{"paper_id":"c8c7fe2f-4725-4e3f-b6f8-08b7414ec078","body_text":"Human-specific transposable elements shaped the evolution of craniofacial \ndevelopment through regulation of neural crest migration  \n \nLaura Deelen1, Zoe H. Mitchell 1, Martina Demurtas 1, Beatriz Garcia Del Valle 1 and Marco \nTrizzino1,* \n \n1 Department of Life Sciences, Imperial College London, London, UK \n* Corresponding author: E-mail: m.trizzino@imperial.ac.uk \n \nAbstract  \nCraniofacial development and neural crest specification are evolutionarily conserved \nprocesses, yet subtle modifications to their gene regulatory networks drive species -specific \ncraniofacial diversity. Transposable elements (TEs) are increasingly recognized as \ncontributors to genome evolution, but their role in shaping neural crest regulatory programs \nremains u nderexplored. Here, we investigate the domestication of h uman-specific TEs as \ntranscriptional enhancers during cranial neural crest cell (CNCC) specification, a process \ncritical for vertebrate head development. Using human iPSC -derived CNCCs, we identified  \n~250 human-specific TEs acting as active enhancers. These TEs were predominantly LTR5Hs \nand, to a lesser extent, SVA-E/Fs. We demonstrate that these elements have been co-opted \nthrough the acquisition of the conserved CNCC coordinator motif, and are bound by the CNCC \nsignature factor TWIST1, and that their co-option appears to be largely exclusive to CNCCs. \nTo assess their functional relevance, we used CRISPR-interference to repress ~75% of all the \nLTR5Hs and SVAs active in CNCCs, which led to widespread transcriptional changes in genes \nassociated with neural crest migration, a process essential for CNCCs to populate the embryo \nand form craniofacial structures. Using a cell migration assay , we showed that CNCC \nmigration was significantly impaired by CRISPR-mediated TE repression.  Finally, we \ndemonstrate that genes near human -specific TEs are more highly expres sed in  human \nCNCCs relative to chimpanzee, and TE repression re turns their expression to chimpanzee \nlevels.  \nThese findings reveal how  human-specific TEs have been co -opted to fine -tune CNCC \nregulatory networks, potentially contributing to the evolution of lineage-specific craniofacial \ntraits.  \n \n \nKeywords: LTR5Hs, SVA, enhancer, CNCC, co-option, TWIST1, coordinator motif, evolution \nof cell migration \n \n \n \n \n \n \n \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nIntroduction \nCraniofacial development is a highly complex process that requires precise spatiotemporal \nregulation and involves contributions from all three germ layers and in particular from the  \nneural crest cells (NCCs)  (Gans & Northcutt, 1983 ; Ahlstrom & Erickson, 2009; Martik & \nBronner, 2021; Theveneau & Mayor, 2012 ). NCCs emerge during early embryogenesis, \nbetween weeks 3 -4 in humans, at the neural plate border between the neuroectoderm and \nnon-neural ectoderm. As neurulation progresses, the neural plate invaginates and separates \nfrom the dorsal ectoderm, forming the neural tube. At this stage, NCCs undergo epithelial-to-\nmesenchymal transition (EMT), allowing them to delaminate and migrate to specific regions \nthroughout the developing embryo  (Ahlstrom & Erickson, 2009; Martik & Bronner, 2021; \nTheveneau & Mayor, 2012) . Among the NCC subtypes, cranial neural crest cells (CNCCs) \nplay a pivotal role in the formation of key craniofacial structures, including bones and cartilage \n(Bronner & LeDouarin, 2012; Cordero et al., 2011; Jheon & Schneider, 2009).  \nAlthough craniofacial development is an evolutionary conserved process, recent adaptations \nto the modern human craniofacial complex include  changes in shape  and function  to \naccommodate the enlargement of the brain , the  transition t o bipedal posture, laryngeal \nextension for speech as well as adjustments for the evolvement of sensory organs (Lieberman, \n1998; Sambataro et al., 2022; Spoor et al., 1994). The evolution of human-specific craniofacial \ntraits has required precise modifications in gene expression and increasing evidence suggests \nthat regulatory changes, rather than protein -coding mutations, have been key to shaping \nspecies-specific features (Carroll, 2005; King & Wilson, 1975; Wray, 2007). One major source \nof these regulatory innovations are the transposable elements (TEs). Comprising nearly half \nof the human genome, TEs are now recognized as key contributors to genomic evolution \nthrough their ability to integrate into the genome and act as cis-regulatory elements (Bourque \net al., 2008; Chuong et al., 2013, 2016; Cosby et al., 2021; Goubert et al., 2020; Kunarso et \nal., 2010; Lynch et al., 2011; Pontis et al., 2019; Schmidt et al., 2012; Sundaram & Wysocka, \n2020). Transposable element-mediated rewiring of gene regulatory networks has previously \nbeen implicated as a major driver of species-specific gene expression patterns (Chuong et al., \n2013; Feschotte, 2008; Fueyo et al., 2022; Jacques et al., 2013; Patoori et al., 2022; Playfoot \net al., 2021; Prescott et al., 2015; Sundaram et al., 2014; Trizzino et al., 2017).  \nHowever, much remains to be uncovered about the precise mechanisms through which \ntransposable elements (TEs) have been co -opted as cis -regulatory elements in humans, \nparticularly in the context of craniofacial development. In the human genome, SINE-Vntr-Alus \n(SVAs) and LTR5Hs have been previously linked to gene regulatory activity (Barnada et al., \n2022; Chuong et al., 2016; Fuentes et al., 2018; Patoori et al., 2022; Pontis et al., 2019; \nTrizzino et al., 2017). SVAs are the youngest TE family and include roughly 3000 copies in the \nhuman genome. They are  composed of a hexamer repeat, an Alu -like element, a variable \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nnumber of tandem repeats (VNTRs), a SINE element, and a poly -A tail (Fig. 1A). The SVAs \nare hominoid-specific, comprise of six subfamilies (A–F), with SVA-E and SVA-F being found \nexclusively in humans, with ∼1700 copies in total (Quinn & Bubb, 2014; Wang et al., 2005) . \nLTR5Hs are also human-specific, and are remnants of an ancestral endogenous retrovirus of \nthe HERV-K subtype.  \nCo-option of SVAs and LTR5Hs  as active cis -regulatory elements has been observed in \ndifferent human tissues (Barnada et al., 2022; Chuong et al., 2013; Fuentes et al., 2018; \nOstertag et al., 2003; Patoori et al., 2022; Pontis et al., 2019; Trizzino et al., 2017). Since the \nexpansion of LTR5Hs and SVA -E/F subfamilies occurred around the time of the human –\nchimpanzee split, we set out to investigate if these elements could have contributed to human-\nspecific craniofacial development.  \nHuman cranial neural crest cell (CNCC) specification and migration  can be  effectively \nmodelled in vitro  using human -induced pluripotent stem cells (hiPSCs).  Therefore, in this \nstudy, we employed an inducible CRISPR -interference (CRISPRi) hiPSC line to investigate \nthe impact of silencing human -specific SVA -E, SVA -F, and LTR5Hs elements  to CNCC \nformation and migration, which are essential processes for the development of the craniofacial \nstructures, including bones and cartilage. To achieve this, we employed previously published \nsingle-guide RNAs (sgRNAs) targeting approximately 80% of these transposable elements \n(Pontis et al., 2019).  \nWith this approach, we identified  approximately 250 human-specific SVAs and LTR5Hs that \nare accessible and depleted of the repressive histone mark H3K9me3 in human CNCCs.  We \nfound that the specific DNA sequence was the primary driver for the co -option of this set of \nTEs. Importantly, silencing these retroelements attenuated the expression of hundreds of \ngenes involved in CNCC migration , which is a  key process in craniofacial morphogenesis . \nFunctional assays confirmed that migration was disrupted, suggesting a potential role for the \ntransposons in species -specific craniofacial development. This was further supported by \ncomparisons with previously published chimpanzee CNCC data, which revealed that the \nexpression levels of genes located near accessible human -specific transposable elements \nresembled those observed in human CNCCs upon depletion of these elements.  \n \nResults \nAn inducible CRISPR-interference iPSC system for the repression of hominoid-specific \nTEs \nTo investigate the role of human-specific transposable elements (TEs) ( SVAs and LTR5Hs; \nFig. 1a) in human cranial neural crest cell (CNCC) development, we designed a stable human \niPSC line with an inducible  CRISPR-interference (CRISPRi) system with single-guide RNAs \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n(sgRNAs) targeting ~80% of all SVAs and LTR5Hs annotated in the human genome (Fig. 1b). \nThe sgRNAs were originally designed and validated in a study by the Trono group (Pontis et \nal., 2019) and were further used in subsequent studies (Barnada et al., 2022; Patoori et al., \n2022). Briefly, we cloned a stable  iPSC line with a  permanently integrated TET-inducible, \ncatalytically dead, Cas9 fused to a repressive KRAB domain (dCas9 -KRAB), along with the \ntwo gRNAs targeting the LTR5Hs and SVAs (hereafter +gRNA line) . The KRAB domain \nrecruits the transcriptional machinery necessary to deposit repressive histone methylation \n(H3K9me3) to the regions targeted by dCas9. To account for potential off-target effects caused \nby exposure to doxycycline (TET-ON) or by Cas9 expression, we cloned the same iPSC line \nwith an identical  dCas9-KRAB construct but without any gRNA s (hereafter -gRNAs line). \nTreating the cells with doxycycline for 24 hours was sufficient to activate dCas9 in both \nCRISPRi lines (i.e. with and without gRNAs; Fig. 1c,d).   \nNext, we generated CNCCs from our CRISPRi-iPSC lines using an established 5-day protocol \n(Fig. 1e -f; Leung et al., 2016) . Since both SVAs and LTR5Hs have been shown to have \nimportant roles in human embryonic stem cells and iPSCs  (Barnada et al., 2022; Fuentes et \nal., 2018; Pontis et al., 2019) , doxycycline was only introduced 24h after differentiation (Fig. \n1c). By day 5 of differentiation, both cell lines expressed markers typical of CNCC identi ty, \nboth at gene (SOX9, SOX10, TWIST1, TFAP2A) and protein  (SOX9, AP2 a) level. We \ngenerally did not observe significant differences in CNCC marker expression between the two \nlines, apart from TFAP2A (AP2a) at the gene level (Fig. 1e,f), indicating that expression of the \nmain genes essential for CNCC identity was largely unaffected by the CRISPRi.  \n \nHundreds of SVAs and LTR5Hs are accessible in human CNCCs \nWe set out to determine whether any LTR5Hs and human-specific SVA exhibited chromatin \naccessibility in human CNCCs , and whether these elements could be repressed using our \nCRISPRi system. To this end, we performed ATAC-seq (paired-end, 150 bp reads) in hiPSC-\nderived CNCCs generated with our CRISPRi-iPSC lines (+ and -gRNAs). K-mer clustering of \nthe ATAC-seq data identified a total of 256 accessible LTR5Hs and human-specific SVAs (Fig. \n2a; Supplementary File S1). Notably, 77% of these 256 TEs displayed decreased accessibility \nin the +gRNA CRISPRi line relative to the -gRNA control (cluster 2, Fig. 2a). This is consistent \nwith the assumption that these gRNAs can target ~80% of all the human LR5Hs and SVAs  \n(Pontis et al. 2019) . LTR5Hs were significantly overrepresented among the 256 accessible \nhuman-specific TEs (observed 87%, expected 29%; Fisher’s Exact Test p < 2.2 x 10 -16; Fig. \n2b), while the SVAs were significantly underrepresented (13% observed vs 71% expected; \nFisher’s Exact Test p < 2.2 x 10-16; Fig. 2b), highlighting a potential primary role for LTR5Hs in \nCNCCs.  \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nFurthermore, we wanted to confirm that the loss in chromatin accessibility observed in the \n+gRNA lines was a direct consequence of the CRISPRi-mediated repression. To this end, we \nperformed ChIP-seq for H3K9me3 (paired-end 150 bp reads), which showed accumulation of \nthis repressive histone mark at approximately 75% of the 256 accessible LTR5Hs and human-\nspecific SVAs in the +gRNA samples (Fig. 2c). Notably, there was a remarkable overlap (92%) \nbetween the TEs that lost chromatin accessibility (Fig. 2a) and those gaining H3K9me3 (Fig. \n2c).  \nWe further investigated the genomic locations of these accessible human -specific TEs. \nOverall, 91% of the 256 accessible LTR5Hs and human -specific SVAs were located > 1 kb \nfrom the nearest transcription start site ( TSS), and the median distance was 8.9 kb. This \nsuggests that these accessible mobile elements could be  putative CNCC enhancers.  To \nconfirm this, we leveraged publicly available H3K27ac ChIP-seq data previously generated by \nour group in hiPSC-derived CNCCs (Barnada et al., 2024) . This analysis revealed that the \nvast majority of the 256 accessible human -specific TEs are also decorated by the H3K27ac, \nan established active enhancer mark, supporting their role as bona-fide human-specific CNCC \nenhancers (Supplementary Figure S1a).  \nTo ensure that our findings were not biased by a specific differentiation protocol, we used an \nalternative iPSC-to-CNCC differentiation method (Bajpai et al., 2010)  and performed ATAC-\nseq on the differentiated cells. With this protocol, migratory CNCCs are obtained in 2-3 weeks  \n(Bajpai et al., 2010; Barnada et al., 2024; Mitchell et al., 2025; Pagliaroli et al., 2021) . Using \nthis approach, we similarly identified 374 LTR5Hs and human-specific SVA elements that are \naccessible in CNCCs, the majority of which exhibited reduced accessibility in the +gRNA line \ncompared to the -gRNA control (Supplementary Fig. S1 b). Moreover, comparable to our  \nfindings obtained with the 5-day protocol, LTR5Hs were significantly overrepresented in the \nset of accessible TEs (83% observed vs 29% expected; Fisher’s Exact Test p < 2.2 x 10 -16), \nwhile SVAs were significantly underrepresented (17% observed vs 71% expected; Fisher’s \nExact Test p < 2.2 x 10 -16). Importantly, 91% of the 256 human -specific TEs identified as \naccessible in the 5 -day protocol were also found accessible in CNCCs derived using the \nalternative protocol. This consistency suggests that our findings are robust and independent \nof the CNCC differentiation method used. \nFinally, since our gRNAs also target non -human specific SVAs (i.e. SVA -A, -B, -C, -D), we \nexamined the ATAC-seq signal across all existing SVA subfamilies. In total, 184 non-human-\nspecific SVAs (A –D subfamilies) were accessible in CNCCs  and 3922 were inaccessible  \n(Supplementary Fig. S1c). Notably, even when considering all SVA groups, SVAs remained \nsignificantly underrepresented among accessible TEs (46% observed vs. 89% expected; \nFisher’s Exact Test, p < 2.2 × 10⁻¹⁶). \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nIn summary, these experiments identified approximately 550 hominoid -specific TEs, half of \nwhich human -specific, that exhibit signatures of active enhancers in human iPSC -derived \nCNCCs, with LTR5H s elements  playing a prominent role. Notably, our CRISPR -based \napproach enabled the inducible repression of ~75% of these putative TE -derived human-\nspecific CNCC enhancers. \n \nCo-opted human-specific TEs are enriched with the CNCC coordinator motif \nNext, we explored the genomic features driving the co -option of the LTR5Hs and SVAs as \nCNCC enhancers. We performed  computational DNA  motif analysis on the set of 256 \naccessible human-specific TEs using the non-accessible LTR5Hs and SVAs as background \ncontrol for differential enrichment. Recent studies have identified a specific DNA motif, known \nas coordinator, which is enriched at enhancers critical for the regulation of CNCC identity (Kim \net al., 2024; Prescott et al., 2015). Coordinator is a composite motif which consists of a fusion \nbetween a generic AT-rich homeobox motif (TTAATTA) and the binding motif of the CNCC \nmaster regulator TWIST1, typically joined by a stretch of  A nucleotides (Kim et al., 2024; \nPrescott et al., 2015). Importantly, we found both components of the coordinator motif as highly \nenriched in the set of accessible LTR5Hs and SVAs (Fig. 2d ; Supplementary File S 2). \nSpecifically, the TWIST1 motif and the AT-rich homeobox motif were found in 83% and 62% \nof accessible human-specific TEs, respectively (Fig. 2d; Supplementary File S2 ). Moreover, \nwe found that 29% of the accessible human -specific SVAs and LTR5Hs harbour the full \ncoordinator motif  sequence, as opposed to only 14% of the non -accessible TEs.  This \nsuggests that the human -specific TEs accessible in CNCCs are significantly more enriched \nfor the coordinator motif relative to the non-accessible ones (Fisher’s Exact Test p < 0.00001).  \nIn addition, the motifs for other CNCC signature transcription factors, such as AP2a, SOX9/10, \nSLUG and FOXD3 were also found as significantly enriched (Fig. 2d; Supplementary File S2). \nGiven the prevalence of the coordinator motif in accessible LTR5Hs and SVAs, we investigated \nwhether these TEs are directly bound by TWIST1 in human CNCCs. To address this, we \nleveraged publicly available TWIST1 ChIP-seq data generated in iPSC-derived CNCCs (Kim \net al., 2024), which revealed that over half of the accessible LTR5H s and SVA elements are \nbound by TWIST1 in human CNCCs (Fig. 2e). \nOverall, these findings suggest that DNA sequence and transcription factor binding are a major \ndriver for TE co-option as active CNCC enhancers.  \n \nRepression of LTR5Hs and SVAs impairs expression of CNCC-migration genes \nOur experiments so far identified ~550 LTR5Hs and SVAs  (half of which human -specific) \ndisplaying active enhancer signature in human CNCCs.  Since our CRISPRi system enables \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nthe simultaneous repression of ~75% of these elements, we next investigated whether their \nrepression had significant effects on the CNCC transcriptome . To this end, we differentiated \nour doxycycline-treated CRISPRi lines (+ and -gRNAs) into CNCCs and performed RNA-seq. \nFirst, we analyzed gene expression in relation to the nearest transcription start sites (TSS) of \nthe 256 accessible human -specific SVAs and LTR5H s. In total, we identified 107 genes \nlocated near these elements that were actively expressed in CNCCs (median TPM >1 across \nall -gRNA replicates). Overall, the expression of these genes was significantly decreased upon \nTE repression (Wilcoxon’s Rank Sum test p < 0.037; Supplementary Fig. S 2a), with 83/107 \n(=77.5%) displaying lower expression in the +gRNA sample relative to the -gRNA counterpart \n(Supplementary File S3).  \nWe leveraged publicly available RNA-seq data from CNCCs derived from chimpanzee iPSCs \n(Prescott et al., 2015), which we reanalysed using our pipeline, to compare the expression of \nthese 107 genes between the two closely related ape species. This analysis revealed that \nthese genes are typically expressed at significantly higher levels in humans than in \nchimpanzees (Fig. 3a; Supplementary File S3). However, repressing the human-specific SVAs \nand LTR5Hs eliminate d this expression difference between the two species (Fig. 3a), \ndemonstrating a direct role for these TEs in species -specific CNCC gene regulation . \nConsistent with this , repressing the human -specific TEs increased the correlation between \nhuman and chimpanzee expression levels for these genes (Supplementary Fig. S2b).  \nNext, we examined transcriptome-wide effects. Differential gene expression analysis identified \n795 genes that were significantly differentially expressed between +gRNA and -gRNA CNCCs \n(FDR < 0.05; FC < -1.5 or > 1.5; Fig. 3b; Supplementary File S4). Of the se, 501 genes were \ndownregulated, while 294 genes were upregulated in the +gRNA samples (Fig. 3b). Gene \nontology enrichment analysis of the downregulated genes revealed a significant enrichment \nfor cell migration -related processes, suggesting that many of these genes play key roles in \nCNCC migration (Fig. 3c; Supplementary File S5). Conversely, upregulated genes were \nprimarily associated with mitochondrial and cell division processes (Supplementary File S6). \nNotably, only 3 of the differentially expressed genes had an intronic SVA or LTR5Hs, \nsuggesting that the high number of differentially expressed genes is not an artifact of CRISPRi \nmediated repression at gene bodies.  \n \nSilencing human-specific TEs functionally affects CNCC migratory potential in vitro \nSince cell migration was the predominant signature enriched in the downregulated genes, we \ninvestigated whether repressing human -specific SVAs and LTR5Hs could functionally affect \nCNCC migration. To test this, we performed a transwell migration assay , in which hiPSC -\nCNCCs were seeded on geltrex-coated transwell membranes overnight and subsequently \nexposed to medium supplemented with the general chemoattractant fetal bovine serum (FBS) \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nin the lower chamber (Fig. 4a). After 24 hours of incubation, comparison of the –gRNA and \n+gRNA lines revealed a significant reduction in CNCC migration across the membrane upon \nrepression of human-specific TEs, suggesting impaired migratory capacity (Fig. 4b,c). These \nfindings were consistent with the RNA -seq data and suggest that human-specific SVAs and \nLTR5Hs have been co-opted to regulate human CNCC migration.  \n \nThe LTR5Hs and SVAs active in CNCCs are silent in most human cell-types \nFinally, we investigated whether the 256 human -specific SVAs and LTR5H s with active \nenhancer signature in CNCCs were also co-opted as cis-regulatory elements in other human \ncell types. To address this, we leveraged publicly available H3K27ac ChIP-seq data from 14 \ncell types generated by the Roadmap Epigenomics Consortium , including distinct brain \nregions, lung, aorta, adipose tissue, pancreas and spleen (Kundaje et al., 2015). This analysis \nrevealed that , in addition to CNCCs,  these 256 TE  exhibit active enhancer signature \nexclusively in endomesodermal cells, with a subset also active in iPSCs (Fig. 5). In contrast, \nthey remain completely silenced in all other cell types (Fig. 5). The activation of these elements \nin endomesodermal cells is u nsurprising, as a previous study from our lab ha s shown that \nhuman-specific SVAs are highly enriched for the motif of the  key mesodermal regulator \nEOMES ( = TBR2; Patoori et al., 2022 ). Similarly, the co -option of SVAs and LTR5H s as \nregulatory elements in human iPSCs and ESCs has been suggested by previous research \n(Barnada et al., 2022; Fuentes et al., 2018; Pontis et al., 2019). \nIn summary, these findings support the notion that TE co -option as functional cis -regulatory \nelements is largely a cell -type-specific process, with distinct subsets of human -specific TEs \ncontributing to regulatory networks in different developmental contexts. \n \nDiscussion \nTransposable elements (TEs) have historically been viewed as genomic parasites with little \nrelevance beyond their self -propagation mechanisms. Yet, over the past two decades, \nnumerous studies have shown that TEs can substantially influence gene regulatory \narchitectures, driving lineage -specific developmental programs and morphological variation  \n(Chuong et al., 2017; Feschotte, 2008; Fueyo et al., 2022; Patoori et al., 2022; Sundaram & \nWysocka, 2020; Trizzino et al., 2017) . In this regard, the vertebrate cranial neural crest cell \n(CNCC) population, which plays a pivotal role in craniofacial morphogenesis, offers an \nespecially intriguing system for the investigation of TE co -option as a source of regulatory \nnovelty (Bronner & LeDouarin, 2012; Gokhman et al., 2021; Minoux & Rijli, 2010; Prescott et \nal., 2015). Over the course of vertebrate evolution, craniofacial diversity has been shaped by \nsmall but potent modifications in the gene regulatory circuits of the neural crest (Gokhman et \nal., 2021; Prescott et al., 2015) . In this context, our findings suggest that hominoid -specific \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nTEs contribute to these modifications by providing new enhancer platforms that alter CNCC \ngene expression, pointing to a direct role for TEs in the emergence of human-specific \ncraniofacial features (Gokhman et al., 2021; Prescott et al., 2015). \nCNCCs are a multipotent, migratory cell population that emerges from the border region of the \nneural tube and subsequently disperses into developing craniofacial structures, the peripheral \nnervous system, and other tissues  (Simões-Costa et al., 2015; Theveneau & Mayor, 2012) . \nUnderstanding how species -specific genomic elements, such as hominoid -specific TEs, \nmodulate CNCC development can shed light on the evolutionary mechanisms underlying \nmorphological divergence, particularly in the craniofacial region (Capra et al., 2013; Prescott \net al., 2015). Specifically, in this study we demonstrate that LTR5Hs and SVAs, two families \nof TEs unique to hominoids, function as enhancers within human CNCCs. Using integrative \napproaches that combined chromatin accessibility profiling, transcriptomic analysis, and  \nfunctional perturbation via CRISPR-interference, we reveal that hundreds of these TEs display \nactive enhancer signatures and exert direct regulatory control over genes crucial for CNCC \nmigration. These findings are in line with previous studies showing that TEs can be repurposed \nas developmental enhancers, thereby contributing to species -specific gene regulatory \nlandscapes in primates (Jacques et al., 2013; Patoori et al., 2022; Trizzino et al., 2017) . Our \ndata also implicate these TE -derived enhancers in driving human -specific craniofacial \nregulatory programs, as evidenced by the fact that repressing LTR5Hs and SVAs reduces the \nexpression of dozens of genes in human CNCCs to levels normally observed in chimpanzees. \nNotably, LTR5Hs and SVAs have historically been linked to regulatory innovation in primates, \nthough their roles in neural crest biology have remained unexplored  (Fuentes et al., 2018; \nImbeault et al., 2017; Patoori et al., 2022; Pontis et al., 2019). \nOne of the central questions in evolutionary developmental biology is how minor alterations in \ndeeply conserved developmental pathways can yield significant morphological divergence  \n(Carroll, 2005; King & Wilson, 1975) . The CNCC population, which is indispensable for \ncraniofacial bone and cartilage formation, serves as an excellent proof of principle in this \nregard. It has been suggested that relatively small changes in CNCC gene expression can \nprofoundly impact facial shape and size (Khouri-Farah et al., 2025; Le Douarin & Dupin, 2018; \nMinoux & Rijli, 2010; Mitchell et al., 2025; Prescott et al., 2015) . Our study extends this \nframework by proposing that TEs represent a flexible reservoir of regulatory motifs capable of \nintegrating into pre -existing gene regulatory networks, fine -tuning CNCC specification and \nmigration. These findings are consistent with previous reports showing that TEs have been \nexapted into tissue-specific enhancers in various lineages, including immune cells, brain cell-\ntypes, embryonic stem cells, and endometrial tissue (Chuong et al., 2017; Frost et al., 2023; \nLynch et al., 2011; Trizzino et al., 2018; J. Wang et al., 2014). \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nWhile correlative evidence can implicate TEs as enhancers, functional validation is key to \nestablishing their regulatory impact. By employing a CRISPRi approach that targeted \napproximately 75% of all the human LTR5Hs and SVAs active in CNCCs, we observed \npronounced effects on gene expression with a strong enrichment for processes related to cell \nmigration, which is indispensable for CNCCs to navigate into the developing facial primordia  \n(Theveneau & Mayor, 2012) . These results not only reinforce the notion that TEs influence \nCNCC gene networks but also demonstrate that their regulatory input is significant enough to \nmodulate key developmental pathways. This model agrees with evidence from other contexts \nin which TEs have driven evolutionary innovations. For instance, MER41 elements in the \nhuman genome have been exapted as enhancers regulating immune responses  (Chuong et \nal., 2017). Similarly, in the endometrium and placenta, endogenous retroviral LTRs have been \nimplicated in the evolution of pregnancy-specific gene regulatory networks (Frost et al., 2023; \nLynch et al., 2011) . Our study adds craniofacial development to the growing list of \ndevelopmental systems shaped by TE co -option, further highlighting the broad evolutionary \nrelevance of these mobile elements.  \nTE co-option relies on the inherent or mutated presence of transcription factor binding sites \nwithin TE sequences (Barnada et al., 2022; Bejerano et al., 2006; Feschotte, 2008; Patoori et \nal., 2022; Trizzino et al., 2017, 2018) . In this study we show that LTR5Hs and SVAs \ndomesticated as enhancers in CNCCs harbour binding sites for the CNCC coordinator motif \n(Kim et al., 2024; Prescott et al., 2015), as well as motifs for TFAP2A, SOX9/10 and other key \nregulators of neural crest identity. We hypothesize that these factors bind cooperatively to \nmulti-part motifs within the TE loci, enabling the formation of enhancer complexes that drive \nspatial and temporal gene expression programs in CNCCs.  \nDisruptions to CNCC gene regulatory networks can underlie congenital anomalies such as \ncleft lip and palate, craniosynostosis, and other craniofacial malformations  (Khouri-Farah et \nal., 2025; Trainor, 2010) . Given that TE -derived enhancers are integral to the CNCC \ntranscriptional program, mutations or epigenetic dysregulations at these loci could contribute \nto such disorders. Future studies investigating the links between TE variations and craniofacial \npathologies may reveal novel diagnostic markers or therapeutic targets. \nIn addition, comparative investigations in other hominoids, including gorillas and orangutans, \ncould help unravel whether other TEs have been similarly co-opted in the cranial neural crest. \nSuch research would clarify whether TE -driven craniofacial enhance r innovations are a \nhallmark across all hominoids or largely unique to the human lineage, shedding light on how \nsmall-scale genetic elements can produce macro-evolutionary changes in form and function. \nIn conclusion, our findings provide further evidence for TEs as highly adaptive genomic \nelements that actively contribute to shaping developmental and evolutionary trajectories. \nThrough combined roles in CNCC specification, migration, and potentially other  lineage-\n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nspecific developmental programs, TEs demonstrate how evolutionary tinkering at the \nregulatory level can yield morphological diversity.  \n \n \nMaterials and Methods \n \nGeneration of doxycycline-inducible dCas9-KRAB hiPSC lines \nA plasmid containing a tetracycline -inducible dCas9-KRAB expression cassette flanked by \npiggyBac recombination sites was obtained from the Wysocka Lab at Stanford University. This \nplasmid, referred to as ‘p-dCas9-KRAB,’ provides constitutive puromycin resistance, enabling \nselection of stable clones when co-expressed with the piggyBac transposase plasmid (‘p-PB-\nTransposase,’ Systems Bioscience). For the -gRNAs line, the C2277 hiPSC line was co -\ntransfected with p-dCas9-KRAB and p-PB-Transposase by Applied StemCell Inc. (C2277-A, -\ngRNAs line). Next, a piggyBac transposon plasmid (‘p -sgRNA,’ Systems Bioscience) \ncontaining two sgRNAs targe tting ~80% of annotated SVAs and LTR5Hs in humans was \nobtained based on a previously published study (Pontis et al., 2019) . This plasmid confers \nconstitutive dual sgRNA expression and geneticin resistance. For the +gRNAs line, the C2277 \nhiPSC line was co -transfected with p -dCas9-KRAB, p -PB-Transposase, and p -sgRNA \n(C2277-B, +gRNA line). Puromycin (0.125 μg/mL) only ( -gRNAs line) or puromycin (0.125 \nμg/mL) and geneticin (100 μg/mL) (+gRNAs line) were introduced for multiple days to obtain \npurified colonies. \n \niPSC culture and NCC differentiation \nHuman iPSC lines C2277-A (-gRNAs) and C2277-B (+gRNAs) were cultured in feeder -free, \nserum-free 2D culture at 37°C and 5% CO 2. For the generation of NCCs, the differentiation \nmethod was derived from the protocol published by Leung et al. (2016). Briefly, hiPSCs were \ngrown in mTeSR Plus (StemCell Technologies, 100-0276) on Geltrex-coated (Thermofisher, \nA1413302) 6 -well plates unt il reaching ~80% confluency. Differentiation was initiated by \nplating 2x106 hiPSCs in Neural Crest Differentiation media (DMEM/F12 (Gibco, A4192002), \n2% B-27 supplement (Fisher Scientific, 15717988), 3 μM CHIR99021 (Stratech, S1263-SEL-\n5mg), 0.5% bovine serum albumin (Fisher Scientific, 12881630), 1X glutaMAX supplement \n(Gibco, 35050061), 1% penicillin-streptomycin (Gibco, 15070063)) onto Geltrex-coated 6-well \nplates supplemented with 10 μM Y-27632 (Cambridge Bioscience, HY -119937-5MG). The \nfollowing days daily media changes were performed and 2 μg/mL doxycycline was added to \nthe culture media from day 2  onwards (i.e. 24h after the sta rt of differentiation) . NCC \ndifferentiation was assessed after 5 days.  \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nImmunocytochemistry \nHiPSCs-NCCs were harvested by incubation with StemPro Accutase (Gibco, A1110501) for 5-\n10 min followed by aspiration and detachment with DMEM/F12, and subsequently seeded \nonto 16 mm coverslips in 12-well plates coated with Geltrex and left overnight to attach before \nfixation with 4% paraformaldehyde/PBS for 15 min at 37°C. After washing with PBS, the fixed \ncells were stored in PBS until staining. HiPSC -NCCs were subsequently permeabilised with \n0.1% Triton-X-100/PBS (Merck, 648463) for 10 min at RT and block ed using 10% donkey \nserum/PBS (Abcam, AB7475) for 1h at RT. Cells were stained with primary antibodies \novernight at 4°C in the dark, washed and stained with secondary antibodies for 30 min at 37°C. \nThe antibodies used can be found in Supplementary Table S1 . After a subsequent washing \nstep, cells were counterstained with 1 μg/mL DAPI (BioLegend, 422801). Washing steps were \nperformed with 0.1% Tween:PBS (Promega, H5152). Images were acquired using a Zeiss \nAxio Observer and further processing was done using Im ageJ. Normalised intensity was \ncalculated by dividing the signal intensity of each frame by the number of cells. \n \nWestern blot \nCells were lysed in radioimmunoprecipitation assay (RIPA) buffer (Fisher Scientific, 10230544) \nsupplemented with a Pierce protease inhibitor tablet (Fisher Scientific, 15614189). The lysates \nwere vortexed for 30 s and incubated on ice for 30 min. Samples w ere then centrifuged at \n17,000 g for 10 min at 4°C, and the supernatant was collected. Protein concentration was \ndetermined using a Pierce BCA Protein Assay Kit (Fisher Scientific, 23225) according to the \nmanufacturer’s protocol. The plate was incubated at 37°C for 30 min and analyzed using the \nSpectraMax M2 microplate reader (Molecular Devices) at 562 nm. 10 ug of protein were \ndenatured in Laemmli Buffer (Fisher Scientific, J61337.AC) at 95°C for 5 min. Proteins were \nseparated using a 4–12% Novex Tris-Glycine Mini Protein Gel (Invitrogen, XP04122BOX) in \nNovex Tris-Glycine SDS Running Buffer (Fisher Scientific, 11559066) for 90 min. Proteins \nwere transferred onto a nitrocellulose membrane using the Mini Trans -Blot Cell system with \nNuPAGE Transfer Buffer (Life Technologies, NP00061) for 1h. Membranes were blocked in \nLi-Cor Intercept Blocking Buffer (Li-Cor, 927-70001) for 1h at RT, then incubated overnight at \n4°C with primary antibodies (see Table S1) diluted in Intercept Blocking Buffer with 0.2% \nTween. The following day, washes were performed in 0.1% Tween/PBS and membranes were \nincubated with secondary antibodies (see Supplementary Table S1) for 30 min before imaging \non a LiCor Odyssey XF imaging system. \n \nReal-time qPCR \nTotal RNA was isolated using the Monarch Total RNA miniprep kit (New England BioLabs, \nT2010) following the manufacturer’s instructions. Briefly, harvested cells were lysed in RLT \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nbuffer. The lysate was then passed through a gDNA column and centrifuged at 16,000 g for 1 \nmin. Next, 70% ethanol was added to the lysate, which was transferred to an RNeasy silica \ncolumn and centrifuged at 16,000 g for 1 min. The column was washed followe d by DNase I \ntreatment for 15 min at RT. Additional wash steps were performed followed by a final dry \ncentrifugation at 12,000 rpm for 1 minute. RNA was eluted in RNase -free ddH ₂O, and \ncentrifuged at 16,000 g for 1 min. The eluted RNA was either used immediately or stored at -\n80°C. Reverse transcription into cDNA was performed using the Maxima First Strand cDNA \nSynthesis kit with the following thermal cycler settings: 10 min at 25°C, 15 min at 50°C, and 5 \nmin at 85°C. Gene expression was quantified via real -time PCR PowerUp SYBR Green \nSupermix (Life Technologies, A46112). Primers for each gene are listed in Supplementary \nTable S2. GAPDH was used as housekeeping gene. RT -qPCR was performed using a CFX \nConnect Real-Time PCR Detection System (Bio-rad) with the following cycling parameters: 5 \nmin at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. \n \nTranswell migration assay \n24-well inserts (8 μM, Starstedt) were coated on both sides with ~22 μg/cm² Geltrex for 1 h at \n37°C. After removing excess liquid , 1 × 10⁵  hiPSC-NCCs were seeded in Neural Crest \nDifferentiation media + 10 μM Y-27632 in the upper compartment and incubated overnight for \nattachment. The following day, the media was replaced and Neural Crest Differentiation media \nsupplemented with 10% FBS was added to the lower compartment. Migration was assessed \nby fixing the membranes in 4% paraformaldehyde/PBS for 15 min at RT, followed by PBS \nwashing and DAPI staining for 15 min at RT. To ensure visualization of migrated cells only, the \nupper surface of the insert was carefully swabbed with a cotton swab  before fixation . \nMembranes were then excised and mounted on microscope slides for imaging.  10X images \nwere captured from four different fields of view, and the average number of migrated cells was \ncounted. Images were acquired using a Zeiss Axio Observer and migration was quantified \nusing ImageJ. \n \nBulk RNA-seq library preparation \nTotal RNA was isolated using the Monarch Total RNA miniprep kit (New England BioLabs, \nT2010) following the manufacturer’s instructions. RNA was quantified using a Nanodrop \nspectrophotometer and RNA integrity was checked on a Tapestation 2200 (Agilent). Onl y \nsamples with a RIN > 7.0 were used for transcriptome analysis. RNA libraries were prepared \nusing 300 ng of total RNA input using the NEBNext Poly(A) mRNA Magnetic Isolation \nModule(E7490) and NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina  (E7760) \naccording to the manufacturer’s instructions. PE150 sequencing was performed on a \nNovaSeq X Plus instrument (Illumina).  \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \nRNA-seq analysis \nAdapters were removed using TrimGalore!, and gene -level read counts were obtained with \nKallisto (Bray et al., 2016). Differential gene expression analysis was performed using DESeq2 \n(Love et al., 2014) . GO enrichment analysis was performed using Webgestalt 2019  (Liao et \nal., 2019). Additional statistical analysis was carried out using R (version 4.2.2) and GraphPad \nPrism 10. \n \nChIP-seq library preparation \n10 million hiPSC-NCCs were crosslinked in 1% paraformaldehyde for 5 min at RT with mild \nrotation. Crosslinking was quenched with 0.125M glycine by rotation for 5 min at RT. Cells \nwere washed twice with cold PBS and were snap-frozen for 15 min on dry ice. Samples were \nstored at -80 °C until further processing. Cells were resuspended in 1 mL ChIP buffer (150 \nmM NaCl, 1% Triton X-100, 500 mM DTT, 10 mM Tris-HCl, 5 mM EDTA) supplemented with \nPierce protease inhibitor tablet and incubated on ice for 10 min. SDS was added to each \nsample to a final concentration of 0.3%, and chromatin was sheared using the following \nsettings: 9 min, duty factor 5%, 6°C in a Covaris M220 Focused -Ultrasonicator. Chromatin \nfragment size was assessed on a Tapestation 2200. \nThe chromatin lysates were then centrifuged at 13,000 g for 10 min at 4 °C and supernatant \nwas subsequently incubated with ChIP buffer supplemented with Pierce protease inhibitor and \nDynabeads Protein G magnetic beads (Invitrogen) along with 3 μg of H3K9me 3 antibody \n(Abcam, ab8898) and incubated overnight at 4 °C under mild rotation. The following day, \nsamples were placed in a magnetic rack and washed twice with Mixed Micelle Wash Buffer \n(150 mM NaCl, 1% Triton X -100, 0.2% SDS, 20 mM Tris -HCl, 5 mM EDTA, 65 % sucrose), \ntwice with Buffer 200 (200 mM NaCl, 1% Triton X -100, 0.1% sodium deoxycholate, 25 mM \nHEPES, 10 mM Tris-HCl, 1 mM EDTA), twice with LiCl/detergent wash (250 mM LiCl, 0.5% \nsodium deoxycholate, 0.5% NP -40, 10 mM Tris -HCl, 1 mM EDTA), once with col d TE. The \nbeads were resuspended in TE + 1% SDS and incubated at 65 °C for 10 min at 1200 rpm to \nelute immunocomplexes. The elution was repeated twice and the samples were incubated \novernight at 65˚C to reverse cross -linking. The following day, Proteinase K (0.5 mg/mL) was \nadded to digest samples at 65 °C for 1h. DNA was purified using the Zymo ChIP DNA Clean \nand Concentrator kit (Zymo, D5205) and quantified with the Quantifluor ONE dsDNA system \n(Promega, E4871). DNA libraries were prepared using the NEBNext Ultra II DNA library Prep \nKit (E7645L) for Illumina. PE150 sequencing was performed on a NovaSeq X Plus instrument \n(Illumina). \n \nChIP-seq analysis \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nAdapters were removed with TrimGalore! and reads were aligned to hg38 using Burrows -\nWheeler Alignment tool, with the MEM algorithm (Li & Durbin, 2009). Uniquely mapping reads \nwere filtered (MAPQ>10) and PCR duplicates were removed and mitochondrial reads were \ndiscarded. Peaks were called using HOMER with default parameters at 5% FDR (Heinz et al., \n2010). All statistical analyses were performed using BEDTools  (Quinlan & Hall, 2010) , \ndeepTools (Ramírez et al., 2014), R (version 4.2.2) and GraphPad Prism 10. \n \nATAC-seq library preparation \nDNA libraries were prepared following the ATAC-Seq kit (Active Motif, 53150) according to the \nmanufacturer’s instructions. 100,000 cells were tagmented per sample, DNA was purified \nusing SPRI beads and amplified with dual index primers. Libraries were asse ssed for size \ndistribution using the TapeStation 2200 and PE150 sequencing was performed on a NovaSeq \nX Plus instrument (Illumina). \n \nATAC-seq analysis  \nAdapters were removed with TrimGalore! and reads were aligned to hg38 using Burrows -\nWheeler Alignment tool, with the MEM algorithm (Li & Durbin, 2009). With SAMTools (Li et al., \n2009), uniquely mapping reads were filtered (MAPQ>10), PCR duplicates were removed and \nmitochondrial reads were discarded. Consensus peaks were determined in each cell line using \nBEDTools (Quinlan & Hall, 2010). Motif analysis was performed using HOMER (Heinz et al., \n2010). All further downstream analysis was performed using BEDTools and deepTools  \n(Ramírez et al., 2014). \n \nStatistics \nRT-qPCR, transwell migration and image quantification data were analysed using Graphpad \nPrism 10 software (Graphpad, San Diego, CA). Data is represented as mean ± standard error \nof mean  (SEM). Statistical significance was accepted at p <0.05. Sequencing data was \nanalysed using BEDTools, DeepTools, and R as indicated. Motif analysis was performed using \nHOMER. GO enrichment analysis was performed using Webgestalt 2019. \n \nTable 1. Antibodies used in this study. \nAntibody Manufacturer Use Dilution/quantity \nMouse AP2a Fisher Scientific, 11594723 IF 1:100 \nRabbit Sox9  Abcam, AB185230-1001 IF 1:250 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nGoat anti-Mouse IgG2b Cross-\nAdsorbed Secondary Antibody, \nAlexa Fluor™ 647  \nLife Technologies, A21242 IF 1:500 \nGoat anti-Mouse IgG2b Cross-\nAdsorbed Secondary Antibody, \nAlexa Fluor™ 647  \nLife Technologies, A21242 IF 1:500 \nMouse Cas9 Cambridge bioscience, 61757 WB 1:1000 \nRabbit GAPDH (D16H11)  Cell Signalling Technology, \n5174 \nWB 1:1000 \nGoat anti-mouse IgG IRDye® \n800CW  \nLI-COR, 926-32210 WB 1:15,000 \nGoat anti-Rabbit IgG IRDye® \n800CW  \nLI-COR, 926-32211 WB 1:15,000 \nRabbit H3 tri methyl K9 - ChIP \nGrade \nAbcam, ab8898 ChIP 3 ug \n \nTable 2. Primers used in this study for RT-qPCR. \nGene Forward (5’-3’) Reverse (5’-3’) \nSOX9 GTACCCGCACTTGCACAAC TCTCGCTCTCGTTCAGAAGTC \nSOX10 GAGGGCTCCCCCATGTCAGAT GTCTGCCTTGCCCGACTGC \nTFAP2A GCCTCTCGCTCCTCAGCTCC CGTTGGCAGCTTTACGTCTCCC \nTWIST1 GCCAGGTACATCGACTTCCTCT  TCCATCCTCCAGACCGAGAAGG \nGAPDH GAACGGGAAGCTTGTCATCAA ATCGCCCCACTTGATTTTGG \n \nAcknowledgements  \nThe authors thank the Wysocka group at Stanford (and particularly Dr. Raquel Fueyo) for \nproviding the dCAS9-KRAB vector, and Andrew Isopi and Dr. Samantha Barnada (Thomas \nJefferson University), for designing the plasmid with the sg -RNAs. We thank the Facility for \nImaging by Light Microscopy (FILM) at Imperial College London for providing access to \ninstrumentation and technical support, which is part-supported by funding from the Wellcome \nTrust (grant 104931/Z/14/Z) and BBSRC (grant BB/L015129/1). For this work, MT was funded \nby Biotechnology and Biological Sciences Research Council (BBSRC). \n \nData availability \nRNA-seq, ATAC -seq, and ChIP -seq data have been deposited in the Gene Expression \nOmnibus (GEO) under accession code GEO: GSE292478 and are publicly available as of the \ndate of manuscript submission \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nAuthor contributions \nMT and LD designed the project. LD performed most of the experiments. ZHM, MD and BGDV \ncontributed to some of the experiments. LD and MT analyzed the data and wrote the \nmanuscript.  All the authors read and approved the manuscript.  \n \nReferences \nAhlstrom, J. D., & Erickson, C. A. (2009). The neural crest epithelial-mesenchymal transition in \n4D: A ‘tail’ of multiple non-obligatory cellular mechanisms. Development, 136(11), 1801–\n1812. https://doi.org/10.1242/dev.034785 \nBajpai, R., Chen, D. A., Rada-Iglesias, A., Zhang, J., Xiong, Y., Helms, J., Chang, C. P., Zhao, Y., \nSwigut, T., & Wysocka, J. (2010). CHD7 cooperates with PBAF to control multipotent neural \ncrest formation. Nature, 463(7283), 958–962. https://doi.org/10.1038/nature08733 \nBarnada, S. M., Giner de Gracia, A., Morenilla-Palao, C., López-Cascales, M. T., Scopa, C., \nWaltrich, F. J., Mikkers, H. M. M., Cicardi, M. E., Karlin, J., Trotti, D., Peterson, K. A., \nBrugmann, S. A., Santen, G. W. E., McMahon, S. B., Herrera, E., & Trizzino, M. (2024). \nARID1A-BAF coordinates ZIC2 genomic occupancy for epithelial-to-mesenchymal transition \nin cranial neural crest specification. The American Journal of Human Genetics. \nhttps://doi.org/10.1016/j.ajhg.2024.07.022 \nBarnada, S. M., Isopi, A., Tejada-Martinez, D., Goubert, C., Patoori, S., Pagliaroli, L., Tracewell, \nM., & Trizzino, M. (2022). Genomic features underlie the co-option of SVA transposons as \ncis-regulatory elements in human pluripotent stem cells. PLoS Genetics, 18(6), 1–19. \nhttps://doi.org/10.1371/journal.pgen.1010225 \nBejerano, G., Lowe, C. B., Ahituv, N., King, B., Siepel, A., Salama, S. R., Rubin, E. M., Kent, W. \nJ., & Haussler, D. (2006). A distal enhancer and an ultraconserved exon are derived from a \nnovel retroposon. Nature, 441(1), 87–90. https://doi.org/10.1038/nature04696 \nBourque, G., Leong, B., Vega, V. B., Chen, X., Yen, L. L., Srinivasan, K. G., Chew, J. L., Ruan, Y., \nWei, C. L., Huck, H. N., & Liu, E. T. (2008). Evolution of the mammalian transcription factor \nbinding repertoire via transposable elements. Genome Research, 18(11), 1752–1762. \nhttps://doi.org/10.1101/gr.080663.108 \nBray, N. L., Pimentel, H., Melsted, P., & Pachter, L. (2016). Near-optimal probabilistic RNA-seq \nquantification. Nature Biotechnology, 34(5), 525–527. https://doi.org/10.1038/nbt.3519 \nBronner, M. E., & LeDouarin, N. M. (2012). Development and evolution of the neural crest: An \noverview. In Developmental Biology (Vol. 366, Issue 1, pp. 2–9). Academic Press Inc. \nhttps://doi.org/10.1016/j.ydbio.2011.12.042 \nCapra, J. A., Hubisz, M. J., Kostka, D., Pollard, K. S., & Siepel, A. (2013). A Model-Based \nAnalysis of GC-Biased Gene Conversion in the Human and Chimpanzee Genomes. PLoS \nGenetics, 9(8). https://doi.org/10.1371/journal.pgen.1003684 \nCarroll, S. B. (2005). Evolution at two levels: On genes and form. In PLoS Biology (Vol. 3, Issue \n7, pp. 1159–1166). Public Library of Science. https://doi.org/10.1371/journal.pbio.0030245 \nChuong, E. B., Elde, N. C., & Feschotte, C. (2016). Regulatory evolution of innate immunity \nthrough co-option of endogenous retroviruses. Science, 351(6277), 1083–1087. \nhttps://doi.org/10.1126/science.aad5497 \nChuong, E. B., Elde, N. C., & Feschotte, C. (2017). Regulatory activities of transposable \nelements: From conflicts to benefits. In Nature Reviews Genetics (Vol. 18, Issue 2, pp. 71–\n86). Nature Publishing Group. https://doi.org/10.1038/nrg.2016.139 \nChuong, E. B., Rumi, M. A. K., Soares, M. J., & Baker, J. C. (2013). Endogenous retroviruses \nfunction as species-specific enhancer elements in the placenta. Nature Genetics, 45(3), \n325–329. https://doi.org/10.1038/ng.2553 \nCordero, D. R., Brugmann, S., Chu, Y., Bajpai, R., Jame, M., & Helms, J. A. (2011). Cranial neural \ncrest cells on the move: Their roles in craniofacial development. American Journal of \nMedical Genetics, Part A, 155(2), 270–279. https://doi.org/10.1002/ajmg.a.33702 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nCosby, R. L., Judd, J., Zhang, R., Zhong, A., Garry, N., Pritham, E. J., & Feschotte, C. (2021). \nRecurrent evolution of vertebrate transcription factors by transposase capture. Science, \n371(6531). https://doi.org/10.1126/science.abc6405 \nFeschotte, C. (2008). Transposable elements and the evolution of regulatory networks. Nature \nGenetics, 9, 397–405. \nFrost, J. M., Amante, S. M., Okae, H., Jones, E. M., Ashley, B., Lewis, R. M., Cleal, J. K., Caley, \nM. P., Arima, T., Maffucci, T., & Branco, M. R. (2023). Regulation of human trophoblast gene \nexpression by endogenous retroviruses. Nature Structural and Molecular Biology, 30(4), \n527–538. https://doi.org/10.1038/s41594-023-00960-6 \nFuentes, D., Swigut, T., & Wysocka, J. (2018). Systematic perturbation of retroviral LTRs reveals \nwidespread long-range effects on human gene regulation. ELife. \nhttps://doi.org/10.7554/eLife.35989.001 \nFueyo, R., Judd, J., Feschotte, C., & Wysocka, J. (2022). Roles of transposable elements in the \nregulation of mammalian transcription. Nature Reviews Molecular Cell Biology, 23(7), 481–\n497. https://doi.org/10.1038/s41580-022-00457-y \nGans, C., & Northcutt, R. G. (1983). Neural Crest and the Origin of Vertebrates: A New Head. \nScience, 220(4594), 268–273. https://doi.org/10.1126/science.220.4594.268 \nGokhman, D., Agoglia, R. M., Kinnebrew, M., Gordon, W., Sun, D., Bajpai, V. K., Naqvi, S., Chen, \nC., Chan, A., Chen, C., Petrov, D. A., Ahituv, N., Zhang, H., Mishina, Y., Wysocka, J., \nRohatgi, R., & Fraser, H. B. (2021). Human–chimpanzee fused cells reveal cis-regulatory \ndivergence underlying skeletal evolution. Nature Genetics, 53(4), 467–476. \nhttps://doi.org/10.1038/s41588-021-00804-3 \nGoubert, C., Zevallos, N. A., & Feschotte, C. (2020). Contribution of unfixed transposable element \ninsertions to human regulatory variation. Philosophical Transactions of the Royal Society B: \nBiological Sciences, 375(1795). https://doi.org/10.1098/rstb.2019.0331 \nHeinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y. C., Laslo, P., Cheng, J. X., Murre, C., \nSingh, H., & Glass, C. K. (2010). Simple Combinations of Lineage-Determining Transcription \nFactors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. \nMolecular Cell, 38(4), 576–589. https://doi.org/10.1016/j.molcel.2010.05.004 \nImbeault, M., Helleboid, P. Y., & Trono, D. (2017). KRAB zinc-finger proteins contribute to the \nevolution of gene regulatory networks. Nature, 543(7646), 550–554. \nhttps://doi.org/10.1038/nature21683 \nJacques, P. É., Jeyakani, J., & Bourque, G. (2013). The Majority of Primate-Specific Regulatory \nSequences Are Derived from Transposable Elements. PLoS Genetics, 9(5). \nhttps://doi.org/10.1371/journal.pgen.1003504 \nJheon, A. H., & Schneider, R. A. (2009). The cells that fill the bill: Neural crest and the evolution of \ncraniofacial development. In Journal of Dental Research (Vol. 88, Issue 1, pp. 12–21). \nhttps://doi.org/10.1177/0022034508327757 \nKhouri-Farah, N., Winchester, E. W., Schilder, B. M., Robinson, K., Curtis, S. W., Skene, N. G., \nLeslie-Clarkson, E. J., & Cotney, J. (2025). Gene expression patterns of the developing \nhuman face at single cell resolution reveal cell type contributions to normal facial variation \nand disease risk. https://doi.org/10.1101/2025.01.18.633396 \nKim, S., Morgunova, E., Naqvi, S., Goovaerts, S., Bader, M., Koska, M., Popov, A., Luong, C., \nPogson, A., Swigut, T., Claes, P., Taipale, J., & Wysocka, J. (2024). DNA-guided transcription \nfactor cooperativity shapes face and limb mesenchyme. Cell. \nhttps://doi.org/10.1016/j.cell.2023.12.032 \nKing, M.-C., & Wilson, A. C. (1975). Evolution at Two Levels in Humans and Chimpanzees. \nScience, 188, 107–116. https://www.science.org \nKunarso, G., Chia, N. Y., Jeyakani, J., Hwang, C., Lu, X., Chan, Y. S., Ng, H. H., & Bourque, G. \n(2010). Transposable elements have rewired the core regulatory network of human \nembryonic stem cells. Nature Genetics, 42(7), 631–634. https://doi.org/10.1038/ng.600 \nLe Douarin, N. M., & Dupin, E. (2018). The “beginnings” of the neural crest. In Developmental \nBiology (Vol. 444, pp. S3–S13). Elsevier Inc. https://doi.org/10.1016/j.ydbio.2018.07.019 \nLeung, A. W., Leung, A. W., Murdoch, B., Salem, A. F., Prasad, M. S., Gomez, G. A., & García-\nCastro, M. I. (2016). WNT/β-catenin signaling mediates human neural crest induction via a \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\npre-neural border intermediate. Development (Cambridge), 143(3), 398–410. \nhttps://doi.org/10.1242/dev.130849 \nLi, H., & Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler \ntransform. Bioinformatics, 25(14), 1754–1760. https://doi.org/10.1093/bioinformatics/btp324 \nLi, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., & \nDurbin, R. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics, \n25(16), 2078–2079. https://doi.org/10.1093/bioinformatics/btp352 \nLiao, Y., Wang, J., Jaehnig, E. J., Shi, Z., & Zhang, B. (2019). WebGestalt 2019: gene set \nanalysis toolkit with revamped UIs and APIs. Nucleic Acids Research, 47(W1), W199–W205. \nhttps://doi.org/10.1093/nar/gkz401 \nLieberman, D. E. (1998). Sphenoid shortening and the evolution of modern human cranial shape. \nNature, 393(6681), 158–162. https://doi.org/10.1038/30227 \nLove, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and dispersion \nfor RNA-seq data with DESeq2. Genome Biology, 15(12). https://doi.org/10.1186/s13059-\n014-0550-8 \nLynch, V. J., Leclerc, R. D., May, G., & Wagner, G. P. (2011). Transposon-mediated rewiring of \ngene regulatory networks contributed to the evolution of pregnancy in mammals. Nature \nGenetics, 43(11), 1154–1159. https://doi.org/10.1038/ng.917 \nMartik, M. L., & Bronner, M. E. (2021). Riding the crest to get a head: neural crest evolution in \nvertebrates. In Nature Reviews Neuroscience (Vol. 22, Issue 10, pp. 616–626). Nature \nResearch. https://doi.org/10.1038/s41583-021-00503-2 \nMinoux, M., & Rijli, F. M. (2010). Molecular mechanisms of cranial neural crest cell migration and \npatterning in craniofacial development. In Development (Vol. 137, Issue 16, pp. 2605–2621). \nhttps://doi.org/10.1242/dev.040048 \nMitchell, Z. H., den Hoed, J., Claassen, W., Demurtas, M., Deelen, L., Campeau, P. M., Liu, K., \nFisher, S. E., & Trizzino, M. (2025). CHD3 regulates BMP signalling response during cranial \nneural crest cell specification. https://doi.org/10.1101/2025.02.14.638260 \nOstertag, E. M., Goodier, J. L., Zhang, Y., & Kazazian, H. H. (2003). SVA Elements Are \nNonautonomous Retrotransposons that Cause Disease in Humans. In Am. J. Hum. Genet \n(Vol. 73). \nPagliaroli, L., Porazzi, P., Curtis, A. T., Scopa, C., Mikkers, H. M. M., Freund, C., Daxinger, L., \nDeliard, S., Welsh, S. A., Offley, S., Ott, C. A., Calabretta, B., Brugmann, S. A., Santen, G. \nW. E., & Trizzino, M. (2021). Inability to switch from ARID1A-BAF to ARID1B-BAF impairs \nexit from pluripotency and commitment towards neural crest formation in ARID1B-related \nneurodevelopmental disorders. Nature Communications, 12(1). \nhttps://doi.org/10.1038/s41467-021-26810-x \nPatoori, S., Barnada, S. M., Large, C., Murray, J. I., & Trizzino, M. (2022). Young transposable \nelements rewired gene regulatory networks in human and chimpanzee hippocampal \nintermediate progenitors. Development (Cambridge), 49(23). \nhttps://doi.org/10.1242/dev.200413 \nPlayfoot, C. J., Duc, J., Sheppard, S., Dind, S., Coudray, A., Planet, E., & Trono, D. (2021). \nTransposable elements and their KZFP controllers are drivers of transcriptional innovation in \nthe developing human brain. Genome Research, 31(9), 1531–1545. \nhttps://doi.org/10.1101/gr.275133.120 \nPontis, J., Planet, E., Offner, S., Turelli, P., Duc, J., Coudray, A., Theunissen, T. W., Jaenisch, R., \n& Trono, D. (2019). Hominoid-Specific Transposable Elements and KZFPs Facilitate Human \nEmbryonic Genome Activation and Control Transcription in Naive Human ESCs. Cell Stem \nCell, 24(5), 724-735.e5. https://doi.org/10.1016/j.stem.2019.03.012 \nPrescott, S. L., Srinivasan, R., Marchetto, M. C., Grishina, I., Narvaiza, I., Selleri, L., Gage, F. H., \nSwigut, T., & Wysocka, J. (2015). Enhancer Divergence and cis-Regulatory Evolution in the \nHuman and Chimp Neural Crest. Cell, 163(1), 68–83. \nhttps://doi.org/10.1016/j.cell.2015.08.036 \nQuinlan, A. R., & Hall, I. M. (2010). BEDTools: A flexible suite of utilities for comparing genomic \nfeatures. Bioinformatics, 26(6), 841–842. https://doi.org/10.1093/bioinformatics/btq033 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\nQuinn, J. P., & Bubb, V. J. (2014). SVA retrotransposons as modulators of gene expression. \nMobile Genetic Elements, 4(4), e32102. https://doi.org/10.4161/mge.32102 \nRamírez, F., Dündar, F., Diehl, S., Grüning, B. A., & Manke, T. (2014). DeepTools: A flexible \nplatform for exploring deep-sequencing data. Nucleic Acids Research, 42(W1). \nhttps://doi.org/10.1093/nar/gku365 \nRoadmap Epigenomics Consortium, Kundaje, A., Meuleman, W., Ernst, J., Bilenky, M., Yen, A., \nHeravi-Moussavi, A., Kheradpour, P., Zhang, Z., Wang, J., Ziller, M. J., Amin, V., Whitaker, J. \nW., Schultz, M. D., Ward, L. D., Sarkar, A., Quon, G., Sandstrom, R. S., Eaton, M. L., … \nKellis, M. (2015). Integrative analysis of 111 reference human epigenomes. Nature, \n518(7539), 317–329. https://doi.org/10.1038/nature14248 \nSambataro, S., Fiorillo, L., Bocchieri, S., Stumpo, C., Cervino, G., Herford, A. S., & Cicciù, M. \n(2022). Craniofacial Evolution: From Australopithecus to Modern Man. Journal of \nCraniofacial Surgery, 33(1), 325–332. https://doi.org/10.1097/SCS.0000000000007841 \nSchmidt, D., Schwalie, P. C., Wilson, M. D., Ballester, B., Gonalves, Â., Kutter, C., Brown, G. D., \nMarshall, A., Flicek, P., & Odom, D. T. (2012). Waves of retrotransposon expansion remodel \ngenome organization and CTCF binding in multiple mammalian lineages. Cell, 148(1–2), \n335–348. https://doi.org/10.1016/j.cell.2011.11.058 \nSimões-Costa, M., Stone, M., & Bronner, M. E. (2015). Axud1 Integrates Wnt Signaling and \nTranscriptional Inputs to Drive Neural Crest Formation. Developmental Cell, 34(5), 544–554. \nhttps://doi.org/10.1016/j.devcel.2015.06.024 \nSpoor, F., Wood, B., & Zonneveld, F. (1994). Implications of early hominid labyrinthine \nmorphology for evolution of human bipedal locomotion. Nature, 369(6482), 645–648. \nhttps://doi.org/10.1038/369645a0 \nSundaram, V., Cheng, Y., Ma, Z., Li, D., Xing, X., Edge, P., Snyder, M. P., & Wang, T. (2014). \nWidespread contribution of transposable elements to the innovation of gene regulatory \nnetworks. Genome Research, 24(12), 1963–1976. https://doi.org/10.1101/gr.168872.113 \nSundaram, V., & Wysocka, J. (2020). Transposable elements as a potent source of diverse cis-\nregulatory sequences in mammalian genomes. In Philosophical Transactions of the Royal \nSociety B: Biological Sciences (Vol. 375, Issue 1795). Royal Society Publishing. \nhttps://doi.org/10.1098/rstb.2019.0347 \nTheveneau, E., & Mayor, R. (2012). Neural crest migration: interplay between chemorepellents, \nchemoattractants, contact inhibition, epithelial–mesenchymal transition, and collective cell \nmigration. WIREs Developmental Biology, 1(3), 435–445. https://doi.org/10.1002/wdev.28 \nTrainor, P. A. (2010). Craniofacial birth defects: The role of neural crest cells in the etiology and \npathogenesis of Treacher Collins syndrome and the potential for prevention. In American \nJournal of Medical Genetics, Part A: Vol. 152 A (Issue 12, pp. 2984–2994). \nhttps://doi.org/10.1002/ajmg.a.33454 \nTrizzino, M., Kapusta, A., & Brown, C. D. (2018). Transposable elements generate regulatory \nnovelty in a tissue-specific fashion. BMC Genomics, 19(1). https://doi.org/10.1186/s12864-\n018-4850-3 \nTrizzino, M., Park, Y. S., Holsbach-Beltrame, M., Aracena, K., Mika, K., Caliskan, M., Perry, G. H., \nLynch, V. J., & Brown, C. D. (2017). Transposable elements are the primary source of \nnovelty in primate gene regulation. Genome Research, 27(10), 1623–1633. \nhttps://doi.org/10.1101/gr.218149.116 \nWang, H., Xing, J., Grover, D., Hedges Kyudong Han, D. J., Walker, J. A., & Batzer, M. A. (2005). \nSVA elements: A hominid-specific retroposon family. Journal of Molecular Biology, 354(4), \n994–1007. https://doi.org/10.1016/j.jmb.2005.09.085 \nWang, J., Xie, G., Singh, M., Ghanbarian, A. T., Raskó, T., Szvetnik, A., Cai, H., Besser, D., \nPrigione, A., Fuchs, N. V., Schumann, G. G., Chen, W., Lorincz, M. C., Ivics, Z., Hurst, L. D., \n& Izsvák, Z. (2014). Primate-specific endogenous retrovirus-driven transcription defines \nnaive-like stem cells. Nature, 516(7531), 405–409. https://doi.org/10.1038/nature13804 \nWray, G. A. (2007). The evolutionary significance of cis-regulatory mutations. In Nature Reviews \nGenetics (Vol. 8, Issue 3, pp. 206–216). https://doi.org/10.1038/nrg2063 \n  \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \nFigure 1. An inducible CRISPRi tool to repress human -specific SVAs and LR5Hs in \niPSC-derived CNCCs – (a) Schematic overview of SVA and LTR5Hs transposable elements, \nillustrating their structure and phylogenetic distribution across Old World monkeys, apes, and \nhumans. Human-specific SVA subfamilies (i.e., SVA_E/F/F1) and the LTR5Hs are highlighted, \nalong with the approximate number of elements in each category. (b) CRISPR-dCas9-KRAB \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\ntargeting strategy for SVAs and LTR5Hs. Two guide RNAs (gRNA1 and gRNA2) target ~80% \nof all SVAs and LTR5Hs, directing dCas9-KRAB to deposit repressive epigenetic marks at the \nTEs, thereby reducing their transcriptional activity. (c) Experimental timeline for doxycycline \n(dox)-induced expression of dCas9-KRAB. Dox is added to the media 24 hours after the start \nof differentiation into cranial neural crest cells, which spans 5 days. (d) Western blot confirming \ndox-inducible dCas9 -KRAB expression. Lysates from  cells cultured with or without TE -\ntargetting gRNAs were probed with antibodies against dCas9 (top band, ~160 kDa) and \nGAPDH (bottom band, loading control). (e) Immunofluorescence displaying expression of \nCNCC signature markers AP2a (red) and SOX9 (green) in CNCCs differentiated using \nCRISPRi-iPSCs with out (left) and with gRNAs ( right). Signal intensity was quantified  and \nnormalised to the cell number per frame . (f) RT-qPCR of CNCC markers SOX9, TWIST1, \nSOX10 and TFAP2A. n=6. Statistical analyses were performed using unpaired t-tests. Error \nbars indicate mean ± SEM. **, p<0.01. \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \nFigure 2 – Hundreds of human -specific SVAs and LTR5Hs function as enhancers in \nhuman CNCCs – (a) ATAC-seq signal across human -specific SVAs and LTR5Hs. Heatmap \nrows represent individual transposable elements (TEs) aligned at their start or end (±500 bp), \nand the intensity reflects chromatin accessibility. Clusters were generated with deepTools \nusing k -mer algorithm. (b) Pie charts showing the observed versus expected fractions of \naccessible TEs belonging to the LTR5Hs/SVA subfamilies.  (c) H3K9me3 enrichment at the \naccessible human-specific SVAs and LTR5Hs. The top panel displays the average H3K9me3 \nsignal (average profile) aligned to the TE start or end (±3 kb), while the heatmap below shows \nindividual TEs ranked by signal intensity. (d) Transcription factor motif analysis of accessible \nhuman-specific SVAs and LTR5Hs. Representative enriched motifs (TWIST1, HOMEOBOX, \nSOX9/10, AP2a, SLUG, and FOXD3) in accessible human-specific TEs are shown with the \npercentage of TEs containing each motif. (e) Heatmaps of TWIST1 ChIP-seq signal (left) and \ncorresponding input control (right) centred on the accessible human -specific SVAs and \nLTR5Hs (±2 kb). Colo ur intensity indicates normalized enrichment, highlighting TWIST1 \noccupancy at these accessible elements. \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \nFigure 3. Human-specific SVAs and LTR5Hs regulate the expression of CNCC migration \ngenes – (a) Violin plots displaying expression (log2 TPM) of genes located near accessible \nhuman-specific SVAs and LTR5Hs. Three conditions are shown: human CNCCs generated \nusing CRISPRi iPSC line without guide RNAs (−gRNA), human CNCCs generated using \nCRISPRi iPSC l ine with guide RNAs (+gRNA), and chimpanzee CNCCs. The decreased \nexpression in the +gRNA condition indicates potential regulatory contributions of these human-\nspecific TEs. (b) Volcano plot illustrating differentially expressed genes between the −gRNA \nand +gRNA conditions in human CNCCs. The x-axis shows the log2 fold change, while the y-\naxis represents the −log10 P-value. Significantly upregulated (green) and downregulated (red) \ngenes are highlighted, with total numbers indicated. Dashed lines mark common significance \nthresholds. (c) Functional enrichment analysis of downregulated genes. Bubble plots display \ntop enriched pathways, with the x -axis indicating enrichment ratio (blue) or the -log10 FDR \n(red) and the y -axis listing pathway terms. The size  of each bubble reflects statistical \nsignificance. Pathways involved in cell migration and motility are among the most prominently \nenriched. \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \n \nFigure 4. HiPSC-NCCs show inferior migration capability when human-specific TEs are \nsilenced. (a) Outline of the transwell migration assay. (b) 1 x 105 hiPSC-NCCs (+/- gRNAs) \nwere seeded overnight, followed by a media change in the upper chamber and incubation with \ndifferentiation medium +10% FBS in the lower chamber for 24h. At 24h, non-migrated hiPSC-\nNCCs on the top of the membrane were swabbed away and migrated hiPSC-CMs were fixed, \nstained and imaged. DAPI staining was used to visualise nuclei. Scale bar: 50 μm. (c) \nQuantification of transwell membranes. 10X images were taken from 4 different fields of view \nand the average number of migrated cells was calculated . n=5. Statistical analyses were \nperformed using an unpaired t -test. Error bars indicate mean ± S EM. This experiment was \nrepeated twice in two independent rounds of differentiation, which yielded comparative results. \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint \n\n \n \n \nFigure 5. Co -option of SVAs and LTR5Hs as active enhancers is cell -type specific – \nHeatmaps of normalized H3K27ac ChIP -seq signal (Roadmap Epigenomics Consortium) \nacross 256 accessible human -specific SVAs and LTR5Hs in multiple tissues and cell types. \nEach row corresponds to an individual transposable element (TE), aligned at its cent re (±3 \nkb), while columns represent different tissues/cell lines. The colour bar on the right indicates \nthe relative intensity of H3K27ac signal, with higher enrichment in red and lower enrichment \nin blue.  \n \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted April 6, 2025. ; https://doi.org/10.1101/2025.04.04.647334doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}