{"paper_id":"e3f79f5f-2b63-4b99-b3a2-c1ff38df8465","body_text":"ORIGINAL ARTICLE\nPotential therapeutic role of punicalagin\nagainst mechanical-trauma-induced stress urinary incontinence\nvia upregulation of Nrf2 and TGF- β1s i g n a l i n g\nEffect of punicalagin on mechanical trauma induced SUI\nJianming Tang1 & Cheng Liu1 & Jie Min 1 & Ming Hu 1 & Ya n g L i1 & Li Hong 1\nReceived: 19 November 2016 / Accepted: 19 January 2017 / Published online: 6 February 2017\n# The Author(s) 2017. This article is published with open access at Springerlink.com\nAbstract\nIntroduction and hypothesis We investigated the effect of\npunicalagin (PUN; 2,3-hexahydroxydiphenoyl-gallagyl-D-\nglucose), on mechanical-trauma-induced stress urinary incon-\ntinence (SUI) in mouse and the mechanisms underlying any\neffects.\nMethods Ninety virgin female C57BL/6 mice were randomized\ninto six groups: five groups underwent vaginal distention (VD)\nfor 1 h and leak-point pressure (LPP) was measured on the 1st,\n3rd, 7th, 14th, and 28th day following (VD groups 1 d, 3 d, 7 d,\n14 d, and 28 d). The sixth group was a noninstrumented control\n(NC) group. Then, 75 virgin female C57BL/6 mice were ran-\ndomized into five groups: a VD group (that just underwent VD)\nand an NC group were orally administered saline every day for\n7 days; and three VD + PUN groups that underwent VD and\nwere orally administered PUN respectively at 2.5, 5, and 10 mg/\nkg every day for 7 days. LPP was tested on the day 7, then all\nmice were sacrificed and their urethras and anterior vaginal walls\nharvested for Masson staining, immunohistochemistry study,\nWestern blot analysis, and quantitative polymerase chain reaction\n(qPCR).\nResults LPPs after VD were significantly lower than the NC\ngroup, and the LPPs of mice on days 14 and 28 day after VD\nwere significantly higher than on the days 1, 3, and 7. PUN\nsignificantly improved VD-induced drops in LPP and alleviated\nVD-induced decrease of collagen I, collagen III,α-smooth mus-\ncle actin (SMA), transforming growth factor (TGF)-β1, and p-\nSmad3, nuclear factor-erythroid 2 p45-related factor 2 (Nrf2),\nand glutathione peroxidase (GPx1) protein levels, and increase\nof 8-hydroxydeoxyguanosine (OHdG) in urethra and anterior\nvaginal wall. PUN also up-regulated the expression of manga-\nnese superoxide dismutase (MnSOD), whereas protein levels of\nSmad 2, p-Smad2, and Smad3 were not changed.\nConclusions PUN exerts certain therapeutic effect on\nmechanical-trauma-induced SUI in mice, which might be\nthrough the activation of TGF-β1/Smad3 and Nrf2/antioxidant\nresponse element (ARE) signaling activation.\nKeywords Mechanical trauma . V aginal distension.\nPunicalagin . Stress urinary incontinence. Oxidative damage .\nExtracellular matrix\nIntroduction\nStress urinary incontinence (SUI) is a common social and\nhygiene problem affecting the quality of life (QoL) of\n25~57% adult women worldwide and causing serious social\neconomic load [ 1– 5]. Although progress has been made in\ntreating SUI in recent decades, pharmacological therapy is\npoorly understood. Therefore, drug discovery and develop-\nment for SUI is extremely urgent. The etiologic and patho-\nphysiologic mechanisms, however, have not been well eluci-\ndated. Aging, vaginal childbirth, declined hormonal status\n(menopause), and obesity were the main risk factors of SUI\n[4– 6]. Increasing research confirmed that mechanical-trauma-\ninduced oxidative damage and extracellular matrix (ECM)\nremodeling are probably involved in the pathogenesis of\nSUI, especially birth trauma and increased abdominal-\npressure-induced SUI or pelvic organ prolapase (POP) with\nSUI [ 7– 11]. Nuclear factor-erythroid 2 p45-related factor 2\n(Nrf2) is an upstream transcription factor modulating\n* Li Hong\ndrhongli7777@gmail.com\n1 Department of Gynecology and Obstetrics, Renmin Hospital of\nWuhan University, #238 Liberation Road, Wuhan 430060, Hubei\nProvince, People’ s Republic of China\nInt Urogynecol J (2017) 28:947– 955\nDOI 10.1007/s00192-017-3283-x\n\n\nantioxidant ability [ 12]. Upon oxidative stress, Nrf2 parts\nfrom kelch-like ECH-associated protein 1 (Keap1) and trans-\nlocates into the nucleus to induce the expression of antioxidant\nresponse elements (ARE), such as glutathione peroxidase\n(GPx), superoxide dismutase (SOD), catalase (CA T), and\nheme oxygenase (HO)-1, against oxidative damage [ 12].\nCollagen is an important component in ECM and plays a\ncritical role in maintaining the normal functions of the pelvic\nsupport structure. Previous studies demonstrated that inconti-\nnence is associated with reduced content of collagen I, III, and\nα-smooth muscle actin (SMA) [ 6, 13– 17]. Transforming\ngrowth factor β (TGF-β), including TGF- β1, TGF-β2, and\nTGF-β3, a pleiotropic cytokine, plays important roles in many\nphysiological and pathological processes; in mammals, the\nprimary factor is TGF- β1, and the TGF- β1/Smads pathway\nplays an important role in the regulation of collagen\nmetabolism.\nAccrding to the Chinese Compendium of Materia Medica,\npomegranate peel is used to treat archoptoma, dysentery,\nhematockezia, morbid leucorrhoea, uterine bleeding, and\nuroclepsia. Punicalagin (2,3-hexahydroxydiphenoyl-\ngallagyl-D-glucose; PUN), the major bioactive component\nof pomegranate peel, has antioxidant, anti-inflammatory, an-\ntiviral, antiapoptosis, and anti-collagen-degradation properties\n[18– 20]. Previous studies demonstrated that PUN inhibits li-\npopolysaccharide (LPS)-induced oxidative stress via upregu-\nlation of the Nrf2/HO-1 pathway and alleviates oxidative\ndamage [ 18]. Additionally, PUN shows anti-collagen-\ndegradation activity in vitro [ 20]. In the work reported here,\nwe tested the hypothesis that PUN plays a role in treating\nmechanical-stress-induced oxidative damage and ECM re-\nmodeling, even the potential therapeutical effect on\nmechanical-trauma-induced SUI.\nMaterials and methods\nReagents\nPunicalagin [>98% high-performance liquid chromatography\n(HPLC) purity] was purchased from Chengdu must Bio-tech\n(Chengdu, China). Antibodies to β-actin (ab8227), collagen I\n(ab21286), collagen III (ab7778), α-SMA (ab124964), Nrf2\n(ab137550), TGF-β1 (ab92486), and GPx1 (ab22604) were\nobtained from Abcam (Cambridge, UK). Antibodies to\nSmad2 (5339p), Smad3 (9523p), p-Smad2 (3108p), and p-\nSmad3 (9520p) were purchased from Cell Signaling\nTechnology (Danvers, MA, USA). Antibody to MnSOD\n(06– 984) was purchased from Millipore (Billerica, MA,\nUSA). Fluorescence-labeled secondary antibodies\n(IRDye700 and IRDye800, goat antimouse/rabbit) was pur-\nchased from Licor, Inc. (Lincoln, NE, USA).\nExperimental animals and study design\nLeak-point pressure (LPP) reflects the ability of urinary insis-\ntence, hence the LPPs of mice in every group were measured\nto determine the identification index of SUI in mice. In the\nfirst part of this research, in order to investigate the efficiency\nand duration of a vaginal distention (VD)-induced mouse\nmodel of SUI, 90 wild-type virgin female C57BL/6 mice\n(8~10 weeks old) were randomized into six groups: a\nnoninstrumented control (NC) group; and five groups\nunderwent VD for 1 h with 8-mm dilators (0.3 ml saline)\nand their LPPs were measured respectively on days 1, 3, 7,\n14, and 28 after VD (groups VD 1 d, 3 d, 7 d, 14 d, and 28 d).\nThere was no statistically significant difference among body\nweights of mice between groups (Table 1). In the second part\nof this research, to explore the potential therapeutic role of\nPUN against VD-induced SUI and its underlying mechanism,\n75 wild-type virgin female C57BL/6 mice (8~10 weeks old)\nwere randomized into five groups: NC, VD, and VD + PUN\n2.5, 5, and 10. VD and VD + PUN 2.5, 5, and 10 mice\nunderwent VD for 1 h with 8-mm dilators the first day, then\nthe VD + PUN 2.5, 5, and 10 groups were orally administered\n2.5, 5, and 10 mg/kg of PUN, respectively, every 24 h during\nthe entire experimental period. Mice in the NC and VD groups\nwere fed with equal amount of 0.9% normal saline. LPPs of\nmice in all groups were measured on the day 7 after VD.\nAnimals were sacrificed, and urethras and anterior vaginal\nwalls were harvested for immunohistochemistry study,\nWestern blot analysis, and quantitative polymerase chain re-\naction (qPCR). There was no statistically significant differ-\nence among body weight (Table 2). All experimental proto-\ncols were approved by the Institutional Animal Care and Use\nCommittee of Renmin Hospital of Wuhan University.\nVaginal distention\nMice in the experimental groups underwent VD after being\nanesthetized with urethane (1 g/kg, i.p.). After lubrication with\nparaffin oil, a modified 6-F Foley catheter was inserted into\nthe vagina and secured to the vaginal introitus with a 5/0 silk\nsuture. Then, 0.3 ml distilled water was infused into the\nTa bl e 1 Body weights of mice in six groups x /C6 SðÞ\nGroup Weight (g) F value P value\nNC 16.04 ± 0.71 0.36 0.73\nVD 1 d 16.20 ± 0.64\nVD 3 d 15.97 ± 0.66\nVD 7 d 16.23 ± 0.50\nVD 14 d 16.05 ± 0.78\nVD 28 d 16.17 ± 0.70\nNC noninstrumented control,VD vaginal distention,\n948 Int Urogynecol J (2017) 28:947– 955\n\nballoon to distend the vagina. Each balloon ’ sd i a m e t e rw a s\nmeasured before VD using a V ernier caliper. After 1 h, the\nballoon was deflated and removed, and the mouse permitted to\nwake spontaneously. The NC group did not undergo VD.\nSuprapubic tube implantation and LPP measurement\nOne day before LPP measurement, a epidural catheter\nwas implanted in the bladder under urethane (1 g/kg,\ni.p.) anesthesia. On the day of LPP measurement, mice\nwere again anesthetized with urethane (1 g/kg, i.p.), the\nbladder catheter was connected to both a micro syringe\npump and a pressure transducer of a urinary dynamics\ndetector (Nidoc970C, Weixin Medical of China) through\na T-branch pipe. Pressure and force transducer signals\nwere amplified and digitized for computer data collec-\ntion. The bladder was then filled with room-temperature\nsaline at 1 ml/h through the bladder catheter. When half\nthe bladder capacity was reached, gentle pressure with\none finger was applied to the mouse ’ s abdomen.\nPressure was gently increa sed until urine leaked, at\nwhich time the externally applied pressure was rapidly\nremoved. Peak bladder pressure was used as the LPP .\nV oids could be easily distin guished from leaks. If a\nmouse voided, the bladder was refilled and the process\nwas repeated. At least five LPPs were obtained on each\nanimal and the mean calculated.\nWestern blot\nTotal protein was extracted from specimens using\nradioimmunoprecipitation assay (RIPA) buffer containing\nphenylmethylsulfonyl fluoride (PMSF). Proteins were denatured\nat 95 °C after concentration measurement, then 30μgo ft h et o t a l\nprotein was separated from these samples by 10% sodium dode-\ncyl sulfate (SDS)– polyacrylamide gel electrophoresis (PAGE)\nthen transferred onto polyvinylidene fluoride (PVDF) mem-\nbranes. After being blocked, membranes were sequential blotted\nwith primary and secondary antibodies (1:10000). Signals were\ndetected with an Odyssey infrared imaging system (LI-COR Bio,\nUSA). Primary antibodies were as follows: anti-Nrf2 (1:500),\nanti-GPx1 (1:500), anti-MnSOD (1:500), anti-TGF-β1 (1:250),\nanti-Smad2 (1:250), anti-p-Smad2 (1:250), anti-Smad3 (1:250),\nanti-p-Smad3 (1:250), anticollagen I (1:100), anticollagen III\n(1:250), anti- α-SMA (1:5000), and anti-tissue inhibitor of\nmetalloprotease (anti-TIMP-3) (1:1000).\nQuantitative real-time polymerase chain reaction\nPrimers were purchased from Sangon Biotech (Shanghai,\nChina). Total RNA was extracted using RNAiso Plus\n(TaKaRa Biotech, Dalian, China), and first-strand comple-\nmentary (c) DNA was synthesized using a PrimeScript\nTM\nRT regent Kit (TaKaRa Biotech, Dalian, China). q-PCR was\nconducted using SYBR\nR Premix Ex Taq ™ II Kit (TaKaRa\nBiotech, Dalian, China). SYBR green real-time PCR mix for\nPCR containing 7.5 μM each of forward and reverse primers\n(listed in Table 3). The reaction conditions were as follows:\npredenaturation at 95 °C for 30 s; 40 cycles of 95 °C for 5 s,\nand 60 °C for 34 s; then a final extension stage of 95 °C for\n15 s, 60 °C for 1 min, and 95 °C for 15 s. β-actin was used as\nthe reference gene. Relative quantification of gene expression\nfor both target and reference genes was performed by the\n2\n-ΔΔ Ct method and based on Ct values. Real-time PCR anal-\nysis results are presented as mean ± standard deviation (SD) of\nfold change in expression.\nTa bl e 2 Body weights of mice in five groups x /C6 SðÞ\nGroup Weight (g) F value P value\nNC 16.10 ± 0.73 0.20 0.99\nVD 16.03 ± 0.72\nVD + PUN 2.5 15.97 ± 0.70\nVD + PUN 5 16.13 ± 0.64\nVD + PUN 10 15.95 ± 0.67\nNC noninstrumented control,VD vaginal distention, PUN punicalagin\nTa bl e 3 Primers for quantitative\nreal-time polymerase chain\nreaction\nGene name Gene ID Primer sequence (5 ′-3′) Amplicon size (bp)\nCollagen I (A1) NM_007742.3 F: AAGAAGCACGTCTGGTTTGGAG 175\nR: GGTCCA TGT AGGCTACGCTGTT\nCollagen III (A1) NM_009930 F: GTGGCAA TGTAAAGAAGTCTCTGAAG 191\nR: GGGTGCGA TA TCTA TGA TGGGT AG\nα-SMA NM_031004.2 F: AACTGGT A TTGTGCTGGACTCTG 172\nR: CTCAGCAGT AGTCACGAAGGAA TA\nβ-actin NM_007393.3 F: GTGACGTTGACA TCCGT AAAGA 287\nR: GT AACAGTCCGCCTAGAAGCAC\nSMA smooth muscle actin\nInt Urogynecol J (2017) 28:947– 955 949\n\nImmunohistochemistry and Masson staining\nAll specimens were embedded in paraffin and cut into\n4-μm-thick slices and fixed to glass slides. For immu-\nnohistochemical staining, sections were deparaffinized in\nxylene and rehydrated in a graded ethanol series.\nConnective tissue was stained with Masson trichrome\n(Sigma, USA) following the protocol.\nImmunohistochemical staining of 8-\nhydroxydeoxyguanosine (8-OHdG) was performed fol-\nlowing the protocol -(UltraSensitive\n™ S-P Kit, Maxim\nBio, China). As negative controls for immunohistochem-\nistry analysis, sections were incubated with nonimmune\nserum instead of the primary antibody and showed no\nstaining. Images were then analyzed with Image-Pro\nPlus5.1.\nStatistical analyses\nAll statistical analyses were performed with SPSS 21.0\n(IBM Corporation, Armonk, NY , USA), and data are\npresented as mean ± SD. Data were further subjected to\nanalysis of variance (ANOV A). Differences between two\ngroups were determined using Student ’ s t test, and mul-\ntiple means were compared by Tukey ’ st e s t . P values <\n0.05 were considered stat istically significant.\nResults\nLPP decreased after VD and recovered over time\nThe VD induced SUI mouse model shows self-restoring ca-\npacity. In this study, as show in Table 4 and Fig. 1a,a l lL P P s\nmeasured on days 1, 3, 7, 14, and 28 after VD were signifi-\ncantly decreased when compared with the NC group. No sig-\nnificant change was found on days 1, 3, and 7 after VD.\nHowever, on the day 14 after VD, LPP was significantly\nhigher than on days 1, 3, and 7 and significantly lower than\non day 28 after VD. Therefore, VD-induced SUI mouse model\nstabilized 7 days after VD and recovered from day 14.\nPUN promotes LPP recovery after VD in mice\nOur preliminary result indicated that the VD-induced SUI\nmouse model was stable 7 days after VD. Hence, we tested\nLPPs of mice on day 7 after VD for more medication time.\nTable 5 and Fig. 1b show LPPs of mice in five groups. LPPs\nwere significantly decreased in the VD and PUN 2.5, 5, and\n10 groups compared with the NC group. Notably, treatment\nwith 5 and 10 mg/kg PUN after VD significantly increased\nLPP; no significant change was found between PUN 2.5 and\nVD groups.\nTa bl e 4 Leak-point pressure of mice in six groups x /C6 SðÞ\nGroup LPP (cmH2O) 95% CI\nNC 46.42 ± 6.30 (42.94– 49.91)\nVD 1 d 15.88 ± 7.07 (11.97– 19.79)\nVD 3 d 23.23 ± 5.46 (20.21– 26.26)\nVD 7 d 22.84 ± 6.58 (19.20– 26.48)\nVD 14 d 33.35 ± 9.60 (28.04– 38.67)\nVD 28 d 41.73 ± 12.73 (34.68– 48.78)\nNC noninstrumented control,VD vaginal distention,LPP leak-point pres-\nsure, CI confidence interval\nFig. 1 Leak-point pressure (LPP) values: a Mice in vaginal distention\n(VD) groups 1 d, 3 d, 7 d, 14 d, and 28 d were significantly lower than\nthose in noninstrumented control (NC) group, and LPP recovered from\nthe day 14 after VD. *P <0 . 0 5v sN Cg r o u p ;\n#P <0 . 0 5v sV D1dg r o u p ;\n&P <0 . 0 5v sV D3dg r o u p ;$P <0 . 0 5v sV D7dg r o u p ;^P <0 . 0 5v sV D\n14 d group. b LPP values of mice in VD, VD + punicalagin (PUN) 2.5,\nVD + PUN 5, and VD + PUN 10 groups were significantly lower than the\nNC group, whereas, values were significantly increased in VD + PUN 5\nand VD + PUN 10 groups compared with the NC group. *P <0 . 0 5v sN C\ngroup;\n#P < 0.05 compared with VD group. Every measurement was\nrepeated five times\n950 Int Urogynecol J (2017) 28:947– 955\n\nPUN prevents VD-induced metabolic disorder of ECM\nin urethras and anterior vaginal wall of mice\nHistologic examination of the midurethra showed typical\nmorphology of urethra and anterior vaginal wall\n(Fig. 2a). Urethral muscle fibers were disrupted\n(Fig. 2a) and connective tissues decreased in the VD\ncompared with the NC group (Fig. 2b). Connective tis-\nsues in urethra and anterior vaginal wall were apparent-\nly increased in a dose-dependent manner in mice in the\nVD + PUN group compared with the VD-alone group\n(Fig. 2b). In addition, the results of Western blot and q-\nPCR analysis (Fig. 3) show that both protein (Fig. 3a)\nand messenger RNA (mRNA) (Fig. 3b)e x p r e s s i o n\nTa bl e 5 Leak-point pressure (LPP) of mice in five groups x /C6 SðÞ\nGroup LPP (cmH2O) 95% CI\nNC 48.17 ± 10.52 (42.34– 54.00)\nVD 22.19 ± 9.33 (17.02– 27.36)\nVD + PUN 2.5 25.73 ± 8.16 (21.21– 30.25)\nVD + PUN 5 31.16 ± 10.25 (25.48– 36.84)\nVD + PUN 10 33.16 ± 13.88 (25.47– 40.85)\nNC noninstrumented control, VD vaginal distention, PUN punicalagin,\nLPP leak-point pressure, CI confidence interval\nFig. 2 Masson trichrome\nstaining of urethra and anterior\nvaginal wall: a noninstrumented\ncontrol (NC) group (a–c), vaginal\ndistention (VD) group (d–f),\nVD + punicalagin (PUN) 2.5\ngroup (g–i), VD + PUN 5 group\n(j–l), and VD + PUN 10 group\n(m–p). Collagen fibers stained\nblue,m u s c l ewhite, cellulose and\ncytoplasm red, nuclei blue-\npurple. Second column:\nmagnification of the black\nrectanglein the first column;third\ncolumn: magnification of the red\ndotted rectangle in the first\ncolumn. Original magnification:\n×100 (a, d, g, j, m); ×200 (b–c, e–\nf, h–i, k–l, o–p). b\nSemiquantitative assay of colla-\ngen using quantity one-4.6.2.\n*P <0 . 0 5 .E v e r ye x p e r i m e n tw a s\nrepeated three times\nInt Urogynecol J (2017) 28:947– 955 951\n\nlevels of collagen I, collagen III, and α-SMA in urethra\nand anterior vaginal wall were significantly decreased\nafter VD than those in the NC group. PUN increased\nprotein expression of collagen I, collagen III, and α-\nSMA in a dose-dependent manner in VD + PUN mice\ncompared with VD alone.\nPUN reverses VD-evoked TGFβ1/Smad3 signaling\ninhibition in urethras and anterior vaginal wall of mice\nTGF-β/Smads signaling plays an vital role in metabolism of\nECM and has been reported to have participated in the path-\nological process of mechanical-trauma-induced SUI. In this\nstudy, results shown in Fig. 4 that expression levels of\nTGF-β1 and p-Smad3 were significantly decreased after VD\ncompared with the NC group, but there were no significance\nchanges in Smad2, p-Smad2, and Smad3. Similarly, PUN\nmarkedly increased TGF-β1 and p-Smad3 protein expression\nin a dose-dependent manner in the urethra and anterior vaginal\nwall after VD than in the NC group, with no significant effect\non protein expression of Smad2, p-Smad2, and Smad3.\nPUN alleviates VD-induced oxidative damage in urethras\nand anterior vaginal wall of mice through upregulation\nof Nrf2/ARE signaling\nTo identify the involvement of Nrf2/ARE signaling activation\nin PUN against mechanical-trauma-induced SUI, we detected\nprotein expression of Nrf2, GPx1, MnSOD, and the oxidative\ndamage biomarker 8-OHdG in mice. As shown in Fig. 5a,\nexpression levels of Nrf2 and GPx1 in urethra and anterior\nvaginal wall were significantly decreased after VD than in\nFig. 3 Protein and messenger RNA (mRNA) expressions of collagen I,\ncollagen III, andα-smooth-muscle actin (SMA) in five groups.a Western\nblotting was performed to detect protein expression of collagen I,\ncollagen III, and α-SMA in urethra and anterior vaginal wall of mice in\nfive groups, and semiquantitative assay was done using quantity one-\n4.6.2. b Messenger RNA (mRNA) expression of collagen I, collagen\nIII, and α-SMA in urethra and anterior vaginal wall of mice in five\ngroups were detected by quantitative polymerase chain reaction (q-\nPCR). * P < 0.05 vs nonintrumented control (NC) group; #P <0 . 0 5\ncompared with vaginal distention (VD) group; every experiment was\nrepeated three times\nFig. 4 Western blotting shows protein expressions of transforming\ngrowth factor (TGF)- β1/Smads signaling pathways in urethra and\nanterior vaginal wall of mice in five groups. Semiquantitative assay was\ndone using quantity one-4.6.2. * P < 0.05 compared with NC group;\n#P < 0.05 compared with VD group. Every experiment was repeated\nthree times\n952 Int Urogynecol J (2017) 28:947– 955\n\nthe NC group, and there was no significant difference in\nMnSOD groups. In addition, PUN increased Nrf2, GPx1,\nand MnSOD expression in a dose-dependent manner, and 8-\nOHdG expression was significantly increased in the VD group\n(Fig. 5b– c). However, 8-OHdG in PUN groups 5 and 10 were\nsignificantly decreased c ompared with the VD group\n(Fig. 5b– c).\nDiscussion\nSUI is a common social and hygiene problem affecting the\nQoL of women worldwide and causing serious social eco-\nnomic load. Mechanical trauma, such as connective tissue,\nmuscle, or nerve, or damage to the vaginal wall or urethra\nand its suspensory structures due to VD is a widely recognized\nrisk factor in the genesis of SUI. In addition, there are as yet no\ndrugs to effectively cure SUI. In this study, we used PUN to\nreverse mechanical-trauma-induced SUI in a mouse model\nand found it has a therapeutic role against mechanical-\ntrauma-induced decreases in LPP and metabolic disorders of\nthe ECM. This effect may be via TGF- β1/Smad3, and\nNrf2/ARE signaling activation.\nVD is used to induce SUI in mice and rats, as evidenced by\nLPP and/or maximal urethral closing pressure (MUCP) on\nurodynamic testing [ 1, 8, 21, 22]. An SUI mouse model re-\nvealed that a 0.3-ml intravaginal balloon (diameter ∼8m m ,\nequal to brain-case diameter of newborn mice) produced\nFig. 5 Nuclear factor-erythroid 2 p45-related factor 2 (Nrf2)/antioxidant\nresponse element (ARE) signa ling-related proteins and 8-\nhydroxydeoxyguanosine (8-OHdG) expression in five groups. a\nWestern blotting detected Nrf2, glutathione peroxidase (GPx1), and\nmanganese superoxide dismutase (MnSOD) in urethra and anterior\nvaginal wall of mice in five groups. Semiquantitative assay was done\nusing quantity one-4.6.2. b Expression of 8-OHdG was detected using\nimmunohistochemistry in urethra and anterior vaginal wall;\nrepresentative images are shown: negative control ( a–b);\nnoninstrumented control (NC) ( c–d); vaginal dilation (VD) ( e–f2); VD\n+ punicalagin (PUN) 2.5 (g–h); VD + PUN 5 ( i–j); VD + PUN 10 ( k–l).\nImages in the second column are magnification of the first column; the\nimages in the forth column are magnification of the third column. Scale =\n50 μm. c Semiquantitative assay used Image-Pro Plus 5.1. *P <0 . 0 5c v s\n#P < 0.05 vs VD. Every experiment was repeated three times\nInt Urogynecol J (2017) 28:947– 955 953\n\ngreater LPP than 0.1- and 0.2-ml balloons [ 23]. VD-induced\nSUI mouse model possesses self-restoring capacity [ 24, 25],\nand LPP on measurements on days 0, 4, 10, and 20 after VD\nshowed that LPP was restored from day 20 [ 25].\nIn our study reported here, we measured LPP on days 1, 3,\n7, 14, and 28 after VD. Seven days after VD, LPP was mark-\nedly decreased from that of the NC group and began to recov-\ner from day 14. Based on this result, we tested LPPs on day 7\nfollowing VD and PUN oral therapy. We found that PUN has\nthe potential to cure mechanical-trauma-induced SUI in mice\nand report such findings here for the first time.\nThe vesical neck and urethra are attached to the anterior\nvaginal wall, which has fascial connections to the levator ani\nmuscles through the arcus tendineus fasciae pelvis. In addi-\ntion, connective tissue comprising collagen and elastin, as\nwell as muscle tissue, provides the vaginal wall with sufficient\nstrength and resilience to maintain normal anatomic position\nand function. Pelvic floor injury (such as during childbirth)\nmay disrupt these supportive tissues and connections, causing\nthe urethra to lose its hammock-like support and resulting in\nSUI [26]. In this study, urethral muscle fibers were disrupted,\nconnective tissue strength decreased, and both protein and\nmRNA expressions of collagen I, collagen III, and α-SMA\ndecreased in urethra and the anterior vaginal wall after VD.\nHowever, PUN significantly alleviated the metabolic disorder\nof ECM. This may be due to the mechanism of PUN against\nmechanical-trauma-induced SUI.\nTGF-β1 signaling plays an important role in collagen and\nα-SMA regulation.Studies show that TGF-β1 signaling is in-\nvolved in the pathological process of mechanical-trauma-\ninduced SUI [ 27– 29]. In addition, TGF- β1e x p r e s s i o ni n\nuterosacral ligaments of women with POP and SUI was de-\ncreased compared with women with POP only or in the con-\ntrol group [ 15]. To determine whether TGF- β1s i g n a l i n gi s\ninvolved in PUN-induced increase in ECM after VD, we\nassessed changes in TGF- β1 signaling in the mouse urethra\nand anterior vaginal. Our results show that the protein expres-\nsion levels of TGF- β1 and p-Smad3 in the VD group were\nsignificantly down-regulated compared with the NC group,\nwith no significant difference in Smad2, p-Smad2, and\nSmad3 expression, whereas PUN activated VD-induced\nTGF-β1/Smad3 signaling inhibition. One study indicated that\nTGF-β1 and p-Smad2 expression was up-regulated in urethral\ntissue of SUI rats and not in the sham group [ 29]. Another\nstudy found that Smad7 expression decreased and Smad3 in-\ncreased in urethral tissue of SUI rats vs the control group [28].\nHowever, those studies measured TGF- β signaling 4 weeks\nafter VD; our results show that the LPP began to recover from\nday 14. We tested TGF- β signaling on day 7 also, which\nshowed early-phase changes in TGF-β signaling in both ure-\nthra and anterior vaginal wall of our mouse model, whereas\nthe rat models reflect the later-phase changes in urethral tis-\nsues. Hence, we deduce that TGF-β signaling was inhibited in\nthe early phase and activated in the later phase of our study. In\naddition, changes in Smad3 were antecedent to Smad2. As a\nresult, LPP was decreased in the early phase and gradually\nrecovered in the later phase of recovery from VD. As a con-\nsequence, TGF- β signaling may be an important target for\npreventing and treating SUI.\nOxidative damage to vaginal wall and urethral sphincter\nwas confirmed as a result of mechanical trauma and was\nprominent in the pathological process of pelvic floor dysfunc-\ntion (PFD) [ 7– 11].\n Previous study indicated that cyclic me-\nchanical strain increased oxidative damage to human\nparametrial ligament fibroblasts and may be a pathogenesis\nof PFD [ 30]. A recent study showed that H\n2O2 significantly\ndecreased the contractile force of isolated strips of bladder and\nbladder-base urethra [11]. PUN, as a type of antioxidant, has\nshown to alleviate oxidative damage both in vivo and in vitro\nby upregulating Nrf2/ARE signaling pathway.\nIn this study, protein expressions of Nrf2 and its down-\nstream GPx1 were significantly decreased in VD mice, and\noxidative damage aggravated the urethra and anterior vaginal\nwall. However, PUN up-regulated expressions of antioxidant\nproteins Nrf2 and GPx1 and alleviated VD-induced oxidative\ndamage to the urethra and anterior vaginal wall. Hence,\nmechanical-trauma-induced decrease in antioxidant capacity\nand increase in oxidative damage to urethra and anterior vag-\ninal wall may be the pathogenesis of a metabolic disorder of\nthe ECM and result in SUI. Therefore, the oxidation – antiox-\nidation system may be an important target for SUI prevention\nand treatment. Some antioxidant foods or drugs may have\nbeneficial protective effects against mechanical-trauma-\ninduced SUI.\nIn conclusion, our results suggest that mechanical-trauma-\ninduced VD can cause SUI in female mice, recovery begins at\nday 14. In the early phase after VD, direct disruption of the\nurethral structure and TGF-β1/Smad3 and Nrf2/ARE signal-\ning inhibition induced a metabolic disorder in the ECM. .\nPUN had certain therapeutic effects on mechanical-trauma-\ninduced SUI by up-regulating Nrf2/ARE and TGF- β1/\nSmad3 pathways. However, further research is needed to con-\nfirm the relationship between these two signaling processes in\nthe pathogenesis of mechanical-trauma-induced SUI.\nAcknowledgements This work was financially supported by the\nNational Natural Science Foundation of China (number 81471442).\nCompliance with ethical standards\nEthical standard The procedures of the animal study received approv-\nal from the ethical committee of the Institutional Animal Care and Use\nCommittee of Renmin Hospital of Wuhan University (20140305).\nConflicts of interest None.\n954 Int Urogynecol J (2017) 28:947– 955\n\nOpen Access This article is distributed under the terms of the Creative\nCommons Attribution 4.0 International License (http://\ncreativecommons.org/licenses/by/4.0/), which permits unrestricted use,\ndistribution, and reproduction in any medium, provided you give appro-\npriate credit to the original author(s) and the source, provide a link to the\nCreative Commons license, and indicate if changes were made.\nReferences\n1. Chen YH, Lin YN, Chen WC, Hsieh WT, Chen HY . Treatment of\nstress urinary incontinence by cinnamaldehyde, the major constitu-\nent of the chinese medicinal herb ramulus cinnamomi. Evid Based\nComplement Alternat Med: eCAM. 2014;2014:280204. doi: 10.\n1155/2014/280204.\n2. Di Biase M, Malhorta N, Kocjancic E. Management of stress uri-\nnary incontinence. Semin Colon Rectal Surg. 2016;27(1):46 – 50.\ndoi:10.1053/j.scrs.2015.12.009.\n3. Koch M, Mitulovic G, Hanzal E, Umek W, Seyfert S, Mohr T, et al.\nUrinary proteomic pattern in female stress urinary incontinence: a\npilot study. Int Urogynecol J. 2016;27(11):1729– 34. doi:10.1007/\ns00192-016-3033-5.\n4. Lavelle ES, Zyczynski HM. Stress urinary incontinence: compara-\ntive efficacy trials. Obstet Gynecol Clin N Am. 2016;43(1):45– 57.\ndoi:10.1016/j.ogc.2015.10.009.\n5. Syan R, Brucker BM. Guideline of guidelines: urinary inconti-\nnence. BJU Int. 2016;117(1):20– 33. doi:10.1111/bju.13187.\n6. Feola A, Abramowitch S, Jones K, Stein S, Moalli P . Parity nega-\ntively impacts vaginal mechanical properties and collagen structure\nin rhesus macaques. Am J Obstet Gynecol. 2010;203(6):595.e1– 8.\ndoi:10.1016/j.ajog.2010.06.035.\n7. Chen HY , Chen WC, Lin YN, Chen YH. Synergistic effect of\nvaginal trauma and ovariectomy in a murine model of stress urinary\nincontinence: upregulation of urethral nitric oxide synthases and\nestrogen receptors. Mediat Inflamm. 2014;2014:314846. doi: 10.\n1155/2014/314846.\n8. Chen YH, Lin YN, Chen WC, Hsieh WT, Chen HY . Treatment of\nstress urinary incontinence by ginsenoside Rh2. Am J Chin Med.\n2014;42(4):817– 31. doi:10.1142/S0192415X14500529.\n9. Choy KW, Liu YM, Chu CY , Wang CC, Lui WT, Lee LL, et al.\nHigh isoprostane level in cardinal ligament-derived fibroblasts and\nurine sample of women with uterine prolapse. BJOG: Int J Obstet\nGynaecol. 2008;115(9):1179– 83. doi: 10.1111/j.1471-0528.2008.\n01806.x.\n10. Kim EJ, Chung N, Park SH, Lee KH, Kim SW , Kim JY , et al.\nInvolvement of oxidative stress and mitochondrial apoptosis in\nthe pathogenesis of pelvic organ prolapse. J Urol. 2013;189(2):\n588– 94. doi:10.1016/j.juro.2012.09.041.\n11. Malone L, Schuler C, Leggett RE, Levin RM. Effect of estrogen\nand ovariectomy on response of the female rabbit urinary bladder to\ntwo forms of in vitro oxidative stress. Int Urogynecol J. 2014;25(6):\n791– 8. doi:10.1007/s00192-013-2289-2.\n12. Bryan HK, Olayanju A, Goldring CE, Park BK. The Nrf2 cell\ndefence pathway: Keap1-dependent and -independent mechanisms\nof regulation. Biochem Pharmacol. 2013;85(6):705 – 17. doi: 10.\n1016/j.bcp.2012.11.016.\n13. Chen B, Y eh J. Alterations in connective tissue metabolism in stress\nincontinence and prolapse. J Urol. 2011;186(5):1768 – 72. doi:10.\n1016/j.juro.2011.06.054.\n14. Goepel C, Thomssen C. Changes in the extracellular matrix in\nperiurethral tissue of women with stress urinary incontinence.\nActa Histochem. 2006;108(6):441 – 5. doi:10.1016/j.acthis.2006.\n07.001.\n15\n. Suzme R, Y alcin O, Gurdol F, Gungor F, Bilir A. Connective tissue\nalterations in women with pelvic organ prolapse and urinary incon-\ntinence. Acta Obstet Gynecol Scand. 2007;86(7):882 – 8. doi: 10.\n1080/00016340701444764.\n16. Wen Y , Polan ML, Chen B. Do extracellular matrix protein expres-\nsions change with cyclic reproductive hormones in pelvic connec-\ntive tissue from women with stress urinary incontinence? Hum\nReprod. 2006;21(5):1266– 73. doi:10.1093/humrep/dei485.\n17. Han L, Wang L, Wang Q, Li H, Zang H. Association between\npelvic organ prolapse and stress urinary incontinence with collagen.\nExp Ther Med. 2014;7(5):1337– 41. doi:10.3892/etm.2014.1563.\n18. Xu X, Li H, Hou X, Li D, He S, Wan C, et al. Punicalagin Induces\nNrf2/HO-1 Expression via Upregulation of PI3K/AKT Pathway\nand Inhibits LPS-Induced Oxidative Stress in RAW264.7\nMacrophages. Mediat Inflamm. 2015;2015:380218. doi: 10.1155/\n2015/380218.\n19. Li G, Feng Y , Xu Y , Wu Q, Han Q, Liang X, et al. The anti-infective\nactivity of punicalagin against Salmonella enterica subsp. enterica\nserovar typhimurium in mice. Food Funct. 2015;6(7):2357– 64. doi:\n10.1039/c5fo00053j.\n20. Jean-Gilles D, Li L, V aidyanathan VG, King R, Cho B, Worthen\nDR, et al. Inhibitory effects of polyphenol punicalagin on type-II\ncollagen degradation in vitro and inflammation in vivo. Chem Biol\nInteract. 2013;205(2):90– 9. doi:10.1016/j.cbi.2013.06.018.\n21. Chen YH, Chen CJ, Lin YN, Wu YC, Hsieh WT, Wu BT, et al.\nProteomic analysis of urethral protein expression in an estrogen\nreceptor alpha-deficient murine model of stress urinary inconti-\nnence. World J Urol. 2015;33(10):1635 – 43. doi:10.1007/s00345-\n014-1474-3.\n22. Chen HY , Chen CJ, Lin YN, Chen YH, Chen WC, Chen CM.\nProteomic analysis related to stress urinary incontinence following\nvaginal trauma in female mice. Eur J Obstet Gynecol Reprod Biol.\n2013;171(1):171– 9. doi:10.1016/j.ejogrb.2013.08.034.\n23. Lin Y -H, Liu G, Daneshgari F. A mouse model of simulated birth\ntrauma induced stress urinary incontinence. Neurourol Urodyn.\n2008;27(4):353– 8. doi:10.1002/nau.20509.\n24. Hijaz A, Daneshgari F, Sievert KD, Damaser MS. Animal models\nof female stress urinary incontinence. J Urol. 2008;179(6):2103 –\n10. doi:10.1016/j.juro.2008.01.096.\n25. Lin YH, Liu G, Li M, Xiao N, Daneshgari F. Recovery of conti-\nnence function following simulated birth trauma involves repair of\nmuscle and nerves in the urethra in the female mouse. Eur Urol.\n2010;57(3):506– 12. doi:10.1016/j.eururo.2009.03.020.\n26. Parker-Autry CY , Burgio KL, Richter HE. Vitamin D status: a re-\nview with implications for the pelvic floor. Int Urogynecol J.\n2012;23(11):1517– 26. doi:10.1007/s00192-012-1710-6.\n27. Wen Y , Zhao YY , Polan ML, Chen B. Effect of relaxin on TGF-\nbeta1 expression in cultured vaginal fibroblasts from women with\nstress urinary incontinence. Reprod Sci. 2008;15(3):312 – 20. doi:\n10.1177/1933719108315299.\n28. Wang H, Liu J, Zeng J, Zeng C, Zhou Y . Expression of TbetaR-2,\nSmad3 and Smad7 in the vaginal anterior wall of postpartum rats\nwith stress urinary incontin ence. Arch Gynecol Obstet.\n2015;291(4):869– 76. doi:10.1007/s00404-014-3495-y.\n29. Li GY , Cui WS, Zhou F, Gao ZZ, Xin H, Liu T, et al. Pathology of\nurethral fibromuscular system related to parturition-induced stress uri-\nnary incontinence and TGF-beta1/Smad pathway. Mol Cell Biochem.\n2012;364(1– 2):329– 35\n. doi: 10.1007/s11010-012-1234-x.\n30. Hong S, Li H, Wu D, Li B, Liu C, Guo W, et al. Oxidative damage\nto human parametrial ligament fibroblasts induced by mechanical\nstress. Mol Med Rep. 2015;12(4):5342– 8. doi:10.3892/mmr.2015.\n4115.\nInt Urogynecol J (2017) 28:947– 955 955","source_license":"CC0","license_restricted":false}