{"paper_id":"bff37d92-2cdf-4684-9932-8bd84c636ed1","body_text":"Regulation of functional steroid receptors and\nligand-induced responses in telomerase-immortalized human\nendometrial epithelial cells\nS Hombach-Klonisch1, A Kehlen2, P A Fowler3, B Huppertz4, J F Jugert 5, G Bischoff6,\nE Schlüter1, J Buchmann7 and T Klonisch1\n1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, Canada\n2Department of Immunology, Martin Luther University, Halle-Wittenberg, Germany\n3Department of Obstetrics and Gynecology, University of Aberdeen, Aberdeen, UK\n4Department of Anatomy, RWTH Aachen, Germany\n5Department of Dermatology, RWTH Aachen, Germany\n6Department of Analytical and Environmental Chemistry, Martin Luther University, Halle-Wittenberg, Germany\n7Department of Pathology, Martin Luther University, Halle-Wittenberg, Germany\n(Requests for offprints should be addressed to T Klonisch, Department of Human Anatomy and Cell Science, Faculty of Medicine, 130 Basic Medical Scien ces,\n730 Williams Avenue, University of Manitoba, Winnipeg, Manitoba, R3E 0W3, Canada; Email: klonisch@cc.umanitoba.ca)\nAbstract\nInformation on the regulation of steroid hormone receptors and their distinct functions within the human endometrial\nepithelium is largely unavailable. We have immortalized human primary endometrial epithelial cells (EECs) isolated\nfrom a normal proliferative phase endometrium by stably transfecting the catalytic subunit (hTERT) of the human\ntelomerase complex and cultured these hTERT-EECs now for over 350 population doublings. Active hTERT was\ndetected in hTERT-EECs employing the telomerase repeat amplification assay protocol. hTERT-EECs revealed a\npolarized, non-invasive epithelial phenotype with apical microvilli and production of a basal lamina when grown on a\nthree-dimensional collagen–fibroblast lattice. Employing atomic force microscopy, living hTERT-EECs were shown to\nproduce extracellular matrix (ECM) components and ECM secretion was modified by estrogen and progesterone (P4).\nhTERT-EECs expressed inducible and functional endogenous estrogen receptor-alpha (ER-alpha) as demonstrated by\nestrogen response element reporter assays and induction of P4 receptor (PR). P4 treatment down-regulated PR\nexpression, induced MUC-1 gene activity and resulted in increased ER-beta transcriptional activity. Gene activities of\ncytokines and their receptors interleukin (IL)-6, leukemia inhibitory factor (LIF), IL-11 and IL-6 receptor (IL6-R), LIF\nreceptor and gp130 relevant to implantation revealed a 17 beta-estradiol (E2)-mediated up-regulation of IL-6 and an\nE2- and P4-mediated up-regulation of IL6-R in hTERT-EECs. Thus, hTERT-EECs may be regarded as a novel in vitro\nmodel to investigate the role of human EECs in steroid hormone-dependent normal physiology and pathologies,\nincluding implantation failure, endometriosis and endometrial cancer.\nJournal of Molecular Endocrinology (2005) 34, 517–534\nIntroduction\nThe monthly recurrent remodeling of the human\nendometrium in preparation for embryonic implantation\nis under the control of the ovarian steroid hormones\nestrogen and progesterone (P4), which profoundly affect\nproliferation and differentiation of endometrial cells in a\ntime- and concentration-dependent manner. Distur-\nbances in this intricate endocrine network can result in\naltered responses of the stromal and epithelial endome-\ntrial cell compartments, leading to severe clinical\nconditions, including implantation failure, endometriosis\nand endometrial carcinoma (Brandenberger et al. 1999,\nJazaeri et al. 2001, Kitawaki et al. 2002, Utsunomiya et al.\n2003). Unique even among primates, studies on the\nmolecular dynamics of the human endometrium require\nappropriate human cellular in vitro model systems.\nPrimary human endometrial monolayers in culture have\nlimited lifespan and undergo cellular de-differentiation\n(Mulholland et al. 1988, Zhang et al. 1995, Classen-Linke\net al. 1997, Arnold et al. 2001, Grümmer et al. 2001).\nTogether with problems obtaining normal human\nendometrial tissue, this restricts the use of isolated\nhuman endometrial cells or endometrial tissues for\nexperimental in vitro approaches.\nEndometrial carcinoma cell lines, including ECC-1,\nHEC-1A, RL-95, Ishikawa and EN, have long been\nemployed as experimental models but their usefulness is\n517\nJournal of Molecular Endocrinology (2005) 34, 517–534\n0952–5041/05/034–517 © 2005 Society for Endocrinology Printed in Great Britain\nDOI: 10.1677/jme.1.01550\nOnline version via http://www.endocrinology-journals.org\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nlimited since their transformed phenotype has partially\nresulted in a loss of physiological growth regulation and\npolarization or altered steroid hormone receptor\nregulation (Thie et al. 1995, Koopman et al. 1999, Di\nNezza et al. 2003, Farnell & Ing 2003, Isaka et al. 2003).\nIn particular, primary endometrial epithelial cells (EECs)\ndisplay a rapid decrease in proliferative capacity within a\nfew culture passages (Mulholland et al. 1988, Classen-\nLinke et al. 1997, Arnold et al. 2001). In addition, the\nprocess of dedifferentiation includes down-regulation of\nsteroid hormone receptors (Schatz et al. 1990, White\net al. 1990). However, due to the lack of experimental\nmodels retaining steroid hormone responsiveness there is\nconflicting evidence on the effects of 17 beta-estradiol\n(E2) on EECs (Marshburn et al. 1992, Zhang et al. 1995,\nDardes et al. 2002).\nRecently, hTERT overexpression has been employed\nas a novel strategy to immortalize human somatic cells,\nincluding human uterine leiomyoma and normal\nmyometrial cells, human skin fibroblasts and retinal\npigment cells (Bodnar et al. 1998, Counter et al. 1998,\nCarney et al. 2002). The catalytic subunit hTERT of the\nribonucleoprotein telomerase complex is the rate-\nlimiting factor for telomerase activity in normal human\nsomatic cells facilitating the elongation of chromosomal\ntelomeres (Counter et al. 1998). It is highly pertinent that\nimmortalization of human somatic cells by virtue of\noverexpression of hTERT does not interfere with\nnormal cellular physiology (Jiang et al. 1999, Carney et al.\n2002).\nIn the normal human endometrium, telomerase\nactivity has been exclusively detected during the\nproliferative phase of the cycle and localized to\nglandular epithelial cells at the base of the endometrial\ncrypts within the stratum basale (Kyo et al. 1997, Tanaka\net al. 1998, Yokoyama et al. 1998). These basal glandular\nepithelial cells provide a recurrent source for the cellular\nrestitution of the endometrial epithelial lining during the\nproliferative phase of the cycle. In isolated primary\nEECs, E2 was unable to sustain telomerase activity,\nwhich has been reported to cease within 8 days of\nculture resulting in the senescence of primary EECs\n(Varma et al. 1982, Tanaka et al. 1998).\nIn the present study we present a novel hTERT-\nimmortalized human endometrial epithelial cell line\n(hTERT-EECs) which displays a stable epithelial\nphenotype. Hormonally responsive to the actions of\novarian steroid hormones, estrogen receptor (ER)-alpha\ninduced the expression of a functional P4 receptor (PR),\nwhich, in turn, affected expression of ER-beta in these\nimmortalized cells. The hTERT-EEC cell line may\nprovide a unique in vitro cellular model to study the\nmolecular endocrine involvement of human EECs in the\nnormal human endometrium and in impaired endome-\ntrial function, such as endometriosis and implantation\nfailure.\nMaterials and methods\nIsolation and immortalization of human EECs\nPrimary EECs were isolated from a healthy human\nendometrium staged day 7 of the proliferative phase of\nthe cycle based on cycle days and inspection of the\nendometrium by an experienced gynecopathologist (J B).\nThis study was approved by the University Ethical\nCommittee and the patient had given written, informed,\nconsent. The nulliparous patient, aged 37, had\nundergone surgery because of uterine myomatosis. A\nmodification of the isolation protocol by Satyaswaroop\net al. (1979) was used. Briefly, several endometrial tissue\nspecimens from the region of the uterine corpus were cut\ninto 1–3 mm\n3 pieces, washed in PBS, digested for\n45 min at 37 /p8C in PBS with 4 mg/ml BSA (Sigma)\ncontaining 2·5 mg/ml collagenase (CLSII, ‘Worthington\ntype’; Biochrom, Berlin, Germany) and 25 µg/ml\nDNAse (Sigma) and passed through a 250 µm sieve to\nremove mucous material and undigested tissue. Stromal\ncells were separated from epithelial cells by sequential\nsieving through 70 µm and 40 µm nylon sieves with\nstromal cells passing into the filtrate. The remaining\nEECs on top of the filter were backwashed with PBS and\nincubated for a further 30 min at 37 /p8C in PBS\ncontaining 4 mg/ml collagenase, 1 mg/ml hyaluroni-\ndase (Sigma), 0·17 mg/ml DNAse and 1 mg/ml\nproteinase K (Sigma) to further separate into single\nepithelial cells from the isolated glands. After centrifuga-\ntion, cell pellets were washed once at 4 /p8C in culture\nmedium consisting of Ham’s F-12 minimal essential\nmedium (MEM) (Biochrom) substituted with 2 mM\n-glutamine (Life Technologies, Karlsruhe, Germany),\n10% fetal calf serum (FCS) (Biochrom), 160 ng/ml\nbovine insulin (Life Technologies) and 1 nM E2 (Sigma),\nincluding the antibiotics streptomycin (100 µg/ml),\npenicillin (100 µg/ml) and amphotericin B (0·5 µg/ml)\n(all Sigma). EECs were resuspended in the same medium\nat 37 /p8C and seeded into six-well dishes coated with\ncollagen IV (Greiner, Solingen, Germany). From 2 days\nof culture onwards, EECs were cultured in medium\ndevoid of antibiotics.\nPrior to transfection, the EECs were passaged into\nfresh six-well culture dishes. On the second or third day\nfollowing isolation of primary cells transfection was\nperformed under serum-free conditions for 6 h at\n60–80% cellular confluency employing the Lipo-\nfectamine PLUS transfection kit (Life Technologies) and\n1, 5 and 10 µg of the eukaryotic expression plasmid\npCIneo hTERT plasmid (generously provided by Prof.\nR Weinberg, Whitehead Institute, MA, USA). The\ntransfection medium was replaced by normal culture\nmedium overnight, and the day after transfection cells\nwere passaged in fresh normal culture medium.\nSelection of stable transfectants started 48 h later on\nthese highly proliferating cells with culture medium\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs518\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\ncontaining 600 µg/ml geneticin (Life Technologies).\nStarting from cell passage 18, stable hTERT transfect-\nants of EECs (hTERT-EECs) were further character-\nized. Stable hTERT-EECs transfectants were cultured\nin normal E2-free medium. Non-transfected primary\nEECs or EECs transfected with the empty pCIneo\nplasmid died at passages four or five, approximately\n18–26 days after isolation. Of the ten hTERT-EECs\nclones isolated we report here the characterization of\nclone, hTERT-EEC B37.\nTelomerase repeat amplification protocol (TRAP)\nTelomerase activity in primary EECs and in hTERT-\nEECs was determined with the TRAPeze telomerase\ndetection kit (Intergen Company, Oxford, UK) accord-\ning to kit instructions. Briefly, primary human EECs\nwere used 5 days following isolation and hTERT-EECs\nwere used at passage 45 corresponding to 250\npopulation doublings. Cells (10\n4) were lysed for 30 min\nat 4 /p8C in CHAPS lysis buffer provided with the kit,\nsnap-frozen on dry ice and aliquots were stored at\n–80 /p8C until used.\nE2 and P4 stimulation\nFor stimulation studies with E2 at 1 and 10 nM for\n24–48 h, hTERT-EECs were grown in phenol red-free\nmedium (Promocell, Heidelberg, Germany) supple-\nmented with 10% charcoal-stripped FCS (steroid\nhormone depleted FCS; Biozol, Eching, Germany) for at\nleast 3 days. hTERT-EECs were primed with 1 nM E2\nprior to the incubation for 48 h with 50–500 ng/ml P4\nor with 10\n/p16 M of the stable derivative medroxyproges-\nterone acetate (MPA) (both Sigma).\nProliferation assays\nKi-67 cell proliferation assay\nIn order to have a complementary measure of active cell\nproliferation beyond the standard methods of thymidine\nor bromodeoxyuridine (BrdU) incorporation, we devel-\noped an alternative to the ELISAs reported by Frahm\net al. (1998, 1999). Ki-67 was selected as a marker\nbecause of evidence that its cellular expression has a\ndirect relationship with function/type of cellular events\nor disease progression (Barzanti et al. 2000).\nEuropium (Eu) labeling This assay is based on DELFIA\ntechnology (time-resolved fluorescence). An aliquot of\n200 µg/ml of Ki-67 (sc-15402) rabbit polyclonal\nantibody (Autogen Bioclear UK Ltd, Calne, Wilts, UK)\nwas desalted using a MicroSpin G-25 centrifugal column\n(Amersham Biosciences) in order to remove azide, which\ninterferes with Eu labeling. The antibody (100 µl) was\nthen combined with 10 µl labeling buffer (500 mM\nNa\n2CO3, pH 9·2). Sephadex G-25 (Amersham) was\nsoaked in elution buffer (50 mM Tris–HCl containing\n9 g NaCl/l and 0·5 g NaN\n3/l, pH 7·8) prior to being\npacked into a 30 /p21 cm plastic column and allowed to\nsettle overnight. The Ki-67 was then labeled using an Eu\nlabeling kit according to the manufacturer’s instructions\n(Perkin-Elmer UK Ltd, Beaconsfield, Bucks, UK).\nBriefly, 125 µl labeling buffer containing the Eu labeling\nreagent were added to 125 µl Ki-67 antibody in labeling\nbuffer and incubated overnight at room temperature\n(RT). The G-25 column was equilibrated with 90 ml\nelution buffer, the Eu+Ki-67 antibody mixture was\nloaded and 60 fractions of 1 ml were collected. The\nfractions were diluted 1:10 000 in DELFIA enhancer\nsolution (containing the following per liter: 1 ml Triton\nX-100, 1·4 g phthalic acid, 6 ml glacial acetic acid, 1 ml\ntri-n-octylphosphine oxide dissolved at 19 mg/ml etha-\nnol and 0·5 ml 4,4,4-trifluoro-(2-naphthyl)-1,3-\nbutanedione dissolved at 8 mg/ml ethanol, pH 3·2) and\ncounted in a 96-well microtiter plate using a 1234\nDELFIA fluorometer (Perkin-Elmer). Two peaks of Eu\nwere detected, the first containing labeled Ki-67\nantibody, the second containing free Eu. The 1 ml\nfractions comprising the first peak were combined and\nstabilizer (heavy metal-free BSA; Perkin-Elmer) was\nadded (0·1% of final volume). The labeled anti-Ki-67\nstock solution was then stored at 8 /p8C.\nDELFIA Ki-67 assay On the day of the assay the culture\ndishes to be assayed were decanted and tapped dry over\nfilter paper. Two hundred microliters of Triton X-100 in\n70% ethanol were added to each well and the dishes\nincubated for 30 min at RT to permeabilize cell\nmembranes. Dishes were then decanted and 100 µl\nEu-labeled anti-Ki-67 antibody (60 µl stock Eu-labeled\nKi-67 in 9 ml culture media as detailed below)\nwere added to each well. After 30 min shaking\nincubation at RT the plates were washed three times\nwith a plate washer containing DELFIA wash buffer\n(1 ml Tween-20/l distilled water). Two hundred\nmicroliters of DELFIA enhancer were then added to\neach well and the dishes counted as above after 5 min\nshaking incubation.\nMTT cell viability assay\nOn the day of the assay the culture dishes were decanted\nand 10 µl of 5 mg MTT (3-[4,5-dimethylthiazol-2-yl]-\n2,5-diphenyl-tetrazolium bromide)/ml added to each\nwell. The dishes were then incubated for a further 4 h at\n37 /p8C in a water-saturated 95% CO\n2 incubator to allow\ndevelopment of formazan salt. The MTT was then\nremoved and 100 µl DMSO (Sigma) were added to each\nwell and left for 20 min until color developed.\nSteroid hormone-responsive hTERT-EECs · S HOMBACH-KLONISCH and others 519\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nAbsorbance was read at 690 nm using an Anthos\nHT111 plate reader (Labtech, Salzburg, Austria).\nBrdU incorporation proliferation assay A colorimetric BrdU\ncell proliferation ELISA (Roche Diagnostics) was used\naccording to manufacturer’s instructions. Briefly, on the\nday of assay 20 µl BrdU labeling solution were added to\neach well, except for negative controls which received no\nBrdU, and incubated for 2 h at 37 /p8C in a water-\nsaturated 95% CO\n2 incubator. The culture dishes were\ninverted and tapped dry onto filter paper and 200 µl\nFixDenat added to each well and left for 20 min at RT.\nThe dishes were then drained and blocked with\n200 µl/well of ELISA blocking reagent (Roche) for\n30 min at RT. After decanting, 100 µl anti-BrdU\nsolution were added to each well and the dishes\nincubated for 30 min at RT. The dishes were drained\nagain, washed and incubated with 100 µl/well of\nsubstrate solution for 10 min at RT. Finally 25 µl 1 M\nH\n2SO4 were added to each well and incubated for 1 min\non a shaker at 300 r.p.m. The absorbance was measured\nat 450 nm within 5 min (Anthos HT111 plate reader;\nLabtech).\nE2 induction of cell proliferation In order to investigate the\nE2 induction of proliferation in hTERT-EECs, two\nexperiments were carried out and repeated at least\ntwice. In the first series of experiments, rows of wells\nwere plated out with between 0 and 20 000 cells in\n96-well culture dishes and incubated for 72 h in\nnormal culture medium supplemented with 10%\nFCS. The medium was then replaced with either\nsteroid-free culture medium or normal culture\nmedium plus 1 nM E2 (Sigma) and incubated for a\nfurther 48 h. Cell viability and proliferation were then\ndetermined using the MTT, BrdU and Ki-67 assays. In\nthe second series of experiments, rows of wells\nwere plated out with between 0 and 20 000 cells in\n96-well culture dishes and incubated for 72 h in\nnormal culture medium supplemented with 10% FCS or\nculture medium supplemented with 10% charcoal-\ntreated FCS to remove steroid hormones. Thereafter,\nmedium was replaced with steroid-free culture medium\nor normal culture medium plus 1 nM E2 and incubated\nfor a further 48 h. Cell viability and proliferation\nwere then determined using the MTT, BrdU and Ki-67\nassays.\nThree-dimensional (3D) culture of hTERT-EECs on a\nfibroblast/collagen lattice\nA dermal equivalent fibroblast/collagen matrix was\nemployed as a 3D culture system for hTERT-EECs\n(Hoeller et al. 2001). Briefly, 8 vol of acidic collagen\n(3 mg/ml collagen I and III in 12 mM HCl; Biochrom)\nand 1 vol of 10-fold Dulbecco’s MEM (Dulbecco’s\nMEM (DMEM) with 4·5 g/l -glucose; Biochrom) were\nneutralized with 1 M sodium hydroxide. One vol of\nhuman foreskin fibroblasts (1 /p210\n5 cells/ml) in FCS was\nadded and 4 ml of the mixture were poured immediately\ninto polycarbonate membrane tissue culture inserts\n(2·5 cm diameter, 0·4 µm pore size; Nunc, Roskilde,\nDenmark). The inserts were placed into six-well culture\nplates (Falcon-Becton Dickinson, Franklin Lakes, NJ,\nUSA) and filled with 2 ml culture medium. After\ncomplete polymerization, dermal equivalents were\ncovered by culture medium which was composed of\nDMEM/Ham’s F-12 (1/1) high glucose, low calcium\nwith -glutamine (PAA, Linz, Austria) with 10%\nFCS, 1·8 /p210\n/p14 M adenine (hydrochloride), 10 /p110 M\ncholera toxin, 2 /p210/p19 M 3,3 /p9,5-triiodo--thyronine\n(sodium salt) (all Sigma), 10 ng/ml human recombinant\nepidermal growth factor (EGF), 5 µg/ml human\nrecombinant insulin (both Roche), 4 µg/ml hydrocorti-\nsone (Serva, Heidelberg, Germany) and 5 µg/ml\ntransferrin (human HOLO, iron-saturated; Promocell).\nTwo days after casting the dermal equivalents,\nhTERT-EECs at passage 40 grown to subconfluency\nwere detached from the culture flask and seeded at\n1/p210\n6 cells per well. Seven days later the inserts were\nlifted onto polypropylene stoppers, the medium inside\nthe insert was changed to high calcium (1·2 mM) and\ncultures were then cultivated at the air–liquid interface\nfor another 7 days. For transmission electron mi-\ncroscopy, 3D gels were immersed in 2·2% phosphate-\nbuffered glutaraldehyde solution for 2 h, postfixed for\nanother 2 h in phosphate-buffered OsO\n4, dehydrated in\ngraded series of ethanol and embedded in Araldite.\nUltrathin sections (0·1 µm) were examined with a\nPhillips EM 300 transmission electron microscope.\nAtomic force microscopy (AFM)\nImaging of living hTERT-EEC surface structures and\nextracellular matrix (ECM) components was analyzed by\nAFM contact mode (Bischoff et al. 2003). hTERT-EECs\nat 1 /p210\n3 cells were seeded onto 1 cm 2 cover slips and\ncultured to 60–80% confluency. For AFM analysis, cells\nwere thoroughly rinsed three times with PBS without\nCa\n2+/Mg2+. Measurements were performed in constant\nforce contact mode by cantilever probes with very low\nspring constants (about 0·06 N/m). The force was\nadjusted to the minimum possible, to approach the\nprobe softly to the surface and avoid probe–sample\ninteractions. Since drying-up processes strongly change\nthe cell surfaces, the observations of the humid cells were\nperformed for a maximum time period of 90 min. The\ninfluence of estrogen and P4 on the secretion of ECM\nproduced by hTERT-EECs was investigated by\nculturing the cells in estrogen-depleted culture medium\nfor 3 days prior to exposure to 10 nM E2 for 48 h. To\ndetermine the role of P4 on ECM production,\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs520\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nE2-primed hTERT-EECs were exposed to 1 µM MPA\nfor 24 h.\nImmunohistochemistry\nFor immunocytochemistry, hTERT-EECs cells at 80%\nconfluence were washed once in PBS, fixed in Bouin’s\nsolution and embedded in paraffin. For cytokeratin\nstaining, antigen retrieval was performed by incubation\nof the sections with proteinase K (30 µg/ml for 30 min\nat 37 /p8C) and endogenous alkaline phosphatase was\ninactivated with 20% acidic acid in distilled water for\n30 s prior to saturation of non-specific protein binding\nsites with 10% normal goat serum for 1 h at RT. The\nmouse monoclonal antibodies to cytokeratin (clone\nMNF 116) and vimentin (clone V9) (both Dako,\nHamburg, Germany) were diluted in PBS plus 0·1%\nTween-20 (PBS-T) containing 10% goat normal serum\nat 1:250 or 1:500 respectively, and incubated at 4 /p8C\novernight. Sections were washed in PBS-T and\nincubated with an alkaline phosphatase-conjugated\ngoat anti-mouse Ig secondary antibody (Dianova,\nHamburg, Germany) at 1:250 for 1 h at RT. Specific\nbinding was visualized with the alkaline phosphatase\nsubstrate HistoMark Red (Kirkegaard Perry Laborato-\nries, Gaithersburg, MD, USA). Prior to immunodetec-\ntion of the proliferation marker Ki-67 (Mib-1, dilution\n1:50; Dianova), deparaffinized 3 µm sections were\nmicrowaved for 20 min in 0·1 M citrate buffer at pH\n6·2. Endogenous peroxidase activity was inhibited for\n15 min using a 3% solution of H\n2O2 in methanol. After\nwashing in PBS, sections were incubated with a 1:200\ndilution of biotinylated goat anti-mouse secondary\nantibody (Vector Laboratories, Burlingame, CA, USA)\nfor 30 min at RT. Detection of bound antibody was\naccomplished using the avidin-biotin complex method\n(Elite.Kit; Vector) and incubation for 5 min with a 0·1%\nsolution of 3,3 /p9-diaminobenzidine (Sigma) as chro-\nmogen. The specificity of the immunostaining was\nchecked by replacing the primary antibody with mouse\nnon-immune serum.\nImmunodetection of ER-alpha and PR in hTERT-\nEECs was performed employing a peroxidase detection\nreaction. Endogenous peroxidase was inactivated with\n3% H\n2O2 in methanol for 15 min and non-specific\nprotein binding was saturated for 1 h with 10% goat\nnon-immune serum in PBS-T. The mouse monoclonal\nantibodies to human ER-alpha (clone D-12; Santa Cruz\nBiotechnology, Inc. (Santa Cruz, CA, USA) and to\nhuman PR (clone PgR 636; Dako) were diluted in\nPBS-T at 1:100 and 1:50 respectively. A peroxidase\nconjugated goat anti-mouse Ig secondary antibody\n(Dianova) was employed at 1:200 in PBS-T for 1 h prior\nfor visualization of specific binding sites with the\nperoxidase substrate 3,3 /p9-diaminobenzidine (Pierce/\nPerbio, Bonn, Germany).\nImmunofluorescent detection of the epithelial cell\nmarker E-cadherin was performed on confluent hTERT-\nEECs grown on silanized glass slides. Cells were washed\ntwice with PBS and fixed in 4% paraformaldehyde. Slides\nwere boiled in citrate buffer for 15 min for antigen\nretrieval and incubated for 1 h at RT with a mouse\nmonoclonal antibody to E-cadherin (Dako) diluted 1:25\nin PBS-T. After incubation with a fluorescein\nisothiocyanate-labeled secondary antibody (Alexa Fluor;\nMolecular Probes, Leiden, The Netherlands) and\ncounterstaining of the nuclei with propidium iodide\n(Sigma), sections were examined with a laser scanning\nmicroscope (TCS-SP; Leica, Wetzlar, Germany).\nWestern blot analysis\nFor the immunodetection of ER-alpha, hTERT-EECs\nwere grown in estrogen-free culture conditions for 5 days\nreaching 80% confluence in 25 cm\n2 flasks and lysis was\nperformed in a cell lysis buffer containing 2% SDS and\n10% saccharose in 63 mM Tris for 30 min at 4 /p8C. The\nlysate was boiled for 5 min at 90 /p8C and centrifuged to\npellet the cell debris. The amount of protein was\ndetermined using a protein assay kit (BioRad) and a\nspectrophotometer at 595 nm. The lysate was stored\nat /p180 /p8C until used. Protein extracts (30 µg/lane)\nwere run on a 12% SDS polyacrylamide gel and\nproteins were blotted onto a nitrocellulose membrane\n(Amersham). After saturation of non-specific protein\nbinding sites with 5% milk in PBS-T for 2 h at RT,\nmembranes were incubated in blocking solution at\n4 /p8C overnight with a mouse monoclonal antibody\nto human ER-alpha (1:100) (Clone D-12; Santa\nCruz). Following several washing steps, a peroxidase-\nconjugated goat anti-mouse Ig secondary antibody\n(Dianova) was incubated for 1 h at RT at 1:20 000 in\nPBS-T. After washing, specific binding was visualized\nwith an ECL detection reagent on ECL Hyperfilm (both\nAmersham).\nRNA isolation, RT- and quantitative RT-PCR\n(Q-RT-PCR)\nTotal RNA was isolated with Trizol reagent (Life\nTechnologies). The amount of mRNA isolated was\ndetermined by spectrophotometry at 260 and 280 nm\n(Sambrook et al. 1989). Primers and PCR conditions\nused for RT-PCR are listed in Table 1. The RT-PCR\nreactions were carried out in 50 µl solution containing\n1 µl cDNA, 5 µl 10 /p2Advantage cDNA polymerase mix\nbuffer, 100 µM dNTP, 10 pmol of each primer (Table 1)\nand 2·5 U Taq DNA-polymerase (Life Technologies).\nThe PCR cycles consisted of an initial denaturation for\n3 min at 95 /p8C, followed by 40 cycles of denaturation at\n95 /p8C and annealing at 60 /p8C, both for 1 min each, and\nSteroid hormone-responsive hTERT-EECs · S HOMBACH-KLONISCH and others 521\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nan elongation step for 2 min at 72 /p8C and a final\nextension cycle for 10 min at 72 /p8C.\nFor quantitation, 1 µl of the reverse transcriptase\nreaction mixture was added to 25 µl reaction mixture\nconsisting of 1 /p2Advantage2 reaction buffer, 1·5 U\nTaq polymerase (Clontech, Heidelberg, Germany),\n0·2/p2SYBR Green (Biozym, Hess. Oldendorf,\nGermany), 200 µM each dNTP, and 0·5 µM of each\nprimer listed (Table 1). A negative control without\ntemplate was included. Assays were done in triplicates in\na Rotor-Gene 2000 (LTF, Wasserburg, Germany).\nInitial denaturation at 95 /p8C for 300 s was followed by\n40 cycles with denaturation at 95 /p8C for 15 s, annealing\nat 60 /p8C for 30 s, and elongation at 72 /p8C for 20 s. To\nverify the single PCR products melting curves were\ngenerated and amplicons were cloned and sequenced\nbidirectionally. The fluorescence intensity of the\ndouble-strand specific SYBR Green, reflecting the\namount of formed PCR product, was read after each\nelongation step at 82 /p8C. Relative quantitation of gene\nexpression was performed with the software Rotor-Gene\nversion 4·6 (LTF, Wasserburg, Germany) in compara-\ntive quantitation mode. This mode allowed the\ncomparison between differently treated samples relative\nto a control sample. The second derivative of the raw\ndata was taken to calculate the take off point. Based on\nthe take off point and the reaction efficiency, the relative\nconcentration of each sample was calculated in\ncomparison with the control sample. Standard devia-\ntions were determined by t-test.\nEstrogen response element (ERE) reporter assay\nProliferative hTERT-EECs cultured under estrogen-free\nconditions for 5 days were transiently transfected with an\nERE luciferase reporter plasmid (generously provided by\nDr Silke Kietz, Karolinska Institute, Huddinge, Sweden)\nemploying the Lipofectamine Plus transfection kit (Life\nTechnologies). Culture medium was changed 6 h after\ntransfection, and after 24 h of transfection hTERT-\nEECs were incubated for another 24 h with 10 nM E2\nor 1 µM diethylstilbestrol (DES) diluted in estrogen-free\nmedium. Cells were washed once with PBS, lysed for\n15 min at RT with cell culture lysis reagent (Promega,\nHeidelberg, Germany) and supernatants were stored at\n/p180 /p8C until used. Luciferase activity was determined\nwith the firefly luciferase substrate (Promega) in a Serius\n2 luminometer (Berthold Detection Systems, Pforzheim,\nGermany). Estrogen-free cultured hTERT-EECs trans-\nfected with the luciferase reporter plasmid served as the\nnegative control.\nFlow cytometry analysis\nCells were detached from six-well plates using Accutase\n(PAA). Following two washes in 4 /p8C PBS, standard\nsurface membrane immunofluorescence techniques\nwere used. Cells were stained with either CD10 or\nCD13 monoclonal antibodies (both Becton Dickinson,\nHeidelberg, Germany) or an IgG1 isotype control\n(Becton Dickinson) at 4 /p8C for 40 min. After two\nwashings with 4 /p8C PBS containing 0·1% sodium azide,\ncells were labeled with the phycoerythrin-conjugated\ngoat anti-mouse IgG secondary antibody (Dianova) at\n4 /p8C for 30 min, washed three times and fixed using 1%\nparaformaldehyde in PBS. Fluorescence was analyzed in\na Becton Dickinson Calibur fluorescence activated cell\nsorter (FACS) using Cellquest software. Ten thousand\ncells per sample were counted. Mean fluorescence\nintensity (MFI) was calculated as sample MFI minus\ncontrol antibody MFI.\nStatistical analysis\nThe cell proliferation analyses were performed using the\nStatview 5 program (Abacus Concepts, Inc., Berkley,\nCA, USA). All results are presented as means /p5\nS.E.M.\nBecause the proliferation data were not normally\ndistributed, the effects of treatments on proliferation and\nviability were determined using the non-parametric\nMann–Whitney test. The relationship between Ki-67\nand BrdU proliferation assays was analysed by simple\nlinear correlation with significance established using\nTable 1 Oligonucleotide primers employed in normal and\nquantitative RT-PCR analysis\nPrimer sequences (58 to 3 8)\nPrimer\nF-hERa_exon4 caggggtgaagtggggtctgctg\nR-hERa_exon5 atgcggaaccgagatgatgtagc\nF-hERb_exon7 cgatgctttggtttgggtgat\nR-hERb_exon8 ctttaggccaccgagttgatt\nF-hPR gattcagaagccagccagagcc\nR-hPR tctggtcatcaatatgtaagttcg\nF-hIL-6 cgccttcggtccagttgccttc\nR-hIL-6 caggctggatttgtggttggg\nF-hIL-6R cgaggtgtccacccccatgc\nR-hIL-6R gtcataagggctccgtgggtc\nF-hLIF gtcttggcggcaggagttgtg\nR-hLIF ctggaagacatccttacccgag\nF-hLIFR ctggatggtggacaataaaagaatg\nR-hLIFR ttgtcaatgtagcatctaatttccac\nF-hMUC1 ggcacccagtctcctttcttcc\nR-hMUC1 aacacagaccagcaccagcagc\nF-hINT alpha-3 acaaactccgccccatcatcatc\nR-hINT alpha-3 ctcacccatcactgtcccccc\nF-hINT alpha6 gtgacaaacagcccttccaaccc\nR-hINT alpha6 gctcacaagttaccttttccaatcc\nF-hINTbeta-1 taacattaccaaggtagaaagtcgg\nR-hINTbeta-1 ttttcacccgtgtcccatttggc\nF-hINTbeta-3 atgtgtgcctggtgctctgatg\nR-hINTbeta-3 acactctgcttccttcacttcctc\nF-hINTbeta-4 gtgaggagacagggaaataggtg\nR-hINTbeta-4 gtgaggagacagggaataggtg\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs522\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nFischer’s z statistic. Results from the quantitative\nRT-PCR analyses were based on three independent cell\nculture experiments and PCR analysis for each of the\ncDNA samples was repeated at least twice. Results are\npresented as means /p5\nS.E.M. P values of P<0·05 were\nconsidered as statistically significant.\nResults\nHuman primary EECs in the first and second passage\nfollowing isolation were immortalized by lipid-mediated\ntransfection with the catalytic subunit of the human\ntelomerase complex (hTERT). Of the several epithelial\ncell clones derived after single cell cloning, we have been\ncontinuously culturing clone hTERT-EEC B37 for 69\npassages or an estimated 370 population doublings in\nselection medium containing 600 µg/ml geneticin. By\ncontrast, untransfected primary EECs underwent\nsenescence after five or six passages. The TRAP assay\nrevealed active telomerase in hTERT-EECs and weaker\nhTERT activity in primary EECs derived from the first\npassage after isolation (Fig. 1).\nStarting at passage 20 onwards, hTERT-EECs were\nfurther characterized. The hTERT-EECs expressed the\nnuclear proliferation marker Ki-67 (Fig. 2A) and\ndisplayed typical epithelial cell morphology. Immunocy-\ntochemistry was positive for the epithelial cell marker\ncytokeratin (Fig. 2B) and cells were devoid of\nimmunostaining for the stromal cell markers vimentin\n(Fig. 2C), CD10 and CD13 (Fig. 3), demonstrating the\nepithelial nature of hTERT-EECs. As shown by\nconfocal laser scanning microscopy, confluent hTERT-\nEECs expressed membrane-anchored immunoreactive\nepithelial adhesion marker E-cadherin at lateral cell\ncontacts (Fig. 2D) and revealed contact inhibition when\ngrown to confluency on collagen-coated cell culture\ndishes. Employing specific primers (Table 1), RT-PCR\nanalysis of untreated hTERT-EECs revealed transcripts\nfor the integrin subunits alpha 3, alpha 6, beta 1, beta 3\nand beta 4 (data not shown).\nWhen cultured to confluence on collagen IV-coated\ncell culture dishes, hTERT-EECs displayed contact\ninhibition, remained viable for 2 weeks with daily\nchanges of culture medium and after renewed passaging\ncontinued to grow normally. The hTERT-EECs were\nnon-invasive in a fibroblast/collagen lattice employed as\na 3D culture system. Growing as a continuous epithelial\nlining, hTERT-EECs displayed a polarized phenotype,\nproducing a basal lamina towards the collagen matrix\nand displaying apical microvillous surface structures as\nshown by transmission electron microscopy (Fig. 2 G).\nAFM revealed extensive deposition of ECM compo-\nnents deposited by neighboring hTERT-EEC cells (Fig.\n4A). ECM production and composition were altered in\nthe presence of E2 and P4. hTERT-EEC cells cultured\nin normal medium or in estrogen-free medium\nsupplemented with 1 nM E2 produced large amounts of\ntubular-shaped ECM structures with diameters of\n60–120 nm (Fig. 4B and D). The same cells cultured in\nestrogen-free medium and then co-stimulated with E2\n(1 nM) plus MPA (10\n/p16 M) produced an amorphous\nECM layer which was sticky to the AFM cantilever.\nTubular-shaped ECM structures observed under the\ninfluence of P4 had taken on a mucus-like appearance\n(Fig. 4C).\nhTERT-EECs expressed transcripts for ER-alpha,\nER-beta and PR and displayed nuclear localization of\nimmunoreactive ER-alpha and PR proteins (Fig. 2E and\nF). Both QT-RT-PCR and Western analysis revealed\nup-regulation of ER-alpha transcript (Fig. 5) and\nER-alpha protein (Fig. 6), following culture of hTERT-\nEECs in estrogen-free medium for 3 days. Consecutive\nexposure to E2 (10\n/p18-10/p19 M) for 24 h caused a\nsignificant down-regulation of ER-alpha at the transcript\n(Fig. 5) and protein level (Fig. 6). Expression levels of\nER-beta transcripts remained unaltered under these\nconditions (Fig. 5). Functionality of the induced\nendogenous ER-alpha was demonstrated by transient\nFigure 1 T elomerase activity was detected in human primary\nEECs of the first passage on day 3 of culture (lane 1) and\nhTERT-EEC B37 at passage 40 (lane 2). Heat-inactivated\nhTERT-EEC B37 (lane 3) and CHAPS lysis buffer only (lane 4)\nserved as negative controls. Positive control template for active\ntelomerase served as positive control (lane 5). T elomerase\nactivity was determined by TRAP . As expected, early passage\nprimary EECs still demonstrated some telomerase activity (lane\n1). Despite their long-term culture ( .2 years), stable\nhTERT-EECs transfectants revealed active hTERT (lane 2).\nSteroid hormone-responsive hTERT-EECs ·\nS HOMBACH-KLONISCH and others 523\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nFigure 2 Localization of key cell markers in hTERT-EECs. Immunocytochemical staining of paraformaldehyde\n(PFA)-fixed, paraffin-embedded hTERT-EEC B37 cells with antibodies against the nuclear proliferation marker Ki-67 (A),\nthe epithelial cell marker cytokeratin (B), the stromal cell marker vimentin (C), ER-alpha (E) and PR (F).\nImmunofluorescent labeling for the epithelial adhesion molecule E-cadherin (D) was performed on 4% PFA-fixed\nhTERT-EEC B37 cells grown to confluency on collagen-coated glass slides. Magnifications: (B) ×200; (D) ×600; all\nothers ×400. (G) Polarized hTERT-EEC B37 display a basal lamina (BL) and apical microvillous structures (arrows), as\nshown by transmission electron microscopy of hTERT-EEC B37 cells grown on a 3D collagen/fibroblast lattice for 2\nweeks. Magnification: ×90 000.\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs524\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\ntransfection assays with an ERE-luciferase reporter\nplasmid. Exposure to either 1 µM DES or 10 nM\nE2 initiated a strong induction of luciferase reporter\nactivity (Fig. 7). Exposure to E2 strongly up-regulated\ntranscriptal activity of the PR gene, a classic ER-alpha\ntarget gene in the endometrium (Figs 5 and 8A). The\nE2-induced PR appeared to be functional as demon-\nstrated by the significant down-regulation of PR-\ntranscripts following exposure of the hTERT-EECs to\nP4 or the stable metabolite MPA (Fig. 8A).\nThe influence of E2 on viability and proliferation of\nhTERT-EECs was assessed with the MTT cell viability\nassay and both BrdU and Ki-67 proliferation assays. On\naverage over the series of experiments the correlation\nbetween Ki-67 and BrdU proliferation assays was high\n(r=0·88–0·98, P<0·001) except that BrdU incorporation\nbecame asymptotic more quickly than Ki-67 expression\nat higher cell numbers. When the cells were not given at\nleast 72 h of steroid-free incubation (Fig. 9a–c), there\nwas no significant change in cell viability or proliferation\nfollowing E2 treatment, except for a significant increase\nin BrdU incorporation at 20 000 cells/well (up to 16%\nincrease, P<0·05). However, when the cells were given\nat least 72 h in the absence of steroids (Fig. 9d–f) both\nBrdU incorporation and Ki-67 expression were signifi-\ncantly increased by subsequent exposure to E2 (up to 53\nand 18% respectively, P<0·001). These results are\neasily explained by the up-regulation of ER-alpha\nexpression under estrogen-deprived culture conditions\n(Figs 5 and 6). Cell viability was not influenced by\nestrogen irrespective of the medium used (Fig. 9b). P4\ntreatment for 48 h with 500 nM P4 or 1 µM MPA on\nestrogen-primed PR-positive hTERT-EECs did not\nstimulate proliferation in either assay (data not shown).\nIn an attempt to determine the suitability of our\nhTERT-EECs as an in vitro model to study endometrial\nepithelial cell physiology, we analyzed the expression of\nthe interleukin (IL)-6, IL-6 receptor (IL6-R), leukemia\ninhibitory factor (LIF), LIF receptor (LIF-R) and gp130\nisoforms which are known to be important mediators of\nendometrial function during implantation (for specific\nprimers see Table 1; primers for gp130 according to\nSherwin et al. 2002). Both IL-6 and IL6-R were\nexpressed by hTERT-EECs. Up-regulation of IL-6\ntranscripts was detected by Q-RT-PCR in hTERT-\nEECs upon exposure to estrogen (Fig. 8B) with P4 or\nMPA having no further effect. Estrogens only moder-\nately affected IL-6R expression in hTERT-EECs.\nHowever, exposure of the cells to P4 or MPA caused an\nup-regulation of IL6-R (Fig. 8B). Employing specific\nFigure 3 FACS analysis was performed on hTERT-EECs cells for the detection of\nthe stromal markers CD10 and CD13 employing monoclonal antibodies to CD10 and\nCD13. No immunostaining was detected on the epithelial hTERT-EECs cells. A\nmonoclonal isotype-control antibody was used as negative control.\nSteroid hormone-responsive hTERT-EECs ·\nS HOMBACH-KLONISCH and others 525\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nPCR primers reported by Sherwin et al. , RT-PCR for\nthe four known gp130 isoforms revealed the exclusive\npresence of the full-size gp130 transcript in hTERT-\nEECs. Transcriptional activity for LIF and LIF-R was\nweak and, like gp130, remained unaffected by ovarian\nsteroid hormones (data not shown). The highly\nglycosylated membrane-anchored mucin MUC-1 has\nbeen implicated in endometrial receptivity. MUC-1\ngene activity was up-regulated in hTERT-EECs upon\ntreatment with E2 and this transcriptional activation was\nfurther enhanced in the presence of P4 (Fig. 8C; Table\n1). Induction of ER-beta gene activity in hTERT-EECs\nFigure 4 Images of living hTERT-EECs cell surface and intercellular ECM components observed by AFM. hTERT-EECs were\ngrown in normal medium on coverslips, washed three times with PBS without Ca 2+/Mg2+. The moist cells were studied at RT\nunder near-native conditions in AFM contact mode (A). ECM produced by hTERT-EECs cultured with 1 nM E2 for 24 h revealed\na tubular structure (B). E2-primed hTERT-EECs incubated with 100 ng/ml P4 for 24 h produced an ECM which interacted stickily\nduring scanning with the scanning probe (C). (D) Higher magnification of secreted tubular-shaped ECM upon E2 treatment of\nhTERT-EECs.\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs526\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nwas dependent on the presence of a functional PR and\nhigher concentrations of P4 or MPA (Fig. 8D).\nDiscussion\nHere we present a novel, hormonally responsive\ntelomerase-immortalized human endometrial epithelial\ncell line (hTERT-EEC) which has conserved the ability\nof a fine-tuned regulation of steroid hormone receptors.\nThese hTERT-EECs derived from primary endometrial\nglandular epithelial cells of the proliferative phase have\nbeen cultured for over 350 population doublings (65\npassages) and displayed a stable epithelial phenotype.\nKyo et al. (2003) have recently described the\nimmortalization of human EECs from a late prolifera-\ntive phase of the cycle by viral transfection with HPV E6\nand E7 additional to hTERT to overcome Rb/p16\nmediated telomerase-independent early senescence\ndescribed in certain epithelial cells. In contrast to the\nmethod used by Kyo et al. (2003), our primary EECs\nderived from an early stage of the menstrual cycle (day\n7) and cells had been liberated from the isolated\nendometrial glands by an additional enzymatic treat-\nment. This may have resulted in a higher percentage of\nindividual EECs with stem cell-like characteristics to be\ntransfected. As demonstrated for primary mammary\nepithelial cells and conjunctival keratinocytes, a sub-\npopulation of isolated epithelial cells lacks p16\nexpression, escapes senescence stage M0 and can be\nimmortalized by introducing hTERT only (Foster et al.\n1998, Kiyono et al. 1998, Rheinwald et al. 2002).\nhTERT-EECs revealed cellular contact inhibition\nwhen cultured at confluency as a monolayer on\ncollagen-coated culture dishes for more than 2 weeks\nand, when re-seeded, remained viable, metabolically\nactive and proliferative cells. By contrast, established\nhuman endometrial carcinoma cell lines frequently\nemployed in studies on EEC physiology have lost\nnormal epithelial anchorage-dependent growth control\n(Isaka et al. 2003). Cellular polarization is a critical\nparameter affecting numerous cell functions (Yeaman\net al. 1999) and has been shown in primary EECs to be\nimportant for embryo attachment and implantation\n(Meseguer et al. 2001) and to enhance protein secretion\n(Negami & Tominaga 1989). hTERT-EECs cultured in\na 3D collagen/fibroblast matrix displayed a polarized,\nnon-invasive phenotype as illustrated by the production\nof a basal lamina and the formation of microvilli at the\napical cell membrane. Thus, when cultured under\nFigure 5 Steroids modulate steroid receptor gene expression in hTERT-EECs.\nQuantitative RT-PCR was performed on hTERT-EEC B37 cells precultured under\nestrogen-free conditions for 72 h. Thereafter, cells were treated without E2 or 10 nM\nE2. In addition, the hTERT-EECs were primed with 1 nM E2 for 24 h to induce PR\nproduction prior to treatment with 100 ng/ml P4. Hormonal treatment periods for E2\nand P4 were 24 h (1d; d=day) and 48 h (2d). E2 resulted in a specific and lasting\ndown-regulation of ER-alpha, but not ER-beta, which was unaffected by E2. E2\ntreatment caused an up-regulation of PR at both days of treatment. One hundred\nnanograms/ml of P4 did not influence ER-beta transcripts. 1d columns show a\nrepresentative result from three independent experiments which was set at 1 (100%)\nand served as references to determine the relative means±\nS.E.M. (P≤0·05) of the\nQPCR results derived from the stimulation assays.\nSteroid hormone-responsive hTERT-EECs · S HOMBACH-KLONISCH and others 527\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nappropriate culture conditions, the hTERT-EECs have\nconserved a phenotype resembling native human EECs\nin vivo . Primary human EECs were reported to retain\ntheir polarization for a limited time period only\n(Classen-Linke et al. 1997, Negami & Tominaga 1989)\nand, when grown on ECM material from an\nEngelbreth-Holm-Swarm tumor (MatrigelR), showed\nincreased protein secretion (Negami & Tominaga 1989).\nThis Matrigel, however, is supplemented with several\ngrowth factors including transforming growth factor- /afii9826,\nEGF, insulin-like growth factor (IGF)-I, basic fibroblast\ngrowth factor and platelet-derived growth factor, and\nthese growth factors and/or the tumor matrix itself may\nperturb physiological EEC responses. Similarly, the\naddition of growth factor supplements derived from\ncrude protein extracts of bovine brain to the culture\nmedium of human primary EECs would be regarded as\na drawback (Zhang et al. 1995). By contrast, hTERT-\nEECs have been continuously cultured independently of\nthe presence of numerous growth factors.\nAFM showed that live hTERT-EECs deposited long\ntubular-shaped ECM structures, ranging in diameter\nfrom 60 to 120 nm. Similar to a previous report on\nreticulin fiber production in human menstrual cells\ncultured on collagen gels (Kamelle et al. 2002), the\nproduction of ECM by hTERT-EECs was influenced\nby the ovarian steroid hormones. Estrogen treatment\nof the ER-alpha-positive hTERT-EECs resulted in an\nincreased secretion of tubular-shaped ECM structures.\nIn the presence of P4, production of these ECM\nstructures was greatly reduced and replaced by a\nmucus-like secretion, which proved sticky as determined\nby AFM contact scanning mode. These findings in\nhTERT-EECs may reflect a physiological secretory\nresponse of normal endometrial glandular epithelium\nto P4.\nResponsiveness to estrogen and P4 is an important\ncharacteristic of the EEC. The human endometrial\ncarcinoma cell lines Ishikawa, RL-95, ECC-1, KLE,\nHEC-1A and EN revealed altered or impaired\nhormonal responsiveness (Thie et al. 1995, Jazaeri et al.\n2001, Dardes et al. 2002, Di Nezza et al. 2003, Farnell &\nIng 2003, Isaka et al. 2003). In hTERT-EECs, the level\nof expression of ER-alpha, but not ER-beta, was\nregulated by estrogen, demonstrating different regulat-\nory processes to affect the transcriptional activation of\nthe two human ER isoforms in hTERT-EECs. Cultured\nunder estrogen-free conditions, hTERT-EECs re-\nsponded with a marked induction of ER-alpha gene\nactivity that was reflected in increased production of\nER-alpha protein. By contrast, estrogens in the culture\nmedium proved to be strong repressors of ER-alpha\nproduction by hTERT-EECs. Down-regulation of\nER-alpha following estrogen treatment has recently\nbeen shown in endometrial glands of ovariectomized\nmacaques (Wang et al. 2002), in endometrial epithelial\nand stromal cells of immature ewes (Meikle et al. 2000)\nand in the human endometrial carcinoma cell line\nECC-1 (Dardes et al. 2002). hTERT-EECs produced a\nfunctional ER-alpha that was clearly responsive to\nestrogen or the synthetic estrogenic compound DES, as\ndemonstrated by a strong induction of luciferase using a\nERE-luciferase reporter plasmid. In agreement with\nobservations in primary human EECs (Zhang et al. 1995,\nClassen-Linke et al. 1997) and Ishikawa cells (Lessey et al.\n1996), E2 induced PR expression in hTERT-EECs,\nwhich is a classic endometrial ER target gene (Milgrom\net al. 1973, Classen-Linke et al. 1997, Brandenberger et al.\n1999, Saegusa & Okayasu 2000, Borthwick et al. 2003).\nThe dose-dependent decrease of PR transcriptional gene\nactivity in the presence of P4 indicated a functional PR\nsignaling pathway in hTERT-EECs as had been\ndescribed for primary EECs (Classen-Linke et al. 2000,\nSpencer & Bazer 2002). We employed MUC-1 gene\nexpression to provide further evidence for P4-induced\nphysiological responses by this cellular endometrial\nmodel system. Expression and secretion of the highly\nglycosylated membrane anchored protein MUC-1 from\nglandular and luminal EECs is increased during the\nsecretory phase of the cycle and MUC-1 is believed to\nact as an anti-adhesive factor of the receptive\nendometrium (Aplin et al. 1996, Meseguer et al. 2001).\nMUC-1 is down-regulated locally by the blastocyst at the\nsite of embryonic attachment (Meseguer et al. 2001).\nFigure 6 Representative Western blot ( n=3) demonstrating the\nspecific up-regulation of ER-alpha protein (67 kDa) in\nhTERT-EEC B37 when cultured in estrogen-free medium (C).\nCells cultured in normal medium plus 10% FCS (A) or in\nmedium supplemented with 10 nM E2 (B) were devoid of\nimmunoreactive ER-alpha indicating that E2 and traces of\nestrogens present in FCS are sufficient in suppressing\nER-alpha expression in hTERT-EECs.\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs528\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nP4 caused increased MUC-1 gene activity in estrogen-\nprimed PR-positive hTERT-EECs, suggesting these cells\nto be a suitable model for studies on P4 signaling in\nhuman EECs. Altered P4 signaling resulting in reduced\nepithelial secretory functions has been linked to clinical\nproblems such as recurrent miscarriage (Aplin et al.\n1996). In hTERT-EECs, P4, but not E2, affected the\nbalance between ER-alpha and ER-beta expression by\nup-regulating ER-beta mRNA. Within the human\nglandular epithelium increased ER-beta gene activity\nhas been described during the late secretory phase of the\ncycle (Critchley et al. 2002). An altered relationship of\nER-alpha to ER-beta expression has been detected in\nendometriotic stromal cells (Brandenberger et al. 1999)\nand was linked to endometrial carcinoma (Fujimoto et al.\n2000, Saegusa & Okayasu 2000, Jazaeri et al. 2001).\nER-beta appears to be important for the regulation and\ncontrol of estrogen-mediated effects within the human\nendometrium. Thus, hTERT-EECs may qualify as a\nsuitable cellular model to investigate factors disturbing\nthis fine-tuned balance and regulation of the different\nsteroid hormone receptors potentially leading to\nendometrial disease.\nThere are conflicting results on the expression of\nER-alpha within human EECs (Marshburn et al. 1992,\nZhang et al. 1995, Dardes et al. 2002). The hTERT-\nEECs showed a down-regulation at the gene and protein\nlevel of ER-alpha by its ligand E2. This would explain\nthe lack of proliferative response of the hTERT-EECs\nduring long-term incubation with E2. By contrast,\nestrogen-free culture conditions caused the hTERT-\nEECs to induce expression of a functional endogenous\nER-alpha allowing for proliferation to resume upon\nexposure to E2. These results clearly demonstrated that\nthe ER-alpha is an essential component of the\nestrogen-mediated growth-promoting effect in hTERT-\nEECs and may help to explain contradictory reports on\nthe effect of E2 on EEC proliferation. In human primary\nEECs cultured under estrogen-free culture conditions\nprior to E2 treatment, E2 had a similar growth-\npromoting effect (Zhang et al. 1995). By contrast,\nMarshburn et al. (1992) did not observe any proliferative\nresponse to E2 in primary EECs grown on ECM.\nHowever, in this study exposure of the cells to E2 had\nnot been preceded by estrogen-free culture conditions,\nthus suggesting that these EECs did not express sufficient\namounts of ER-alpha for E2 to be effective. An\nestrogen-induced, but IGF-I-mediated, paracrine effect\non the proliferation of isolated human EECs was\ndiscovered in a co-culture system with endometrial\nstromal cells (Pierro et al. 2001). This indirect\nestrogen-induced proliferative effect on EECs may, in\npart, be explained by our observation that, regardless of\nthe culture conditions used, isolated primary human\nendometrial stromal cells constitutively express ER-\nalpha.\nMembers of the IL-6 family of cytokines are known\nkey regulators of implantation in the endometrium\n(Sherwin et al. 2002). IL-6 expression in human EECs is\nregulated by hypoxia, IL-1 and steroid hormones and its\nexpression is highest during the mid-secretory phase\nsuggesting a role in embryo implantation (Sherwin et al.\n2002, von Wolff et al. 2002). Increased IL-6 secretion by\nEECs has been reported in women suffering from\nFigure 7 hTERT-EECs express functional ER. Transient transfection assays\nemploying an ERE-luciferase reporter plamid. Incubation of hTERT-EECs with 1 µM\nDES or 10 nM E2 resulted in a strong induction of luciferase activity demonstrating\nthat the ER-alpha was functional in these cells. Data is represented as means±\nS.E.M.\nof three independent experiments.\nSteroid hormone-responsive hTERT-EECs · S HOMBACH-KLONISCH and others 529\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nendometriosis (Piva et al. 2001), recurrent abortion\nand unexplained infertility (Tseng et al. 1996, von\nWolff et al. 2000). The human glandular endometrial\nepithelium expresses IL6-R, LIF-R and gp130, a\nheterodimerization partner and signal transducer\nprotein for both cytokine receptors (Cork et al. 2002,\nSherwin et al. 2002). Therefore, we investigated whether\nthe hTERT-EECs may serve as a suitable cellular model\nfor studies on the physiological role of human EECs\nduring implantation. hTERT-EECs expressed tran-\nscripts for IL-6R, LIF-R, gp130 and the corresponding\ncytokine ligands IL-6 and LIF-R. IL-6 and IL6-R gene\nactivity was significantly up-regulated by estrogen and\nP4 respectively, suggesting the presence of a hormonally\nFigure 8 Quantitative RT-PCR analysis from three independent incubations demonstrated the responsiveness of hTERT-EECs\ntowards the steroid hormones E2 and P4. Prior to incubation with P4 and the synthetic P4 analogue MPA, hTERT-EECs had been\ncultured estrogen-free for 3 days and were then primed with 10 nM E2 for 24 h to induce PR expression. Incubation without E2 for\n4 days (1); E2-deprived cells were treated with 10 nM E2 for 24 h only (2), and subsequently 1 nM E2+various concentrations of\nP4: 50 ng/ml P4 (3), 100 ng/ml P4 (4), 500 ng/ml (5) or 1 µM MPA (6). (A) A differential regulation of PR gene expression by\nsteroid hormones was demonstrated by the suppressive effect of P4 and MPA on PR gene activity in hTERT-EEC B37. A similar\npartial suppression of PR gene expression was observed for all concentrations of P4 employed, suggesting a saturable effect of\nP4 at 50 ng/ml or 1 µM MPA. (B) E2 has stimulatory effects on the IL-6 system of hTERT-EECs. A 4-fold up-regulation of IL-6\ngene activity in hTERT-EECs resulted from E2 treatment. By contrast, a slight but significant transcriptional up-regulation of IL6-R\nwas observed at higher concentrations of P4 and MPA, whereas E2 alone or in combination with 50 ng/ml P4 was unable to affect\nIL6-R expression. This would indicate that in hTERT-EECs both ovarian steroids were able to differentially affect the IL6\nligand–receptor system. (C) Treatment of estrogen-deprived, ER-alpha-induced hTERT-EECs with 10 nM E2 caused an\nup-regulation in MUC-1 transcriptional gene activity which was further enhanced in the presence of P4 and MPA. (D) P4 induced\nER-beta gene activity at 500 ng/ml (4) or 1 µM MPA (5). The lower P4 concentrations used for the incubations shown in Fig. 5\nwere not sufficient to induce ER-beta expression (see Fig. 5). Data is represented as means±\nS.E.M. of three independent\nexperiments. * P≤0·05 significance compared to E2 free cultured cells.\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs530\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nFigure 9 E2 effects on hTERT-EECs viability and proliferation. Cell viability (MTT , a, d) and cellular\nproliferation as determined by BrdU ELISA (b, e) and Ki-67 assay (c, f) are shown. Representative\ngraphs in (a–c) show the effects of the addition of 10 nM E2 ( •) or medium only containing 10% FCS\n(d) on cells following 72 h of incubation in steroid-supplemented medium. Graphs (d–f) show the\neffects of 10 nM E2 on cells following 72 h incubation in either steroid-free medium ( •)o r\nsteroid-supplemented medium ( d). Pre-treatment of hTERT-EECs for 72 h with steroid-free medium\nwas required to stimulate cell proliferation with 10 nM E2 treatment for 48 h (e, f). This proliferative\neffect was abolished when hTERT-EECs had been incubated in the presence of estrogens derived\neither from FCS which had not been estrogen-freed or from E2 added to the culture medium. Results\nof single experiments are shown, with values expressed as means±\nS.E.M. with significance denoted\nby stars (* P,0·05) and (** P,0·001) as determined by the Mann–Whitney test.\nSteroid hormone-responsive hTERT-EECs · S HOMBACH-KLONISCH and others 531\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\ncontrolled and potentially functional cytokine-receptor\nsystem within the immortalized human endometrial\nepithelial cell model.\nIn conclusion, hTERT-EECs may be a suitable novel\nhuman endometrial cellular model linking studies on the\nmolecular and endocrine role of EECs with relevant\nclinical pathologies, such as endometriosis, implantation\nand its failures and endometrial carcinogenesis.\nAcknowledgements\nWe thank Mrs Pamela Cunningham, Margaret Fraser\nand Christine Froehlich for their expert technical\nassistance. We are grateful to Dr Heather Wallace\n(Department of Medicine and Therapeutics, University\nof Aberdeen, UK) for advice on proliferation assays and\nassistance with the BrdU and MTT assays. We thank\nProf. Rez Parwaresch (Institute of Hemopathology and\nLymph Node Registry, Christian Albrechts University,\nKiel, Germany) for assistance with gifts of antibodies and\nprotocols during the development of the DELFIA Ki-67\nproliferation assay. We thank Dr Sonja Kertschanska\n(Department of Anatomy, RWTH Aachen, Germany)\nand Mrs Yvonne Marquardt (Department of Dermatol-\nogy, RWTH Aachen, Germany) for their expertise in\nTEM and collagen/fibroblast matrices. We are grateful\nto Dr Silke Kietz (Karolinska Institute, Huddinge,\nSweden) and Prof. Robert A Weinberg (Whitehead\nInstitute for Biomedical Research, Cambridge, MA,\nUSA) for providing the ERE-luciferase reporter plasmid\nand pCIneo hTERT expression plasmid respectively.\nWe are grateful to Dr Robert Augustin (Department of\nAnatomy and Cell Biology, MLU Halle, Germany) for\nhis assistance during confocal laser scanning microscopy\nand thank Mr Robert Bischoff (Sensobi Sensoren\nGmbH, Halle/Saale, Germany) for generously provid-\ning access to the Atomic Force Microscope. This work\nwas partially funded by the Deutsche Forschungsge-\nmeinschaft (DFG HO2319/3–1; KL1249/5–1/2)\nand the Wilhelm-Roux-Program (FKZ 2/11, 4/32)\nof the Medical Faculty, Martin Luther University,\nHalle-Wittenberg. The authors declare that there is no\nconflict of interest that would prejudice the impartiality\nof this scientific work.\nReferences\nA p l i nJ ,H e yN&L iT1 9 9 6MUC1 as a cell surface and secretory\ncomponent of endometrial epithelium: reduced levels in recurrent\nmiscarriage. American Journal of Reproduction and Immunology 35\n261–266.\nArnold J, Kaufman D, Seppälä M & Lessey B 2001 Endometrial\nstromal cells regulate epithelial cell growth in vitro :an e w\nco-culture model. Human Reproduction 16 836–845.\nBarzanti F, Dal Susino M, Volpi A, Amadori D, Riccobon A, Scarpi\nE, Medri L, Bernardi L, Naldi S, Aldi M et al. 2000 Comparison\nbetween different cell kinetic variables in human breast cancer.\nCell Proliferation 33 75–89.\nBischoff G, Bernstein A, Wohlra bD&H e i nH - J2 0 0 3I maging\nliving chondrocyte surface structures with AFM contact mode. In\nAtomic Force Microscopy – Biomedical Methods and Applications. Series:\nMethods in Molecular Biology , vol 242, pp 105–124. Eds PC Braga &\nD Ricci. Humana Press.\nBodnar A, Quellette M, Frolkis M, Holt S, Chiu C, Morin G,\nHarley C, Shay J, Lichtsteine rS&W right W 1998 Extension of\nlife-span by introduction of telomerase into normal human cells.\nScience 279 349–352.\nBorthwick J, Charnock-Jones D, Tom B, Hull M, Teirney R, Phillips\nS & Smith S 2003 Determination of the transcript profile of the\nhuman endometrium. Molecular Human Reproduction 9 19–33.\nBrandenberger A, Lebovic D, Tee M, Ryan I, Tseng J, Jaffe R &\nTaylor R 1999 Estrogen receptor (ER)-alpha and ER-beta\nisoforms in normal endometrial and endometriosis-derived stromal\ncells. Molecular Human Reproduction 5 651–655.\nCarney S, Tahara H, Swartz C, Risinger J, He H, Moore A,\nHaseman J, Barret tJ&D i x o nD 2002 Immortalization of human\nuterine leiomyoma and myometrial cell lines after induction of\ntelomerase activity: molecular and phenotypic characteristics.\nLaboratory Investigation 82 719–727.\nClassen-Linke I, Krusche M, Knauth eR&B eier H 1997\nEstablishment of a human endometrial cell culture system and\ncharacterization of its polarized hormone responsive epithelial\ncells. Cell and Tissue Research 287 171–185.\nClassen-Linke I, Alfer J, Krusche C, Chwalisz K, Rath W & Beier H\n2000 Progestins, progesterone receptor modulators, and\nprogesterone antagonists change VEGF release of endometrial\ncells in culture. Steroids 65 763–771.\nCork B, Tuckerman E, L iT&L aird S 2002 Expression of\ninterleukin (IL)-11 receptor by the human endometrium in vivo\nand effects of IL-11, IL-6 and LIF on the production of MMP\nand cytokines by human endometrial calls in vitro . Molecular Human\nReproduction 8 841–848.\nCounter C, Meyerson M, Eaton E, Ellisen L, Caddle S, Haber D &\nWeinberg R 1998 Telomerase activity is restored in human cells\nby ectopic expression of hTERT (hEST2), the catalytic subunit of\ntelomerase. Oncogene 16 1217–1222.\nCritchley HOD, Henderson TA, Kelly RW, Scobie GS, Evan LR,\nGroome NP & Saunders PTK 2002 Wild-type estrogen receptor\n(ER/afii98261) and the splice variant (ER /afii9826cx//afii98262) are both expressed\nwithin the human endometrium throughout the normal\nmenstrual cycle. Journal of Clinical Endocrinology and Metabolism 87\n5265–5273.\nDardes R, Schafer J, Pearce S, Osipo C, Che n B & Jordan V 2002\nRegulation of estrogen target genes and growth by selective\nestrogen receptor modulators in endometrial cancer cells.\nGynecologic Oncology 85 498–506.\nDi Nezza L, Joblin gT&S alamonsen L 2003 Progestin suppresses\nmatrix metalloproteinase production in endometrial cancer.\nGynecologic Oncology 89 325–333.\nFarnellY&I n gN 2003 The effects of estradiol and selective\nestrogen receptor modulators on gene expression and messenger\nRNA stability in immortalized sheep endometrial stromal cells and\nhuman endometrial adenocarcinoma cells. Journal of Steroid\nBiochemistry and Molecular Biology 84 453–461.\nFoster SA, Wong DJ, Barrett MT & Galloway DA 1998 Inactivation\nof p16 in human mammary epithelial cells by CpG island\nmethylation. Molecular and Cellular Biology 18 1793–1801.\nFrahm S, Zott B, Dworeck C, Steinmann J, Nepper t J & Parwaresch\nR 1998 Improved ELISA proliferation assay (EPA) for the\ndetection of in vitro cell proliferation by a new Ki-67-antigen\ndirected monoclonal antibody (Ki-S3). Journal of Immunological\nMethods 211 43–50.\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs532\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nFrahm S, Rudolph P, Dworeck C, Zott B, Heidebrecht H,\nS t e i n m a n nJ&N e p p e r tJ1 9 9 9Immunoenzymatic detection of\nthe new proliferation associated protein p100 by means of a\ncellular ELISA: specific detection of cells in cell cycle phases S,\nG2 and M. Journal of Immunological Methods 223 147–153.\nFujimoto J, Sakaguchi H, Aoki I, Khatun S, Toyok iH&T a m a y aT\n2000 Steroid receptors and metastatic potential in endometrial\ncancers. Journal of Steroid Biochemistry and Molecular Biology 75\n209–212.\nGrümmer R, Schwarzer F, Bainczyk K, Hess-Stumpp H, Redigor P,\nS c h i n d l e rA&W i nterhager E 2001 Peritoneal endometriosis:\nvalidation of an in-vivo model. Human Reproduction 16 1736–1743.\nHoeller D, Huppertz B, Roos T, Gutierrez P, Mer kH&J u gert F\n2001 An improved and rapid method to construct skin equivalents\nfrom human hair follicles and fibroblasts. Experimental Dermatology\n10 264–271.\nIsaka K, Nishi H, Sagawa Y, Nakada T, Osakabe Y, Serizawa H,\nE b i h a r aY&Takayama M 2003 Establishment of a new human\ncell line (EN) with TP53 mutation derived from endometrial\ncarcinoma. Cancer Genetics and Cytogenetics 141 20–25.\nJazaeri A, Nunes K, Dalton M, Xu M, Shupnik M & Rice L 2001\nWell-differentiated endometrial adenocarcinomas and poorly\ndifferentiated mixed mullerian tumors have altered ER and PR\nisoform expression. Oncogene 20 6965–6969.\nJiang X-R, Jimenez G, Chang E, Frolkis M, Kusler B, Sage M,\nBeeche M, Bodnar A, Wahl G, Tisty T et al. 1999 Telomerase\nexpression in human somatic cells dues not induce changes\nassociated with an immortalized phenotype. Nature Genetics 21\n111–114.\nKamelle S, Sienk oA&B e n b r o o kD2002 Retinoids and steroids\nregulate menstrual phase histological features in human\nendometrial organotypic cultures. Fertility and Sterility 78 596–602.\nKitawaki J, Kado N, Ishihara H, Koshiba H, Kitaok a Y & Honjo H\n2002 Endometriosis: the pathophysiology as an estrogen-\ndependent disease. Journal of Steroid Biochemistry and Molecular Biology\n83 149–155.\nKiyono T, Foster SA, Koop JI, McDougall JK, Galloway DA &\nKlingelhutz AJ 1998 Both Rb/p16\nINK4a inactivation and\ntelomerase activity are required to immortalize human epithelial\ncells. Nature 396 84–88.\nKoopman E, Blok L, Brinkmann A, Helmerhors t T & Huikeshoven\nF 1999 Differential gene expression in progesterone-sensitive and\nprogesterone-insensitive endometrial carcinoma cells. European\nJournal of Obstetrics, Gynecology, and Reproductive Biology 82 135–138.\nKyo S, Takakura M, Koham aT&I n o u eM 1997 Telomerase\nactivity in human endometrium. Cancer Research 57 610–614.\nKyo S, Nakamura M, Kiyono T, Maida Y, Kanaya T, Tanaka M,\nYatabeN&I n o u eM2 0 0 3S uccessful immortalization of\nendometrial glandular cells with normal structural and functional\ncharacteristics. American Journal of Pathology 163 2259–2269.\nLessey B, Ilesanmi A, Castelbaum A, Yuan L, Somkuti S, Chwalisz\nK & Satyaswaroop P 1996 Characterization of the functional\nprogesterone receptor in an endometrial adenocarcinoma\ncell line (Ishikawa): progesterone-induced expression of the\nalpha1 integrin. Journal of Steroid Biochemistry and Molecular Biology 59\n31–39.\nMarshburn P, Head J, McDonal dP&C asey M 1992 Culture\ncharacteristics of human endometrial glandular epithelium\nthroughout the menstrual cycle: modulation of deoxyribonucleic\nacid synthesis by 17 beta-estradiol and medroxyprogesterone\nacetate. American Journal of Obstetrics and Gynecology 167 1888–1898.\nMeikle A, Bielli A, Masironi B, Pedrana G, Wang H, Forsberg M &\nSahlin L 2000 An immunohistochemical study on the regulation\nof estrogen receptor alpha by estradiol in the endometrium of\nthe immature ewe. Reproductive and Nutritional Development 40\n587–596.\nMeseguer M, Aplin J, Caballero-Campo P, O’Connor J, Martin J,\nRemohi J, Pellice rA&S i m o nC2 0 0 1 Human endometrial mucin\nMUC1 is up-regulated by progesterone and down-regulated\nin vitro by the human blastocyst. Biology of Reproduction 64 590–601.\nMilgrom E, Luu T, Atger M & Baulieu E 1973 Mechanisms\nregulating the concentration and the conformation of progesterone\nreceptor(s) in the uterus. Journal of Biological Chemistry 248\n6366–6474.\nMulholland J, Winterhage rE&B eier H 1988 Changes in proteins\nsynthesized by rabbit endometrial epithelial cells following primary\nculture. Cell and Tissue Research 252 123–132.\nNegamiA&T o m i n a g aT1989 Gland and epithelium formation\nin vitro from epithelial cells of the human endometrium. Human\nReproduction 4 620–624.\nPierro E, Minici F, Alesiani O, Miceli F, Proto C, Screpanti I,\nMancusoS&L anzone A 2001 Stromal–epithelial interactions\nmodulate estrogen responsiveness in normal human endometrium.\nBiology of Reproduction 64 831–838.\nPiva M, Horowitz G & Sharpe-Timms K 2001 Interleukin-6\ndifferentially stimulates haptoglobin production by peritoneal and\nendometriotic cells in vitro : a model for endometrial–peritoneal\ninteraction in endometriosis. Journal of Clinical Endocrinology and\nMetabolism 86 2553–2561.\nRheinwald JG, Hahn WC, Ramsey MR, Wu JY, Guo Z, Tsao H,\nDe Luca M, Catrical àC&O ’ T o o l eK M2002 A two-stage,\np16\nINK4A- and p53-dependent keratinocyte senescence mechanism\nthat limits replicative potential independent of telomere status.\nMolecular and Cellular Biology 22 5157–5172.\nSaegusa M & Okayasu I 2000 Changes in expression of estrogen\nreceptors alpha and beta in relation to progesterone receptor and\npS2 status in normal and malignant endometrium. Japanese Journal\nof Cancer Research 91 510–518.\nSambrook J, Fritsc hE&M aniatis T 1989 Molecular Cloning: a\nLaboratory Manual , edn 2 Appendix E5. Cold Spring Harbor, NY:\nCold Spring Harbor Laboratory Press.\nSatyaswaroop P, Bressler R, de la Pena M & Gurpide E 1979\nIsolation and culture of human endometrial glands. Journal of\nClinical Endocrinology and Metabolism 48 639–641.\nSchatz F, Gordo nR&L a u f e rN 1990 Culture of human\nendometrial cells under polarizing conditions. Differentiation 42\n184–190.\nSherwin J, Smith S, Wilso nA&S harkey A 2002 Soluble gp 130 is\nupregulated in the implantation window and shows altered\nsecretion in patients with primary unexplained infertility. Journal of\nClinical Endocrinology and Metabolism 87 3953–3960.\nSpencerT&B azer F 2002 Biology of progesterone action during\npregnancy recognition and maintenance of pregnancy. Frontiers in\nBioscience 7 1879–1898.\nTanaka M, Kyo S, Takakura M, Kanaya T, Sagawa T, Yamashita\nK, Okada Y, Hiyam a E & Inoue M 1998 Expression of\ntelomerase activity in human endometrium is localized to\nepithelial glandular cells and regulated in a menstrual phase\ndependent manner correlated with cell proliferation. American\nJournal of Pathology 153 1985–1991.\nThie M, Harrach-Ruprecht B, Sauer H, Fuchs P, Albers A &\nDenker H 1995 Cell adhesion to the apical pole of epithelium:\na function of cell polarity. European Journal of Cell Biology 66\n180–191.\nTseng J, Rya nI&M ilam T 1996 Interleukin-6 secretion in vitro is\nup-regulated in ectopic and eutopic endometrial stromal cells from\nwomen with endometriosis. Journal of Clinical Endocrinology and\nMetabolism 81 1118–1122.\nUtsunomiya H, Suzuki T, Ito K, Moriya T, Konno R, Sato S,\nYaegashi N, Okamur aK&S asano H 2003 The correlation\nbetween the response to progesterone treatment and the\nexpression of progesterone receptor B and 17 beta-hydroxysteroid-\ndehydrogenase type 2 in human endometrial carcinoma. Clinical\nEndocrinology 58 696–703.\nVarma V, Melin S, Adamec T, Dorman B, Siegfried J, Walton L,\nC a r n e yC&Norton C 1982 Monolayer culture of human\nSteroid hormone-responsive hTERT-EECs ·\nS HOMBACH-KLONISCH and others 533\nwww.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access\n\n\nendometrium: methods of culture and identification of cell types.\nIn Vitro 18 911–918.\nvon Wolff M, Thaler C, Strowitzki T, Broome J, Stolz W &\nTabibzadeh S 2000 Regulated expression of cytokines in human\nendometrium throughout the menstrual cycle: dysregulation in\nhabitual abortion. Molecular Human Reproduction 6 627–634.\nvon Wolff M, Stieger S, Lumpp K, Bücking J, Strowitzk iT&T haler\nC 2002 Endometrial interleukin-6 in vitro is not regulated directly\nby female steroid hormones, but by pro-inflammatory cytokines\nand hypoxia. Molecular Human Reproduction 8 1096–1102.\nWang H, Isaksson E, von Schoultz B, Clin eJ&S a h l i nL2 0 0 2T h e\neffect of long-term treatment with steroid hormones or tamoxifen\non estrogen receptors (alpha ad beta) in the endometrium of\novarectomized cynomolgus macaques. Journal of Endocrinology 175\n673–681.\nW h i t eT ,d iS a n t A g n e s eP&Miller R 1990 Human endometrial\ncells grown on an extracellular matrix form simple columnar\nepithelia and glands. In Vitro Cell Development and Biology 26\n636–642.\nYeaman C, GrindstaffK&N elson W 1999 New perspectives on\nmechanisms involved in generating epithelial cell polarity.\nPhysiological Reviews 79 73–98.\nYokoyama Y, Takahashi Y, Shinohara A, Lian Z, Xiaoyun W, Niwa\nK & Tamaya T 1998 Telomerase activity is found in the\nepithelial cells but not in the stromal cells in human endometrial\ncell culture. Molecular Human Reproduction 4 985–989.\nZhang L, Rees M & Bicknell R 1995 The isolation and long-term\nculture of normal human endometrial epithelium and stroma.\nJournal of Cell Science 108 323–331.\nReceived 9 December 2004\nAccepted 10 December 2004\nMade available online as an Accepted Preprint\n16 December 2004\nS HOMBACH-KLONISCH and others · Steroid hormone-responsive hTERT-EECs534\nwww.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 517–534\nDownloaded from Bioscientifica.com at 06/13/2026 04:30:14AM\nvia free access","source_license":"public-domain-us","license_restricted":false}