{"paper_id":"e7faf45d-4e36-4797-91a7-275e3e6fb4bb","body_text":"Engineered hematopoietic stem cells give rise to therapeutic antibody secreting B cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Biological Sciences - Article Engineered hematopoietic stem cells give rise to therapeutic antibody secreting B cells Matthew Porteus, Sofia Luna, William Feist, Ashley Utz, Jumana Afaghani, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9269825/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Monoclonal antibodies represent half of the top ten selling drugs. Their proven efficacy, however, generally requires repeated administration for prolonged periods of time. In contrast, cell-based therapies offer a different set of pharmacokinetics and pharmacodynamics than traditional medicines, including the potential to have lifetime durability after a single infusion. Here, we describe a genome-engineered stem cell-based platform for continuous antibody production from a single dose. Using CRISPR/Cas9 homology-directed repair mediated editing, we precisely integrated therapeutic antibody expression cassettes into a safe-harbor locus of hematopoietic stem and progenitor cells (HSPCs). Upon differentiation, these gene-targeted HSPCs generate B cells that secrete monoclonal antibodies. We validated this platform using two clinically approved antibodies, achieving efficient targeted integration of the gene-targeted antibodies (GT-Ab) in human HSPCs that successfully engraft in immunodeficient mice. Direct engineering of human B cells demonstrated robust secretion of therapeutic antibodies. To evaluate in vivo antibody production, we transplanted engineered GT-Ab murine HSPCs into immunocompetent mice, achieving durable serum antibody concentrations within the therapeutic range over several months. Lastly, by fusing the antibody to a destabilization domain, we enabled tunable antibody secretion via small molecule regulation. This modular platform establishes a potentially curative approach for chronic diseases currently reliant on repeated antibody administration, offering durable antibody production from a single treatment. Biological sciences/Stem cells/Haematopoietic stem cells Biological sciences/Biotechnology/Stem-cell biotechnology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Therapeutic monoclonal antibodies have revolutionized the treatment of a broad spectrum of diseases, including cancer, autoimmune disorders, and infectious diseases. Beginning with the approval of the first monoclonal antibody by the United States Food and Drug Administration (US FDA) in 1986 1 , the number of clinically-approved therapeutic antibodies has grown at an astounding pace that has only accelerated in recent years 2 . As of 2024, there were over one hundred clinically-approved antibodies in the US that act on approximately one hundred distinct pharmacological targets 3 . This has led to the market size of therapeutic antibodies to reach nearly $250 billion in 2023 with a projected growth to >$400 billion by 2028 4 . While therapeutic antibodies have proven to address many needs that prior drug modalities (i.e. small molecules) were unable to, we are now in a new era of cell-based medicines to treat and cure disease. The advantage of cell-based medicines is they have entirely different pharmacokinetic and pharmacodynamic properties compared to traditional medicines, including the ability to proliferate, respond to signals, and migrate into tissues 5 . They also have the potential for long term durability in patients, even for a lifetime if a stem cell is transplanted. With the advances in genome-editing of human cells we can now create a broader class of cell-based medicines by engineering cells with completely new biologic functions. One application of this approach is to modify cells to secrete therapeutic biologic proteins (i.e. antibodies, enzymes, cytokines, hormones). Monoclonal antibodies are a particularly compelling target due to their conserved framework yet variable specificity that supports easy adaption to a broad range of clinical uses. Despite their proven success, therapeutic antibodies require repeated administration of high bolus doses every 2-4 weeks to maintain their efficacy 6 . Highlighting the need for a long-term delivery platform, there have been several strategies that aim to deliver monoclonal antibodies continuously. First, antibody gene therapy involves the in vivo gene transfer of an antibody sequence, most successfully through recombinant viral vectors 7 . Although antibody gene therapy addresses some of the problems associated with traditional antibody injection, there still remain large obstacles such as preexisting immunity to viral vectors and loss of expression over time, which has hampered its clinical development 8 . Cell-based strategies for delivery of antibodies have primarily focused on editing of autologous B cells for antibody expression 9–13 . B cells are an optimal choice for antibody production since they are the immune system’s endogenous specialized antibody secreting lineage. However, engineered B cells face significant translational hurdles as standardized clinical protocols for B cell transplantation are lacking, and long-term evidence on their persistence in humans remains unproven. Conversely, hematopoietic stem cell transplant (HSCT) is a well-established clinical procedure that has proven to have lifelong durability 14 . Thus, we have developed a genetically engineered cell-based therapy that would enable continuous antibody production from a single dose of autologous hematopoietic stem and progenitor cells (HSPCs). Using CRISPR/Cas9 homology directed repair (HDR) mediated editing, we engineer HSPCs that will give rise to mature B cells capable of secreting a therapeutic antibody of interest. By modifying the HSPC we take advantage of the stem cell’s established ability to engraft and repopulate the blood system 14 and build on past success of using CRISPR/Cas9 engineered HSPCs for the treatment of disease 15 . However, we aim to restrict antibody expression to the B cell lineage in order to harness its professional ability for antibody secretion – particularly in terminally differentiated plasma cells, which can produce thousands of antibodies per second 16,17 . This strategy also leaves other hematopoietic lineages, including the hematopoietic stem cell (HSC) itself, unperturbed, minimizing any consequences of antibody expression from other cell types. We employ precision CRISPR/Cas9 genome-editing to specifically target the therapeutic antibody expression cassette to a previously established genomic safe-harbor site, CCR5 18 , and use a synthetic B cell promoter for antibody expression. By targeting a safe-harbor locus and leaving the endogenous immunoglobulin loci intact, therapeutic antibodies act as passengers in B cell development. We establish proof of concept for this system with two clinically-approved monoclonal antibodies, an anti-PCSK9 antibody for hypercholesterolemia 19 and an anti-TNFα antibody for autoimmune disease 20 . In this study, we demonstrate high efficiency targeted integration of GT-Abs in human HSPCs that engraft in immunodeficient mice. We then demonstrate that GT-Ab human B cells and transplanted GT-Ab murine HSCs produce strong expression of both therapeutic antibodies in vitro and in vivo , respectively. Importantly, in vivo antibody concentrations reach levels necessary for therapeutic efficacy in humans. Finally, we showcase the ability to regulate antibody expression via a small molecule to improve the safety of this therapy. Altogether, here we show use of a HSPC engineering platform that enables continuous antibody production from derived B cells, offering a versatile system into which any antibody – currently available or developed in the future – could be easily integrated. Results Efficient targeting of therapeutic antibody expression cassettes to a safe-harbor locus in human HSPCs The need for repeated administration of therapeutic antibodies led us to develop a genome-engineering strategy enabling continuous cell-based antibody production. In order to express antibodies from a single transcript and reduce mispairing with endogenously expressed antibodies, we utilize a peptide linker to physically pair the light and heavy chain of the antibody 21 . To confirm that functional antibodies can be produced with the linker, each antibody was produced either in the traditional manner using separate plasmids to deliver the light and heavy chain or with one plasmid to deliver the light and heavy chains paired by the peptide linker (Extended Data Fig. 1a). Production of purified antibodies with or without linker was confirmed at the expected molecular weights via western blot analysis for IgG (Extended Data Fig. 1b) and linker antibodies demonstrated comparable activity to their traditional counterparts in antigen-specific functional assays (LDLR expression for anti-PCSK9; TNFa neutralization for anti-TNFa) (Extended Data Fig. 1c,d). We used a single-guide RNA (sgRNA) that specifically targets the human CCR5 safe harbor locus that was previously validated to achieve high efficiency HDR editing in primary human CD34 + HSPCs 22,23 . When used with high-fidelity Cas9 24 this sgRNA was found to have no measurable insertions/deletions (indels) in the top in silico predicted off-target sites 22,23 . To deliver gene-targeted antibody (GT-Ab) donors, adeno-associated virus serotype 6 (AAV6) donor repair templates were designed for therapeutic antibody expression (Fig. 1a). For strong expression in the B cell lineage, antibody expression is driven through a previously described synthetic B cell promoter, the EEK promoter, comprised of human immunoglobulin promoter and enhancer elements 25 . Driving monoclonal antibody expression specifically within the B cell lineage using this promoter has potential efficacy advantages because B lineage cells are the natural producers of high levels of antibody with species-specific glycosylation patterns. It also confers potential safety advantages because the monoclonal antibody will not be produced in other cell types. Primary CD34 + cells were edited via electroporation with ribonucleoprotein (RNP) followed by transduction with AAV6 (2500 vector genomes (vg)/cell) carrying the anti-PCSK9 antibody (GT-Ab PCSK9 ) or the anti-TNFα antibody (GT-Ab TNFα ) sequence. We achieved high targeted integration frequencies of approximately 35% edited alleles in umbilical cord-blood (CB) derived CD34 + cells and 24% in adult peripheral blood derived CD34 + cells in both gene-targeted conditions as measured by in-out droplet digital PCR (ddPCR) (Fig. 1b). To assess the impact of GT-Ab engineering on HSPC proliferation and differentiation capacity, we performed a colony forming unit (CFU) assay and demonstrated distribution of colonies between the major subtypes was not impeded by GT-Ab edited cells relative to mock (electroporation only) edited cells (Fig. 1c). We observed a decrease in total colony formation that was consistent with prior reports of RNP/AAV6 HDR-based editing 26–28 (Fig. 1d). Measurement of mono- and bi-allelic targeted integration frequencies of each antibody in single-cell colonies revealed that 38% of cells for GT-Ab PCSK9 and 52% of cells for GT-Ab TNFα had at least one allele with the therapeutic antibody insertion (Fig. 1e). Because higher doses of AAV6 are associated with increased activation of the p53 pathway 26 that has potential to impair HSPC viability and engraftment, we decreased the AAV6 vector dose while maintaining high efficiency editing through use of modulators of the DNA repair pathway. There have been several reported strategies to bias the cell’s endogenous repair pathways following double-stranded break. Small molecule inhibition of non-homologous end-joining (NHEJ) via inhibition of DNA-PKcs with AZD7648 has been shown to increase the frequency of HDR-based editing in multiple primary human cell types, including HSPCs 29 . Alternatively, inhibition of 53BP1, a protein that favors NHEJ by inhibiting the early rate-limiting end-resection step of HDR initiation 30 , has also been reported to increase HDR-based editing 26,31,32 . Thus, we tested the use of either small molecule AZD7648 (AZD) or peptide inhibitor of 53BP1 (HDR Enhancer Protein, HEP) with half (1250 vg/cell) or one-fourth (625 vg/cell) the vector dose of AAV6 in CD34 + HSPCs. As expected, lowering of AAV6 vector dose alone led to lower targeted integration frequency and addition of either AZD or HEP led to improvement of targeted integration at both vector doses that reached or exceeded frequencies seen in the original high vector dose condition shown in Fig. 1b (2500 vg/cell) (Fig. 1f,g). Additionally, CFU assay analysis demonstrated that addition of AZD or HEP did not influence HSPC colony distribution (Extended Data Fig. 2a,b). Therefore, to preserve cell health and engraftment potential, we chose to move forward in future experiments using the lowest vector dose tested (625 vg/cell) combined with use of either AZD or HEP to maintain high-efficiency editing. GT-Ab engineered HSPCs engraft in immunodeficient mice Next, we sought to confirm that our genome engineering strategy does not impair the key function of HSPCs to engraft and reconstitute the blood system. Transplantation of human HSPCs into immunodeficient mice is a powerful tool to evaluate human cell hematopoiesis and is considered the pre-clinical gold standard for evaluating the stem cell potential of cell therapies 33 . We therefore edited two donors of CB CD34 + cells with either GT-Ab PCSK9 or GT-Ab TNFα using 625 vg/cell of AAV6 and either AZD or HEP. GT-Ab HSPCs were then transplanted into sub-lethally irradiated NSG mice and chimerism and blood cell lineage formation was analyzed after 16 weeks (Fig. 2a). Prior to transplantation, allelic editing frequencies in HSPCs were ~41% in the AZD conditions and ~35% in the HEP conditions (Fig. 2b). At 16 weeks post-transplantation, cells from all GT-Ab conditions successfully engrafted in the bone marrow and showed migration to the spleen, a secondary hematopoietic site (Fig. 2c,d). There was a decrease in engraftment in the GT-Ab conditions compared to mock edited cells, which was consistent with those seen in prior studies using RNP/AAV6 gene-modified cells 28,34,35 and thus likely not due to the introduction of the antibody cassette itself. Further supporting this point, there was maintenance of GT-Ab PCSK9 or GT-Ab TNFα edited cells in the bone marrow of mice at endpoint, indicating gene-targeted HSPCs retain their ability to engraft (Fig. 2e). By using the lower MOI of AAV6, we observed no drop in engraftment of the HDR edited allele frequency from pre-transplant (Fig. 2b) following engraftment (Fig. 2e). There was variability in frequency of targeted integration between mice, but on average the editing frequency (38% in GT-Ab PCSK9 +AZD, 30% in GT-Ab PCSK9 +HEP, 56% in GT-Ab TNFα +AZD) neared or surpassed that seen in each condition pre-transplant except in one group (14% in GT-Ab TNFα +HEP). GT-Ab HSPCs reconstituted the myeloid, B cell, and T cell lineages at similar frequencies to control cells indicating the gene-editing strategy does not introduce major reconstitution bias. There was an observed bias to the myeloid lineage in individual mice that exhibited overall lowered levels of engraftment, consistent with prior reports using this mouse model 22,23,35 (Fig. 2f). Notably, due to their lack of immune system, immunodeficient mice do not reconstitute with highly differentiated human B cells 36,37 . Likely due to insufficient T cell help, in previous studies we have observed very low or absent levels of human IgG production from xeno-transplanted mice 23 . Thus, when we measured therapeutic antibody concentration in the serum of GT-Ab xeno-transplanted mice via antigen specific ELISA, it was not surprising to see very low levels of anti-PCSK9 antibodies in the GT-Ab PCSK9 mice and no anti-TNFα antibodies in the GT-Ab TNFα except a very low amount in one mouse (4.7 ng/mL) (Fig. 2g). GT-Ab engineered B cells efficiently secrete therapeutic antibodies Given the limitations in B cell development of transplanted human HSPCs in immunodeficient mice, direct editing of primary human B cells offers a potential alternative for modeling gene-targeted antibody secretion. CD19 + B cells from healthy adult peripheral blood mononuclear cells (PBMCs) were isolated and activated for three days using a previously published protocol 11 . We then used the same GT-Ab engineering system described above to edit the activated B cells and measured targeted integration frequency and antibody concentration in the culture supernatant after varying amounts of time in culture (3 and 5 days) (Fig. 3a). At three days post-editing, we observed targeted integration frequencies in the B cells that was comparable to those seen in CD34 + cells (average 30.8% for GT-Ab PCSK9 and 23.2% for GT-Ab TNFα ) (Fig. 3b). At day 9 post-activation after leaving cells for 3 days in culture, we observed efficient secretion of either anti-PCSK9 or anti-TNFα antibodies into the culture supernatant measured by antigen specific ELISA for each antibody (Fig. 3c). After replating and a five-day incubation period, we observed an expected increase in antibody concentration in both conditions (Fig. 3c). Interestingly, anti-PCSK9 antibodies were produced more efficiently than anti-TNFα antibodies, potentially reflecting differences in half-life of antibodies or the use of more contemporary antibody engineering approaches in the development of the anti-PCSK9 antibody. To demonstrate that antibodies produced from gene-targeted B cells were functional, we applied the supernatant from the GT-Ab TNFα B cells to a TNFα activity assay using a THP-1 NF-κB reporter cell line 38 . GT-Ab TNFα B cell supernatant collected from four biological donors was able to efficiently eliminate TNFα activity compared to supernatant from mock edited cells (Fig. 3d). Next, we investigated if GT-Ab B cells were able to differentiate into plasma cells, the terminally differentiated antibody secreting cell type, capable of secreting thousands of antibodies per cell per second 17,39 . Using a previously defined protocol 12 , GT-Ab B cells were successfully differentiated into CD38 ++ CD138 - plasmablasts and CD38 ++ CD138 + plasma cells at similar frequencies to control cells (Fig. 3e,f). Plasmablasts and plasma cells were then isolated via fluorescence activated cell sorting (FACS) and genomic DNA was isolated from each population. Analysis of editing in each population by ddPCR revealed maintenance of GT-Ab edited alleles in both populations compared to the bulk population, indicating that there is no selection against edited cells (Fig. 3g). Notably, differentiated cells were able to secrete antibodies with measured concentrations highest at day 10 of differentiation (Fig. 3h). Altogether, these results support the idea that B cells carrying the GT-Ab edit can successfully secrete therapeutic antibodies and differentiate into plasma cells. Transplanted GT-Ab mouse HSPCs achieve therapeutic antibody concentrations To better evaluate in vivo antibody production, we modeled autologous HSCT through transplantation of murine GT-Ab HSPCs into immunocompetent mice, capable of reconstituting with fully mature antibody secreting B cells. To accomplish this, murine c-kit + HSPCs were isolated from bone marrow of CD45.1 C57BL/6 mice and expanded ex vivo, using a protocol adapted from previously published protocols 40,41 . Following expansion, we employed a sgRNA targeting the murine Rosa26 safe harbor locus 42–44 and re-designed the AAV6 repair donors containing the antibody cassettes for integration at this locus (Extended Data Fig. 3a). To reach editing frequencies in murine HSPCs similar to that achieved in human HSPCs we tested use of AZD (Extended Data Fig. 3b) and found that 1 µM AZD was able to increase targeted integration frequencies to those achieved in human HSPCs (Fig. 4a). Using this optimized editing protocol, 1x10 6 CD45.1 GT-Ab murine HSPCs along with 2.5x10 5 CD45.1/CD45.2 bone marrow support cells were transplanted into lethally irradiated CD45.2 C57BL/6 mice and peripheral blood was taken every four weeks until endpoint at 16 weeks post-transplant (Fig. 4b). Prior to transplant, cells were assessed for frequency of c-Kit + Sca1 + Lineage − (KSL) HSPCs and we found a slight decrease in frequency of KSL cells in the GT-Ab conditions compared to mock (Extended Data Fig. 3c,d). We observed engraftment of mock and GT-Ab HSPCs in the peripheral blood at week four post-transplant (average 82.8% for mock, 57.9% for GT-Ab PCSK9 , and 71.5% for GT-Ab TNFα ), which decreased at week 8 and then remained relatively stable through week 16 for the GT-Ab conditions (Fig. 4c). Consistent that gene editing causes some toxicity to HSPCs 44 , endpoint analysis of bone marrow showed lower engraftment of GT-Ab HSPCs (average chimerism 8.3% for both GT-Ab PCSK9 and GT-Ab TNFα ) compared to mock edited cells (average 79.9%). This pattern was also consistent although less prominent in the spleen (average chimerism 83.3% for Mock versus 19.5% for GT-Ab PCSK9 and 29.4% for GT-Ab TNFα ) (Extended Data Fig. 4a). We also observed that donor lineage reconstitution (B cell, T cell, myeloid) in the spleen and peripheral blood was similar when comparing mock and GT-Ab conditions. In the bone marrow, likely due to the very low levels of donor engraftment, we saw bias toward the B cell lineage in the GT-Ab conditions, although all three hematopoietic lineages were still able to form (Extended Data Fig. 4b). Importantly, we saw stable maintenance of GT-Ab edited alleles compared to input editing in the peripheral blood at each timepoint (Fig. 4d) and in all three hematopoietic compartments at endpoint when accounting for donor chimerism (Fig. 4e), indicating that there is no selection against the GT-Ab edited cells following engraftment. To evaluate antibody secretion from transplanted cells, serum samples were collected every four weeks and run on antigen specific ELISA. We measured strong expression of each antibody as early as four weeks post-transplant with concentrations increasing until 12 weeks and maintaining to endpoint at week 16 (Fig. 4f,g). Consistent with in vitro data in GT-Ab human B cells, we saw the anti-PCSK9 antibody was produced much more efficiently than the TNFα antibody in the serum of mice. At week 16, the anti-PCSK9 antibody reached an average concentration of 206 µg/mL while the anti-TNFα antibody reached an average concentration of 5.5 µg/mL. Nevertheless, both antibodies either reached or far surpassed concentrations necessary for therapeutic efficacy in humans for each respective antibody (approximate therapeutic concentration 10-15 µg/mL for anti-PCSK9 and 3-7 µg/mL for anti-TNFα antibody) 45,46 . We also assessed mouse IgG production in the transplanted mice and found there was an average of ~1600 µg/mL of mouse IgG at 16 weeks. Thus anti-PCSK9 and anti-TNFα antibodies represented an average 13.1% and 0.4% of total IgG, respectively (Extended Data Fig. 4c). Of note, due to the lower chimerism observed in the GT-Ab mice, these serum antibody concentrations were achieved with only 3.2-18.5% total edited cells in the bone marrow when accounting for editing frequency and chimerism, which resulted in 4.3-13.8% edited cells in the spleen and 3.1-13.9% edited cells in the peripheral blood. The fact that robust antibody production can be achieved despite low levels of edited cell chimerism indicates that our approach may be effective even with low levels of engraftment. This suggests that durable therapeutic antibody production could be established without the need for aggressive myeloablative conditioning, thereby improving the safety and clinical feasibility of this strategy. We next characterized B cell development in mice transplanted with GT-Ab murine HSPCs to evaluate for any perturbations. First, we performed flow cytometry to phenotypically characterize B cells in the bone marrow and spleen. In the bone marrow, we observed similar frequencies of B220 low pre-pro-B, pro-B, and pre-B cells in the bulk population, but observed an increase in pre-pro-B cells in the GT-Ab conditions in the donor CD45.1 + cells alone which may reflect artifact of low donor engraftment frequencies (Extended Data Fig. 5a). In the spleen, we looked for IgD + mature B cells and found that mock and GT-Ab cells formed similar frequencies of both early mature (IgD + IgM + ) and late mature (IgD + IgM - ) B cells in both the bulk population and donor CD45.1 + cells alone (Extended Data Fig. 5b). We then isolated the B220 + donor-derived spleen cells by FACS and found that GT-Ab targeted integration frequencies were comparable to that of the bulk population, indicating no selection against the edited cells during formation of B cells (Fig. 4h). To more carefully interrogate the development of GT-Ab B cells in vivo, we performed B cell receptor (BCR) sequencing on the donor B220 + spleen cells to evaluate for any perturbation in the BCR repertoire. We found a similar number of clonotypes and length of CDR3 regions between groups (Fig. 4i, Extended Data Fig. 5c). We also found that the number of clones occupying the top 50% of total sequencing reads (D50 diversity index) was similar amongst all groups, indicating similar BCR diversity (Fig. 4j). Similarly, there was no significant differences in V/J gene usage (Extended Data Fig. 5d,e). Taken together, these data largely support that introduction of the GT-Ab cassette in a safe-harbor locus and expression of exogenous antibodies does not impair B cell formation or development in vivo. Engineered antibody levels can be modulated through small molecule regulation The high levels of antibodies seen in the immunocompetent mouse model prompted us to develop a system in which antibody expression could be regulated. Previous work by the Wandless group developed a system to tune protein expression through fusion of a protein of interest to a FK506 binding protein 12 (FKBP12) destabilization domain (DD) 47 . The protein fused to the DD is rapidly degraded unless a synthetic ligand, Shield-1 (Shld1), is provided to stabilize the DD. We designed an AAV6 repair template containing the anti-PCSK9 antibody expression cassette with the DD fused to the C-terminus of the heavy chain of the antibody (Fig. 5a, Extended Data Fig. 6a). We then targeted primary human B cells with the antibody alone (GT-Ab PCSK9 ) or with the antibody fused to the FKBP12-DD (GT-Ab PCSK9+DD ). Despite similar targeted integration frequencies in each group (Fig. 5b), addition of the FKBP12-DD led to decreased antibody expression even in the presence of Shld1 (Fig. 5c). Nonetheless, to demonstrate that antibody levels can be modulated using this system, we applied varying concentrations of Shld1 to GT-Ab PCSK9+DD edited cells. Measurement of antibody concentration in the supernatant revealed that expression could indeed be finely tuned through Shld1 concentration (Fig. 5d, Extended Data Fig. 6b). Lastly, we assessed whether antibody expression is reversible using the FKBP12-DD. GT-Ab PCSK9+DD B cells were split into a +Shld1 (Group A) and -Shld1 (Group B) condition and after three days, antibody expression was almost exclusively seen in the +Shld1 condition (Group A). To evaluate reversibility, we then switched the groups and checked antibody concentration in the supernatant after three days. We observed little antibody expression in the cells with Shld1 removed (Group A), while the introduction of Shld1 to Group B led to new antibody expression (Fig. 5e). Lastly, we demonstrate that antibody secretion can also be controlled using the FKBP12-DD in human B cells differentiated to plasma cells (Fig. 5f-h). Altogether, these results demonstrate that addition of the FKBP12-DD allows for finely tunable and reversible antibody expression. The ability to precisely regulate antibody levels may be critical for the safe delivery of sustained antibody production using cell-based therapies. Discussion Although hematopoietic stem cell transplantation has been a curative therapy for decades, advances in genome-engineering allow us to expand the scope for which it may be useful. The FDA approval of the first CRISPR edited HSC medicines in 2024 48 marked a major step forward in using genome-engineering to treat disease. While autologous HSCT has traditionally focused on curing genetic diseases, our work expands this paradigm, demonstrating that genome-edited HSCs could effectively treat non-genetic conditions by re-writing new function into cells. Here we explore one application of this ability by using HDR-based genome-editing of HSPCs to introduce therapeutic antibody expression in the B cell lineage. We first show efficient targeted integration frequency of up to 40% GT-Ab targeted alleles in human CD34 + HSPCs. Because RNP/AAV6-based editing has been shown to impact the health and engraftment ability of HSPCs 49–51 , we next lowered the amount of AAV6 used in conjunction with modulators of the DNA repair pathway to maintain high-efficiency editing. Using either inhibition of NHEJ (AZD7648) or inhibition of 53BP1 (HEP), we considerably lowered the vector dose of AAV6 while maintaining ~40% GT-Ab targeted alleles (Fig. 1). We next demonstrated that GT-Ab human HSPCs successfully engraft in immunodeficient mice, with edited alleles maintained at an average of ~35% across conditions in the bone marrow (Fig. 2). Although we saw minimal antibody expression in the xenografted mice due to their limited ability to form antibody secreting B cells, we then turned to two alternate models to evaluate antibody expression. First, we show that GT-Ab B cells produce functional antibodies, and these B cells can mature into plasma cells in vitro (Fig. 3). Next, we model autologous HSCT in an immunocompetent setting by engineering and transplanting GT-Ab murine HSPCs which led to strong production of therapeutically relevant concentrations of antibodies in vivo with no apparent disruption in normal B cell development (Fig. 4). Lastly, by fusing the gene-targeted antibody to a destabilization domain, we demonstrate that antibody concentration can be controlled through small molecule modulation (Fig. 5). The use of cells as drug delivery vehicles has long gained attention due to the potential to harness the intrinsic pharmacokinetic and biodistribution properties of different cell types 52 . Yet somatic cell-based therapies are unlikely to rival the lifelong durability of HSCT. Additionally, past efforts have relied on transient modification of cells, such as through drug encapsulation or attachment on the cell surface 53 . With advances enabling the stable integration of large genetic payloads into a variety of primary cell types 54 , it is now possible to achieve sustained, long-term expression of therapeutic proteins. A permanently genetically engineered stem cell confers ideal properties for the stable production of drugs through a single dose, unlike any other medicine developed before. In this work, we utilize RNP/AAV6 HDR-mediated editing as AAV6 remains one of the most efficient methods of donor DNA delivery to HSPCs. Despite this, it is well known that the use of AAV6 impacts the ability HSPCs to engraft 22,23,28 , which is primarily due to the activation of the DNA damage response and p53 pathway 26,55 . Yet, much work is currently underway to ameliorate these effects. Here we explore some of these methods by reducing the vector dose of AAV6 in combination with NHEJ or 53BP1 inhibitors, which has been previously shown to reduce toxicity in HSPCs 26,29,32 . Alternatively, a range of DNA donor delivery approaches—including single-stranded oligodeoxynucleotides (ssODNs), lipid nanoparticles, and integrase-deficient lentiviral vectors (IDLVs) 50,56 —are under active investigation for reducing toxicity. As these strategies continue to mature, the antibody engineering platform described here could be readily incorporated into alternative delivery vectors. Past work has investigated the direct use of human B cells and plasma cells to deliver therapeutic proteins, including antibodies 9–13,57 . While we believe the transplantation of engineered HSPCs has the potential for longer lasting durability than this approach, we recognize the choice of B cells specifically to express the therapeutic antibody to be important. We therefore forego the use of a ubiquitous promoter that might express in many off-target lineages in favor of the EEK promoter that limits expression to the B cell lineage to limit any unintended effects on other cell types. Additionally, as the endogenous antibody-secreting lineage, B cells offer several advantages over other cell types. First, terminally differentiated plasma cells are capable of secreting antibodies at an enormous rate (10 2 -10 3 antibodies per second per cell) 16,17 . In our approach, the frequency of engineered HSPCs in the bone marrow should mirror the frequency of engineered B cells in the periphery. Use of a pan-B cell promoter drives antibody expression across all B cell sub-types, including plasma cells, allowing for robust antibody secretion proportional to overall B cell reconstitution. In addition to producing high levels of antibodies, B cells may endow beneficial natural post-translational modifications to their antibody products, particularly since IgG antibodies undergo extensive N-glycosylation following translation 58 . Glycosylation of antibodies is known to effect immunogenicity, function, and longevity 59,60 , thus B cell produced antibodies have the potential to be longer lived and less immunogenic than their traditionally injected counterparts. Because expression from B cells is likely to be most advantageous, future work may benefit from exploring methods of more specific B cell lineage expression than use of a synthetic promoter, such as knock-in downstream of a B cell specific gene, co-opting an endogenous promoter. Despite the grueling repeated injection or infusion regimens, it is unlikely that patients with diseases that currently require injections of therapeutic antibodies would be subjected to the toxic chemotherapeutic pre-conditioning that is currently the standard of care prior to HSCT. Rather, we envision this therapy to be paired with reduced-intensity, non-toxic conditioning regimens. Currently, strategies to employ antibody-based conditioning which selectively target and deplete HSCs are in both pre-clinical work and clinical trials 61–64 . Notably, in our model of autologous HSCT in immunocompetent mice the GT-Ab mice had an average of only 2.4% edited alleles in the bone marrow at endpoint which resulted in therapeutically relevant antibody concentrations in the bloodstream (on the scale of micrograms/milliliter), highlighting the potential compatibility of this therapy with reduced-intensity pre-transplant conditioning. Although two clinically relevant monoclonal antibodies were used in this work as a proof-of-concept, it is important to note that this platform’s modular nature allows for easy swapping of monoclonal antibodies for current and future targets. Furthermore, as antibody-like proteins (such as nanobodies 65 , heavy-chain antibodies (HCAbs) 66 , and bispecific T cell engagers (BITEs) 67 ) continue to be developed, these therapeutics could also readily be implemented in our system. Further, while antibodies are a natural first drug to be produced by B cell progeny, more broadly, this system has the potential to deliver any protein biologic. Many biologics, especially those of small size, currently suffer from short half-lives due to rapid kidney filtration or cleavage by peptidases necessitating frequent, taxing dosing regimens for patients 68 . Fusion proteins (e.g. etanercept), enzymes (e.g. factor IX, lysosomal enzymes), and peptides (e.g. semaglutide) could all potentially benefit from inclusion in this system. Overall, the work presented here provides a framework for sustained delivery of therapeutic protein biologics from a single infusion of HSPCs. Methods Antibody production and purification. Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker. Antibody constructs were expressed in Expi293F cells (Thermo Fisher Scientific, cat.: A14527) and grown in combined media (66% FreeStyle/33% Expi media, Thermo Fisher Scientific, cat.: 12338018 and A1435101, respectively) at 37 °C and 8% CO2 with shaking at 120 rpm. The day of transfection, cells were diluted to a density of approximately 3-4 × 10 6 cells per ml. For a 100 mL transfection volume: 60 µg of total DNA was added to 10 mL of expression media, followed by dropwise addition of 130 µL of FectoPRO transfection reagent (Polyplus, Sébastien Brant, France, cat.: 101000014) with vigorous mixing. Heavy and light chain plasmids were used at a 1:1 ratio, while single plasmid linker antibody constructs were used alone. For simultaneous production of a traditional and linker antibody, 20 μg of each plasmid (traditional light chain, traditional heavy chain, and linker antibody) were applied in 100 mL cell cultures. After a 10-minute incubation at room temperature, the transfection mixture was added to 100 ml of cells. D-glucose (4 g/L, Sigma-Aldrich) and valproic acid (3 mM, Acros Organics) were then added to the cells immediately post-transfection to increase recombinant protein production. The cells were harvested 3–5 days after transfection by spinning the cultures at 7,000g for 5 minutes. Cell culture supernatants were filtered through a 0.22μm filter, combined with 1/10th volume of 10x HEPES-buffered saline (HBS) and purified using the ÄKTA pure fast performance liquid chromatography (FPLC, Cytiva) with a 5 mL MabSelect PrismA column (Cytvia, cat.: 17549802). The ÄKTA system was equilibrated with: A1 – 1x HBS; A2 – 100 mM glycine pH 2.8; B1 – 0.5 M NaOH; Buffer line – 1x HBS; and Sample lines – ddH2O. The column was washed with A1 and then the proteins were eluted with A2 into 50mL conical tubes containing 2.5 mL of 1M HEPES buffer, pH 7.4. The column was then washed with A1, B1 and A1. The resultant Fc-containing samples were buffer-exchanged and concentrated using 50-kDa or 100-kDa cutoff centrifugal concentrators. The samples were further purified by size exclusion on the same ÄKTA FPLC with Superdex 200 Increase 10/ 300 GL column (Cytiva, cat.: 28-9909-44) and further concentrated using 50-kDa or 100-kDa cutoff centrifugal concentrators. 10% glycerol was added and protein concentration was determined by absorbance at 280 nm (A280) on a NanoDrop UVVis spectrophotometer. The purity was assessed by protein gel electrophoresis. rAAV6 vector design, production, and purification. Recombinant donor vectors were cloned from a gBlock Gene Fragments (Integrated DNA Technologies, IDT, San Jose, CA, USA) using restriction enzyme digest or Gibson Assembly (New England Biolabs, Ipswich, MA, USA) into an Adeno-associated virus, serotype 6 (AAV6) vector plasmid derived from the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA). rAAV6 vectors were either produced in-house or purchased from SignaGen Laboratories (Frederick, MD, USA), PackGene Biotech (Houston, TX, USA) or VectorBuilder Inc. (Chicago, IL, USA). For in-house production, 10-12×10 6 HEK-293T cells per plate were seeded in ten 15 cm 2 dishes. After 24-48 hours, each dish was transfected with a standard polyethylenimine (PEI) transfection using 6 μg ITR-containing plasmid and 22 μg pDGM6 plasmid (gift from David Russell, University of Washington, Seattle, WA, USA). After 48-72 hour incubation, cells were harvested and vectors were purified using the AAVpro purification kit (cat.: 6666; Takara Bio, Kusatsu, Shiga, Japan) as per manufacturer’s instructions. Viral titers were determined using droplet digital PCR (ddPCR) to measure the number of vector genomes per microliter as previously described 69 . CD34 + HSPC isolation and culture. Human cord-blood CD34 + HSPCs were isolated from cord blood by the Stanford Binns Program for Cord Blood Research. Samples were obtained with approval from the Stanford Institutional Review Board Committee under protocol 33813. Briefly, isolated mononuclear cells were positively selected for CD34 using the CD34+ MicroBead Kit Ultrapure (Miltenyi Biotec, San Diego, CA, cat.: 130-100-453). Peripheral blood CD34 + HSPCs were purchased from AllCells (Alameda, CA) or the Fred Hutchinson Cancer Center (Seattle, WA). Cells were cultures at 1.5×10 5 –2.5×10 5 cells/mL in CellGenix® GMP Stem Cell Growth Medium (SCGM, CellGenix, Freiburg, Germany, cat.: 20802-0500) supplemented with a human cytokine (PeproTech, Rocky Hill, NJ, USA) cocktail: stem cell factor (100 ng/mL), thrombopoietin (100 ng/mL), Fms-like tyrosine kinase 3 ligand (100 ng/mL), interleukin 6 (100 ng/mL), streptomycin (20 mg/mL), and penicillin (20 U/mL), and 35 nM of UM171 (APExBIO, Houston, TX, USA, cat.: A89505), as previously described 70 . Cells were cultured at 37°C in a hypoxic incubator with 5% CO 2 and 5% O 2 . B cell isolation and culture . B cells were isolated by negative selection using the human B Cell Isolation Kit II (Miltenyi Biotec, cat: 130-091-151) from leukoreduction system (LRS) chambers obtained deidentified from the Stanford Blood Center. Cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) (Thermo Fisher Scientific, Waltham, MA, USA, cat.: 12440053) supplemented with 10% bovine growth serum (Cytiva, Marlborough, MA, USA, cat.: SH30541.03HI), 1% penicillin-streptomycin (Cytiva, cat.: SV30010), 55 μM of 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA, cat.: M3148), 50 ng/mL of IL-2 (Peprotech, cat.: 200-02), 50 ng/mL of IL-10 (Peprotech, cat.: 200-10), 10 ng/mL of IL-15 (Peprotech, cat.: 200-15), 100 ng/mL of recombinant human MEGACD40L (Enzo Life Sciences, Farmingdale, NY, USA, cat.: ALX-522-110-C010), and 1 μg/mL of CpG oligonucleotide 2006 (Invivogen, San Diego, CA, USA, cat.: tlrl2006-1) at a density of 1×10 6 cells/mL at 37 °C, 5% CO 2 , and ambient oxygen levels, as described previously 11 . Plasma cell differentiation and characterization. B cells were isolated as described above and then activated and differentiated as described previously 71 . Briefly, cells were cultured in a base media of Iscove’s Modified Dulbecco’s Medium (IMDM) (Thermo Fisher Scientific, cat.: 12440053) supplemented with 10% bovine growth serum (Cytiva, cat.: SH30541.03HI), 55 μM of 2-mercaptoethanol (Sigma-Aldrich, cat.: M3148). For the first seven days, media was supplemented with 100 ng/mL of recombinant human MEGACD40L (Enzo Life Sciences, cat.: ALX-522-110-C010), 1 μg/mL of CpG oligonucleotide 2006 (Invivogen), and 40 ng/mL IL-21 (Peprotech, cat.: 200-21). For days 7-12, media supplementation was changed to 50 ng/mL IL-6 (Peprotech, cat.: 200-06), 10 ng/mL of IL-15 (Peprotech, cat.: 200-15), and 15 ng/mL interferon-α2B (Sigma-Aldrich, cat.: H6166). Cells were plated at a density of 1-1.5 × 10 6 cells/mL at 37 °C, 5% CO 2 , and ambient oxygen levels. To evaluate differentiation, cells were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) 10 min at room temperature and then stained for 20 min at 4°C with the following antibody cocktail: anti-human CD38 (BD Biosciences, cat.: 560677), anti-human CD3 (Biolegend, cat.: 300408), anti-human CD19 (Biolegend, cat.: 302211), anti-human CD138 (Biolegend, cat.: 356521), and viability dye Ghost Dye™ Violet 780 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0865-T100). All samples were analyzed on a BD FACSAria II flow cytometer. Data was analyzed using FlowJo software (v.10.10.0). Mouse HSPC isolation and culture. Bone marrow was harvested from B6.SJL-Ptprc a Pepc b /BoyJ mice and HSPCs were isolated using the CD117 MicroBeads, mouse kit (Miltenyi Biotec, cat: 130-091-224). Cells were cultured in CellBIND plates (Corning, Corning, NY, USA, cat: 3337) in Nutrient Mixture F-12 Ham (Sigma-Aldrich, cat: N6658) supplemented with 1X penicillin-streptomycin-glutamine (Gibco, Waltham, MA, USA, cat: 10378-016), 1X Insulin-transferrin-selenium-ethanolamine (ITS-X) (Gibco, cat: 51500-056), 1 mg/mL polyvinyl alcohol (PVA) (Sigma-Aldrich, cat: P8136), 100 ng/mL TPO (Peprotech, cat: 315-14 or Biolegend cat: 718102), and 10 ng/mL SCF (Peprotech, cat: 250-03), based on a previously published protocol 41 , for 2-4 weeks. Prior to editing, cultures were checked for purity via flow cytometry. Cells were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-mouse Lineage cocktail BV421 (Biolegend, cat.: 133311), anti-mouse Sca-1 BV650 (Biolegend, cat.: 108143), anti-mouse CD117 (c-Kit) BV786 (Biolegend, cat.: 105841), anti-mouse CD150 PE (Biolegen, cat.: 115904), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). All samples were analyzed on a BD FACSAria II flow cytometer. Data was analyzed using FlowJo software (v.10.10.0). Genome editing of primary cells. Synthetic chemically modified sgRNAs were purchased from Synthego (Redwood City, CA, USA) or TriLink Biotechnologies (San Diego, CA, USA). Chemical modifications were comprised of 2′-O-methyl-3′-phosphorothioate at the three terminal nucleotides of the 5′ end and the second, third, and fourth bases from the 3’ end as described previously 72 . The target sequence for the sgRNAs are as follows: CCR5 -sgRNA 22,23 5’-TGACATCAATTATTATACAT-3’ and Rosa26 -sgRNA 42–44 5’-ACTCCAGTCTTTCTAGAAGA-3’. HiFi Cas9 protein was purchased from Aldevron (Fargo, ND, USA cat:9214). RNPs were complexed at a Cas9:sgRNA molar ratio of 1:2.5 at room temperature for 15-30 min. Cells were resuspended in P3 buffer (Lonza, Basel, Switzerland, cat.: V4XP-3032) with complexed RNPs and electroporated using the Lonza 4D Nucleofector and 4D-Nucleofector X Unit (program DZ-100 for human HSPCs, EO-117 for B cells, and CA-137 for mouse HSPCs). For some editing experiments, 5 μM of HDR Enhancer Protein (IDT, San Jose, CA) was added to the electroporation mixture prior to electroporation. Immediately following electroporation, AAV6 was dispensed onto cells based on titers determined by ddPCR (0.625-2.5 × 10 3 vg/cell for human and mouse HSPCs, 1-2.5 × 10 4 vg/cell for B cells). For mouse HSPCs and B cells, cells were plated in ~100 μL of serum-free media with AAV6 in a 96 well plate for 3–4 hours prior to replating. For some editing experiments, cells were incubated with 0.5 μM (human HSPCs) or 1 μM (mouse HSPCs) of AZD7648 (Selleck Chemicals, Houston, TX, cat.: S8843) for 24 h, as previously described 29 . Colony forming unit (CFU) assay. Two days post-electroporation 500 HSPCs were plated in each well of a SmartDish 6-well plate (STEMCELL Technologies, Vancouver, Canada, cat.: 27370) containing MethoCult H4434 Classic (STEMCELL Technologies, cat.: 04444). After 14 days, the wells were imaged using the STEMvision Hematopoietic Colony Counter (STEMCELL Technologies). Colonies were counted and scored with manual correction to determine the number of BFU-E, CFU-GM, and CFU-GEMM colonies. Targeted integration analysis by ddPCR. Genomic DNA was extracted from cells using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR, we employed HBA1 specific in-out PCR primers and a probe corresponding to the expected knock-in event (1:3.6 primer to probe ratio). We also used an established genomic DNA reference at the CCRL2 locus. 35 The ddPCR reaction was prepared and underwent droplet generation following the manufacturer’s instructions with a Bio-Rad QX200 ddPCR machine (Bio-Rad, Hercules, CA). Thermocycler settings were as follows: 95°C (10 min, 1°C/s ramp), 94°C (30 s, 1°C/s ramp), 57.7°C (30 s, 1°C/s ramp), 72°C (2 min, 1°C/s ramp), return to step 2 for 50 cycles, and 98°C (10 min, 1°C/s ramp). Analysis of droplet samples was then performed using the QX200 Droplet Digital PCR System (Bio-Rad). We divided the copies/μL to determine the frequency of HDR (%): HDR (FAM) / REF (HEX). The following primers and probes were used in the ddPCR reaction: CCR5: Forward Primer (FP): 5’-GGGAGGATTGGGAAGACA-3’ Reverse Primer (RP): 5’-AGGTGTTCAGGAGAAGGACA-3’ Probe: 5’-6-FAM/AGCAGGCATGCTGGGGATGCGGTGG/3IABkFQ-3’ CCRL2 (reference): FP: 5’-GCTGTATGAATCCAGGTCC-3’, RP: 5’- CCTCCTGGCTGAGAAAAAG -3’ Probe: 5’-HEX/TGTTTCCTC/ZEN/CAGGATAAGGCAGCTGT/3IABkFQ-3’ Rosa26 (targeted integration) 44 : FP: 5’-AAGGGGGAGGATTGGGAAGA-3’, RP: 5’-ACAGCCTCGATTTGTGGTGT-3’ Probe: 5’-6-FAM/CATGCTGGGGATGCGGTGGG/3IABkFQ-3’ Rosa26 (reference): FP: 5’-AAGCCACTGACTATGGTGCC-3’, RP: 5’-CTCAGAAGCAGAAGCATCCCT-3’ Probe: 5’-6-FAM/TGTTCTCAAAGGAAGGATTGTCTGTGC/3IABkFQ-3’ Enzyme-linked immunosorbent assay (ELISA) to detect antibodies. For detection of therapeutic antibodies, antigen specific ELISA was used. For detection of total IgG in B cell supernatant, anti-IgG Fc ELISA was used. NUNC Maxi Sorp plates (Thermo Fisher Scientific, cat: 50-314-51) were coated with 4 μg/mL streptavidin (Thermo Fisher Scientific, cat: 21122) for 1 h at room temperature. Plates were then washed 3 times with MilliQ water and then blocked with ChonBlock (Thermo Fisher Scientific, cat.: 50-152-6971) overnight at 4°C. The next day, plates were coated with 1 μg/mL of antigen (biotinylated human PCSK9 protein or biotinylated human TNF-alpha protein, Acro Biosystems, cat: PC9-H82E7, TNA-H82E3) or biotinylated IgG Fc protein (Fortis Life Sciences, Waltham, MA, USA, cat: A80-104B) for 1 h at room temperature. Plates were then washed with 0.05% PBS-Tween (PBS-T). Media or serum samples were diluted in PBS containing 0.1% BSA and 0.05% Tween-20 and then incubated on the plate for 1 h at room temperature. Plates were washed with PBS-T, followed by incubation with the secondary antibody, horseradish peroxidase (HRP)–conjugated goat anti-human IgGFc antibody (Fortis Life Sciences, cat.: A80-104A) at a 1:2500 dilution. Plates were washed with PBS-T and detection was performed with the 1-Step™ TMB Substrate Kit (Thermo Fisher Scientific, cat.: 34021) and quenched with 3M H 2 SO 4 . Plates were read at 450 nm using a Molecular Devices SpectraMax M3 plate reader with SoftMax Pro software. Standard curves were created using purified linker versions of each antibody or purified human IgG from normal serum (Bethyl, Montgomery, TX, USA, cat.: P80111). Results were analyzed using GraphPad Prism v10 software to calculate a standard curve using a 4-parameter sigmoidal algorithm. Western blot for purified antibodies. Purified antibodies (0.5 μg each) were denatured under reducing conditions by adding 4X Laemmli sample buffer (Bio-Rad, cat.: 1610747) and 2-mercaptoethanol and heated at 100°C for 5 min. Samples were loaded onto a 4-15% MiniPROTEAN TGX precast protein gel (Bio-Rad, cat.: 4561084). Following electrophoresis, protein from gel was transferred to a PVDF membrane using the Trans-Blot Turbo Transfer System (Bio-Rad, cat.: 1704150) and the membrane was blocked using Blotting-Grade Blocker (Bio-Rad, cat.: 1706404) in phosphate-buffered saline with 0.02% Tween 20 (PBS-T) for 30 min at room temperature. The membrane was then incubated in 1:5000 primary antibody (HRP-conjugated Goat pAb to human IgG, Abcam, cat.: 7153) overnight at 4°C. The next day, the membrane was washed three times with PBS-T. SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, cat.: 34579) was used for detection and the membrane was imaged using a Bio-Rad ChemiDoc XRS+ gel imager using ImageLab software. Low-density lipoprotein receptor (LDLR) expression via flow cytometry. 2.5×10 5 HepG2 (ATCC, Manassas, VA, USA, cat.: HB-8065) cells were seeded in 6 well plates. The next day, purified anti-PCSK9 antibodies were applied to cells at 10 ug/mL in the media and allowed to incubate for 48 hours. Media was then removed and cells were washed once with PBS and detached using Accutase cell detachment reagent (Innovative Cell Technologies, San Diego, CA, USA, cat.: AT104). Cells were then collected and blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) for 10 min at room temperature. Cells were then stained with anti-human LDLR BV421 (BD Biosciences, Franklin Lakes, NJ, USA, cat.: 744847) and viability dye Ghost Dye™ Violet 780 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0865-T100) for 20 minutes at 4°C. Samples were analyzed on a LSR Fortessa flow cytometer (BD Biosciences). Data was analyzed using FlowJo software (v.10.10.0). NF-κB reporter assay for TNFα acitivity. Purified anti-TNFα antibodies or B cell supernatant was incubated with recombinant human TNFα (R&D Systems, Minneapolis, MN, USA, cat.: 210-TA) for 30 minutes at room temperature in a 96-well plate. Following incubation, 1×10 4 THP-1 NF-κB-Luc2 reporter cells (ATCC, cat.: TIB-202-NFkB-LUC2) were added to each well and incubated for 2 hours at 37°C. Cells were lysed using Britelite plus reagent (Revvity Health Sciences, Waltham, MA, USA, cat.: 6066766) and relative luminescence units (RLU) was determined using a Synergy H1 plate reader (BioTek, Winooski, VT, USA). Xenotransplantation of human HSPCs in immunodeficient mice. All mice were housed at Stanford University with a 12/12h light/dark cycle at an ambient temperature of 22°C and 50% humidity. All experiments were completed under the Administrative Panel on Laboratory Animal Care (APLAC Protocol #25065).Six- to eight-week-old NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ (NSG) mice (Jackson Laboratories, Strain: 005557) were irradiated with 2 Gy and then transplanted with 5 × 10 5 mock (electroporation only) or genome-edited cord-blood derived CD34 + HSPCs via retro-orbital injection. Human engraftment in bone marrow and spleen was assessed at 16-weeks post-transplantation. Bone marrow mononuclear cells were isolated via Ficoll gradient centrifugation. Spleen samples were treated with RBC Lysis Buffer (IBI Scientific, Dubuque, IA, USA, cat.: IB47620) to eliminate mature red blood cells. Samples were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) and mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature. Samples were then stained for 30 min at 4°C with the following antibody cocktail: anti-mouse CD45.1 BV650 (Biolegend, cat.: 110735), anti-mouse TER-119 PE-Cy5 (eBiosciences, San Diego, CA, USA, cat.: 15-5921-82), anti-human CD45 PacBlue (Biolegend, cat.: 368540), anti-human HLA-ABC APC-Cy7 (Biolegend, cat. 311426), anti-human CD33 PE (BD, cat.: 555450), anti-human CD19 APC (Biolegend, cat.: 302212), anti-human CD3 FITC (Biolegend, cat.: 300305), and viability dye Ghost Dye™ Violet 540 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0879-T100). Samples were analyzed on a CytoFLEX flow cytometer (Beckman-Coulter, Indianapolis, IN, USA). Data was analyzed using FlowJo software (v.10.10.0). Transplantation of murine HSPCs in immunocompetent mice. Eight to twelve-week old C57BL/6 mice (Jackson Laboratories, Strain: 000664) were irradiated with 9.5 Gy and then transplanted with 1×10 6 mock (electroporation only) or genome-edited murine HSPCs along with 2.5×10 5 whole bone marrow support cells previously harvested from euthanized 8- to 12-week-old CD45.1/CD45.2 mice via retro-orbital injection. Peripheral blood samples were collected via retro-orbital blood collection 4-, 8-, and 12-weeks post-transplantation. At 16-weeks post-transplantation, mice were euthanized, and bone marrow, spleen, and peripheral blood were harvested. All samples were treated with RBC Lysis Buffer (IBI Scientific, cat.: IB47620) to eliminate mature red blood cells. Samples were blocked for non-specific binding using FcR Blocking Reagent for mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail to evaluate engraftment: anti-mouse CD45.2 BV421 (Biolegend, cat.: 109831), anti-mouse CD45.1 BV711 (Biolegend, cat.: 110739), anti-mouse CD11b PE (eBiosciences, cat.: 12-0112-82), anti-mouse Ly-6G/Ly-6C PE (eBiosciences, cat.: 12-5931-82), anti-mouse B220 APC-Cy7 (BD Biosciences, cat.: 561102), anti-mouse CD4 APC (eBiosciences, cat.: 17-0042-82), anti-mouse CD8 APC (eBiosciences, cat.: 17-0081-82), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). All samples were analyzed on a BD FACSAria II flow cytometer and B220 + cells were sorted from spleen samples (BD Biosciences, Franklin Lakes, NJ, USA). Data was analyzed using FlowJo software (v.10.10.0). Immunophenotyping of murine B cells. Bone marrow and spleen were isolated from C57BL/6 mice and prepared as described previously. Samples were then blocked for non-specific binding using FcR Blocking Reagent for mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-mouse CD45.2 PE-Cy7 (Biolegend, cat.: 109830), anti-mouse CD45.1 BV650 (Biolegend, cat.: 110736), anti-mouse B220 APC-Cy7 (BD Biosciences, cat.: 561102), anti-mouse CD43 APC (BD Biosciences, cat.: 560663), anti-mouse IgD BV711 (BD Biosciences, cat.:564275), anti-mouse IgM FITC (BD Biosciences, cat.: 553437), anti-mouse CD24 BV421 (BD Biosciences, cat.: 562563), anti-mouse CD249 PE (BD Biosciences, cat.: 553735), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). Samples were analyzed on a BD FACSAria II flow cytometer. B-cell receptor (BCR) repertoire analysis. B220 + cells were sorted from spleen samples of transplanted mice at 16 weeks post-transplant and RNA was extracted using the RNeasy Plus Micro Kit (Qiagen, Netherlands, cat.: 74034). SMART-Seq Mouse BCR kit (Takara, cat.: 634352) was used to sequence CDR3 regions and the Cogent NGS Immune Profiler software (v2.0, Takara) was used to reconstruct BCR sequences and assign V(D)J gene segments. Only productive BCR rearrangements were retained for analysis. PCR duplicates were collapsed using unique molecular identifiers (UMIs), and reconstructed sequences supported by at least one UMI were retained. Filtered TRUST4 outputs were exported in AIRR format and used for downstream repertoire analysis with Immunarch 73 . Clonotypes were defined by identical CDR3 amino acid sequences with shared V and J gene usage. Distributions of CDR3 nucleotide and amino acid lengths were evaluated across unique clonotypes in three mouse groups. V and J gene usage frequencies were calculated based on relative segment usage within each group. Repertoire diversity was quantified using the D50 metric, defined as the minimum number of unique clonotypes accounting for at least 50% of total sequencing reads. Statistical comparisons across groups were performed using the Kruskal–Wallis test, with P values computed within the Immunarch pipeline and adjusted for multiple testing using the Holm–Bonferroni correction. Statistical analysis. GraphPad Prism v10 software was used for all statistical analysis unless otherwise noted. Declarations Acknowledgements We thank the Stanford Institute for Stem Cell Biology and Regenerative Medicine FACS Core for their support and access to flow cytometry machines. We thank the Binns Program for Cord Blood Research for providing purified cord blood HSPCs. We thank the Stanford Human Immune Monitoring Center for assistance with mouse BCR sequencing. S.E.L was supported by the Stanford Medical Scholars Research Program, the American Society of Hematology Minority Medical Student Award Program, the Stanford Medical Scientist Training Program, and NIH F30 Individual Predoctoral Fellowship (1F30HL178496). W.N.F was supported by the Stanford T32 Graduate Training Program in Stem Cell Biology and Regenerative Medicine (5T32GM119995) and the Blavatnik Family Foundation as a Blavatnik Fellow. A.U. was supported by Stanford University Medical Scientist Training Program grants T32-GM007365 and T32GM145402. F.K.E. was supported by the Stanford Knight-Hennessy Scholarship, Paul and Daisy Soros Fellowship for New Americans, and the Hertz Fellowship. A.K.A. was supported by a postdoctoral fellowship from the Stanford Maternal and Child Health Research Institute. N.F.R. was supported by a Postdoc.Mobility fellowship from the Swiss National Science Foundation (P500PM_217687). L.S. was supported by the Knut and Alice Wallenberg Foundation. M.H.P. was supported by the Sutardja Chuk Professorship in Definitive and Curative Medicine and the Laurie Kraus Lacob Translational Medicine endowment. Author Contributions S.E.L, W.N.F., A.U., J.A., M.M., H.Y.G., F.K.E., A.K.A., S.S., N.F.R and L.S. contributed to experimental design, performance, and analysis. S.E.L wrote the draft and finalized versions of the manuscript with input from other authors. M.H.P. supervised the project. Declaration of Interests M.H.P. serves on the scientific advisory board of Allogene Tx and is an advisor to Versant Ventures. M.H.P. has equity in CRISPR Tx and has equity and is a founder of Kamau Therapeutics. The remaining authors declare no competing interests. References Ecker DM, Jones SD, Levine HL. The therapeutic monoclonal antibody market. mAbs . 2015;7(1):9-14. doi:10.4161/19420862.2015.989042 Lu RM, Hwang YC, Liu IJ, et al. Development of therapeutic antibodies for the treatment of diseases. J Biomed Sci . 2020;27(1):1. doi:10.1186/s12929-019-0592-z Lyu X, Zhao Q, Hui J, et al. The global landscape of approved antibody therapies. Antib Ther . 2022;5(4):233-257. doi:10.1093/abt/tbac021 Ltd MRP. Antibody Therapeutics Market is Expected to Reach $479.0 Billion | MarketsandMarkets. GlobeNewswire News Room. January 4, 2024. Accessed May 12, 2025. https://www.globenewswire.com/news-release/2024/01/04/2803871/0/en/Antibody-Therapeutics-Market-is-Expected-to-Reach-479-0-Billion-MarketsandMarkets.html Bashor CJ, Hilton IB, Bandukwala H, Smith DM, Veiseh O. Engineering the next generation of cell-based therapeutics. Nat Rev Drug Discov . 2022;21(9):655-675. doi:10.1038/s41573-022-00476-6 Ovacik M, Lin K. Tutorial on Monoclonal Antibody Pharmacokinetics and Its Considerations in Early Development. Clin Transl Sci . 2018;11(6):540-552. doi:10.1111/cts.12567 Guijarro-Muñoz I, Compte M, Alvarez-Vallina L, Sanz L. Antibody gene therapy: getting closer to clinical application? Curr Gene Ther . 2013;13(4):282-290. doi:10.2174/15665232113139990025 Hollevoet K, Declerck PJ. State of play and clinical prospects of antibody gene transfer. J Transl Med . 2017;15(1):1. doi:10.1186/s12967-017-1234-4 Moffett HF, Harms CK, Fitzpatrick KS, Tooley MR, Boonyaratanakornkit J, Taylor JJ. B cells engineered to express pathogen-specific antibodies protect against infection. Sci Immunol . 2019;4(35). doi:10.1126/sciimmunol.aax0644 Nahmad AD, Raviv Y, Horovitz-Fried M, et al. Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion. Nat Commun . 2020;11(1):1. doi:10.1038/s41467-020-19649-1 Hung KL, Meitlis I, Hale M, et al. Engineering Protein-Secreting Plasma Cells by Homology-Directed Repair in Primary Human B Cells. Mol Ther J Am Soc Gene Ther . 2018;26(2):456-467. doi:10.1016/j.ymthe.2017.11.012 Cheng RYH, Hung KL, Zhang T, et al. Ex vivo engineered human plasma cells exhibit robust protein secretion and long-term engraftment in vivo. Nat Commun . 2022;13(1):1. doi:10.1038/s41467-022-33787-8 Hill TF, Narvekar P, Asher GD, et al. Human plasma cells engineered to secrete bispecifics drive effective in vivo leukemia killing. Mol Ther . 2024;32(8):2676-2691. doi:10.1016/j.ymthe.2024.06.004 Shizuru JA, Negrin RS, Weissman IL. Hematopoietic stem and progenitor cells: clinical and preclinical regeneration of the hematolymphoid system. Annu Rev Med . 2005;56:509-538. doi:10.1146/annurev.med.54.101601.152334 Philippidis A. CASGEVY Makes History as FDA Approves First CRISPR/Cas9 Genome Edited Therapy. Hum Gene Ther . 2024;35(1-2):1-4. doi:10.1089/hum.2023.29263.bfs Hibi T, Dosch HM. Limiting dilution analysis of the B cell compartment in human bone marrow. Eur J Immunol . 1986;16(2):139-145. doi:10.1002/eji.1830160206 Eyer K, Doineau RCL, Castrillon CE, et al. Single-cell deep phenotyping of IgG-secreting cells for high-resolution immune monitoring. Nat Biotechnol . 2017;35(10):977-982. doi:10.1038/nbt.3964 Gomez-Ospina N, Scharenberg SG, Mostrel N, et al. Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I. Nat Commun . 2019;10(1):4045. doi:10.1038/s41467-019-11962-8 Langslet G, Emery M, Wasserman SM. Evolocumab (AMG 145) for primary hypercholesterolemia. Expert Rev Cardiovasc Ther . 2015;13(5):477-488. doi:10.1586/14779072.2015.1030395 Targan SR, Hanauer SB, Deventer SJH van, et al. A Short-Term Study of Chimeric Monoclonal Antibody cA2 to Tumor Necrosis Factor α for Crohn’s Disease. N Engl J Med . 1997;337(15):1029-1036. doi:10.1056/NEJM199710093371502 Koerber JT, Hornsby MJ, Wells JA. An Improved Single-chain Fab Platform for Efficient Display and Recombinant Expression. J Mol Biol . 2015;427(2):576-586. doi:10.1016/j.jmb.2014.11.017 Dudek AM, Feist WN, Sasu EJ, et al. A simultaneous knockout knockin genome editing strategy in HSPCs potently inhibits CCR5- and CXCR4-tropic HIV-1 infection. Cell Stem Cell . 2024;31(4):499-518.e6. doi:10.1016/j.stem.2024.03.002 Feist WN, Luna SE, Ben-Efraim K, et al. Multilayered HIV-1 resistance in HSPCs through CCR5 Knockout and B cell secretion of HIV-inhibiting antibodies. Nat Commun . 2025;16(1):3103. doi:10.1038/s41467-025-58371-8 Vakulskas CA, Dever DP, Rettig GR, et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nat Med . 2018;24(8):1216-1224. doi:10.1038/s41591-018-0137-0 Luo XM, Maarschalk E, O’Connell RM, Wang P, Yang L, Baltimore D. Engineering human hematopoietic stem/progenitor cells to produce a broadly neutralizing anti-HIV antibody after in vitro maturation to human B lymphocytes. Blood . 2009;113(7):1422-1431. doi:10.1182/blood-2008-09-177139 Xu L, Lahiri P, Skowronski J, Bhatia N, Lattanzi A, Porteus MH. Molecular dynamics of genome editing with CRISPR-Cas9 and rAAV6 virus in human HSPCs to treat sickle cell disease. Mol Ther - Methods Clin Dev . 2023;30:317-331. doi:10.1016/j.omtm.2023.07.009 Pavel-Dinu M, Wiebking V, Dejene BT, et al. Gene correction for SCID-X1 in long-term hematopoietic stem cells. Nat Commun . 2019;10(1):1634. doi:10.1038/s41467-019-09614-y Cromer MK, Camarena J, Martin RM, et al. Gene replacement of α-globin with β-globin restores hemoglobin balance in β-thalassemia-derived hematopoietic stem and progenitor cells. Nat Med . 2021;27(4):677-687. doi:10.1038/s41591-021-01284-y Selvaraj S, Feist WN, Viel S, et al. High-efficiency transgene integration by homology-directed repair in human primary cells using DNA-PKcs inhibition. Nat Biotechnol . Published online August 3, 2023:1-14. doi:10.1038/s41587-023-01888-4 Escribano-Díaz C, Orthwein A, Fradet-Turcotte A, et al. A Cell Cycle-Dependent Regulatory Circuit Composed of 53BP1-RIF1 and BRCA1-CtIP Controls DNA Repair Pathway Choice. Mol Cell . 2013;49(5):872-883. doi:10.1016/j.molcel.2013.01.001 Canny MD, Moatti N, Wan LCK, et al. Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR–Cas9 genome-editing efficiency. Nat Biotechnol . 2018;36(1):95-102. doi:10.1038/nbt.4021 Baik R, Cromer MK, Glenn SE, et al. Transient inhibition of 53BP1 increases the frequency of targeted integration in human hematopoietic stem and progenitor cells. Nat Commun . 2024;15(1):1. doi:10.1038/s41467-023-43413-w Brendel C, Rio P, Verhoeyen E. Humanized mice are precious tools for evaluation of hematopoietic gene therapies and preclinical modeling to move towards a clinical trial. Biochem Pharmacol . 2020;174:113711. doi:10.1016/j.bcp.2019.113711 Dever DP, Bak RO, Reinisch A, et al. CRISPR/Cas9 β-globin gene targeting in human haematopoietic stem cells. Nature . 2016;539(7629):384-389. doi:10.1038/nature20134 Gomez-Ospina N, Scharenberg SG, Mostrel N, et al. Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I. Nat Commun . 2019;10(1):4045. doi:10.1038/s41467-019-11962-8 Jangalwe S, Shultz LD, Mathew A, Brehm MA. Improved B cell development in humanized NOD-scid IL2Rγnull mice transgenically expressing human stem cell factor, granulocyte-macrophage colony-stimulating factor and interleukin-3. Immun Inflamm Dis . 2016;4(4):427-440. doi:10.1002/iid3.124 Vuyyuru R, Patton J, Manser T. Human immune system mice: current potential and limitations for translational research on human antibody responses. Immunol Res . 2011;51(2-3):257-266. doi:10.1007/s12026-011-8243-9 THP-1 NF-κB-Luc2 - TIB-202-NFkB-LUC2 | ATCC. https://www.atcc.org. Accessed February 1, 2026. https://www.atcc.org/products/tib-202-nfkb-luc2 Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. B Cells and Antibodies. In: Molecular Biology of the Cell. 4th Edition . Garland Science; 2002. Accessed April 20, 2025. https://www.ncbi.nlm.nih.gov/books/NBK26884/ Ochi K, Morita M, Wilkinson AC, Iwama A, Yamazaki S. Non-conditioned bone marrow chimeric mouse generation using culture-based enrichment of hematopoietic stem and progenitor cells. Nat Commun . 2021;12(1):1. doi:10.1038/s41467-021-23763-z Wilkinson AC, Ishida R, Nakauchi H, Yamazaki S. Long-term ex vivo expansion of mouse hematopoietic stem cells. Nat Protoc . 2020;15(2):2. doi:10.1038/s41596-019-0263-2 Chu VT, Weber T, Wefers B, et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol . 2015;33(5):543-548. doi:10.1038/nbt.3198 Chu VT, Weber T, Graf R, et al. Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes. BMC Biotechnol . 2016;16(1):4. doi:10.1186/s12896-016-0234-4 Wilkinson AC, Dever DP, Baik R, et al. Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice. Nat Commun . 2021;12:686. doi:10.1038/s41467-021-20909-x Vande Casteele N, Ferrante M, Van Assche G, et al. Trough concentrations of infliximab guide dosing for patients with inflammatory bowel disease. Gastroenterology . 2015;148(7):1320-1329.e3. doi:10.1053/j.gastro.2015.02.031 Kasichayanula S, Grover A, Emery MG, et al. Clinical Pharmacokinetics and Pharmacodynamics of Evolocumab, a PCSK9 Inhibitor. Clin Pharmacokinet . 2018;57(7):769-779. doi:10.1007/s40262-017-0620-7 Banaszynski LA, Chen LC, Maynard-Smith LA, Ooi AGL, Wandless TJ. A rapid, reversible, and tunable method to regulate protein function in living cells using synthetic small molecules. Cell . 2006;126(5):995-1004. doi:10.1016/j.cell.2006.07.025 Commissioner O of the. FDA Approves First Gene Therapies to Treat Patients with Sickle Cell Disease. FDA. August 9, 2024. Accessed May 10, 2025. https://www.fda.gov/news-events/press-announcements/fda-approves-first-gene-therapies-treat-patients-sickle-cell-disease Lee BC, Gin A, Wu C, et al. Impact of CRISPR/HDR editing versus lentiviral transduction on long-term engraftment and clonal dynamics of HSPCs in rhesus macaques. Cell Stem Cell . 2024;31(4):455-466.e4. doi:10.1016/j.stem.2024.02.010 Romero Z, Lomova A, Said S, et al. Editing the Sickle Cell Disease Mutation in Human Hematopoietic Stem Cells: Comparison of Endonucleases and Homologous Donor Templates. Mol Ther . 2019;27(8):1389-1406. doi:10.1016/j.ymthe.2019.05.014 Lattanzi A, Camarena J, Lahiri P, et al. Development of β-globin gene correction in human hematopoietic stem cells as a potential durable treatment for sickle cell disease. Sci Transl Med . 2021;13(598):eabf2444. doi:10.1126/scitranslmed.abf2444 Yu H, Yang Z, Li F, Xu L, Sun Y. Cell-mediated targeting drugs delivery systems. Drug Deliv . 27(1):1425-1437. doi:10.1080/10717544.2020.1831103 Wang LLW, Gao Y, Feng Z, Mooney DJ, Mitragotri S. Designing drug delivery systems for cell therapy. Nat Rev Bioeng . 2024;2(11):944-959. doi:10.1038/s44222-024-00214-0 Porteus MH. A New Class of Medicines through DNA Editing. N Engl J Med . 2019;380(10):947-959. doi:10.1056/NEJMra1800729 Dudek AM, Feist WN, Sasu EJ, et al. A simultaneous knockout knockin genome editing strategy in HSPCs potently inhibits CCR5- and CXCR4-tropic HIV-1 infection. Cell Stem Cell . 2024;31(4):499-518.e6. doi:10.1016/j.stem.2024.03.002 Vavassori V, Ferrari S, Beretta S, et al. Lipid nanoparticles allow efficient and harmless ex vivo gene editing of human hematopoietic cells. Blood . 2023;142(9):812-826. doi:10.1182/blood.2022019333 Hartweger H, McGuire AT, Horning M, et al. HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells. J Exp Med . 2019;216(6):1301-1310. doi:10.1084/jem.20190287 Trzos S, Link-Lenczowski P, Pocheć E. The role of N-glycosylation in B-cell biology and IgG activity. The aspects of autoimmunity and anti-inflammatory therapy. Front Immunol . 2023;14:1188838. doi:10.3389/fimmu.2023.1188838 Liu L. Antibody glycosylation and its impact on the pharmacokinetics and pharmacodynamics of monoclonal antibodies and Fc-fusion proteins. J Pharm Sci . 2015;104(6):1866-1884. doi:10.1002/jps.24444 Goh JB, Ng SK. Impact of host cell line choice on glycan profile. Crit Rev Biotechnol . 2018;38(6):851-867. doi:10.1080/07388551.2017.1416577 Agarwal R, Dvorak CC, Kwon HS, et al. Non-Genotoxic Anti-CD117 Antibody Conditioning Results in Successful Hematopoietic Stem Cell Engraftment in Patients with Severe Combined Immunodeficiency. Blood . 2019;134(Supplement_1):800. doi:10.1182/blood-2019-126239 Kwon HS, Logan AC, Chhabra A, et al. Anti-human CD117 antibody-mediated bone marrow niche clearance in nonhuman primates and humanized NSG mice. Blood . 2019;133(19):2104-2108. doi:10.1182/blood-2018-06-853879 Czechowicz A, Palchaudhuri R, Scheck A, et al. Selective hematopoietic stem cell ablation using CD117-antibody-drug-conjugates enables safe and effective transplantation with immunity preservation. Nat Commun . 2019;10(1):617. doi:10.1038/s41467-018-08201-x Denis M, Swartzrock L, Willner H, et al. Hematopoiesis after anti-CD117 monoclonal antibody treatment in the settings of wild-type and Fanconi anemia mice. Haematologica . 2024;109(9):2920-2929. doi:10.3324/haematol.2023.284275 Alexander E, Leong KW. Discovery of nanobodies: a comprehensive review of their applications and potential over the past five years. J Nanobiotechnology . 2024;22(1):661. doi:10.1186/s12951-024-02900-y Muyldermans S. Nanobodies: Natural Single-Domain Antibodies. Annu Rev Biochem . 2013;82(Volume 82, 2013):775-797. doi:10.1146/annurev-biochem-063011-092449 Tian Z, Liu M, Zhang Y, Wang X. Bispecific T cell engagers: an emerging therapy for management of hematologic malignancies. J Hematol OncolJ Hematol Oncol . 2021;14(1):75. doi:10.1186/s13045-021-01084-4 Strohl WR. Fusion Proteins for Half-Life Extension of Biologics as a Strategy to Make Biobetters. Biodrugs . 2015;29(4):215-239. doi:10.1007/s40259-015-0133-6 Aurnhammer C, Haase M, Muether N, et al. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods . 2012;23(1):18-28. doi:10.1089/hgtb.2011.034 Bak RO, Dever DP, Porteus MH. CRISPR/Cas9 genome editing in human hematopoietic stem cells. Nat Protoc . 2018;13(2):358-376. doi:10.1038/nprot.2017.143 Cheng RYH, de Rutte J, Ito CEK, et al. SEC-seq: association of molecular signatures with antibody secretion in thousands of single human plasma cells. Nat Commun . 2023;14(1):1. doi:10.1038/s41467-023-39367-8 Hendel A, Bak RO, Clark JT, et al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat Biotechnol . 2015;33(9):985-989. doi:10.1038/nbt.3290 Nazarov VI, Tsvetkov VO, Popov AA, Balashov I. immunarch: Multi-Modal Immune Repertoire Analytics for Immunotherapy and Vaccine Design in R. Published online 2025. https://immunomind.github.io/docs/ Additional Declarations Yes there is potential Competing Interest. WF is an employee of Colassal Biosciences. MHP is a founder and equity holder in Kamau Tx, holds equity in CRISPR Tx, is on the Board of Directors of Arbor Bio, and is on the SABs of Biogen, Allogene Tx, and Dispatch Tx. Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9269825\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Biological Sciences - Article\",\"associatedPublications\":[],\"authors\":[{\"id\":617097775,\"identity\":\"b5d182f1-1b06-419d-afb6-ad61d6ee8eb1\",\"order_by\":0,\"name\":\"Matthew Porteus\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYDADfjBpA8QHGBgkCCoHKmKQbGAGkmmkaDE4QKwW3dnNxz5/qDhsb3z+/MHPBQk2+XwHmA/e5sGjxezOseQZB84cTtx2I5lZekZCmuXMA2zJ1ni13MgxZjjYdjjB7AYzgzTvj8MGBgd4zKQJa/kHdFj/YebfPAkgLfzfiNDScJhxA0MymzRECw8bfi1AvzCcOZaeOONGspk1T0KageRhNmPLOfi03G4+zFBRY23P33/w8W2eBBsDvuPND2+8waMFSxQw41OOXcsoGAWjYBSMAjQAABGJTuUV3PnHAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0002-3850-4648\",\"institution\":\"Stanford University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Matthew\",\"middleName\":\"\",\"lastName\":\"Porteus\",\"suffix\":\"\"},{\"id\":617097776,\"identity\":\"1b3ad514-bfa2-470a-a786-a110a89ce4fb\",\"order_by\":1,\"name\":\"Sofia Luna\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-9173-9518\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sofia\",\"middleName\":\"\",\"lastName\":\"Luna\",\"suffix\":\"\"},{\"id\":617097777,\"identity\":\"23f31955-aa5c-4a42-a0d5-c3be1caa2f89\",\"order_by\":2,\"name\":\"William Feist\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"William\",\"middleName\":\"\",\"lastName\":\"Feist\",\"suffix\":\"\"},{\"id\":617097778,\"identity\":\"5fadb501-9304-4a1e-8fc2-40b28318e589\",\"order_by\":3,\"name\":\"Ashley Utz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ashley\",\"middleName\":\"\",\"lastName\":\"Utz\",\"suffix\":\"\"},{\"id\":617097779,\"identity\":\"ff815804-22b8-4b86-889b-39bebdf0f75a\",\"order_by\":4,\"name\":\"Jumana Afaghani\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jumana\",\"middleName\":\"\",\"lastName\":\"Afaghani\",\"suffix\":\"\"},{\"id\":617097780,\"identity\":\"1196096f-bce0-46d7-b8e2-6b5069e24dcc\",\"order_by\":5,\"name\":\"Masashi Miyauchi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Masashi\",\"middleName\":\"\",\"lastName\":\"Miyauchi\",\"suffix\":\"\"},{\"id\":617097781,\"identity\":\"d01c3e0a-0beb-41ce-ad79-142fedd089fa\",\"order_by\":6,\"name\":\"Hana Ghanim\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-4102-2367\",\"institution\":\"Stanford University School of Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hana\",\"middleName\":\"\",\"lastName\":\"Ghanim\",\"suffix\":\"\"},{\"id\":617097782,\"identity\":\"0d4fe203-989b-4d7e-8081-618f1d11ff5f\",\"order_by\":7,\"name\":\"Freja Ekman\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-3935-4685\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Freja\",\"middleName\":\"\",\"lastName\":\"Ekman\",\"suffix\":\"\"},{\"id\":617097783,\"identity\":\"a1561e22-df61-4ea0-b31f-f2ccbd1ad803\",\"order_by\":8,\"name\":\"Anais Amaya\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-8396-2226\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Anais\",\"middleName\":\"\",\"lastName\":\"Amaya\",\"suffix\":\"\"},{\"id\":617097784,\"identity\":\"fc9b34da-bada-4091-ab50-2da8d75361a0\",\"order_by\":9,\"name\":\"Sridhar Selvaraj\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sridhar\",\"middleName\":\"\",\"lastName\":\"Selvaraj\",\"suffix\":\"\"},{\"id\":617097785,\"identity\":\"a1ff592f-f436-489f-98f0-b586d42e12e9\",\"order_by\":10,\"name\":\"Norman Russkamp\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Norman\",\"middleName\":\"\",\"lastName\":\"Russkamp\",\"suffix\":\"\"},{\"id\":617097786,\"identity\":\"a5ad7cdf-b7ad-4009-a477-de834680cc4e\",\"order_by\":11,\"name\":\"Ludwig Schmiderer\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Stanford University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ludwig\",\"middleName\":\"\",\"lastName\":\"Schmiderer\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-03-30 16:33:24\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9269825/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9269825/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":106207326,\"identity\":\"3ed1b0da-08a7-4d3d-8f1f-f049c3081ab6\",\"added_by\":\"auto\",\"created_at\":\"2026-04-06 06:06:53\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":121407,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eTargeted integration of therapeutic antibody cassettes in CD34\\u003c/strong\\u003e\\u003csup\\u003e\\u003cstrong\\u003e+\\u003c/strong\\u003e\\u003c/sup\\u003e\\u003cstrong\\u003e human HSPCs\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eSchematic of CRISPR/Cas9 genome-editing at \\u003cem\\u003eCCR5\\u003c/em\\u003e locus with delivery of therapeutic antibody cassettes (anti-PCSK9 antibody (GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e) or anti-TNFα antibody (GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e)) via recombinant AAV6 vector. EEK = EEK promoter, SS = signal sequence, BGH = BGH-polyA signal. \\u003cstrong\\u003eb. \\u003c/strong\\u003eTargeted integration frequency of therapeutic antibody cassettes in cord blood (left) or peripheral blood (right) derived CD34\\u003csup\\u003e+ \\u003c/sup\\u003eHSPCs. Dots represent independent biological donors: n = 10 for GT-Ab\\u003csup\\u003ePCSK9 \\u003c/sup\\u003ecord blood, n = 8 for GT-Ab\\u003csup\\u003eTNFα \\u003c/sup\\u003ecord blood, n = 2 for both conditions peripheral blood. Mean targeted integration frequency shown at bottom of each bar. \\u003cstrong\\u003ec. \\u003c/strong\\u003eCFU assay of mock edited cells versus GT-Ab edited cells. Bars represent relative frequency of each progenitor colony type: CFU-GEMM (multi-potential granulocyte, erythroid, macrophage, megakaryocyte progenitor cells), CFU-GM (colony forming unit- granulocytes and monocytes), BFU-E (erythroid burst forming units). n=3 independent biological donors, with technical duplicate wells for each donor. \\u003cstrong\\u003ed. \\u003c/strong\\u003eTotal colony number for CFU assay described in panel C shown as percent of number of plated cells for each editing condition. n=3 independent biological donors, with technical duplicate wells for each donor. \\u003cstrong\\u003ee. \\u003c/strong\\u003eFrequency of mono- or bi-allelic knock in single cell derived colonies from two of the CFU assays shown in panel C and D. n represents the total number of colonies pooled across two donors. \\u003cstrong\\u003ef. \\u003c/strong\\u003eTargeted integration frequency in CB CD34\\u003csup\\u003e+ \\u003c/sup\\u003ecells with no treatment or treatment with 0.5 µM AZD7648 or 5 µM HEP using AAV6 vector dose of 1250 vg/cell. n=3 independent biological donors. \\u003cstrong\\u003eg. \\u003c/strong\\u003eTargeted integration frequency in CB CD34\\u003csup\\u003e+ \\u003c/sup\\u003ecells with no treatment or treatment with 0.5 µM AZD7648 or 5 µM HEP using AAV6 vector dose of 625 vg/cell. n=3 independent biological donors for all conditions except n=2 GT-Ab\\u003csup\\u003eTNFα \\u003c/sup\\u003eno treatment. All bars represent mean +/- standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/e59d495ea77445ce00d35e2c.jpg\"},{\"id\":106402511,\"identity\":\"e8e10e2a-6fa0-471d-9f47-a868b2f5a51a\",\"added_by\":\"auto\",\"created_at\":\"2026-04-08 09:12:12\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":105847,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGT-Ab human HSPCs engraft in immunodeficient mice\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eGraphical representation of transplantation of human HSPCs into NSG mice and endpoint analysis. \\u003cstrong\\u003eb. \\u003c/strong\\u003eGT-Ab targeted integration frequency in CB CD34\\u003csup\\u003e+ \\u003c/sup\\u003eHSPCs prior to transplantation. n = 2 donors edited and transplanted separately. \\u003cstrong\\u003ec. \\u003c/strong\\u003ePercent human chimerism in the bone marrow at week 16 post-transplant. Dots represent individual mice: n = 4 mice for Mock, n = 5 mice for each GT-Ab condition. \\u003cstrong\\u003ed. \\u003c/strong\\u003ePercent human chimerism in the spleen at week 16 post-transplant. \\u003cstrong\\u003ee. \\u003c/strong\\u003eGT-Ab targeted integration frequency in bone marrow of mice at week 16 post-transplant. Dots represent individual mice: n = 4 mice for Mock, n = 5 mice for each GT-Ab condition. \\u003cstrong\\u003ef. \\u003c/strong\\u003eLineage distribution (CD33\\u003csup\\u003e+\\u003c/sup\\u003e myeloid, CD19\\u003csup\\u003e+\\u003c/sup\\u003e B cell, CD3\\u003csup\\u003e+\\u003c/sup\\u003e T cell) in the bone marrow of mice at week 16 post-transplant. Dots represent individual mice: n = 4 mice for Mock, n = 5 mice for each GT-Ab condition. \\u003cstrong\\u003eg. \\u003c/strong\\u003eSerum antibody concentration for each antibody measured by antigen specific ELISA for each antibody at week 16 post-transplant. n = 2 mice for Mock, n = 5 mice for each GT-Ab condition. All bars represent mean +/- standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/abc81e40216df642688131f5.jpg\"},{\"id\":106207329,\"identity\":\"2d360126-cf17-4e2a-9348-742327c325b4\",\"added_by\":\"auto\",\"created_at\":\"2026-04-06 06:06:53\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":140864,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGT-Ab human B cells express functional antibodies and differentiate into plasma cells \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eTimeline of isolation, genome editing, and media supernatant collection of primary human B cells. \\u003cstrong\\u003eb. \\u003c/strong\\u003eTargeted integration frequency of therapeutic antibody cassettes at \\u003cem\\u003eCCR5\\u003c/em\\u003e locus in primary human CD19\\u003csup\\u003e+\\u003c/sup\\u003e B cells. Cells were targeted with an AAV6 vector dose of 25,000 vg/cell. Dots represent independent biological donors: n = 6 for GT-Ab\\u003csup\\u003ePCSK9 \\u003c/sup\\u003eand n =\\u0026nbsp; 4 for GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e. Mean targeted integration frequency shown at bottom of each bar. \\u003cstrong\\u003ec. \\u003c/strong\\u003eAntibody concentration in cell culture supernatant at each indicated timepoint as measured by antigen specific ELISA for each antibody. n = 4 for all conditions. \\u003cstrong\\u003ed. \\u003c/strong\\u003ePercent TNFα activity measured by NF-κB reporter assay when supernatant applied from GT-Ab B cells. Each donor activity normalized to mock for same B cell donor. Donor 1 \\u0026amp; 2 targeted with an AAV6 vector dose of 10,000 vg/cell and Donor 3 \\u0026amp; 4 targeted with an AAV6 vector dose of 25,000 vg/cell. Dots and error bars represent mean and standard deviation of technical duplicates. \\u003cstrong\\u003ee. \\u003c/strong\\u003eRepresentative flow cytometry plot of mock, GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e, and GT-Ab\\u003csup\\u003eTNFα \\u003c/sup\\u003eB cells differentiated to plasma cells on day 12. \\u003cstrong\\u003ef. \\u003c/strong\\u003eFrequency of CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e- \\u003c/sup\\u003eplasmablasts and CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e+ \\u003c/sup\\u003eplasma cells of live single CD3\\u003csup\\u003e-\\u003c/sup\\u003e cells for three primary B cell donors. \\u003cstrong\\u003eg.\\u003c/strong\\u003e Targeted integration frequency in bulk cells versus FACS isolated CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e- \\u003c/sup\\u003eplasmablasts (PB) and CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e+ \\u003c/sup\\u003eplasma cells (PC) on day 12. n = 3 for all conditions. \\u003cstrong\\u003eh. \\u003c/strong\\u003eAntibody concentration in cell culture supernatant as measured by antigen specific ELISA for each antibody. n = 3 for all conditions. All bars represent mean +/- standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/a9fd8413a713adf1da4ebc43.jpg\"},{\"id\":106207328,\"identity\":\"e2a09171-291a-4883-893b-6d4308604ca8\",\"added_by\":\"auto\",\"created_at\":\"2026-04-06 06:06:53\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":140933,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGT-Ab engrafted immunocompetent mice produce therapeutically relevant concentrations of antibodies\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eTargeted integration frequency of therapeutic antibody cassettes at\\u003cem\\u003e Rosa26 \\u003c/em\\u003elocus in murine HSPCs with and without 1 µM AZD7648. NT = no treatment. Dots represent independent murine HSPC cultures: n = 2 for GT-Ab with no treatment, n = 4 for GT-Ab +AZD. Mean targeted integration frequency shown at bottom of each bar. \\u003cstrong\\u003eb. \\u003c/strong\\u003eGraphical representation of timeline of transplantation, blood collection, and endpoint analysis in C57BL/6. \\u003cstrong\\u003ec. \\u003c/strong\\u003eDonor chimerism (CD45.1\\u003csup\\u003e+\\u003c/sup\\u003e of total CD45) in peripheral blood at week 4, 8, 12, and 16. Dots represent individual mice: n = 5 mice for Mock, n = 6 mice for each GT-Ab condition except in week 12 GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e n = 5 due to insufficient blood collection in one mouse. \\u003cstrong\\u003ed. \\u003c/strong\\u003eTargeted integration frequency of GT-Abs in peripheral blood at week 4, 8, and 12. Values calculated by dividing total targeted integration frequency measured by ddPCR by donor chimerism measured by flow cytometry in panel C. n are same as in panel c. \\u003cstrong\\u003ee. \\u003c/strong\\u003eTargeted integration frequency of GT-Abs in bone marrow (BM), spleen (SP), and peripheral blood (PB) at week 16 compared to targeted integration frequency of HSPCs prior to transplantation (input, n=1). Values for BM, SP, and PB calculated as in panel D. Dots represent individual mice: n = 5 mice for Mock, n = 6 mice for each GT-Ab condition. \\u003cstrong\\u003ef. \\u003c/strong\\u003eSerum antibody concentration of anti-PCSK9 antibody measured by antigen specific ELISA in GT-Ab\\u003csup\\u003ePCSK9 \\u003c/sup\\u003etransplanted mice at week 4, 8, 12, and 16. n are same as in panel C. \\u003cstrong\\u003eg. \\u003c/strong\\u003eSerum antibody concentration of anti-TNFα antibody measured by antigen specific ELISA in GT-Ab\\u003csup\\u003eTNFα \\u003c/sup\\u003etransplanted mice at week 4, 8, 12, and 16. n are same as in panel C. \\u003cstrong\\u003eh. \\u003c/strong\\u003eTargeted integration frequency in bulk spleen cells versus FACS isolated B220\\u003csup\\u003e+ \\u003c/sup\\u003eB cells at week 16 post-transplant. n= 6 mice per condition. Data for bulk same as in panel E. \\u003cstrong\\u003ei. \\u003c/strong\\u003eTotal number of unique clonotypes identified by analysis of mouse BCR sequencing. n = 3 mice per condition. Bars represent mean +/- 2.5-9.75% quantile range. P = 1 for comparison between each group\\u003csup\\u003e \\u003c/sup\\u003eby Kruskal–Wallis test adjusted for multiple testing using the Holm–Bonferroni correction. \\u003cstrong\\u003ej. \\u003c/strong\\u003eD50 diversity score from analysis of clonotypes from mouse BCR sequencing. n = 3 mice per condition. Bars represent mean +/- 2.5-9.75% quantile range. P = 0.4 for Mock v. GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e and Mock v. GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e, P = 0.3 for GT-Ab\\u003csup\\u003ePCSK9 \\u003c/sup\\u003ev. GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e by Kruskal–Wallis test adjusted for multiple testing using the Holm–Bonferroni correction. All bars represent mean +/- standard deviation unless noted otherwise.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/3c349102b2ee8463fe9b0129.jpg\"},{\"id\":106207330,\"identity\":\"5c3cb4cc-92ba-4a71-8aed-051c8ae2502a\",\"added_by\":\"auto\",\"created_at\":\"2026-04-06 06:06:54\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":116968,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEngineered antibody expression can be tuned and reversed via small molecule regulation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eSchematic of gene-targeted antibody fused to FKBP12 destabilization domain (DD) at the C-terminus and resultant proteins products with and without ligand, Shield-1 (Shld1). \\u003cstrong\\u003eb. \\u003c/strong\\u003eTargeted integration frequency of anti-PCSK9 antibody or anti-PCSK9 antibody +DD cassette at \\u003cem\\u003eCCR5\\u003c/em\\u003e locus in primary human CD19\\u003csup\\u003e+\\u003c/sup\\u003e B cells. Dots represent independent biological donors: n = 3 for each condition. \\u003cstrong\\u003ec. \\u003c/strong\\u003eAntibody concentration in cell culture supernatant three days post-editing as measured by antigen specific ELISA for the anti-PCSK9 antibody. n = 4 for all conditions. \\u003cstrong\\u003ed. \\u003c/strong\\u003eAntibody concentration in cell culture supernatant three days post-editing as measured by antigen specific ELISA for each antibody. n = 2 for 0.0078-0.0625 µM, n = 3 for all other concentrations. \\u003cstrong\\u003ee. \\u003c/strong\\u003eAntibody concentration with (purple) and without (gray) Shld1 three days post-editing. Cells were then switched groups (-/+Shld1) and incubated for an additional three days, n = 3. \\u003cstrong\\u003ef.\\u003c/strong\\u003e Frequency of CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e- \\u003c/sup\\u003eplasmablasts and CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e+ \\u003c/sup\\u003eplasma cells of live single CD3\\u003csup\\u003e-\\u003c/sup\\u003e cells for three primary B cell donors. \\u003cstrong\\u003eg.\\u003c/strong\\u003e Targeted integration frequency in bulk cells versus FACS isolated CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e- \\u003c/sup\\u003eplasmablasts (PB) and CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e+ \\u003c/sup\\u003eplasma cells (PC) on day 12, n = 3. \\u003cstrong\\u003eh. \\u003c/strong\\u003eAntibody concentration in cell culture supernatant with and without addition of Shld-1 as measured by antigen specific ELISA, n = 3. All bars represent mean +/- standard deviation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/69f1e2d9d6701b34dbac4ce7.jpg\"},{\"id\":106405499,\"identity\":\"bb93379d-65df-4b2c-ae15-670ac0a8ccd7\",\"added_by\":\"auto\",\"created_at\":\"2026-04-08 09:26:53\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2373222,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9269825/v1/abd733a7-8599-48e9-a3c7-0ee004f545b9.pdf\"}],\"financialInterests\":\"\\u003cb\\u003eYes\\u003c/b\\u003e there is potential Competing Interest.\\nWF is an employee of Colassal Biosciences. MHP is a founder and equity holder in Kamau Tx, holds equity in CRISPR Tx, is on the Board of Directors of Arbor Bio, and is on the SABs of Biogen, Allogene Tx, and Dispatch Tx.\",\"formattedTitle\":\"Engineered hematopoietic stem cells give rise to therapeutic antibody secreting B cells\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eTherapeutic monoclonal antibodies have revolutionized the treatment of a broad spectrum of diseases, including cancer, autoimmune disorders, and infectious diseases. Beginning with the approval of the first monoclonal antibody by the United States Food and Drug Administration (US FDA) in 1986\\u003csup\\u003e1\\u003c/sup\\u003e, the number of clinically-approved therapeutic antibodies has grown at an astounding pace that has only accelerated in recent years\\u003csup\\u003e2\\u003c/sup\\u003e. As of 2024, there were over one hundred clinically-approved antibodies in the US that act on approximately one hundred distinct pharmacological targets\\u003csup\\u003e3\\u003c/sup\\u003e. This has led to the market size of therapeutic antibodies to reach nearly $250 billion in 2023 with a projected growth to \\u0026gt;$400 billion by 2028\\u003csup\\u003e4\\u003c/sup\\u003e. While therapeutic antibodies have proven to address many needs that prior drug modalities (i.e. small molecules) were unable to, we are now in a new era of cell-based medicines to treat and cure disease. The advantage of cell-based medicines is they have entirely different pharmacokinetic and pharmacodynamic properties compared to traditional medicines, including the ability to proliferate, respond to signals, and migrate into tissues\\u003csup\\u003e5\\u003c/sup\\u003e. They also have the potential for long term durability in patients, even for a lifetime if a stem cell is transplanted. With the advances in genome-editing of human cells we can now create a broader class of cell-based medicines by engineering cells with completely new biologic functions. One application of this approach is to modify cells to secrete therapeutic biologic proteins (i.e. antibodies, enzymes, cytokines, hormones). Monoclonal antibodies are a particularly compelling target due to their conserved framework yet variable specificity that supports easy adaption to a broad range of clinical uses.\\u003c/p\\u003e\\n\\u003cp\\u003eDespite their proven success, therapeutic antibodies require repeated administration of high bolus doses every 2-4 weeks to maintain their efficacy\\u003csup\\u003e6\\u003c/sup\\u003e. Highlighting the need for a long-term delivery platform, there have been several strategies that aim to deliver monoclonal antibodies continuously. First, antibody gene therapy involves the \\u003cem\\u003ein vivo\\u003c/em\\u003e gene transfer of an antibody sequence, most successfully through recombinant viral vectors\\u003csup\\u003e7\\u003c/sup\\u003e. Although antibody gene therapy addresses some of the problems associated with traditional antibody injection, there still remain large obstacles such as preexisting immunity to viral vectors and loss of expression over time, which has hampered its clinical development\\u003csup\\u003e8\\u003c/sup\\u003e. Cell-based strategies for delivery of antibodies have primarily focused on editing of autologous B cells for antibody expression\\u003csup\\u003e9–13\\u003c/sup\\u003e. B cells are an optimal choice for antibody production since they are the immune system’s endogenous specialized antibody secreting lineage. However, engineered B cells face significant translational hurdles as standardized clinical protocols for B cell transplantation are lacking, and long-term evidence on their persistence in humans remains unproven.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eConversely, hematopoietic stem cell transplant (HSCT) is a well-established clinical procedure that has proven to have lifelong durability\\u003csup\\u003e14\\u003c/sup\\u003e. Thus, we have developed a genetically engineered cell-based therapy that would enable continuous antibody production from a single dose of autologous hematopoietic stem and progenitor cells (HSPCs). Using CRISPR/Cas9 homology directed repair (HDR) mediated editing, we engineer HSPCs that will give rise to mature B cells capable of secreting a therapeutic antibody of interest. By modifying the HSPC we take advantage of the stem cell’s established ability to engraft and repopulate the blood system\\u003csup\\u003e14\\u003c/sup\\u003e and build on past success of using CRISPR/Cas9 engineered HSPCs for the treatment of disease\\u003csup\\u003e15\\u003c/sup\\u003e. However, we aim to restrict antibody expression to the B cell lineage in order to harness its professional ability for antibody secretion – particularly in terminally differentiated plasma cells, which can produce thousands of antibodies per second\\u003csup\\u003e16,17\\u003c/sup\\u003e. This strategy also leaves other hematopoietic lineages, including the hematopoietic stem cell (HSC) itself, unperturbed, minimizing any consequences of antibody expression from other cell types. We employ precision CRISPR/Cas9 genome-editing to specifically target the therapeutic antibody expression cassette to a previously established genomic safe-harbor site, \\u003cem\\u003eCCR5\\u003c/em\\u003e\\u003csup\\u003e18\\u003c/sup\\u003e, and use a synthetic B cell promoter for antibody expression. By targeting a safe-harbor locus and leaving the endogenous immunoglobulin loci intact, therapeutic antibodies act as passengers in B cell development. We establish proof of concept for this system with two clinically-approved monoclonal antibodies, an anti-PCSK9 antibody for hypercholesterolemia\\u003csup\\u003e19\\u003c/sup\\u003e and an anti-TNFα antibody for autoimmune disease\\u003csup\\u003e20\\u003c/sup\\u003e. In this study, we demonstrate high efficiency targeted integration of GT-Abs in human HSPCs that engraft in immunodeficient mice. We then demonstrate that GT-Ab human B cells and transplanted GT-Ab murine HSCs produce strong expression of both therapeutic antibodies \\u003cem\\u003ein vitro\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003ein vivo\\u003c/em\\u003e, respectively. Importantly, \\u003cem\\u003ein vivo\\u0026nbsp;\\u003c/em\\u003eantibody concentrations reach levels necessary for therapeutic efficacy in humans. Finally, we showcase the ability to regulate antibody expression via a small molecule to improve the safety of this therapy. Altogether, here we show use of a HSPC engineering platform that enables continuous antibody production from derived B cells, offering a versatile system into which any antibody – currently available or developed in the future – could be easily integrated.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEfficient targeting of therapeutic antibody expression cassettes to a safe-harbor locus in human HSPCs\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe need for repeated administration of therapeutic antibodies led us to develop a genome-engineering strategy enabling continuous cell-based antibody production. In order to express antibodies from a single transcript and reduce mispairing with endogenously expressed antibodies, we utilize a peptide linker to physically pair the light and heavy chain of the antibody\\u003csup\\u003e21\\u003c/sup\\u003e. To confirm that functional antibodies can be produced with the linker, each antibody was produced either in the traditional manner using separate plasmids to deliver the light and heavy chain or with one plasmid to deliver the light and heavy chains paired by the peptide linker (Extended Data Fig. 1a). Production of purified antibodies with or without linker was confirmed at the expected molecular weights via western blot analysis for IgG (Extended Data Fig. 1b) and linker antibodies demonstrated comparable activity to their traditional counterparts in antigen-specific functional assays (LDLR expression for anti-PCSK9; TNFa neutralization for anti-TNFa) (Extended Data Fig. 1c,d).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWe used a single-guide RNA (sgRNA) that specifically targets the human \\u003cem\\u003eCCR5\\u0026nbsp;\\u003c/em\\u003esafe harbor locus that was previously validated to achieve high efficiency HDR editing in primary human CD34\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003eHSPCs\\u003csup\\u003e22,23\\u003c/sup\\u003e. When used with high-fidelity Cas9\\u003csup\\u003e24\\u003c/sup\\u003e this sgRNA was found to have no measurable insertions/deletions (indels) in the top \\u003cem\\u003ein silico\\u003c/em\\u003e predicted off-target sites\\u003csup\\u003e22,23\\u003c/sup\\u003e. To deliver gene-targeted antibody (GT-Ab) donors, adeno-associated virus serotype 6 (AAV6) donor repair templates were designed for therapeutic antibody expression (Fig. 1a). For strong expression in the B cell lineage, antibody expression is driven through a previously described synthetic B cell promoter, the EEK promoter, comprised of human immunoglobulin promoter and enhancer elements\\u003csup\\u003e25\\u003c/sup\\u003e. Driving monoclonal antibody expression specifically within the B cell lineage using this promoter has potential efficacy advantages because B lineage cells are the natural producers of high levels of antibody with species-specific glycosylation patterns. It also confers potential safety advantages because the monoclonal antibody will not be produced in other cell types. Primary CD34\\u003csup\\u003e+\\u003c/sup\\u003e cells were edited via electroporation with ribonucleoprotein (RNP) followed by transduction with AAV6 (2500 vector genomes (vg)/cell) carrying the anti-PCSK9 antibody (GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e) or the anti-TNFα antibody (GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e) sequence. We achieved high targeted integration frequencies of approximately 35% edited alleles in umbilical cord-blood (CB) derived CD34\\u003csup\\u003e+\\u003c/sup\\u003e cells and 24% in adult peripheral blood derived CD34\\u003csup\\u003e+\\u003c/sup\\u003ecells in both gene-targeted conditions as measured by in-out droplet digital PCR (ddPCR) (Fig. 1b). To assess the impact of GT-Ab engineering on HSPC proliferation and differentiation capacity, we performed a colony forming unit (CFU) assay and demonstrated distribution of colonies between the major subtypes was not impeded by GT-Ab edited cells relative to mock (electroporation only) edited cells (Fig. 1c). We observed a decrease in total colony formation that was consistent with prior reports of RNP/AAV6 HDR-based editing\\u003csup\\u003e26–28\\u003c/sup\\u003e (Fig. 1d). Measurement of mono- and bi-allelic targeted integration frequencies of each antibody in single-cell colonies revealed that 38% of cells for GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e and 52% of cells for GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e had at least one allele with the therapeutic antibody insertion (Fig. 1e).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eBecause higher doses of AAV6 are associated with increased activation of the p53 pathway\\u003csup\\u003e26\\u003c/sup\\u003e that has potential to impair HSPC viability and engraftment, we decreased the AAV6 vector dose while maintaining high efficiency editing through use of modulators of the DNA repair pathway. There have been several reported strategies to bias the cell’s endogenous repair pathways following double-stranded break. Small molecule inhibition of non-homologous end-joining (NHEJ) via inhibition of DNA-PKcs with AZD7648 has been shown to increase the frequency of HDR-based editing in multiple primary human cell types, including HSPCs\\u003csup\\u003e29\\u003c/sup\\u003e. Alternatively, inhibition of 53BP1, a protein that favors NHEJ by inhibiting the early rate-limiting end-resection step of HDR initiation\\u003csup\\u003e30\\u003c/sup\\u003e, has also been reported to increase HDR-based editing\\u003csup\\u003e26,31,32\\u003c/sup\\u003e. Thus, we tested the use of either small molecule AZD7648 (AZD) or peptide inhibitor of 53BP1 (HDR Enhancer Protein, HEP) with half (1250 vg/cell) or one-fourth (625 vg/cell) the vector dose of AAV6 in CD34\\u003csup\\u003e+\\u003c/sup\\u003e HSPCs. As expected, lowering of AAV6 vector dose alone led to lower targeted integration frequency and addition of either AZD or HEP led to improvement of targeted integration at both vector doses that reached or exceeded frequencies seen in the original high vector dose condition shown in Fig. 1b (2500 vg/cell) (Fig. 1f,g). Additionally, CFU assay analysis demonstrated that addition of AZD or HEP did not influence HSPC colony distribution (Extended Data Fig. 2a,b). Therefore, to preserve cell health and engraftment potential, we chose to move forward in future experiments using the lowest vector dose tested (625 vg/cell) combined with use of either AZD or HEP to maintain high-efficiency editing.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGT-Ab engineered HSPCs engraft in immunodeficient mice\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we sought to confirm that our genome engineering strategy does not impair the key function of HSPCs to engraft and reconstitute the blood system. Transplantation of human HSPCs into immunodeficient mice is a powerful tool to evaluate human cell hematopoiesis and is considered the pre-clinical gold standard for evaluating the stem cell potential of cell therapies\\u003csup\\u003e33\\u003c/sup\\u003e. We therefore edited two donors of CB CD34\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003ecells with either GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e or GT-Ab\\u003csup\\u003eTNFα\\u0026nbsp;\\u003c/sup\\u003eusing 625 vg/cell of AAV6 and either AZD or HEP. GT-Ab HSPCs were then transplanted into sub-lethally irradiated NSG mice and chimerism and blood cell lineage formation was analyzed after 16 weeks (Fig. 2a). Prior to transplantation, allelic editing frequencies in HSPCs were ~41% in the AZD conditions and ~35% in the HEP conditions (Fig. 2b). At 16 weeks post-transplantation, cells from all GT-Ab conditions successfully engrafted in the bone marrow and showed migration to the spleen, a secondary hematopoietic site (Fig. 2c,d). There was a decrease in engraftment in the GT-Ab conditions compared to mock edited cells, which was consistent with those seen in prior studies using RNP/AAV6 gene-modified cells\\u003csup\\u003e28,34,35\\u003c/sup\\u003e and thus likely not due to the introduction of the antibody cassette itself. Further supporting this point, there was maintenance of GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e or GT-Ab\\u003csup\\u003eTNFα\\u0026nbsp;\\u003c/sup\\u003eedited cells in the bone marrow of mice at endpoint, indicating gene-targeted HSPCs retain their ability to engraft (Fig. 2e). By using the lower MOI of AAV6, we observed no drop in engraftment of the HDR edited allele frequency from pre-transplant (Fig. 2b) following engraftment (Fig. 2e). There was variability in frequency of targeted integration between mice, but on average the editing frequency (38% in GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e+AZD, 30% in GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e+HEP, 56% in GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e+AZD) neared or surpassed that seen in each condition pre-transplant except in one group (14% in GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e+HEP). GT-Ab HSPCs reconstituted the myeloid, B cell, and T cell lineages at similar frequencies to control cells indicating the gene-editing strategy does not introduce major reconstitution bias. There was an observed bias to the myeloid lineage in individual mice that exhibited overall lowered levels of engraftment, consistent with prior reports using this mouse model\\u003csup\\u003e22,23,35\\u003c/sup\\u003e (Fig. 2f). Notably, due to their lack of immune system, immunodeficient mice do not reconstitute with highly differentiated human B cells\\u003csup\\u003e36,37\\u003c/sup\\u003e. Likely due to insufficient T cell help, in previous studies we have observed very low or absent levels of human IgG production from xeno-transplanted mice\\u003csup\\u003e23\\u003c/sup\\u003e. Thus, when we measured therapeutic antibody concentration in the serum of GT-Ab xeno-transplanted mice via antigen specific ELISA, it was not surprising to see very low levels of anti-PCSK9 antibodies in the\\u0026nbsp;GT-Ab\\u003csup\\u003ePCSK9\\u0026nbsp;\\u003c/sup\\u003emice and no anti-TNFα antibodies in the GT-Ab\\u003csup\\u003eTNFα\\u0026nbsp;\\u003c/sup\\u003eexcept a very low amount in one mouse (4.7 ng/mL) (Fig. 2g).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGT-Ab engineered B cells efficiently secrete therapeutic antibodies\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGiven the limitations in B cell development of transplanted human HSPCs in immunodeficient mice, direct editing of primary human B cells offers a potential alternative for modeling gene-targeted antibody secretion. CD19\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003eB cells from healthy adult peripheral blood mononuclear cells (PBMCs) were isolated and activated for three days using a previously published protocol\\u003csup\\u003e11\\u003c/sup\\u003e. We then used the same GT-Ab engineering system described above to edit the activated B cells and measured targeted integration frequency and antibody concentration in the culture supernatant after varying amounts of time in culture (3 and 5 days) (Fig. 3a). \\u0026nbsp;At three days post-editing, we observed targeted integration frequencies in the B cells that was comparable to those seen in CD34\\u003csup\\u003e+\\u003c/sup\\u003e cells (average 30.8% for GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e and 23.2% for GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e) (Fig. 3b). At day 9 post-activation after leaving cells for 3 days in culture, we observed efficient secretion of either anti-PCSK9 or anti-TNFα antibodies into the culture supernatant measured by antigen specific ELISA for each antibody (Fig. 3c). After replating and a five-day incubation period, we observed an expected increase in antibody concentration in both conditions (Fig. 3c). Interestingly, anti-PCSK9 antibodies were produced more efficiently than anti-TNFα antibodies, potentially reflecting differences in half-life of antibodies or the use of more contemporary antibody engineering approaches in the development of the anti-PCSK9 antibody. To demonstrate that antibodies produced from gene-targeted B cells were functional, we applied the supernatant from the GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e B cells to a TNFα activity assay using a THP-1 NF-κB reporter cell line\\u003csup\\u003e38\\u003c/sup\\u003e. GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e B cell supernatant collected from four biological donors was able to efficiently eliminate TNFα activity compared to supernatant from mock edited cells (Fig. 3d).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we investigated if GT-Ab B cells were able to differentiate into plasma cells, the terminally differentiated antibody secreting cell type, capable of secreting thousands of antibodies per cell per second\\u003csup\\u003e17,39\\u003c/sup\\u003e. Using a previously defined protocol\\u003csup\\u003e12\\u003c/sup\\u003e, GT-Ab B cells were successfully differentiated into CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e- \\u0026nbsp;\\u003c/sup\\u003eplasmablasts and CD38\\u003csup\\u003e++\\u003c/sup\\u003eCD138\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003eplasma cells at similar frequencies to control cells (Fig. 3e,f). Plasmablasts and plasma cells were then isolated via fluorescence activated cell sorting (FACS) and genomic DNA was isolated from each population. Analysis of editing in each population by ddPCR revealed maintenance of GT-Ab edited alleles in both populations compared to the bulk population, indicating that there is no selection against edited cells (Fig. 3g). Notably, differentiated cells were able to secrete antibodies with measured concentrations highest at day 10 of differentiation (Fig. 3h). Altogether, these results support the idea that B cells carrying the GT-Ab edit can successfully secrete therapeutic antibodies and differentiate into plasma cells.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTransplanted GT-Ab mouse HSPCs achieve therapeutic antibody concentrations\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo better evaluate \\u003cem\\u003ein vivo\\u003c/em\\u003e antibody production, we modeled autologous HSCT through transplantation of murine GT-Ab HSPCs into immunocompetent mice, capable of reconstituting with fully mature antibody secreting B cells. To accomplish this, murine c-kit\\u003csup\\u003e+\\u003c/sup\\u003e HSPCs were isolated from bone marrow of CD45.1 C57BL/6 mice and expanded ex vivo, using a protocol adapted from previously published protocols\\u003csup\\u003e40,41\\u003c/sup\\u003e. Following expansion, we employed a sgRNA targeting the murine \\u003cem\\u003eRosa26\\u003c/em\\u003e safe harbor locus\\u003csup\\u003e42–44\\u003c/sup\\u003e and re-designed the AAV6 repair donors containing the antibody cassettes for integration at this locus (Extended Data Fig. 3a). To reach editing frequencies in murine HSPCs similar to that achieved in human HSPCs we tested use of AZD (Extended Data Fig. 3b) and found that 1 µM AZD was able to increase targeted integration frequencies to those achieved in human HSPCs (Fig. 4a).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eUsing this optimized editing protocol, 1x10\\u003csup\\u003e6\\u003c/sup\\u003e CD45.1 GT-Ab murine HSPCs along with 2.5x10\\u003csup\\u003e5\\u0026nbsp;\\u003c/sup\\u003eCD45.1/CD45.2 bone marrow support cells were transplanted into lethally irradiated CD45.2 C57BL/6 mice and peripheral blood was taken every four weeks until endpoint at 16 weeks post-transplant (Fig. 4b). Prior to transplant, cells were assessed for frequency of c-Kit\\u003csup\\u003e+\\u003c/sup\\u003eSca1\\u003csup\\u003e+\\u003c/sup\\u003eLineage\\u003csup\\u003e−\\u003c/sup\\u003e (KSL) HSPCs and we found a slight decrease in frequency of KSL cells in the GT-Ab conditions compared to mock (Extended Data Fig. 3c,d). We observed engraftment of mock and GT-Ab HSPCs in the peripheral blood at week four post-transplant (average 82.8% for mock, 57.9% for GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e, and 71.5% for GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e), which decreased at week 8 and then remained relatively stable through week 16 for the GT-Ab conditions (Fig. 4c). Consistent that gene editing causes some toxicity to HSPCs\\u003csup\\u003e44\\u003c/sup\\u003e, endpoint analysis of bone marrow showed lower engraftment of GT-Ab HSPCs (average chimerism 8.3% for both GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e and GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e) compared to mock edited cells (average 79.9%). This pattern was also consistent although less prominent in the spleen (average chimerism 83.3% for Mock versus 19.5% for GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e and 29.4% for GT-Ab\\u003csup\\u003eTNFα\\u003c/sup\\u003e) (Extended Data Fig. 4a). We also observed that donor lineage reconstitution (B cell, T cell, myeloid) in the spleen and peripheral blood was similar when comparing mock and GT-Ab conditions. In the bone marrow, likely due to the very low levels of donor engraftment, we saw bias toward the B cell lineage in the GT-Ab conditions, although all three hematopoietic lineages were still able to form (Extended Data Fig. 4b). Importantly, we saw stable maintenance of GT-Ab edited alleles compared to input editing in the peripheral blood at each timepoint (Fig. 4d) and in all three hematopoietic compartments at endpoint when accounting for donor chimerism (Fig. 4e), indicating that there is no selection against the GT-Ab edited cells following engraftment.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo evaluate antibody secretion from transplanted cells, serum samples were collected every four weeks and run on antigen specific ELISA. We measured strong expression of each antibody as early as four weeks post-transplant with concentrations increasing until 12 weeks and maintaining to endpoint at week 16 (Fig. 4f,g). Consistent with \\u003cem\\u003ein vitro\\u0026nbsp;\\u003c/em\\u003edata in GT-Ab human B cells, we saw the anti-PCSK9 antibody was produced much more efficiently than the TNFα antibody in the serum of mice. At week 16, the anti-PCSK9 antibody reached an average concentration of 206 µg/mL while the anti-TNFα antibody reached an average concentration of 5.5 µg/mL. Nevertheless, both antibodies either reached or far surpassed concentrations necessary for therapeutic efficacy in humans for each respective antibody (approximate therapeutic concentration 10-15 µg/mL for anti-PCSK9 and 3-7 µg/mL for anti-TNFα antibody) \\u0026nbsp;\\u003csup\\u003e45,46\\u003c/sup\\u003e. We also assessed mouse IgG production in the transplanted mice and found there was an average of ~1600 µg/mL of mouse IgG at 16 weeks. Thus anti-PCSK9 and anti-TNFα antibodies represented an average 13.1% and 0.4% of total IgG, respectively (Extended Data Fig. 4c). Of note, due to the lower chimerism observed in the GT-Ab mice, these serum antibody concentrations were achieved with only 3.2-18.5% total edited cells in the bone marrow when accounting for editing frequency and chimerism, which resulted in 4.3-13.8% edited cells in the spleen and 3.1-13.9% edited cells in the peripheral blood. The fact that robust antibody production can be achieved despite low levels of edited cell chimerism indicates that our approach may be effective even with low levels of engraftment. This suggests that durable therapeutic antibody production could be established without the need for aggressive myeloablative conditioning, thereby improving the safety and clinical feasibility of this strategy.\\u003c/p\\u003e\\n\\u003cp\\u003eWe next characterized B cell development in mice transplanted with GT-Ab murine HSPCs to evaluate for any perturbations. First, we performed flow cytometry to phenotypically characterize B cells in the bone marrow and spleen. In the bone marrow, we observed similar frequencies of B220\\u003csup\\u003elow\\u003c/sup\\u003e pre-pro-B, pro-B, and pre-B cells in the bulk population, but observed an increase in pre-pro-B cells in the GT-Ab conditions in the donor CD45.1\\u003csup\\u003e+\\u003c/sup\\u003e cells alone which may reflect artifact of low donor engraftment frequencies (Extended Data Fig. 5a). In the spleen, we looked for IgD\\u003csup\\u003e+\\u003c/sup\\u003e mature B cells and found that mock and GT-Ab cells formed similar frequencies of both early mature (IgD\\u003csup\\u003e+\\u003c/sup\\u003eIgM\\u003csup\\u003e+\\u003c/sup\\u003e) and late mature (IgD\\u003csup\\u003e+\\u003c/sup\\u003eIgM\\u003csup\\u003e-\\u003c/sup\\u003e) B cells in both the bulk population and donor CD45.1\\u003csup\\u003e+\\u003c/sup\\u003e cells alone (Extended Data Fig. 5b). We then isolated the B220\\u003csup\\u003e+\\u003c/sup\\u003e donor-derived spleen cells by FACS and found that GT-Ab targeted integration frequencies were comparable to that of the bulk population, indicating no selection against the edited cells during formation of B cells (Fig. 4h). To more carefully interrogate the development of GT-Ab B cells in vivo, we performed B cell receptor (BCR) sequencing on the donor B220\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003espleen cells to evaluate for any perturbation in the BCR repertoire. We found a similar number of clonotypes and length of CDR3 regions between groups (Fig. 4i, Extended Data Fig. 5c). We also found that the number of clones occupying the top 50% of total sequencing reads (D50 diversity index) was similar amongst all groups, indicating similar BCR diversity (Fig. 4j). Similarly, there was no significant differences in V/J gene usage (Extended Data Fig. 5d,e). Taken together, these data largely support that introduction of the GT-Ab cassette in a safe-harbor locus and expression of exogenous antibodies does not impair B cell formation or development in vivo.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEngineered antibody levels can be modulated through small molecule regulation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe high levels of antibodies seen in the immunocompetent mouse model prompted us to develop a system in which antibody expression could be regulated. Previous work by the Wandless group developed a system to tune protein expression through fusion of a protein of interest to a FK506 binding protein 12 (FKBP12) destabilization domain (DD)\\u003csup\\u003e47\\u003c/sup\\u003e. \\u0026nbsp;The protein fused to the DD is rapidly degraded unless a synthetic ligand, Shield-1 (Shld1), is provided to stabilize the DD. We designed an AAV6 repair template containing the anti-PCSK9 antibody expression cassette with the DD fused to the C-terminus of the heavy chain of the antibody (Fig. 5a, Extended Data Fig. 6a). We then targeted primary human B cells with the antibody alone (GT-Ab\\u003csup\\u003ePCSK9\\u003c/sup\\u003e) or with the antibody fused to the FKBP12-DD (GT-Ab\\u003csup\\u003ePCSK9+DD\\u003c/sup\\u003e). Despite similar targeted integration frequencies in each group (Fig. 5b), addition of the FKBP12-DD led to decreased antibody expression even in the presence of Shld1 (Fig. 5c). Nonetheless, to demonstrate that antibody levels can be modulated using this system, we applied varying concentrations of Shld1 to GT-Ab\\u003csup\\u003ePCSK9+DD\\u0026nbsp;\\u003c/sup\\u003eedited cells. Measurement of antibody concentration in the supernatant revealed that expression could indeed be finely tuned through Shld1 concentration (Fig. 5d, Extended Data Fig. 6b). Lastly, we assessed whether antibody expression is reversible using the FKBP12-DD. GT-Ab\\u003csup\\u003ePCSK9+DD\\u0026nbsp;\\u003c/sup\\u003eB cells were split into a +Shld1 (Group A) and -Shld1 (Group B) condition and after three days, antibody expression was almost exclusively seen in the +Shld1 condition (Group A). To evaluate reversibility, we then switched the groups and checked antibody concentration in the supernatant after three days. We observed little antibody expression in the cells with Shld1 removed (Group A), while the introduction of Shld1 to Group B led to new antibody expression (Fig. 5e). Lastly, we demonstrate that antibody secretion can also be controlled using the FKBP12-DD in human B cells differentiated to plasma cells (Fig. 5f-h). Altogether, these results demonstrate that addition of the FKBP12-DD allows for finely tunable and reversible antibody expression. The ability to precisely regulate antibody levels may be critical for the safe delivery of sustained antibody production using cell-based therapies.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAlthough hematopoietic stem cell transplantation has been a curative therapy for decades, advances in genome-engineering allow us to expand the scope for which it may be useful. The FDA approval of the first CRISPR edited HSC medicines in 2024\\u003csup\\u003e48\\u003c/sup\\u003e marked a major step forward in using genome-engineering to treat disease. While autologous HSCT has traditionally focused on curing genetic diseases, our work expands this paradigm, demonstrating that genome-edited HSCs could effectively treat non-genetic conditions by re-writing new function into cells. Here we explore one application of this ability by using HDR-based genome-editing of HSPCs to introduce therapeutic antibody expression in the B cell lineage. We first show efficient targeted integration frequency of up to 40% GT-Ab targeted alleles in human CD34\\u003csup\\u003e+\\u003c/sup\\u003eHSPCs. Because RNP/AAV6-based editing has been shown to impact the health and engraftment ability of HSPCs\\u003csup\\u003e49–51\\u003c/sup\\u003e, we next lowered the amount of AAV6 used in conjunction with modulators of the DNA repair pathway to maintain high-efficiency editing. Using either inhibition of NHEJ (AZD7648) or inhibition of 53BP1 (HEP), we considerably lowered the vector dose of AAV6 while maintaining ~40% GT-Ab targeted alleles (Fig. 1). We next demonstrated that GT-Ab human HSPCs successfully engraft in immunodeficient mice, with edited alleles maintained at an average of ~35% across conditions in the bone marrow (Fig. 2). Although we saw minimal antibody expression in the xenografted mice due to their limited ability to form antibody secreting B cells, we then turned to two alternate models to evaluate antibody expression. First, we show that GT-Ab B cells produce functional antibodies, and these B cells can mature into plasma cells \\u003cem\\u003ein vitro\\u003c/em\\u003e (Fig. 3). Next, we model autologous HSCT in an immunocompetent setting by engineering and transplanting GT-Ab murine HSPCs which led to strong production of therapeutically relevant concentrations of antibodies \\u003cem\\u003ein vivo\\u003c/em\\u003e with no apparent disruption in normal B cell development (Fig. 4). Lastly, by fusing the gene-targeted antibody to a destabilization domain, we demonstrate that antibody concentration can be controlled through small molecule modulation (Fig. 5).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe use of cells as drug delivery vehicles has long gained attention due to the potential to harness the intrinsic pharmacokinetic and biodistribution properties of different cell types\\u003csup\\u003e52\\u003c/sup\\u003e. Yet somatic cell-based therapies are unlikely to rival the lifelong durability of HSCT. Additionally, past efforts have relied on transient modification of cells, such as through drug encapsulation or attachment on the cell surface\\u003csup\\u003e53\\u003c/sup\\u003e. With advances enabling the stable integration of large genetic payloads into a variety of primary cell types\\u003csup\\u003e54\\u003c/sup\\u003e, it is now possible to achieve sustained, long-term expression of therapeutic proteins. A permanently genetically engineered stem cell confers ideal properties for the stable production of drugs through a single dose, unlike any other medicine developed before.\\u003c/p\\u003e\\n\\u003cp\\u003eIn this work, we utilize RNP/AAV6 HDR-mediated editing as AAV6 remains one of the most efficient methods of donor DNA delivery to HSPCs. Despite this, it is well known that the use of AAV6 impacts the ability HSPCs to engraft\\u003csup\\u003e22,23,28\\u003c/sup\\u003e, which is primarily due to the activation of the DNA damage response and p53 pathway\\u003csup\\u003e26,55\\u003c/sup\\u003e. Yet,\\u0026nbsp;much work is currently underway to ameliorate these effects. Here we explore some of these methods by reducing the vector dose of AAV6 in combination with NHEJ or 53BP1 inhibitors, which has been previously shown to reduce toxicity in HSPCs\\u003csup\\u003e26,29,32\\u003c/sup\\u003e. Alternatively, a range of DNA donor delivery approaches—including single-stranded oligodeoxynucleotides (ssODNs), lipid nanoparticles, and integrase-deficient lentiviral vectors (IDLVs)\\u003csup\\u003e50,56\\u003c/sup\\u003e—are under active investigation for reducing toxicity. As these strategies continue to mature, the antibody engineering platform described here could be readily incorporated into alternative delivery vectors.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePast work has investigated the direct use of human B cells and plasma cells to deliver therapeutic proteins, including antibodies\\u003csup\\u003e9–13,57\\u003c/sup\\u003e. While we believe the transplantation of engineered HSPCs has the potential for longer lasting durability than this approach, we recognize the choice of B cells specifically to express the therapeutic antibody to be important. We therefore forego the use of a ubiquitous promoter that might express in many off-target lineages in favor of the EEK promoter that limits expression to the B cell lineage to limit any unintended effects on other cell types. Additionally, as the endogenous antibody-secreting lineage, B cells offer several advantages over other cell types. First, terminally differentiated plasma cells are capable of secreting antibodies at an enormous rate (10\\u003csup\\u003e2\\u003c/sup\\u003e-10\\u003csup\\u003e3\\u003c/sup\\u003e antibodies per second per cell)\\u003csup\\u003e16,17\\u003c/sup\\u003e. In our approach, the frequency of engineered HSPCs in the bone marrow should mirror the frequency of engineered B cells in the periphery. Use of a pan-B cell promoter drives antibody expression across all B cell sub-types, including plasma cells, allowing for robust antibody secretion proportional to overall B cell reconstitution. In addition to producing high levels of antibodies, B cells may endow beneficial natural post-translational modifications to their antibody products, particularly since IgG antibodies undergo extensive N-glycosylation following translation\\u003csup\\u003e58\\u003c/sup\\u003e. Glycosylation of antibodies is known to effect immunogenicity, function, and longevity\\u003csup\\u003e59,60\\u003c/sup\\u003e, thus B cell produced antibodies have the potential to be longer lived and less immunogenic than their traditionally injected counterparts. Because expression from B cells is likely to be most advantageous, future work may benefit from exploring methods of more specific B cell lineage expression than use of a synthetic promoter, such as knock-in downstream of a B cell specific gene, co-opting an endogenous promoter.\\u003c/p\\u003e\\n\\u003cp\\u003eDespite the grueling repeated injection or infusion regimens, it is unlikely that patients with diseases that currently require injections of therapeutic antibodies would be subjected to the toxic chemotherapeutic pre-conditioning that is currently the standard of care prior to HSCT. Rather, we envision this therapy to be paired with reduced-intensity, non-toxic conditioning regimens. Currently, strategies to employ antibody-based conditioning which selectively target and deplete HSCs are in both pre-clinical work and clinical trials\\u003csup\\u003e61–64\\u003c/sup\\u003e. Notably, in our model of autologous HSCT in immunocompetent mice the GT-Ab mice had an average of only 2.4% edited alleles in the bone marrow at endpoint which resulted in therapeutically relevant antibody concentrations in the bloodstream (on the scale of micrograms/milliliter), highlighting the potential compatibility of this therapy with reduced-intensity pre-transplant conditioning.\\u003c/p\\u003e\\n\\u003cp\\u003eAlthough two clinically relevant monoclonal antibodies were used in this work as a proof-of-concept, it is important to note that this platform’s modular nature allows for easy swapping of monoclonal antibodies for current and future targets. Furthermore, as antibody-like proteins (such as nanobodies\\u003csup\\u003e65\\u003c/sup\\u003e, heavy-chain antibodies (HCAbs)\\u003csup\\u003e66\\u003c/sup\\u003e, and bispecific T cell engagers (BITEs)\\u003csup\\u003e67\\u003c/sup\\u003e) continue to be developed, these therapeutics could also readily be implemented in our system. Further, while antibodies are a natural first drug to be produced by B cell progeny, more broadly, this system has the potential to deliver any protein biologic. Many biologics, especially those of small size, currently suffer from short half-lives due to rapid kidney filtration or cleavage by peptidases necessitating frequent, taxing dosing regimens for patients\\u003csup\\u003e68\\u003c/sup\\u003e. Fusion proteins (e.g. etanercept), enzymes (e.g. factor IX, lysosomal enzymes), and peptides (e.g. semaglutide) could all potentially benefit from inclusion in this system. Overall, the work presented here provides a framework for sustained delivery of therapeutic protein biologics from a single infusion of HSPCs.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAntibody production and purification.\\u003c/strong\\u003e Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker. Antibody constructs were expressed in Expi293F cells (Thermo Fisher Scientific, cat.: A14527) and grown in combined media (66% FreeStyle/33% Expi media, Thermo Fisher Scientific, cat.: 12338018 and A1435101, respectively) at 37 \\u0026deg;C and 8% CO2 with shaking at 120 rpm. The day of transfection, cells were diluted to a density of approximately 3-4\\u0026thinsp;\\u0026times;\\u0026thinsp;10\\u003csup\\u003e6\\u003c/sup\\u003e cells per ml. For a 100 mL transfection volume: 60 \\u0026micro;g of total DNA was added to 10 mL of expression media, followed by dropwise addition of 130 \\u0026micro;L of FectoPRO transfection reagent (Polyplus, S\\u0026eacute;bastien Brant, France, cat.: 101000014) with vigorous mixing. Heavy and light chain plasmids were used at a 1:1 ratio, while single plasmid linker antibody constructs were used alone. For simultaneous production of a traditional and linker antibody, 20 \\u0026mu;g of each plasmid (traditional light chain, traditional heavy chain, and linker antibody) were applied in 100 mL cell cultures. After a 10-minute incubation at room temperature, the transfection mixture was added to 100\\u0026thinsp;ml of cells. D-glucose (4 g/L, Sigma-Aldrich) and valproic acid (3 mM, Acros Organics) were then added to the cells immediately post-transfection to increase recombinant protein production. The cells were harvested 3\\u0026ndash;5\\u0026thinsp;days after transfection by spinning the cultures at 7,000g for 5 minutes. Cell culture supernatants were filtered through a 0.22\\u0026mu;m filter, combined with 1/10th volume of 10x HEPES-buffered saline (HBS) and purified using the \\u0026Auml;KTA pure fast performance liquid chromatography (FPLC, Cytiva) with a 5 mL MabSelect PrismA column (Cytvia, cat.: 17549802). The \\u0026Auml;KTA system was equilibrated with: A1 \\u0026ndash; 1x HBS; A2 \\u0026ndash; 100\\u0026thinsp;mM glycine pH 2.8; B1 \\u0026ndash; 0.5\\u0026thinsp;M NaOH; Buffer line \\u0026ndash; 1x HBS; and Sample lines \\u0026ndash; ddH2O. The column was washed with A1 and then the proteins were eluted with A2 into 50mL conical tubes containing 2.5 mL of 1M HEPES buffer, pH 7.4. The column was then washed with A1, B1 and A1. The resultant Fc-containing samples were buffer-exchanged and concentrated using 50-kDa or 100-kDa cutoff centrifugal concentrators. The samples were further purified by size exclusion on the same \\u0026Auml;KTA FPLC with Superdex 200 Increase 10/ 300 GL column (Cytiva, cat.: 28-9909-44) and further concentrated using 50-kDa or 100-kDa cutoff centrifugal concentrators. 10% glycerol was added and protein concentration was determined by absorbance at 280 nm (A280) on a NanoDrop UVVis spectrophotometer. The purity was assessed by protein gel electrophoresis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003erAAV6 vector design, production, and purification.\\u0026nbsp;\\u003c/strong\\u003eRecombinant donor vectors were cloned from a gBlock Gene Fragments (Integrated DNA Technologies, IDT, San Jose, CA, USA) using restriction enzyme digest or Gibson Assembly (New England Biolabs, Ipswich, MA, USA) into an Adeno-associated virus, serotype 6 (AAV6) vector plasmid derived from the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA). rAAV6 vectors were either produced in-house or purchased from SignaGen Laboratories (Frederick, MD, USA), PackGene Biotech (Houston, TX, USA) or VectorBuilder Inc. (Chicago, IL, USA). For in-house production, 10-12\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e HEK-293T cells per plate were seeded in ten 15 cm\\u003csup\\u003e2\\u003c/sup\\u003e dishes. After 24-48 hours, each dish was transfected with a standard polyethylenimine (PEI) transfection using 6 \\u0026mu;g ITR-containing plasmid and 22 \\u0026mu;g pDGM6 plasmid (gift from David Russell, University of Washington, Seattle, WA, USA). After 48-72 hour incubation, cells were harvested and vectors were purified using the AAVpro purification kit (cat.: 6666; Takara Bio, Kusatsu, Shiga, Japan) as per manufacturer\\u0026rsquo;s instructions. Viral titers were determined using droplet digital PCR (ddPCR) to measure the number of vector genomes per microliter as previously described\\u003csup\\u003e69\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003ch3\\u003e\\u003cstrong\\u003eCD34\\u003csup\\u003e+\\u003c/sup\\u003e HSPC isolation and culture.\\u0026nbsp;\\u003c/strong\\u003eHuman cord-blood CD34\\u003csup\\u003e+\\u003c/sup\\u003e HSPCs were isolated from cord blood by the Stanford Binns Program for Cord Blood Research. Samples were obtained with approval from the Stanford Institutional Review Board Committee under protocol 33813. Briefly, isolated mononuclear cells were positively selected for CD34 using the CD34+ MicroBead Kit Ultrapure (Miltenyi Biotec, San Diego, CA, cat.: 130-100-453). Peripheral blood CD34\\u003csup\\u003e+\\u003c/sup\\u003e HSPCs were purchased from AllCells (Alameda, CA) or the Fred Hutchinson Cancer Center (Seattle, WA). Cells were cultures at 1.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e\\u0026ndash;2.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/mL in CellGenix\\u0026reg; GMP Stem Cell Growth Medium (SCGM, CellGenix, Freiburg, Germany, cat.: 20802-0500) supplemented with a human cytokine (PeproTech, Rocky Hill, NJ, USA) cocktail: stem cell factor (100 ng/mL), thrombopoietin (100 ng/mL), Fms-like tyrosine kinase 3 ligand (100 ng/mL), interleukin 6 (100 ng/mL), streptomycin (20 mg/mL), and penicillin (20 U/mL), and 35 nM of UM171 (APExBIO, Houston, TX, USA, cat.: A89505), as previously described\\u003csup\\u003e70\\u003c/sup\\u003e. Cells were cultured at 37\\u0026deg;C in a hypoxic incubator with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e and 5% O\\u003csub\\u003e2\\u003c/sub\\u003e.\\u0026nbsp;\\u003c/h3\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eB cell isolation and culture\\u003c/strong\\u003e. B cells were isolated by negative selection using the human B Cell Isolation Kit II (Miltenyi Biotec, cat: 130-091-151) from leukoreduction system (LRS) chambers obtained deidentified from the Stanford Blood Center. Cells were cultured in Iscove\\u0026rsquo;s Modified Dulbecco\\u0026rsquo;s Medium (IMDM) (Thermo Fisher Scientific, Waltham, MA, USA, cat.: 12440053) supplemented with 10% bovine growth serum (Cytiva, Marlborough, MA, USA, cat.: SH30541.03HI), 1% penicillin-streptomycin (Cytiva, cat.: SV30010), 55 \\u0026mu;M of 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA, cat.: M3148), 50 ng/mL of IL-2 (Peprotech, cat.: 200-02), 50 ng/mL of IL-10 (Peprotech, cat.: 200-10), 10 ng/mL of IL-15 (Peprotech, cat.: 200-15), 100 ng/mL of recombinant human MEGACD40L (Enzo Life Sciences, Farmingdale, NY, USA, cat.: ALX-522-110-C010), and 1 \\u0026mu;g/mL of CpG oligonucleotide 2006 (Invivogen, San Diego, CA, USA, cat.: tlrl2006-1) at a density of 1\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL at 37 \\u0026deg;C, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and ambient oxygen levels, as described previously\\u003csup\\u003e11\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePlasma cell differentiation and characterization.\\u0026nbsp;\\u003c/strong\\u003eB cells were isolated as described above and then activated and differentiated as described previously\\u003csup\\u003e71\\u003c/sup\\u003e. Briefly, cells were cultured in a base media of Iscove\\u0026rsquo;s Modified Dulbecco\\u0026rsquo;s Medium (IMDM) (Thermo Fisher Scientific, cat.: 12440053) supplemented with 10% bovine growth serum (Cytiva, cat.: SH30541.03HI), 55 \\u0026mu;M of 2-mercaptoethanol (Sigma-Aldrich, cat.: M3148). For the first seven days, media was supplemented with 100 ng/mL of recombinant human MEGACD40L (Enzo Life Sciences, cat.: ALX-522-110-C010), 1 \\u0026mu;g/mL of CpG oligonucleotide 2006 (Invivogen), and 40 ng/mL IL-21 (Peprotech, cat.: 200-21). For days 7-12, media supplementation was changed to 50 ng/mL IL-6 (Peprotech, cat.: 200-06), 10 ng/mL of IL-15 (Peprotech, cat.: 200-15), and 15 ng/mL interferon-\\u0026alpha;2B (Sigma-Aldrich, cat.: H6166). Cells were plated at a density of 1-1.5 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL at 37 \\u0026deg;C, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and ambient oxygen levels. To evaluate differentiation, cells were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) 10 min at room temperature and then stained for 20 min at 4\\u0026deg;C with the following antibody cocktail: anti-human CD38 (BD Biosciences, cat.: 560677), anti-human CD3 (Biolegend, cat.: 300408), anti-human CD19 (Biolegend, cat.: 302211), anti-human CD138 (Biolegend, cat.: 356521), and viability dye Ghost Dye\\u0026trade; Violet 780 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0865-T100). All samples were analyzed on a BD FACSAria II flow cytometer. Data was analyzed using FlowJo software (v.10.10.0).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMouse HSPC isolation and culture.\\u0026nbsp;\\u003c/strong\\u003eBone marrow was harvested from B6.SJL-Ptprc\\u003csup\\u003ea\\u003c/sup\\u003e Pepc\\u003csup\\u003eb\\u003c/sup\\u003e/BoyJ mice and HSPCs were isolated using the CD117 MicroBeads, mouse kit (Miltenyi Biotec, cat: 130-091-224). Cells were cultured in CellBIND plates (Corning, Corning, NY, USA, cat: 3337) in Nutrient Mixture F-12 Ham (Sigma-Aldrich, cat: N6658) supplemented with 1X penicillin-streptomycin-glutamine (Gibco, Waltham, MA, USA, cat: 10378-016), 1X Insulin-transferrin-selenium-ethanolamine (ITS-X) (Gibco, cat: 51500-056), 1 mg/mL polyvinyl alcohol (PVA) (Sigma-Aldrich, cat: P8136), 100 ng/mL TPO (Peprotech, cat: 315-14 or Biolegend cat: 718102), and 10 ng/mL SCF (Peprotech, cat: 250-03), based on a previously published protocol\\u003csup\\u003e41\\u003c/sup\\u003e, for 2-4 weeks. Prior to editing, cultures were checked for purity via flow cytometry. Cells were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) 10 min at room temperature and then stained for 30 min at 4\\u0026deg;C with the following antibody cocktail: anti-mouse Lineage cocktail BV421 (Biolegend, cat.: 133311), anti-mouse Sca-1 BV650 (Biolegend, cat.: 108143), anti-mouse CD117 (c-Kit) BV786 (Biolegend, cat.: 105841), anti-mouse CD150 PE (Biolegen, cat.: 115904), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). All samples were analyzed on a BD FACSAria II flow cytometer. Data was analyzed using FlowJo software (v.10.10.0).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGenome editing of primary cells.\\u0026nbsp;\\u003c/strong\\u003eSynthetic chemically modified sgRNAs were purchased from Synthego (Redwood City, CA, USA) or TriLink Biotechnologies (San Diego, CA, USA). Chemical modifications were comprised of 2\\u0026prime;-O-methyl-3\\u0026prime;-phosphorothioate at the three terminal nucleotides of the 5\\u0026prime; end and the second, third, and fourth bases from the 3\\u0026rsquo; end as described previously\\u003csup\\u003e72\\u003c/sup\\u003e. The target sequence for the sgRNAs are as follows: \\u003cem\\u003eCCR5\\u003c/em\\u003e-sgRNA\\u003csup\\u003e22,23\\u003c/sup\\u003e 5\\u0026rsquo;-TGACATCAATTATTATACAT-3\\u0026rsquo; and \\u003cem\\u003eRosa26\\u003c/em\\u003e-sgRNA\\u003csup\\u003e42\\u0026ndash;44\\u003c/sup\\u003e 5\\u0026rsquo;-ACTCCAGTCTTTCTAGAAGA-3\\u0026rsquo;.\\u003c/p\\u003e\\n\\u003cp\\u003eHiFi Cas9 protein was purchased from Aldevron (Fargo, ND, USA cat:9214). RNPs were complexed at a Cas9:sgRNA molar ratio of 1:2.5 at room temperature for 15-30 min. Cells were resuspended in P3 buffer (Lonza, Basel, Switzerland, cat.: V4XP-3032) with complexed RNPs and electroporated using the Lonza 4D Nucleofector and 4D-Nucleofector X Unit (program DZ-100 for human HSPCs, EO-117 for B cells, and CA-137 for mouse HSPCs). For some editing experiments, 5 \\u0026mu;M of HDR Enhancer Protein (IDT, San Jose, CA) was added to the electroporation mixture prior to electroporation. Immediately following electroporation, AAV6 was dispensed onto cells based on titers determined by ddPCR (0.625-2.5 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e vg/cell for human and mouse HSPCs, 1-2.5 \\u0026times; 10\\u003csup\\u003e4\\u003c/sup\\u003e vg/cell for B cells). For mouse HSPCs and B cells, cells were plated in ~100 \\u0026mu;L of serum-free media with AAV6 in a 96 well plate for 3\\u0026ndash;4 hours prior to replating. For some editing experiments, cells were incubated with 0.5 \\u0026mu;M (human HSPCs) or 1 \\u0026mu;M (mouse HSPCs) of AZD7648 (Selleck Chemicals, Houston, TX, cat.: S8843) for 24 h, as previously described\\u003csup\\u003e29\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eColony forming unit (CFU) assay.\\u0026nbsp;\\u003c/strong\\u003eTwo days post-electroporation 500 HSPCs were plated in each well of a SmartDish 6-well plate (STEMCELL Technologies, Vancouver, Canada, cat.: 27370) containing MethoCult H4434 Classic (STEMCELL Technologies, cat.: 04444). After 14 days, the wells were imaged using the STEMvision Hematopoietic Colony Counter (STEMCELL Technologies). Colonies were counted and scored with manual correction to determine the number of BFU-E, CFU-GM, and CFU-GEMM colonies.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTargeted integration analysis by ddPCR. Genomic DNA was extracted from cells using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR, we employed \\u003cem\\u003eHBA1\\u003c/em\\u003e specific in-out PCR primers and a probe corresponding to the expected knock-in event (1:3.6 primer to probe ratio). We also used an established genomic DNA reference at the \\u003cem\\u003eCCRL2\\u003c/em\\u003e locus.\\u003csup\\u003e35\\u003c/sup\\u003e The ddPCR reaction was prepared and underwent droplet generation following the manufacturer\\u0026rsquo;s instructions with a Bio-Rad QX200 ddPCR machine (Bio-Rad, Hercules, CA). Thermocycler settings were as follows: 95\\u0026deg;C (10 min, 1\\u0026deg;C/s ramp), 94\\u0026deg;C (30 s, 1\\u0026deg;C/s ramp), 57.7\\u0026deg;C (30 s, 1\\u0026deg;C/s ramp), 72\\u0026deg;C (2 min, 1\\u0026deg;C/s ramp), return to step 2 for 50 cycles, and 98\\u0026deg;C (10 min, 1\\u0026deg;C/s ramp). Analysis of droplet samples was then performed using the QX200 Droplet Digital PCR System (Bio-Rad). We divided the copies/\\u0026mu;L to determine the frequency of HDR (%): HDR (FAM) / REF (HEX). The following primers and probes were used in the ddPCR reaction:\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eCCR5:\\u0026nbsp;\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eForward Primer (FP): 5\\u0026rsquo;-GGGAGGATTGGGAAGACA-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003eReverse Primer (RP): 5\\u0026rsquo;-AGGTGTTCAGGAGAAGGACA-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003eProbe: 5\\u0026rsquo;-6-FAM/AGCAGGCATGCTGGGGATGCGGTGG/3IABkFQ-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eCCRL2 (reference):\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFP: 5\\u0026rsquo;-GCTGTATGAATCCAGGTCC-3\\u0026rsquo;,\\u003c/p\\u003e\\n\\u003cp\\u003eRP: 5\\u0026rsquo;- CCTCCTGGCTGAGAAAAAG -3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003eProbe: 5\\u0026rsquo;-HEX/TGTTTCCTC/ZEN/CAGGATAAGGCAGCTGT/3IABkFQ-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eRosa26\\u0026nbsp;\\u003c/em\\u003e(targeted integration)\\u003csup\\u003e44\\u003c/sup\\u003e\\u003cem\\u003e:\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFP: 5\\u0026rsquo;-AAGGGGGAGGATTGGGAAGA-3\\u0026rsquo;,\\u003c/p\\u003e\\n\\u003cp\\u003eRP: 5\\u0026rsquo;-ACAGCCTCGATTTGTGGTGT-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003eProbe: 5\\u0026rsquo;-6-FAM/CATGCTGGGGATGCGGTGGG/3IABkFQ-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eRosa26\\u0026nbsp;\\u003c/em\\u003e(reference):\\u003c/p\\u003e\\n\\u003cp\\u003eFP: 5\\u0026rsquo;-AAGCCACTGACTATGGTGCC-3\\u0026rsquo;,\\u003c/p\\u003e\\n\\u003cp\\u003eRP: 5\\u0026rsquo;-CTCAGAAGCAGAAGCATCCCT-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003eProbe: 5\\u0026rsquo;-6-FAM/TGTTCTCAAAGGAAGGATTGTCTGTGC/3IABkFQ-3\\u0026rsquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEnzyme-linked immunosorbent assay (ELISA) to detect antibodies.\\u0026nbsp;\\u003c/strong\\u003eFor detection of therapeutic antibodies, antigen specific ELISA was used. For detection of total IgG in B cell supernatant, anti-IgG Fc ELISA was used. NUNC Maxi Sorp plates (Thermo Fisher Scientific, cat: 50-314-51) were coated with 4 \\u0026mu;g/mL streptavidin (Thermo Fisher Scientific, cat: 21122) for 1 h at room temperature. Plates were then washed 3 times with MilliQ water and then blocked with ChonBlock (Thermo Fisher Scientific, cat.: 50-152-6971) overnight at 4\\u0026deg;C. The next day, plates were coated with 1 \\u0026mu;g/mL of antigen (biotinylated human PCSK9 protein or biotinylated human TNF-alpha protein, Acro Biosystems, cat: PC9-H82E7, TNA-H82E3) or biotinylated IgG Fc protein (Fortis Life Sciences, Waltham, MA, USA, cat: A80-104B) for 1 h at room temperature. Plates were then washed with 0.05% PBS-Tween (PBS-T). Media or serum samples were diluted in PBS containing 0.1% BSA and 0.05% Tween-20 and then incubated on the plate for 1 h at room temperature. Plates were washed with PBS-T, followed by incubation with the secondary antibody, horseradish peroxidase (HRP)\\u0026ndash;conjugated goat anti-human IgGFc antibody (Fortis Life Sciences, cat.: A80-104A) at a 1:2500 dilution. Plates were washed with PBS-T and detection was performed with the 1-Step\\u0026trade; TMB Substrate Kit (Thermo Fisher Scientific, cat.: 34021) and quenched with 3M H\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e. Plates were read at 450 nm using a Molecular Devices SpectraMax M3 plate reader with SoftMax Pro software. Standard curves were created using purified linker versions of each antibody or purified human IgG from normal serum (Bethyl, Montgomery, TX, USA, cat.: P80111). Results were analyzed using GraphPad Prism v10 software to calculate a standard curve using a 4-parameter sigmoidal algorithm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eWestern blot for purified antibodies.\\u0026nbsp;\\u003c/strong\\u003ePurified antibodies (0.5 \\u0026mu;g each) were denatured under reducing conditions by adding 4X Laemmli sample buffer (Bio-Rad, cat.: 1610747) and 2-mercaptoethanol and heated at 100\\u0026deg;C for 5 min. Samples were loaded onto a 4-15% MiniPROTEAN TGX precast protein gel (Bio-Rad, cat.: 4561084). Following electrophoresis, protein from gel was transferred to a PVDF membrane using the Trans-Blot Turbo Transfer System (Bio-Rad, cat.: 1704150) and the membrane was blocked using Blotting-Grade Blocker (Bio-Rad, cat.: 1706404) in phosphate-buffered saline with 0.02% Tween 20 (PBS-T) for 30 min at room temperature. The membrane was then incubated in 1:5000 primary antibody (HRP-conjugated Goat pAb to human IgG, Abcam, cat.: 7153) overnight at 4\\u0026deg;C. The next day, the membrane was washed three times with PBS-T. SuperSignal\\u0026trade; West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, cat.: 34579) was used for detection and the membrane was imaged using a Bio-Rad ChemiDoc XRS+ gel imager using ImageLab software.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eLow-density lipoprotein receptor (LDLR) expression via flow cytometry.\\u0026nbsp;\\u003c/strong\\u003e2.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e HepG2 (ATCC, Manassas, VA, USA, cat.: HB-8065) cells were seeded in 6 well plates. The next day, purified anti-PCSK9 antibodies were applied to cells at 10 ug/mL in the media and allowed to incubate for 48 hours. Media was then removed and cells were washed once with PBS and detached using Accutase cell detachment reagent (Innovative Cell Technologies, San Diego, CA, USA, cat.: AT104). Cells were then collected and blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) for 10 min at room temperature. Cells were then stained with anti-human LDLR BV421 (BD Biosciences, Franklin Lakes, NJ, USA, cat.: 744847) and viability dye Ghost Dye\\u0026trade; Violet 780 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0865-T100) for 20 minutes at 4\\u0026deg;C. Samples were analyzed on a LSR Fortessa flow cytometer (BD Biosciences). Data was analyzed using FlowJo software (v.10.10.0).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eNF-\\u0026kappa;B reporter assay for TNF\\u0026alpha; acitivity.\\u003c/strong\\u003e Purified anti-TNF\\u0026alpha; antibodies or B cell supernatant was incubated with recombinant human TNF\\u0026alpha; (R\\u0026amp;D Systems, Minneapolis, MN, USA, cat.: 210-TA) for 30 minutes at room temperature in a 96-well plate. Following incubation, 1\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e THP-1 NF-\\u0026kappa;B-Luc2 reporter cells (ATCC, cat.: TIB-202-NFkB-LUC2) were added to each well and incubated for 2 hours at 37\\u0026deg;C. Cells were lysed using Britelite plus reagent (Revvity Health Sciences, Waltham, MA, USA, cat.: 6066766) and relative luminescence units (RLU) was determined using a Synergy H1 plate reader (BioTek, Winooski, VT, USA).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eXenotransplantation of human HSPCs in immunodeficient mice.\\u0026nbsp;\\u003c/strong\\u003eAll mice were housed at Stanford University with a 12/12h light/dark cycle at an ambient temperature of 22\\u0026deg;C and 50% humidity. All experiments were completed under the Administrative Panel on Laboratory Animal Care (APLAC Protocol #25065).Six- to eight-week-old NOD.Cg-Prkdc\\u003csup\\u003escid\\u003c/sup\\u003eIl2rg\\u003csup\\u003etm1Wjl\\u003c/sup\\u003e/SzJ (NSG) mice (Jackson Laboratories, Strain: 005557) were irradiated with 2 Gy and then transplanted with 5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e mock (electroporation only) or genome-edited cord-blood derived CD34\\u003csup\\u003e+\\u0026nbsp;\\u003c/sup\\u003eHSPCs via retro-orbital injection. Human engraftment in bone marrow and spleen was assessed at 16-weeks post-transplantation. Bone marrow mononuclear cells were isolated via Ficoll gradient centrifugation. Spleen samples were treated with RBC Lysis Buffer (IBI Scientific, Dubuque, IA, USA, cat.: IB47620) to eliminate mature red blood cells. Samples were blocked for non-specific binding using FcR Blocking Reagent for human (Miltenyi Biotec, cat.: 130-059-901) and mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature. Samples were then stained for 30 min at 4\\u0026deg;C with the following antibody cocktail: anti-mouse CD45.1 BV650 (Biolegend, cat.: 110735), anti-mouse TER-119 PE-Cy5 (eBiosciences, San Diego, CA, USA, cat.: 15-5921-82), anti-human CD45 PacBlue (Biolegend, cat.: 368540), anti-human HLA-ABC APC-Cy7 (Biolegend, cat. 311426), anti-human CD33 PE (BD, cat.: 555450), anti-human CD19 APC (Biolegend, cat.: 302212), anti-human CD3 FITC (Biolegend, cat.: 300305), and viability dye Ghost Dye\\u0026trade; Violet 540 (Tonbo Bioscience, San Diego, CA, USA, cat. 13-0879-T100). Samples were analyzed on a CytoFLEX flow cytometer (Beckman-Coulter, Indianapolis, IN, USA). Data was analyzed using FlowJo software (v.10.10.0).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTransplantation of murine HSPCs in immunocompetent mice.\\u0026nbsp;\\u003c/strong\\u003eEight to twelve-week old C57BL/6 mice (Jackson Laboratories, Strain: 000664) were irradiated with 9.5 Gy and then transplanted with 1\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e mock (electroporation only) or genome-edited murine HSPCs along with 2.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e whole bone marrow support cells previously harvested from euthanized 8- to 12-week-old CD45.1/CD45.2 mice via retro-orbital injection. Peripheral blood samples were collected via retro-orbital blood collection 4-, 8-, and 12-weeks post-transplantation. At 16-weeks post-transplantation, mice were euthanized, and bone marrow, spleen, and peripheral blood were harvested. All samples were treated with RBC Lysis Buffer (IBI Scientific, cat.: IB47620) to eliminate mature red blood cells. Samples were blocked for non-specific binding using FcR Blocking Reagent for mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature and then stained for 30 min at 4\\u0026deg;C with the following antibody cocktail to evaluate engraftment: anti-mouse CD45.2 BV421 (Biolegend, cat.: 109831), anti-mouse CD45.1 BV711 (Biolegend, cat.: 110739), anti-mouse CD11b PE (eBiosciences, cat.: 12-0112-82), anti-mouse Ly-6G/Ly-6C PE (eBiosciences, cat.: 12-5931-82), anti-mouse B220 APC-Cy7 (BD Biosciences, cat.: 561102), anti-mouse CD4 APC (eBiosciences, cat.: 17-0042-82), anti-mouse CD8 APC (eBiosciences, cat.: 17-0081-82), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). All samples were analyzed on a BD FACSAria II flow cytometer and B220\\u003csup\\u003e+\\u003c/sup\\u003e cells were sorted from spleen samples (BD Biosciences, Franklin Lakes, NJ, USA). Data was analyzed using FlowJo software (v.10.10.0).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunophenotyping of murine B cells.\\u0026nbsp;\\u003c/strong\\u003eBone marrow and spleen were isolated from C57BL/6 mice and prepared as described previously. Samples were then blocked for non-specific binding using FcR Blocking Reagent for mouse (Miltenyi Biotec, cat.: 130-092-575) for 10 min at room temperature and then stained for 30 min at 4\\u0026deg;C with the following antibody cocktail: anti-mouse CD45.2 PE-Cy7 (Biolegend, cat.: 109830), anti-mouse CD45.1 BV650 (Biolegend, cat.: 110736), anti-mouse B220 APC-Cy7 (BD Biosciences, cat.: 561102), anti-mouse CD43 APC (BD Biosciences, cat.: 560663), anti-mouse IgD BV711 (BD Biosciences, cat.:564275), anti-mouse IgM FITC (BD Biosciences, cat.: 553437), anti-mouse CD24 BV421 (BD Biosciences, cat.: 562563), anti-mouse CD249 PE (BD Biosciences, cat.: 553735), and LIVE/Dead staining solution (Invitrogen, cat.: L23105). Samples were analyzed on a BD FACSAria II flow cytometer.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eB-cell receptor (BCR) repertoire analysis.\\u0026nbsp;\\u003c/strong\\u003eB220\\u003csup\\u003e+\\u003c/sup\\u003e cells were sorted from spleen samples of transplanted mice at 16 weeks post-transplant and RNA was extracted using the RNeasy Plus Micro Kit (Qiagen, Netherlands, cat.: 74034). SMART-Seq Mouse BCR kit (Takara, cat.: 634352) was used to sequence CDR3\\u0026nbsp;regions and the Cogent NGS Immune Profiler software (v2.0, Takara) was used to reconstruct BCR sequences and assign V(D)J gene segments. Only productive BCR rearrangements were retained for analysis. PCR duplicates were collapsed using unique molecular identifiers (UMIs), and reconstructed sequences supported by at least one UMI were retained. Filtered TRUST4 outputs were exported in AIRR format and used for downstream repertoire analysis with Immunarch\\u003csup\\u003e73\\u003c/sup\\u003e. Clonotypes were defined by identical CDR3 amino acid sequences with shared V and J gene usage. Distributions of CDR3 nucleotide and amino acid lengths were evaluated across unique clonotypes in three mouse groups. V and J gene usage frequencies were calculated based on relative segment usage within each group. Repertoire diversity was quantified using the D50 metric, defined as the minimum number of unique clonotypes accounting for at least 50% of total sequencing reads. Statistical comparisons across groups were performed using the Kruskal\\u0026ndash;Wallis test, with P values computed within the Immunarch pipeline and adjusted for multiple testing using the Holm\\u0026ndash;Bonferroni correction.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical analysis.\\u0026nbsp;\\u003c/strong\\u003eGraphPad Prism v10 software was used for all statistical analysis unless otherwise noted.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank the Stanford Institute for Stem Cell Biology and Regenerative Medicine FACS Core for their support and access to flow cytometry machines. We thank the Binns Program for Cord Blood Research for providing purified cord blood HSPCs. We thank the Stanford Human Immune Monitoring Center for assistance with mouse BCR sequencing. S.E.L was supported by the Stanford Medical Scholars Research Program, the American Society of Hematology Minority Medical Student Award Program, the Stanford Medical Scientist Training Program, and NIH F30 Individual Predoctoral Fellowship (1F30HL178496). W.N.F was supported by the Stanford T32 Graduate Training Program in Stem Cell Biology and Regenerative Medicine (5T32GM119995) and the Blavatnik Family Foundation as a Blavatnik Fellow. A.U. was supported by Stanford University Medical Scientist Training Program grants T32-GM007365 and T32GM145402. F.K.E. was supported by the Stanford Knight-Hennessy Scholarship, Paul and Daisy Soros Fellowship for New Americans, and the Hertz Fellowship. A.K.A. was supported by a postdoctoral fellowship from the Stanford Maternal and Child Health Research Institute. N.F.R. was supported by a Postdoc.Mobility fellowship from the Swiss National Science Foundation (P500PM_217687). L.S. was supported by the Knut and Alice Wallenberg Foundation. M.H.P. was supported by the Sutardja Chuk Professorship in Definitive and Curative Medicine and the Laurie Kraus Lacob Translational Medicine endowment.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eS.E.L, W.N.F., A.U., J.A., M.M., H.Y.G., F.K.E., A.K.A., S.S., N.F.R and L.S. contributed to experimental design, performance, and analysis. S.E.L wrote the draft and finalized versions of the manuscript with input from other authors. M.H.P. supervised the project.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of Interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eM.H.P. serves on the scientific advisory board of Allogene Tx and is an advisor to Versant Ventures. M.H.P. has equity in CRISPR Tx and has equity and is a founder of Kamau Therapeutics. The remaining authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eEcker DM, Jones SD, Levine HL. The therapeutic monoclonal antibody market. \\u003cem\\u003emAbs\\u003c/em\\u003e. 2015;7(1):9-14. doi:10.4161/19420862.2015.989042\\u003c/li\\u003e\\n\\u003cli\\u003eLu RM, Hwang YC, Liu IJ, et al. Development of therapeutic antibodies for the treatment of diseases. \\u003cem\\u003eJ Biomed Sci\\u003c/em\\u003e. 2020;27(1):1. doi:10.1186/s12929-019-0592-z\\u003c/li\\u003e\\n\\u003cli\\u003eLyu X, Zhao Q, Hui J, et al. The global landscape of approved antibody therapies. \\u003cem\\u003eAntib Ther\\u003c/em\\u003e. 2022;5(4):233-257. doi:10.1093/abt/tbac021\\u003c/li\\u003e\\n\\u003cli\\u003eLtd MRP. Antibody Therapeutics Market is Expected to Reach $479.0 Billion | MarketsandMarkets. GlobeNewswire News Room. January 4, 2024. Accessed May 12, 2025. https://www.globenewswire.com/news-release/2024/01/04/2803871/0/en/Antibody-Therapeutics-Market-is-Expected-to-Reach-479-0-Billion-MarketsandMarkets.html\\u003c/li\\u003e\\n\\u003cli\\u003eBashor CJ, Hilton IB, Bandukwala H, Smith DM, Veiseh O. Engineering the next generation of cell-based therapeutics. \\u003cem\\u003eNat Rev Drug Discov\\u003c/em\\u003e. 2022;21(9):655-675. doi:10.1038/s41573-022-00476-6\\u003c/li\\u003e\\n\\u003cli\\u003eOvacik M, Lin K. Tutorial on Monoclonal Antibody Pharmacokinetics and Its Considerations in Early Development. \\u003cem\\u003eClin Transl Sci\\u003c/em\\u003e. 2018;11(6):540-552. doi:10.1111/cts.12567\\u003c/li\\u003e\\n\\u003cli\\u003eGuijarro-Mu\\u0026ntilde;oz I, Compte M, Alvarez-Vallina L, Sanz L. Antibody gene therapy: getting closer to clinical application? \\u003cem\\u003eCurr Gene Ther\\u003c/em\\u003e. 2013;13(4):282-290. doi:10.2174/15665232113139990025\\u003c/li\\u003e\\n\\u003cli\\u003eHollevoet K, Declerck PJ. State of play and clinical prospects of antibody gene transfer. \\u003cem\\u003eJ Transl Med\\u003c/em\\u003e. 2017;15(1):1. doi:10.1186/s12967-017-1234-4\\u003c/li\\u003e\\n\\u003cli\\u003eMoffett HF, Harms CK, Fitzpatrick KS, Tooley MR, Boonyaratanakornkit J, Taylor JJ. B cells engineered to express pathogen-specific antibodies protect against infection. \\u003cem\\u003eSci Immunol\\u003c/em\\u003e. 2019;4(35). doi:10.1126/sciimmunol.aax0644\\u003c/li\\u003e\\n\\u003cli\\u003eNahmad AD, Raviv Y, Horovitz-Fried M, et al. Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2020;11(1):1. doi:10.1038/s41467-020-19649-1\\u003c/li\\u003e\\n\\u003cli\\u003eHung KL, Meitlis I, Hale M, et al. Engineering Protein-Secreting Plasma Cells by Homology-Directed Repair in Primary Human B Cells. \\u003cem\\u003eMol Ther J Am Soc Gene Ther\\u003c/em\\u003e. 2018;26(2):456-467. doi:10.1016/j.ymthe.2017.11.012\\u003c/li\\u003e\\n\\u003cli\\u003eCheng RYH, Hung KL, Zhang T, et al. Ex vivo engineered human plasma cells exhibit robust protein secretion and long-term engraftment in vivo. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2022;13(1):1. doi:10.1038/s41467-022-33787-8\\u003c/li\\u003e\\n\\u003cli\\u003eHill TF, Narvekar P, Asher GD, et al. Human plasma cells engineered to secrete bispecifics drive effective in vivo leukemia killing. \\u003cem\\u003eMol Ther\\u003c/em\\u003e. 2024;32(8):2676-2691. doi:10.1016/j.ymthe.2024.06.004\\u003c/li\\u003e\\n\\u003cli\\u003eShizuru JA, Negrin RS, Weissman IL. Hematopoietic stem and progenitor cells: clinical and preclinical regeneration of the hematolymphoid system. \\u003cem\\u003eAnnu Rev Med\\u003c/em\\u003e. 2005;56:509-538. doi:10.1146/annurev.med.54.101601.152334\\u003c/li\\u003e\\n\\u003cli\\u003ePhilippidis A. CASGEVY Makes History as FDA Approves First CRISPR/Cas9 Genome Edited Therapy. \\u003cem\\u003eHum Gene Ther\\u003c/em\\u003e. 2024;35(1-2):1-4. doi:10.1089/hum.2023.29263.bfs\\u003c/li\\u003e\\n\\u003cli\\u003eHibi T, Dosch HM. Limiting dilution analysis of the B cell compartment in human bone marrow. \\u003cem\\u003eEur J Immunol\\u003c/em\\u003e. 1986;16(2):139-145. doi:10.1002/eji.1830160206\\u003c/li\\u003e\\n\\u003cli\\u003eEyer K, Doineau RCL, Castrillon CE, et al. Single-cell deep phenotyping of IgG-secreting cells for high-resolution immune monitoring. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e. 2017;35(10):977-982. doi:10.1038/nbt.3964\\u003c/li\\u003e\\n\\u003cli\\u003eGomez-Ospina N, Scharenberg SG, Mostrel N, et al. Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2019;10(1):4045. doi:10.1038/s41467-019-11962-8\\u003c/li\\u003e\\n\\u003cli\\u003eLangslet G, Emery M, Wasserman SM. Evolocumab (AMG 145) for primary hypercholesterolemia. \\u003cem\\u003eExpert Rev Cardiovasc Ther\\u003c/em\\u003e. 2015;13(5):477-488. doi:10.1586/14779072.2015.1030395\\u003c/li\\u003e\\n\\u003cli\\u003eTargan SR, Hanauer SB, Deventer SJH van, et al. A Short-Term Study of Chimeric Monoclonal Antibody cA2 to Tumor Necrosis Factor \\u0026alpha; for Crohn\\u0026rsquo;s Disease. \\u003cem\\u003eN Engl J Med\\u003c/em\\u003e. 1997;337(15):1029-1036. doi:10.1056/NEJM199710093371502\\u003c/li\\u003e\\n\\u003cli\\u003eKoerber JT, Hornsby MJ, Wells JA. An Improved Single-chain Fab Platform for Efficient Display and Recombinant Expression. \\u003cem\\u003eJ Mol Biol\\u003c/em\\u003e. 2015;427(2):576-586. doi:10.1016/j.jmb.2014.11.017\\u003c/li\\u003e\\n\\u003cli\\u003eDudek AM, Feist WN, Sasu EJ, et al. A simultaneous knockout knockin genome editing strategy in HSPCs potently inhibits CCR5- and CXCR4-tropic HIV-1 infection. \\u003cem\\u003eCell Stem Cell\\u003c/em\\u003e. 2024;31(4):499-518.e6. doi:10.1016/j.stem.2024.03.002\\u003c/li\\u003e\\n\\u003cli\\u003eFeist WN, Luna SE, Ben-Efraim K, et al. Multilayered HIV-1 resistance in HSPCs through CCR5 Knockout and B cell secretion of HIV-inhibiting antibodies. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2025;16(1):3103. doi:10.1038/s41467-025-58371-8\\u003c/li\\u003e\\n\\u003cli\\u003eVakulskas CA, Dever DP, Rettig GR, et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. \\u003cem\\u003eNat Med\\u003c/em\\u003e. 2018;24(8):1216-1224. doi:10.1038/s41591-018-0137-0\\u003c/li\\u003e\\n\\u003cli\\u003eLuo XM, Maarschalk E, O\\u0026rsquo;Connell RM, Wang P, Yang L, Baltimore D. Engineering human hematopoietic stem/progenitor cells to produce a broadly neutralizing anti-HIV antibody after in vitro maturation to human B lymphocytes. \\u003cem\\u003eBlood\\u003c/em\\u003e. 2009;113(7):1422-1431. doi:10.1182/blood-2008-09-177139\\u003c/li\\u003e\\n\\u003cli\\u003eXu L, Lahiri P, Skowronski J, Bhatia N, Lattanzi A, Porteus MH. Molecular dynamics of genome editing with CRISPR-Cas9 and rAAV6 virus in human HSPCs to treat sickle cell disease. \\u003cem\\u003eMol Ther - Methods Clin Dev\\u003c/em\\u003e. 2023;30:317-331. doi:10.1016/j.omtm.2023.07.009\\u003c/li\\u003e\\n\\u003cli\\u003ePavel-Dinu M, Wiebking V, Dejene BT, et al. Gene correction for SCID-X1 in long-term hematopoietic stem cells. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2019;10(1):1634. doi:10.1038/s41467-019-09614-y\\u003c/li\\u003e\\n\\u003cli\\u003eCromer MK, Camarena J, Martin RM, et al. Gene replacement of \\u0026alpha;-globin with \\u0026beta;-globin restores hemoglobin balance in \\u0026beta;-thalassemia-derived hematopoietic stem and progenitor cells. \\u003cem\\u003eNat Med\\u003c/em\\u003e. 2021;27(4):677-687. doi:10.1038/s41591-021-01284-y\\u003c/li\\u003e\\n\\u003cli\\u003eSelvaraj S, Feist WN, Viel S, et al. High-efficiency transgene integration by homology-directed repair in human primary cells using DNA-PKcs inhibition. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e. Published online August 3, 2023:1-14. doi:10.1038/s41587-023-01888-4\\u003c/li\\u003e\\n\\u003cli\\u003eEscribano-D\\u0026iacute;az C, Orthwein A, Fradet-Turcotte A, et al. A Cell Cycle-Dependent Regulatory Circuit Composed of 53BP1-RIF1 and BRCA1-CtIP Controls DNA Repair Pathway Choice. \\u003cem\\u003eMol Cell\\u003c/em\\u003e. 2013;49(5):872-883. doi:10.1016/j.molcel.2013.01.001\\u003c/li\\u003e\\n\\u003cli\\u003eCanny MD, Moatti N, Wan LCK, et al. Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR\\u0026ndash;Cas9 genome-editing efficiency. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e. 2018;36(1):95-102. doi:10.1038/nbt.4021\\u003c/li\\u003e\\n\\u003cli\\u003eBaik R, Cromer MK, Glenn SE, et al. Transient inhibition of 53BP1 increases the frequency of targeted integration in human hematopoietic stem and progenitor cells. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2024;15(1):1. doi:10.1038/s41467-023-43413-w\\u003c/li\\u003e\\n\\u003cli\\u003eBrendel C, Rio P, Verhoeyen E. Humanized mice are precious tools for evaluation of hematopoietic gene therapies and preclinical modeling to move towards a clinical trial. \\u003cem\\u003eBiochem Pharmacol\\u003c/em\\u003e. 2020;174:113711. doi:10.1016/j.bcp.2019.113711\\u003c/li\\u003e\\n\\u003cli\\u003eDever DP, Bak RO, Reinisch A, et al. CRISPR/Cas9 \\u0026beta;-globin gene targeting in human haematopoietic stem cells. \\u003cem\\u003eNature\\u003c/em\\u003e. 2016;539(7629):384-389. doi:10.1038/nature20134\\u003c/li\\u003e\\n\\u003cli\\u003eGomez-Ospina N, Scharenberg SG, Mostrel N, et al. Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2019;10(1):4045. doi:10.1038/s41467-019-11962-8\\u003c/li\\u003e\\n\\u003cli\\u003eJangalwe S, Shultz LD, Mathew A, Brehm MA. Improved B cell development in humanized NOD-scid IL2R\\u0026gamma;null mice transgenically expressing human stem cell factor, granulocyte-macrophage colony-stimulating factor and interleukin-3. \\u003cem\\u003eImmun Inflamm Dis\\u003c/em\\u003e. 2016;4(4):427-440. doi:10.1002/iid3.124\\u003c/li\\u003e\\n\\u003cli\\u003eVuyyuru R, Patton J, Manser T. Human immune system mice: current potential and limitations for translational research on human antibody responses. \\u003cem\\u003eImmunol Res\\u003c/em\\u003e. 2011;51(2-3):257-266. doi:10.1007/s12026-011-8243-9\\u003c/li\\u003e\\n\\u003cli\\u003eTHP-1 NF-\\u0026kappa;B-Luc2 - TIB-202-NFkB-LUC2 | ATCC. https://www.atcc.org. Accessed February 1, 2026. https://www.atcc.org/products/tib-202-nfkb-luc2\\u003c/li\\u003e\\n\\u003cli\\u003eAlberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. B Cells and Antibodies. In: \\u003cem\\u003eMolecular Biology of the Cell. 4th Edition\\u003c/em\\u003e. Garland Science; 2002. Accessed April 20, 2025. https://www.ncbi.nlm.nih.gov/books/NBK26884/\\u003c/li\\u003e\\n\\u003cli\\u003eOchi K, Morita M, Wilkinson AC, Iwama A, Yamazaki S. Non-conditioned bone marrow chimeric mouse generation using culture-based enrichment of hematopoietic stem and progenitor cells. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2021;12(1):1. doi:10.1038/s41467-021-23763-z\\u003c/li\\u003e\\n\\u003cli\\u003eWilkinson AC, Ishida R, Nakauchi H, Yamazaki S. Long-term ex vivo expansion of mouse hematopoietic stem cells. \\u003cem\\u003eNat Protoc\\u003c/em\\u003e. 2020;15(2):2. doi:10.1038/s41596-019-0263-2\\u003c/li\\u003e\\n\\u003cli\\u003eChu VT, Weber T, Wefers B, et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e. 2015;33(5):543-548. doi:10.1038/nbt.3198\\u003c/li\\u003e\\n\\u003cli\\u003eChu VT, Weber T, Graf R, et al. Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes. \\u003cem\\u003eBMC Biotechnol\\u003c/em\\u003e. 2016;16(1):4. doi:10.1186/s12896-016-0234-4\\u003c/li\\u003e\\n\\u003cli\\u003eWilkinson AC, Dever DP, Baik R, et al. Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2021;12:686. doi:10.1038/s41467-021-20909-x\\u003c/li\\u003e\\n\\u003cli\\u003eVande Casteele N, Ferrante M, Van Assche G, et al. Trough concentrations of infliximab guide dosing for patients with inflammatory bowel disease. \\u003cem\\u003eGastroenterology\\u003c/em\\u003e. 2015;148(7):1320-1329.e3. doi:10.1053/j.gastro.2015.02.031\\u003c/li\\u003e\\n\\u003cli\\u003eKasichayanula S, Grover A, Emery MG, et al. Clinical Pharmacokinetics and Pharmacodynamics of Evolocumab, a PCSK9 Inhibitor. \\u003cem\\u003eClin Pharmacokinet\\u003c/em\\u003e. 2018;57(7):769-779. doi:10.1007/s40262-017-0620-7\\u003c/li\\u003e\\n\\u003cli\\u003eBanaszynski LA, Chen LC, Maynard-Smith LA, Ooi AGL, Wandless TJ. A rapid, reversible, and tunable method to regulate protein function in living cells using synthetic small molecules. \\u003cem\\u003eCell\\u003c/em\\u003e. 2006;126(5):995-1004. doi:10.1016/j.cell.2006.07.025\\u003c/li\\u003e\\n\\u003cli\\u003eCommissioner O of the. FDA Approves First Gene Therapies to Treat Patients with Sickle Cell Disease. FDA. August 9, 2024. Accessed May 10, 2025. https://www.fda.gov/news-events/press-announcements/fda-approves-first-gene-therapies-treat-patients-sickle-cell-disease\\u003c/li\\u003e\\n\\u003cli\\u003eLee BC, Gin A, Wu C, et al. Impact of CRISPR/HDR editing versus lentiviral transduction on long-term engraftment and clonal dynamics of HSPCs in rhesus macaques. \\u003cem\\u003eCell Stem Cell\\u003c/em\\u003e. 2024;31(4):455-466.e4. doi:10.1016/j.stem.2024.02.010\\u003c/li\\u003e\\n\\u003cli\\u003eRomero Z, Lomova A, Said S, et al. Editing the Sickle Cell Disease Mutation in Human Hematopoietic Stem Cells: Comparison of Endonucleases and Homologous Donor Templates. \\u003cem\\u003eMol Ther\\u003c/em\\u003e. 2019;27(8):1389-1406. doi:10.1016/j.ymthe.2019.05.014\\u003c/li\\u003e\\n\\u003cli\\u003eLattanzi A, Camarena J, Lahiri P, et al. Development of \\u0026beta;-globin gene correction in human hematopoietic stem cells as a potential durable treatment for sickle cell disease. \\u003cem\\u003eSci Transl Med\\u003c/em\\u003e. 2021;13(598):eabf2444. doi:10.1126/scitranslmed.abf2444\\u003c/li\\u003e\\n\\u003cli\\u003eYu H, Yang Z, Li F, Xu L, Sun Y. Cell-mediated targeting drugs delivery systems. \\u003cem\\u003eDrug Deliv\\u003c/em\\u003e. 27(1):1425-1437. doi:10.1080/10717544.2020.1831103\\u003c/li\\u003e\\n\\u003cli\\u003eWang LLW, Gao Y, Feng Z, Mooney DJ, Mitragotri S. Designing drug delivery systems for cell therapy. \\u003cem\\u003eNat Rev Bioeng\\u003c/em\\u003e. 2024;2(11):944-959. doi:10.1038/s44222-024-00214-0\\u003c/li\\u003e\\n\\u003cli\\u003ePorteus MH. A New Class of Medicines through DNA Editing. \\u003cem\\u003eN Engl J Med\\u003c/em\\u003e. 2019;380(10):947-959. doi:10.1056/NEJMra1800729\\u003c/li\\u003e\\n\\u003cli\\u003eDudek AM, Feist WN, Sasu EJ, et al. A simultaneous knockout knockin genome editing strategy in HSPCs potently inhibits CCR5- and CXCR4-tropic HIV-1 infection. \\u003cem\\u003eCell Stem Cell\\u003c/em\\u003e. 2024;31(4):499-518.e6. doi:10.1016/j.stem.2024.03.002\\u003c/li\\u003e\\n\\u003cli\\u003eVavassori V, Ferrari S, Beretta S, et al. Lipid nanoparticles allow efficient and harmless ex vivo gene editing of human hematopoietic cells. \\u003cem\\u003eBlood\\u003c/em\\u003e. 2023;142(9):812-826. doi:10.1182/blood.2022019333\\u003c/li\\u003e\\n\\u003cli\\u003eHartweger H, McGuire AT, Horning M, et al. HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells. \\u003cem\\u003eJ Exp Med\\u003c/em\\u003e. 2019;216(6):1301-1310. doi:10.1084/jem.20190287\\u003c/li\\u003e\\n\\u003cli\\u003eTrzos S, Link-Lenczowski P, Pocheć E. The role of N-glycosylation in B-cell biology and IgG activity. The aspects of autoimmunity and anti-inflammatory therapy. \\u003cem\\u003eFront Immunol\\u003c/em\\u003e. 2023;14:1188838. doi:10.3389/fimmu.2023.1188838\\u003c/li\\u003e\\n\\u003cli\\u003eLiu L. Antibody glycosylation and its impact on the pharmacokinetics and pharmacodynamics of monoclonal antibodies and Fc-fusion proteins. \\u003cem\\u003eJ Pharm Sci\\u003c/em\\u003e. 2015;104(6):1866-1884. doi:10.1002/jps.24444\\u003c/li\\u003e\\n\\u003cli\\u003eGoh JB, Ng SK. Impact of host cell line choice on glycan profile. \\u003cem\\u003eCrit Rev Biotechnol\\u003c/em\\u003e. 2018;38(6):851-867. doi:10.1080/07388551.2017.1416577\\u003c/li\\u003e\\n\\u003cli\\u003eAgarwal R, Dvorak CC, Kwon HS, et al. Non-Genotoxic Anti-CD117 Antibody Conditioning Results in Successful Hematopoietic Stem Cell Engraftment in Patients with Severe Combined Immunodeficiency. \\u003cem\\u003eBlood\\u003c/em\\u003e. 2019;134(Supplement_1):800. doi:10.1182/blood-2019-126239\\u003c/li\\u003e\\n\\u003cli\\u003eKwon HS, Logan AC, Chhabra A, et al. Anti-human CD117 antibody-mediated bone marrow niche clearance in nonhuman primates and humanized NSG mice. \\u003cem\\u003eBlood\\u003c/em\\u003e. 2019;133(19):2104-2108. doi:10.1182/blood-2018-06-853879\\u003c/li\\u003e\\n\\u003cli\\u003eCzechowicz A, Palchaudhuri R, Scheck A, et al. Selective hematopoietic stem cell ablation using CD117-antibody-drug-conjugates enables safe and effective transplantation with immunity preservation. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2019;10(1):617. doi:10.1038/s41467-018-08201-x\\u003c/li\\u003e\\n\\u003cli\\u003eDenis M, Swartzrock L, Willner H, et al. Hematopoiesis after anti-CD117 monoclonal antibody treatment in the settings of wild-type and Fanconi anemia mice. \\u003cem\\u003eHaematologica\\u003c/em\\u003e. 2024;109(9):2920-2929. doi:10.3324/haematol.2023.284275\\u003c/li\\u003e\\n\\u003cli\\u003eAlexander E, Leong KW. Discovery of nanobodies: a comprehensive review of their applications and potential over the past five years. \\u003cem\\u003eJ Nanobiotechnology\\u003c/em\\u003e. 2024;22(1):661. doi:10.1186/s12951-024-02900-y\\u003c/li\\u003e\\n\\u003cli\\u003eMuyldermans S. Nanobodies: Natural Single-Domain Antibodies. \\u003cem\\u003eAnnu Rev Biochem\\u003c/em\\u003e. 2013;82(Volume 82, 2013):775-797. doi:10.1146/annurev-biochem-063011-092449\\u003c/li\\u003e\\n\\u003cli\\u003eTian Z, Liu M, Zhang Y, Wang X. Bispecific T cell engagers: an emerging therapy for management of hematologic malignancies. \\u003cem\\u003eJ Hematol OncolJ Hematol Oncol\\u003c/em\\u003e. 2021;14(1):75. doi:10.1186/s13045-021-01084-4\\u003c/li\\u003e\\n\\u003cli\\u003eStrohl WR. Fusion Proteins for Half-Life Extension of Biologics as a Strategy to Make Biobetters. \\u003cem\\u003eBiodrugs\\u003c/em\\u003e. 2015;29(4):215-239. doi:10.1007/s40259-015-0133-6\\u003c/li\\u003e\\n\\u003cli\\u003eAurnhammer C, Haase M, Muether N, et al. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. \\u003cem\\u003eHum Gene Ther Methods\\u003c/em\\u003e. 2012;23(1):18-28. doi:10.1089/hgtb.2011.034\\u003c/li\\u003e\\n\\u003cli\\u003eBak RO, Dever DP, Porteus MH. CRISPR/Cas9 genome editing in human hematopoietic stem cells. \\u003cem\\u003eNat Protoc\\u003c/em\\u003e. 2018;13(2):358-376. doi:10.1038/nprot.2017.143\\u003c/li\\u003e\\n\\u003cli\\u003eCheng RYH, de Rutte J, Ito CEK, et al. SEC-seq: association of molecular signatures with antibody secretion in thousands of single human plasma cells. \\u003cem\\u003eNat Commun\\u003c/em\\u003e. 2023;14(1):1. doi:10.1038/s41467-023-39367-8\\u003c/li\\u003e\\n\\u003cli\\u003eHendel A, Bak RO, Clark JT, et al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e. 2015;33(9):985-989. doi:10.1038/nbt.3290\\u003c/li\\u003e\\n\\u003cli\\u003eNazarov VI, Tsvetkov VO, Popov AA, Balashov I. immunarch: Multi-Modal Immune Repertoire Analytics for Immunotherapy and Vaccine Design in R. Published online 2025. https://immunomind.github.io/docs/\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"nature-portfolio\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Nature Portfolio\",\"twitterHandle\":\"\",\"acdcEnabled\":false,\"dfaEnabled\":false,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9269825/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9269825/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"Monoclonal antibodies represent half of the top ten selling drugs. Their proven efficacy, however, generally requires repeated administration for prolonged periods of time. In contrast, cell-based therapies offer a different set of pharmacokinetics and pharmacodynamics than traditional medicines, including the potential to have lifetime durability after a single infusion. Here, we describe a genome-engineered stem cell-based platform for continuous antibody production from a single dose. Using CRISPR/Cas9 homology-directed repair mediated editing, we precisely integrated therapeutic antibody expression cassettes into a safe-harbor locus of hematopoietic stem and progenitor cells (HSPCs). Upon differentiation, these gene-targeted HSPCs generate B cells that secrete monoclonal antibodies. We validated this platform using two clinically approved antibodies, achieving efficient targeted integration of the gene-targeted antibodies (GT-Ab) in human HSPCs that successfully engraft in immunodeficient mice. Direct engineering of human B cells demonstrated robust secretion of therapeutic antibodies. To evaluate in vivo antibody production, we transplanted engineered GT-Ab murine HSPCs into immunocompetent mice, achieving durable serum antibody concentrations within the therapeutic range over several months. Lastly, by fusing the antibody to a destabilization domain, we enabled tunable antibody secretion via small molecule regulation. This modular platform establishes a potentially curative approach for chronic diseases currently reliant on repeated antibody administration, offering durable antibody production from a single treatment.\",\"manuscriptTitle\":\"Engineered hematopoietic stem cells give rise to therapeutic antibody secreting B cells\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-04-06 06:06:49\",\"doi\":\"10.21203/rs.3.rs-9269825/v1\",\"editorialEvents\":[],\"status\":\"published\",\"journal\":{\"display\":false,\"email\":\"info@researchsquare.com\",\"identity\":\"nature\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"nature\",\"sideBox\":\"Learn more about [Nature](http://www.nature.com/nature/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Nature\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"b115f69f-0030-456a-8cf6-1fc6f829126e\",\"owner\":[],\"postedDate\":\"April 6th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2026-05-05T08:13:05+00:00\",\"index\":5,\"fulltext\":\"This content is not available.\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[{\"id\":65673931,\"name\":\"Biological sciences/Stem cells/Haematopoietic stem cells\"},{\"id\":65673932,\"name\":\"Biological sciences/Biotechnology/Stem-cell biotechnology\"}],\"tags\":[],\"updatedAt\":\"2026-04-06T06:06:49+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-04-06 06:06:49\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9269825\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9269825\",\"identity\":\"rs-9269825\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}