may operate on other Bcs components and not solely the catalytic component BcsAB. It has been shown in \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e that the component BcsE binds c-di-GMP [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e] and has a regulatory role in the assembly of the Bcs complex [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]; however, this component has not been shown to exist in cellulose-producing species belonging to the \\u003cem\\u003eKomagataeibacter\\u003c/em\\u003e and \\u003cem\\u003eNovacetimonas\\u003c/em\\u003e genera and is limited to the type II \\u003cem\\u003ebcs\\u003c/em\\u003e operon present in \\u003cem\\u003eE. coli\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Further research on the regulation of cellulose synthesis and secretion may reveal additional targets to increase fermentation productivity.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eIn this study, we built on existing mechanistic understanding of cellulose synthase regulation by c-di-GMP that showed site-directed mutagenesis of BcsAB to be a clear target for deregulating cellulose synthesis. Previous studies showed mutated BcsAB to be constitutively active when tested \\u003cem\\u003ein vitro\\u003c/em\\u003e. We determined the effect \\u003cem\\u003ein vivo\\u003c/em\\u003e when mutated BcsAB is expressed and showed around two-fold increase in rate of cellulose production early in fermentation with final cellulose yield being at least 30% higher compared to when native BcsAB is expressed. Our work emphasises the need to understand the regulatory system that controls bacterial cellulose production, so that this can be effectively engineered to create an optimised cellulose-producing strain that can achieve commercially viable yields of bacterial cellulose.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of HS media\\u003c/h2\\u003e \\u003cp\\u003eHS medium [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e] was used for growth of cellulose-producing bacteria and in fermentation experiments. HS medium in this study was composed of 5 g/L yeast extract, 5 g/L bacteriological peptone, 20 g/L glucose (unless described otherwise), 2.7 g/L Na\\u003csub\\u003e2\\u003c/sub\\u003eHPO\\u003csub\\u003e4\\u003c/sub\\u003e anhydrous, and 1.5 g/L citric acid monohydrate. HS-agar medium was prepared by inclusion of 15 g/L agar in HS medium.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIsolation of cellulose-producing NhDJU16 strain\\u003c/h2\\u003e \\u003cp\\u003eThe cellulose-producing bacterial strain NhDJU16 was isolated from rotting apple. A sample of rotting apple was collected in a 50 mL Falcon tube by using a scalpel and spatula (sterilised by wiping with 70% ethanol). The sample was stored at 4\\u0026deg;C until use. To isolate the strain from rotting apple, an enrichment culture was performed by adding 20 mL selective medium to a 100 mL sterile shake flask to provide the necessary conditions to prevent the growth of competing microorganisms. Selective medium was prepared by adding 4% ethanol, 1% acetic acid, and 100 mg/L natamycin to HS medium. Ethanol and acetic acid were added after autoclaving from filter sterile stocks, and natamycin was added prior to autoclaving. Selective medium was wrapped in foil to protect from light and stored at 4\\u0026deg;C. A piece of rotting apple was placed in the flask containing selective medium. The enrichment culture was incubated at 30\\u0026deg;C with agitation at 200 rpm for 12 days. Bacterial cellulose was observed growing around the piece of rotting apple. Bacterial cellulose was extracted from the enrichment culture and transferred to a 7 mL Bijou tube. 75 \\u0026micro;l filter sterile cellulase (C2730-50ML, Merck) was then added to hydrolyse the cellulose and release bacteria into a cell suspension. The Bijou tube was incubated at 30\\u0026deg;C 200 rpm for 4 hours with the lid on loose but secure. The resulting cell suspension was used to prepare glycerol stocks by mixing equal volumes of 50% glycerol (filter sterile) and cell suspension. Glycerol stocks were stored at \\u0026minus;\\u0026thinsp;70\\u0026deg;C. To purify and isolate the NhDJU16 strain, one glycerol stock aliquot was thawed and diluted 1:10 with sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO. 100 \\u0026micro;l of diluted glycerol stock was plated on HS-agar (+\\u0026thinsp;1% acetic). The plate was incubated at 30\\u0026deg;C for 3 days. A single colony was picked from the plate using a sterile P10 tip and swirled in 1.5 mL HS medium (+\\u0026thinsp;1% acetic) in a 12-well plate to propagate the isolate and confirm its ability to produce bacterial cellulose. The 12-well plate was incubated at 30\\u0026deg;C for 3 days. Bacterial cellulose was visible at the surface of the culture. The contents of the well were transferred to a 7 mL Bijou tube. 75 \\u0026micro;l filter sterile cellulase (C2730-50ML, Merck) was then added and the tube was incubated at 30\\u0026deg;C 200 rpm for 3 hours with the lid on loose but secure. Equal volumes of 50% glycerol (filter sterile) and resulting cell suspension were mixed to make glycerol stock aliquots in sterile 1.5 mL Eppendorf tubes, which were stored at \\u0026minus;\\u0026thinsp;70\\u0026deg;C.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSpecies identification of NhDJU16\\u003c/h2\\u003e \\u003cp\\u003eThe NhDJU16 strain was identified as \\u003cem\\u003eNovacetimonas hansenii\\u003c/em\\u003e. Species identification was performed by sequence comparisons of the PCR amplified 16S-23S ITS region using genomic DNA as template. Genomic DNA (gDNA) was extracted from 2 mL NhDJU16 glycerol stock using the Wizard\\u0026reg; Genomic DNA purification kit (Promega) according to manufacturer's instructions. Centrifugation steps were performed at 16000 \\u003cem\\u003eg\\u003c/em\\u003e and the DNA pellet was rehydrated by the addition of 100 \\u0026micro;l nuclease free water. The 16S-23S ITS region was amplified by PCR using primers its1 and its2 (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) in a 50 \\u0026micro;l reaction containing 1 U Phusion DNA polymerase, 200 \\u0026micro;M dNTPs, HF buffer, 0.5 \\u0026micro;M primers, and 1 \\u0026micro;l gDNA. The PCR reaction was run on the following programme: 98\\u0026deg;C 2 minutes, then 30 cycles of 98\\u0026deg;C 10 seconds, 65\\u0026deg;C 10 seconds, 72\\u0026deg;C 15 seconds, then 72\\u0026deg;C 7 minutes, 10\\u0026deg;C forever. PCR clean-up was performed using the NucleoSpin\\u0026reg; PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. PCR product was sequenced by Eurofins (LightRun Tube service) using the its1 primer. The DNA sequence provided was blasted against known 16S-23S ITS sequences of \\u003cem\\u003eKomagataeibacter\\u003c/em\\u003e spp. and gave a top hit against \\u003cem\\u003eN. hansenii\\u003c/em\\u003e (formerly \\u003cem\\u003eK. hansenii\\u003c/em\\u003e) (99% identity, E-value 0).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eConstruction of pKoma-bcsAB and pKoma-bcsABm expression vectors\\u003c/h2\\u003e \\u003cp\\u003eThe expression vector (J23104-mRFP1-331Bb, Addgene plasmid #78274) developed as part of a genetic engineering toolkit for \\u003cem\\u003eK. rhaeticus\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e] was used in this study. This plasmid contains the constitutive promoter J23104 and mRFP reporter gene, and was named pKoma-mRFP in this work. The plasmid was received as a bacterial stab culture which was used to inoculate 5 mL LB containing 50 \\u0026micro;g/mL chloramphenicol in a 30 mL universal container. The culture was incubated at 37\\u0026deg;C 200 rpm overnight (\\u0026asymp;\\u0026thinsp;16 hours). Wizard\\u0026reg; Plus SV minipreps DNA purification kit (Promega) was used to isolate and purify the plasmid from the culture, according to the manufacturer's instructions. Inverse PCR was used to amplify the plasmid with the exclusion of mRFP. Prior to using the plasmid as template in inverse PCR, the plasmid was linearised by digestion with HpaI (NEB) in a 50 \\u0026micro;l reaction containing 500 ng pKoma-mRFP plasmid, rCutSmart buffer, and 5 U HpaI in a PCR tube. The reaction was incubated at 37\\u0026deg;C for 1 hour. The digested plasmid was purified using the NucleoSpin\\u0026reg; PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. Inverse PCR was performed in a 50 \\u0026micro;l reaction containing 1 U Phusion DNA polymerase, 200 \\u0026micro;M dNTPs, HF buffer, 0.5 \\u0026micro;M primers (pKoma_inv_fw and pKoma_inv_rv), and 3 ng HpaI-digested pKoma-mRFP plasmid as template. The inverse PCR reaction was run on the following programme: 98\\u0026deg;C 2 minutes, then 30 cycles of 98\\u0026deg;C 10 seconds, 63\\u0026deg;C 10 seconds, 72\\u0026deg;C 100 seconds, then 72\\u0026deg;C 7 minutes, 10\\u0026deg;C forever. PCR clean-up was performed using the NucleoSpin\\u0026reg; PCR clean-up kit (Macherey-Nagel) according to the manufacturer's instructions. The PCR product was subsequently used in In-Fusion\\u0026reg; HD cloning (Clontech) to construct the pKoma-bcsAB and pKoma-bcsABm vectors. The \\u003cem\\u003ebcsAB\\u003c/em\\u003e gene was cloned from NhDJU16 gDNA in two fragments (bcsAB_1 and bcsAB_2) that were subsequently joined by overlap extension (OE) PCR. Outer primers contained 15 bp tails (underlined) for In-Fusion\\u0026reg; HD cloning (Clontech), and inner primers contained 30 bp tails (underlined) for OE PCR. Site-directed mutagenesis was performed by using mutagenic inner primers (mutated bases in bold) to generate fragments bcsABm_1 and bcsABm_2 containing the desired mutation. bcsAB_1 and bcsABm_1 were amplified using the outer primer bcsAB_1_fw and the inner primers bcsAB_1_rv and bcsABm_1_rv respectively. bcsAB_2 and bcsABm_2 were amplified using the outer primer bcsAB_2_rv and the inner primers bcsAB_2_fw and bcsABm_2_fw respectively. 50 \\u0026micro;l PCR reactions contained 1 U Phusion DNA polymerase, 200 \\u0026micro;M dNTPs, HF buffer (for bcsAB_1 and bcsABm_1) or GC buffer (for bcsAB_2 and bcsABm_2), 0.5 \\u0026micro;M primers, 5% DMSO (for bcsAB_2 and bcsABm_2 only), and 50 ng NhDJU16 gDNA. The reactions were run on the following programme: 98\\u0026deg;C 2 minutes, then 30 cycles of 98\\u0026deg;C 10 seconds, 60\\u0026deg;C 10 seconds (for bcsAB_1 and bcsABm_1) or 65\\u0026deg;C 30 seconds (for bcsAB_2 and bcsABm_2), 72\\u0026deg;C 60 seconds (for bcsAB_1 and bcsABm_1) or 72\\u0026deg;C 100 seconds (for bcsAB_2 and bcsABm_2), then 72\\u0026deg;C 7 minutes, 10\\u0026deg;C forever. PCR clean-up was performed as described previously. 50 \\u0026micro;l OE PCR reactions contained 1 U Phusion DNA polymerase, 400 \\u0026micro;M dNTPs, GC buffer, 100 ng bcsAB_1 or bcsABm_1 fragment, 172.5 ng bcsAB_2 or bcsABm_2 fragment, and 5% DMSO. The reactions were run on the following programme: 94\\u0026deg;C 5 minutes, then 30 cycles of 94\\u0026deg;C 30 seconds, 72\\u0026deg;C 130 seconds, then 72\\u0026deg;C 7 minutes, 10\\u0026deg;C forever. PCR clean-up was performed as described previously. The purified PCR products bcsAB and bcsABm were then used in In-Fusion\\u0026reg; HD cloning (Clontech) to construct the pKoma-bcsAB and pKoma-bcsABm vectors. Transformation was performed using StrataClone SoloPack competent cells (Agilent Technologies) according to the manufacturer's instructions. Transformed cells were plated on LB containing 50 \\u0026micro;g/mL chloramphenicol. Transformant colonies were grown in 5 mL LB containing 50 \\u0026micro;g/mL chloramphenicol in 30 mL universal containers. Transformants were screened by PCR using primers pKoma-bcsAB_fw and pKoma-bcsAB_rv in 10 \\u0026micro;l PCR reactions containing 0.2 U Phusion DNA polymerase, 200 \\u0026micro;M dNTP, HF buffer, 0.5 \\u0026micro;M primers, and 1 \\u0026micro;l culture (diluted 1:50). The reactions were run on the following programme: 98\\u0026deg;C 2 minutes, then 30 cycles of 98\\u0026deg;C 10 seconds, 65\\u0026deg;C 10 seconds, 72\\u0026deg;C 15 seconds, then 72\\u0026deg;C 7 minutes, 10\\u0026deg;C forever. Plasmid was isolated and purified from positive transformants using the Wizard\\u0026reg; Plus SV minipreps DNA purification kit (Promega), according to the manufacturer's instructions. Plasmid integrity was confirmed by whole plasmid sequencing (Plasmidsaurus).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers used in this work.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer sequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eits1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-ACCTGCGGCTGGATCACCTCC-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eits2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-CCGAATGCCCTTATCGCGCTC-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003epKoma_inv_fw\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-ATCGCTACTAGAGCCAGGCA-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003epKoma_inv_rv\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-TCACTAGTAGCTAGCACAATACCT-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsAB_1_fw\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGCTAGCTACTAGTGA\\u003c/span\\u003eTTATGCCAGAGGTTCGGTCG-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsAB_1_rv\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eTTCCACCGGGATAGTTGCGGGGATGCGATG\\u003c/span\\u003eACTGTTGCGTTTCTGCTGTG-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsABm_1_rv\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eTTCCACCGGGATAGTTGCGGGGATGCGATG\\u003c/span\\u003eACTGTTG\\u003cb\\u003eGC\\u003c/b\\u003eTTTCTGCTGTG-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsAB_2_fw\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGGGCGTGAAACACAGCAGAAACGCAACAGT\\u003c/span\\u003eCATCGCATCCCCGCAACTAT-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsABm_2_fw\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGGGCGTGAAACACAGCAGAAA\\u003c/span\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eGC\\u003c/span\\u003e\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eCAACAGT\\u003c/span\\u003eCATCGCATCCCCGCAACTAT-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebcsAB_2_rv\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGGCTCTAGTAGCGAT\\u003c/span\\u003eGCAGGTCGTTGCGAGAAGA-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003epKoma-bcsAB_fw\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-GTCGGCCTGTTGGGATGTAT-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003epKoma-bcsAB_rv\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-GGAACCTCTTACGTGCCGAT-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTransformation of NhDJU16 by electroporation\\u003c/h2\\u003e \\u003cp\\u003eNhDJU16 was transformed with plasmids pKoma-bcsAB and pKoma-bcsABm by electroporation using an established protocol [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e] with modifications. Electrocompetent cells were prepared by growing bacteria on HS-agar (+\\u0026thinsp;1% acetic acid) in the presence of cellulase. One plate was inoculated with 100 \\u0026micro;l glycerol stock in one spot, and 140 \\u0026micro;l sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO plus 10 \\u0026micro;l filter sterile cellulase (C2730-50ML, Merck) in another spot. These were mixed together with a spreader and spread evenly. The plate was incubated at 30\\u0026deg;C for 1 day. Bacteria were harvested by using sterile cotton wool buds. Buds covered in bacteria were dipped in 14 mL 1 mM filter sterile HEPES buffer (pH 7) in a 15 mL Falcon tube, and were pressed against the sides of the tube to release bacteria into suspension. The resulting cell suspension was centrifuged at 4600 rpm 5 minutes in a Multifuge 3 SR benchtop centrifuge (Heraeus). The supernatant was discarded and the cells were resuspended in 1 mL 15% glycerol (filter sterile), and then diluted with 15% glycerol to an OD\\u003csub\\u003e600\\u003c/sub\\u003e of 2.8. The resulting cell suspension was split into 100 \\u0026micro;l aliquots in sterile 1.5 mL Eppendorf tubes and these were stored at \\u0026minus;\\u0026thinsp;70\\u0026deg;C. For electroporation, plasmids and electrocompetent cells were thawed at room temperature. 2 \\u0026micro;l plasmid was added to 100 \\u0026micro;l electrocompetent cells and mixed by swirling using a sterile P10 tip, then transferred to a 2 mm electrocuvette (FB102, Fisher Scientific). The electroporator (Gene Pulser II with the Pulse Controller PLUS and Capacitance Extender PLUS modules, Bio-Rad) was configured to 2.5 kV, 400 Ohm resistance, and 25 \\u0026micro;F capacitance. One pulse lasting\\u0026thinsp;\\u0026asymp;\\u0026thinsp;10 ms was applied to each electrocuvette. 800 \\u0026micro;l HS medium and 1.6 \\u0026micro;l filter sterile cellulase (C2730-50ML, Merck) (pre-mixed in a 15 mL Falcon tube) were then added to the electrocuvette, mixed by pipetting up and down, and transferred to a 15 mL Falcon tube. 15 mL Falcon tubes containing electroporated cells were incubated at 30\\u0026deg;C 140 rpm overnight (\\u0026asymp;\\u0026thinsp;17 h) with lids on loose but secure. Overnight cultures were centrifuged at 4600 rpm 5 minutes in a Multifuge 3 SR benchtop centrifuge (Heraeus). Supernatant was discarded and cells were resuspended in 200 \\u0026micro;l sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO. 100 \\u0026micro;l was plated on HS-agar containing 340 \\u0026micro;g/mL chloramphenicol. Plates were incubated at 30\\u0026deg;C for 3 days. Transformant colonies were picked using sterile P200 tips and placed in 100 \\u0026micro;l sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO in sterile 1.5 mL Eppendorf tubes, then mixed up and down by pipetting. The resulting cell suspensions were diluted 1:1000 with sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO and 100 \\u0026micro;l was then plated on HS-agar (+\\u0026thinsp;1% acetic acid, +\\u0026thinsp;340 \\u0026micro;g/mL chloramphenicol). Plates were incubated at 30\\u0026deg;C for 3 days. Purified transformant colonies were picked and resuspended in sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO as described previously. The resulting cell suspensions were plated on HS-agar (+\\u0026thinsp;1% acetic acid, +\\u0026thinsp;340 \\u0026micro;g/mL chloramphenicol) to which cellulase was added as described previously. Plates were incubated at 30\\u0026deg;C for 2 days. Bacteria were harvested from plates using sterile cotton wool buds as described previously. Cells were released into 1 mL sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO in sterile 1.5 mL Eppendorf tubes, from which glycerol stocks were prepared as described previously.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetermination of relative protein abundance of BcsAB\\u003c/h2\\u003e \\u003cp\\u003eTo determine the relative protein abundance of BcsAB and compare between wild-type and transformant strains, samples of protein extract were prepared from bacterial cellulose grown in static fermentation. 10 mL static fermentations were performed in 25 cm\\u003csup\\u003e2\\u003c/sup\\u003e cell culture flasks (430639, Corning\\u0026reg;). 10 mL HS medium containing 40 g/L glucose was added to each flask, to which acetic and chloramphenicol (in ethanol) were added to give final concentrations of 1% and 340 \\u0026micro;g/mL respectively. In the case of the wild-type, chloramphenicol was omitted and ethanol was added instead to a final concentration of 1% to match the ethanol concentration in cultures containing chloramphenicol. The flasks were inoculated to give an OD\\u003csub\\u003e600\\u003c/sub\\u003e of 0.01, and were incubated at 30\\u0026deg;C for 3 days. 25 \\u0026micro;l filter sterile cellulase (C2730-50ML, Merck) was then added, followed by incubation at 30\\u0026deg;C 140 rpm for 90 minutes to hydrolyse cellulose and release cells into suspension. Cell suspension was then transferred to 15 mL Falcon tubes and centrifuged at 3900 rpm 5 minutes in a benchtop centrifuge (Centrifuge 5810 R; Eppendorf). Cells were resuspended in 10 mL of 100 mM Tris.HCl buffer (pH 7.5), then centrifuged again. Washed cells were resuspended in 10 mL lysis buffer containing 510 g/L urea, 0.2% SDS, 2% Triton-X-100, 10 g/L dithiothreitol (DTT), 2% Pharmalyte\\u0026reg; 3\\u0026ndash;10 (Cytiva), and cOmplete\\u0026trade; mini protease inhibitor cocktail (Roche) (one tablet per 10 mL) in Milli-Q\\u0026reg; water. Cells were incubated in lysis buffer for 20 minutes at room temperature, then centrifuged 3500 rpm 5 minutes. 1 mL of supernatant was transferred to a 1.5 mL Eppendorf tube and stored at \\u0026minus;\\u0026thinsp;20\\u0026deg;C. Samples were sent to the University of York Technology Facility for determination of relative protein abundance. In brief, samples were digested with Glu-C protease using an S-trap mediated protocol. Resulting peptides were analysed by PASEF-DIA using an EvoSep One UPLC for peptide separation with a 15 cm Performance C18 column and a 30 SPD gradient. Data were acquired on a TimsTOF-HT mass spectrometer, using a 1.1 s cycle and 25 m/z windows between 400\\u0026ndash;1201 m/z for DIA. Data were searched against NhDJU16 protein sequences including native BcsAB and mutated BcsAB.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatic and shake flask fermentation to produce bacterial cellulose\\u003c/h2\\u003e \\u003cp\\u003e10 mL static fermentations were performed in 25 cm\\u003csup\\u003e2\\u003c/sup\\u003e cell culture flasks (430639, Corning\\u0026reg;) and 20 mL shake flask fermentations were performed in 100 mL shake flasks. HS medium containing 40 g/L glucose and 1% acetic acid was used except in the time-course fermentation where glucose concentration was reduced to 20 g/L. For transformant strains, chloramphenicol (in ethanol) was added to a final concentration of 340 \\u0026micro;g/mL. For the wild-type, ethanol was added to a final concentration of 1% to match the ethanol present in cultures containing chloramphenicol. Inoculum was added to give an OD\\u003csub\\u003e600\\u003c/sub\\u003e of 0.01. Fermentations were incubated at 30\\u0026deg;C. Shake flask fermentations were agitated at 250 rpm.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetermination of cellulose, cell dry weight, and glucose\\u003c/h2\\u003e \\u003cp\\u003eFlask contents were transferred to 50 mL Falcon tubes and centrifuged at 3900 rpm 5 minutes (Centrifuge 5810 R; Eppendorf). Supernatant for glucose measurement was transferred to a 1.5 mL Eppendorf tube, diluted 1:100 with sterile dH\\u003csub\\u003e2\\u003c/sub\\u003eO, and stored at \\u0026minus;\\u0026thinsp;20\\u0026deg;C. Glucose was determined using an enzymatic assay kit (K-GLUC; Megazyme). Remaining supernatant in 50 mL Falcon tubes was discarded, and bacterial cellulose samples were then subjected to a wash cycle (up to 40 mL with dH\\u003csub\\u003e2\\u003c/sub\\u003eO, incubation at 30\\u0026deg;C 140 rpm 30 minutes with tubes horizontal, centrifugation at 3900 rpm 5 minutes, discarding of supernatant). The wash cycle was performed 4\\u0026ndash;6 times in order to remove any residual medium leaving only cellulose and bacteria. The washed bacterial cellulose samples were dried at 70\\u0026deg;C to constant weight (2\\u0026ndash;3 days) and weighed on a fine balance to determine the weight of cellulose\\u0026thinsp;+\\u0026thinsp;bacteria. 50 mL Falcon tubes containing dried bacterial cellulose were then made up to 50 mL with 0.1 M NaOH and incubated at 70\\u0026deg;C for 1 day to remove bacteria. The NaOH was then discarded and NaOH-treated cellulose samples were subjected to a wash cycle (up to 40 mL with dH\\u003csub\\u003e2\\u003c/sub\\u003eO, incubation at 30\\u0026deg;C 140 rpm 30 minutes with tubes horizontal, discarding of wash) two times, followed by drying at 70\\u0026deg;C to constant weight. Dried cellulose samples were weighed on a fine balance to determine the weight of cellulose. Cell dry weight was determined by subtracting the weight of cellulose from the weight of cellulose\\u0026thinsp;+\\u0026thinsp;bacteria.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Biotechnology and Biological Sciences Research Council (BBSRC) [Grant Number BB/T017023/1], the Engineering and Physical Sciences Research Council (EPSRC) [Grant Number EP/V011766/1] through the Textiles Circularity Centre, and the University of York through an EPSRC IAA award.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDJU conceptualised the study, performed the experiments, and wrote the original draft of the manuscript. HE assisted with establishing the methodology to transform cellulose-producing bacteria by electroporation. AG helped in molecular biology work to construct the plasmids. AL and NCB supervised the work, and reviewed and edited the manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe are thankful to Simon McQueen-Mason (deceased) for obtaining the funding to support this work, and for his early supervision of the work.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eGupta PK, Raghunath SS, Prasanna DV, Venkat P, Shree V, Chithananthan C, Choudhary S, Surender K, Geetha K. An update on overview of cellulose, its structure and applications. Cellulose. 2019;201:84727.\\u003c/li\\u003e\\n \\u003cli\\u003eChen S, Zhu L, Sun L, Huang Q, Zhang Y, Li X, Ye X, Li Y, Wang L. A systematic review of the life cycle environmental performance of cotton textile products. Sci Total Environ. 2023;24:163659.\\u003c/li\\u003e\\n \\u003cli\\u003eShen L, Worrell E, Patel MK. Environmental impact assessment of man-made cellulose fibres. Resour Conserv Recy. 2010;55:260-74.\\u003c/li\\u003e\\n \\u003cli\\u003eVan Oel PR, Hoekstra AY. Towards quantification of the water footprint of paper: a first estimate of its consumptive component. Int Ser Prog Wat Res. 2012;26:733-49.\\u003c/li\\u003e\\n \\u003cli\\u003eSun M, Wang Y, Shi L. Environmental performance of straw-based pulp making: A life cycle perspective. Sci Total Environ. 2018;616:753-62.\\u003c/li\\u003e\\n \\u003cli\\u003eMukherjee S. Environmental and social impact of fashion: Towards an eco-friendly, ethical fashion. Int J Interdiscip. 2015;2:22-35.\\u003c/li\\u003e\\n \\u003cli\\u003eDelate K, Heller B, Shade J. Organic cotton production may alleviate the environmental impacts of intensive conventional cotton production. Renew Agr Food Syst. 2021;36:405-12.\\u003c/li\\u003e\\n \\u003cli\\u003eGuo S, Li X, Zhao R, Gong Y. Comparison of life cycle assessment between lyocell fiber and viscose fiber in China. Int J Life Cycle Ass. 2021;26:1545-55.\\u003c/li\\u003e\\n \\u003cli\\u003eLeal Filho W, Perry P, Heim H, Dinis MA, Moda H, Ebhuoma E, Pa\\u0026ccedil;o A. An overview of the contribution of the textiles sector to climate change. Front Environ Sci. 2022;10:973102.\\u003c/li\\u003e\\n \\u003cli\\u003eBailey K, Basu A, Sharma S. The environmental impacts of fast fashion on water quality: a systematic review. Water-Sui. 2022;14:1073.\\u003c/li\\u003e\\n \\u003cli\\u003eFrazier RM, Vivas KA, Azuaje I, Vera R, Pifano A, Forfora N, Jameel H, Ford E, Pawlak JJ, Venditti R, Gonzalez R. Beyond Cotton and Polyester: An Evaluation of Emerging Feedstocks and Conversion Methods for the Future of Fashion Industry. J Bioresour Bioprod. 2024;4.\\u003c/li\\u003e\\n \\u003cli\\u003eGschwandtner C. Outlook on Global Fiber Demand and Supply 2030. Growth. 2022;65:113.\\u003c/li\\u003e\\n \\u003cli\\u003eZhong C. Industrial-scale production and applications of bacterial cellulose. Front Bioeng Biotechnol. 2020;8:605374.\\u003c/li\\u003e\\n \\u003cli\\u003eMelton L. Cellulose shoes made by bacteria. Nat Biotechnol. 2022;40:1163.\\u003c/li\\u003e\\n \\u003cli\\u003eBlanco Parte FG, Santoso SP, Chou CC, Verma V, Wang HT, Ismadji S, Cheng KC. Current progress on the production, modification, and applications of bacterial cellulose. Crit Rev Biotechnol. 2020;40:397-414.\\u003c/li\\u003e\\n \\u003cli\\u003eMohite BV, Patil SV. A novel biomaterial: bacterial cellulose and its new era applications. Biotechnol Appl Bioc. 2014;61.\\u003c/li\\u003e\\n \\u003cli\\u003eJacobus AP, Gross J, Evans JH, Ceccato-Antonini SR, Gombert AK. \\u003cem\\u003eSaccharomyces cerevisiae\\u003c/em\\u003e strains used industrially for bioethanol production. Essays Biochem. 2021;65:147-61.\\u003c/li\\u003e\\n \\u003cli\\u003eTse TJ, Wiens DJ, Reaney MJ. Production of bioethanol\\u0026mdash;A review of factors affecting ethanol yield. Fermentation. 2021;7:268.\\u003c/li\\u003e\\n \\u003cli\\u003eCairns TC, Barthel L, Meyer V. Something old, something new: challenges and developments in \\u003cem\\u003eAspergillus niger\\u003c/em\\u003e biotechnology. Essays Biochem. 2021;65:213-24.\\u003c/li\\u003e\\n \\u003cli\\u003eKsiążek E. Citric Acid: Properties, Microbial Production, and Applications in Industries. Molecules. 2023;29:22.\\u003c/li\\u003e\\n \\u003cli\\u003eUpton DJ, McQueen-Mason SJ, Wood AJ. An accurate description of \\u003cem\\u003eAspergillus niger\\u003c/em\\u003e organic acid batch fermentation through dynamic metabolic modelling. Biotechnol Biofuels. 2017;10:1-4.\\u003c/li\\u003e\\n \\u003cli\\u003eFlorea M, Hagemann H, Santosa G, Abbott J, Micklem CN, Spencer-Milnes X, de Arroyo Garcia L, Paschou D, Lazenbatt C, Kong D, Chughtai H. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain. P Natl Acad Sci USA. 2016;113:E3431-40.\\u003c/li\\u003e\\n \\u003cli\\u003eLiu LP, Yang X, Zhao XJ, Zhang KY, Li WC, Xie YY, Jia SR, Zhong C. A lambda Red and FLP/FRT-mediated site-specific recombination system in \\u003cem\\u003eKomagataeibacter xylinus\\u003c/em\\u003e and its application to enhance the productivity of bacterial cellulose. ACS Synth Biol. 2020;9:3171-80.\\u003c/li\\u003e\\n \\u003cli\\u003eGoosens VJ, Walker KT, Aragon SM, Singh A, Senthivel VR, Dekker L, Caro-Astorga J, Buat ML, Song W, Lee KY, Ellis T. \\u003cem\\u003eKomagataeibacter\\u003c/em\\u003e tool kit (KTK): a modular cloning system for multigene constructs and programmed protein secretion from cellulose producing bacteria. ACS Synth Biol. 2021;10:3422-34.\\u003c/li\\u003e\\n \\u003cli\\u003eKuo CH, Teng HY, Lee CK. Knock-out of glucose dehydrogenase gene in \\u003cem\\u003eGluconacetobacter xylinus\\u003c/em\\u003e for bacterial cellulose production enhancement. Biotechnol Bioproc E. 2015;20:18-25.\\u003c/li\\u003e\\n \\u003cli\\u003eYang L, Zhu X, Chen Y, Wang J. Enhanced bacterial cellulose production in \\u003cem\\u003eGluconacetobacter xylinus\\u003c/em\\u003e by overexpression of two genes (\\u003cem\\u003ebscC\\u003c/em\\u003e and \\u003cem\\u003ebcsD\\u003c/em\\u003e) and a modified static culture. Int J Biol Macromol. 2024;260:129552.\\u003c/li\\u003e\\n \\u003cli\\u003eWeinhouse H, Sapir S, Amikam D, Shilo Y, Volman G, Ohana P, Benziman M. c‐di‐GMP‐binding protein, a new factor regulating cellulose synthesis in \\u003cem\\u003eAcetobacter xylinum\\u003c/em\\u003e. FEBS Lett. 1997;416:207-11.\\u003c/li\\u003e\\n \\u003cli\\u003eRyjenkov DA, Simm R, Römling U, Gomelsky M. The PilZ domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria. J Biol Chem. 2006;281:30310-4.\\u003c/li\\u003e\\n \\u003cli\\u003eFujiwara T, Komoda K, Sakurai N, Tajima K, Tanaka I, Yao M. The c-di-GMP recognition mechanism of the PilZ domain of bacterial cellulose synthase subunit A. Biochem Bioph Res Co. 2013;431:802-7.\\u003c/li\\u003e\\n \\u003cli\\u003eMorgan JL, McNamara JT, Zimmer J. Mechanism of activation of bacterial cellulose synthase by cyclic di-GMP. Nat Struct Mol Biol. 2014;21:489-96.\\u003c/li\\u003e\\n \\u003cli\\u003eFang X, Ahmad I, Blanka A, Schottkowski M, Cimdins A, Galperin MY, R\\u0026ouml;mling U, Gomelsky M. GIL, a new c‐di‐GMP‐binding protein domain involved in regulation of cellulose synthesis in enterobacteria. Mol Microbiol. 2014;93:439-52.\\u003c/li\\u003e\\n \\u003cli\\u003eZouhir S, Abidi W, Caleechurn M, Krasteva PV. Structure and multitasking of the c-di-GMP-sensing cellulose secretion regulator BcsE. Mbio. 2020;11:10-128.\\u003c/li\\u003e\\n \\u003cli\\u003eR\\u0026ouml;mling U, Galperin MY. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions. Trends Microbiol. 2015;23:545-57.\\u003c/li\\u003e\\n \\u003cli\\u003eHestrin S, Schramm MJ. Synthesis of cellulose by \\u003cem\\u003eAcetobacter xylinum\\u003c/em\\u003e. 2. Preparation of freeze-dried cells capable of polymerizing glucose to cellulose. Biochem J. 1954;58:345.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"bacterial cellulose, cellulose synthase, BcsAB, Novacetimonas hansenii, fermentation, cyclic-di-GMP\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4418931/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4418931/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cb\\u003eBackground\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eBacterial cellulose produced via fermentation is a promising alternative to plant-derived cellulose with the potential to provide a sustainable source of cellulose with a significantly lower environmental footprint than unsustainable sources of cellulose such as wood pulp. Optimisation of the production system is needed to raise productivity and achieve commercial viability. The organism used is a key component of this system and a key target for optimisation by strain development procedures. Wild strains of cellulose-producing bacteria regulate their cellulose synthesis in response to the environment. Deregulation of cellulose synthesis is necessary to achieve higher yields. A key regulatory target for strain engineering is the post-translational deregulation of cellulose synthase that is regulated by cyclic-di-GMP. It has been demonstrated \\u003cem\\u003ein vitro\\u003c/em\\u003e that mutating the N-terminal arginine residue of the RXXXR motif creates a constitutively active cellulose synthase, but its \\u003cem\\u003ein vivo\\u003c/em\\u003e effect has not yet been explored.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eResults\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigate the effect of mutating the N-terminal arginine residue of the RXXXR motif \\u003cem\\u003ein vivo\\u003c/em\\u003e with a wild strain of cellulose-producing bacteria isolated in this work. We show heightened bacterial cellulose production in both static and shake flask fermentation when mutated cellulose synthase is expressed compared to when native cellulose synthase is expressed.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eConclusions\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eOur work shows for the first time to our knowledge the \\u003cem\\u003ein vivo\\u003c/em\\u003e effect when the deregulated mutant variant of cellulose synthase is expressed. This work builds on previous studies and furthers progress towards the goal of creating an optimised cellulose-producing strain capable of commercially viable bacterial cellulose production. The work also highlights the importance of elucidating and disrupting the regulatory mechanisms that govern cellulose synthesis, and the challenging nature of this field.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Deregulation of cellulose synthesis by site-directed mutagenesis of cellulose synthase leads to heightened bacterial cellulose production\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-05-22 04:56:39\",\"doi\":\"10.21203/rs.3.rs-4418931/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6c113387-08af-4ec9-be3e-5bf813907c56\",\"owner\":[],\"postedDate\":\"May 22nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-06-12T16:12:24+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-05-22 04:56:39\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4418931\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4418931\",\"identity\":\"rs-4418931\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}