{"paper_id":"bfeb7876-3eba-4691-9de5-ef4acb91d995","body_text":"A novel NLR immune receptor from Aegilops tauschii confers resistance to wheat eyespot disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A novel NLR immune receptor from Aegilops tauschii confers resistance to wheat eyespot disease Sanu Arora, David Gilbert, Kumar Gaurav, Nicolas Trenk, Alberto Prieto, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8021535/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Eyespot, a stem-base soil-borne fungal disease, is an important constraint on wheat production in temperate regions. Resistance in wheat remains limited, with Pch1 and Pch2 being currently deployed in breeding but no underlying or associated gene identified to date. Here, we phenotyped a sequence-configured diversity panel of Aegilops tauschii , the D subgenome progenitor of bread wheat, with one of the two causative agents of eyespot, Oculimacula yallundae . A k -mer-based genome-wide association mapping approach identified Pch4 , a nucleotide-binding leucine-rich repeat (NLR) gene on chromosome 1DS. Transgenic wheat and synthetic hexaploids carrying Pch4 showed strong resistance to the pathogen. Phylogenetic and synteny analyses revealed that Pch4 belongs to the same NLR lineage as the cereal powdery mildew resistance gene Pm3 , indicating a shared evolutionary origin. The discovery of Pch4 expands the repertoire of available eyespot resistances and provides new opportunities for strategic stacking of resistance genes to enhance disease resilience in wheat. Biological sciences/Plant sciences/Plant immunity Biological sciences/Plant sciences/Plant genetics Biological sciences/Plant sciences/Plant breeding Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Two soil-borne pathogens of wheat, Oculimacula yallundae and Oculimacula acuformis , cause cereal eyespot, a stem-base disease prevalent in temperate regions 1 . When infected, susceptible wheat varieties can develop moderate to severe stem lesions that disrupt water and nutrient transport, leading to symptoms such as lodging and premature grain ripening, which can cause yield losses of up to 40% 2,3,4 . The two pathogens differ in fungicide response 5 and host preference, with O. yallundae being more aggressive on wheat than rye while O. acuformis exhibits similar aggressiveness on both hosts 6 . Furthermore, wheat landraces and wild relatives are reported to have differential resistance to the two pathogens, suggesting that resistance to O. yallundae and O. acuformis may have partially independent genetic mechanisms 7 , 8 . To date, only a few resistance loci - Pch1 , Pch2 , Pch3 and QPch.jic-5A - effective against eyespot have been identified 9 , 10 , 11 , 12 , 13 . Pch1 , introgressed onto chromosome 7D from the wheat wild relative Aegilops ventricosa , is effective against both Oculimacula species and is widely deployed. However, its application has been hindered by linkage drag due to limited recombination within the translocated Ae. ventricosa segment 14 . Pch2 and QPch.jic-5A were both identified in the wheat variety Cappelle Desprez. Pch2 was found to provide effective resistance to O. acuformis at the seedling stage but a significantly lower resistance to O. yallundae , while QPch.jic-5A conferred resistance to both species at both seedling and adult stages 2 , 13 . Pch3 , identified on chromosome 4V in Dasypyrum villosum , is yet to be widely deployed, likely due to the undesirable linkage drag 11 . Although the screening of multiple wheat and wild wheat diversity panels has revealed promising variation for eyespot resistance, it has not led to identification and deployment of any additional resistance loci 2 , 15 , 16 , 17 , 18 , 19 . Wheat wild relatives are a rich, largely untapped, source of disease resistance ( R ) genes for improving the resilience of bread wheat against biotic threats. Analysis of the reported R genes for wheat diseases reveal that over 40% of them have originated from wild species 20 . Among these, Aegilops tauschii , the progenitor of wheat D subgenome, stands out as a major contributor. Harnessing its genetic diversity has therefore become a key focus in wheat breeding programs. This wild species comprises three distinct genetic lineages - L1, L2 and L3 - with L2 being the primary donor to the wheat D subgenome 21 . Of the 24 Ae. tauschii R genes identified to date that confer resistance to pathogens, 15 have been cloned, all of which confer resistance to foliar diseases (Supplementary Table 1). Although Ae. tauschii is also reported to harbour resistance against soil-borne pathogens infecting wheat, no R genes underlying such resistance have yet been identified 19 . In this study, we investigate the Ae. tauschii genetics underlying resistance to O. yallundae . We report the cloning of the first R gene conferring resistance to wheat eyespot, a nucleotide-binding domain and leucine-rich repeat (NLR) gene, designated Pch4 . We discovered this R gene by screening a sequence-configured Ae. tauschii diversity panel with the pathogen, followed by k- mer based genome-wide association study (GWAS). We further demonstrate through synthetic hexaploid phenotyping and transgenic overexpression in a susceptible wheat cultivar that this wild wheat R gene provides effective resistance to O. yallundae in a hexaploid wheat background. With the cloning of the first R gene against a soil-borne disease in Ae. tauschii , this work provides a roadmap for further exploration of resistance to soil-borne pathogens of wheat from the D subgenome progenitor. Results Association mapping identified eyespot resistance locus on chromosome 1DS We undertook glasshouse-based phenotyping of a diversity panel consisting of 151 Ae. tauschii L2 lines, using a single isolate of O. yallundae , 20/848, which was isolated by RAGT Seeds from soil near Cambridge, UK. We adapted an existing phenotyping protocol to screen the Ae. tauschii diversity panel along with wheat control lines across three experimental repeats and developed an Ae. tauschii specific disease severity scale (Fig. 1 a) 22 . Phenotypic analysis revealed that 32 Ae. tauschii lines, 21.3% of the diversity panel, exhibited a strong resistance response, out of which 23 lines exhibited greater resistance than the most resistant hexaploid wheat control, Skyfall , which carries Pch1 (Fig. 1 b). An additional 14 lines were categorized as having an intermediate response. Notably, several wheat control varieties carrying either Pch1 or Pch2 were classified as intermediate or susceptible in this assay indicating that these resistances are not equally effective in all backgrounds (Supplementary Table 2). We conducted k -mer based GWAS using the average phenotype scores of the L2 lines which were sequenced in a previous study 21 , except those with intermediate phenotype, and mapped the significantly associated k -mers to the reference assembly of TA1675 23 . This mapping revealed a significantly associated peak of 0.7 Mb on chromosome 1DS spanning a region of 6.23 Mb to 6.93 Mb within which there were 12 annotated genes (Fig. 1 c-d, Supplementary Table 3). Out of these genes, the most significantly associated k -mers mapped to Aet.TA1675.r1.1D001090 (Fig. 1 d), which belongs to the NLR gene family typically associated with disease resistance in plants. There was only one other NLR gene in the associated interval, Aet.TA1675.r1.1D001100 , which is located next to Aet.TA1675.r1.1D001090 at a genomic distance of around 68 kb. We considered both these NLRs as potential candidates underlying the identified eyespot resistance. Comparison of the two NLR genes showed they shared 82.9% nucleotide identity (Fig. 2 a) and 77.7% pairwise amino acid identity (Supplementary Fig. 1). We checked for the presence of both the NLRs across the L2 diversity panel using BLASTn 24 . Despite their physical proximity, the two genes are not perfectly linked and show differential correlation with the phenotype (Fig. 2 b-d). Aet.TA1675.r1.1D001090 was present in 29 of 32 lines scored as resistant along with six intermediate lines and three susceptible lines, while Aet.TA1675.r1.1D001100 was present in only 16 resistant, seven intermediate and nine susceptible lines, therefore, exhibiting a significantly weaker association with resistance (Supplementary Table 4). Therefore, we focused on Aet.TA1675.r1.1D001090 as the primary candidate gene for the identified eyespot resistance, hereby designated as Pch4 . Based on the RNA-seq mapping to the annotated reference assembly of TA1675 and using InterPro 25 , the Pch4 candidate was ascertained to encode a 1447 amino acid sequence across two exons, with defined coiled-coil (CC), nucleotide-binding (NB), and leucine-rich repeat (LRR) domains (Fig. 2 e). The alternate allele in the susceptible line AL8/78, annotated as AET1Gv20020600 , was found to differ significantly from the Pch4 candidate, with the two alleles sharing only 85% amino acid identity (Supplementary Fig. 2). We assessed the broader effectiveness of Pch4 resistance using historical data, where a single isolate of O. yallundae , P84-8, was used to phenotype a diversity collection of Ae. tauschii lines 19 . Out of 78 Ae. tauschii L2 lines shared with our diversity panel, 18 were ascertained to carry Pch4 based on the sequencing data, and all of them but one were reported to be resistant, indicating the potential effectiveness of Pch4 against P84-8 (Supplementary Fig. 3, Supplementary Table 5). We also checked the presence of the Pch4 candidate in 117 diverse Ae. tauschii L1 lines using BLASTn 24 and found four that carry the allele (Supplementary Fig. 4a). L1 lines were screened with a single isolate of O. yallundae , 16/847, and all four L1 lines ascertained to carry Pch4 exhibited a strong resistance response (Supplementary Fig. 4b, Supplementary Table 6). Validation and characterisation of Pch4 in hexaploid wheat and Ae. tauschii To assess the potential relevance of Pch4 for wheat breeding programs, we first examined its allelic variation within the Watkins collection, a recently published diversity panel of wheat landraces sequenced using resistance gene enrichment sequencing 26 . A BLASTn 24 search across 300 lines of this collection failed to identify any wheat lines carrying the Pch4 candidate allele, suggesting that this allele was likely not introduced into hexaploid wheat during the hybridisation of Ae. tauschii with tetraploid wheat. Next, we ascertained the presence of Pch4 in synthetic hexaploid wheat (SHW) lines previously generated through direct hybridisation of Ae. tauschii D subgenome donors with tetraploid wheat 21 (Supplementary Table 7). We selected two contrasting lines for evaluation, both sharing a highly susceptible tetraploid donor, Hoh-506. The D subgenome donor of SHW-070 was a resistant Ae. tauschii accession carrying the Pch4 candidate allele, while that of SHW-042 was a susceptible Ae. tauschii accession carrying an alternate allele. To compare the effectiveness of Pch4 relative to other known eyespot resistances, we phenotyped the SHWs alongside wheat varieties carrying either Pch1 (VPM1) or a combination of Pch2 and QPch.jic-5A (Cappelle Desprez) (Fig. 3 a, Supplementary Table 8). Phenotyping using a mixed inoculum of O. yallundae demonstrated that Pch4 conferred equally effective resistance in hexaploid wheat as in diploid Ae. tauschii . The degree of resistance provided by Pch4 was comparable to that of Pch1 and significantly greater than the resistance conferred by the combined Pch2 and QPch.jic-5A (Fig. 3 b, Supplementary Table 9). To determine the inheritance pattern of Pch4 , a biparental Ae. tauschii F 2 population was generated by crossing the resistant line BW_01185, carrying Pch4 , with the susceptible line BW_01086 that contains an alternate allele. Four F 1 plants were advanced to F 2 , generating a total of 164 F 2 seedlings, which were phenotyped in a growth cabinet bioassay using a mixed isolate inoculum of O. yallundae . Phenotypic data, and genotypic screening of recombinants using KASP markers designed to distinguish between parental alleles (Supplementary Tables 10 and 11), suggested that resistance is inherited in a dominant manner. Heterozygotes exhibited significantly reduced disease severity compared to the susceptible parent, however, the homozygotes displayed a significantly higher degree of resistance compared to both heterozygotes and homozygotes with the BW_01086 Pch4 allele, indicating a dosage dependent or incomplete dominance effect (Fig. 3 c). To further validate the dosage dependent effect, we tested our homoeolog-specific KASP marker in a SHW backcross (SHWBC) population, NIAB-SHW-BC-219, which was generated by crossing the Pch4 carrying SHW-069 with the susceptible wheat variety Robigus 27 . The response of the SHWBC population to pathogen infection confirmed a dosage effect for Pch4 , with homozygotes exhibiting significantly greater resistance than heterozygotes (Supplementary Fig. 5, Supplementary Table 12). To validate the function of the Pch4 candidate, we cloned its genomic sequence for stable transgenic expression in the susceptible wheat line Chinese Spring (CS) and placed it in a construct under the control of a rice actin promoter ( OsActin1 ) and a 35S terminator (Fig. 3 d). We obtained two positive independent T 0 lines carrying Pch4 , which were advanced to T 2 for phenotyping. We designed a homoeologue specific KASP marker (Supplementary Table 10) to develop sister lines from the same T 0 transgenic that were positive or negative for the presence of Pch4 . Chinese Spring is highly susceptible to eyespot and therefore any reduction in phenotype score could be attributed to the presence of the transgene. Infection of T 2 plants using a mixed inoculum of O. yallundae revealed that the lines containing the transgene were significantly more resistant to eyespot compared to zero copy plants (Fig. 3 e-f). To test whether Pch4 confers species-specific resistance, we infected plants from the T 2 sister lines with a mixed inoculum of O. acuformis . Both control and Pch4 positive lines exhibited a highly susceptible response, showing that Pch4 confers species-specific resistance to O. yallundae (Supplementary Table 13). A browning of the coleoptile was frequently observed in the resistant Ae. tauschii , SHW and transgenic plants, likely reflecting a phenolic response to pathogen infection. To further validate that our visual phenotyping, based on pathogen penetration and stem lesion development through the successive plant tissue layers, accurately reflected pathogen infection, we employed fluorescence microscopy. Wheat Germ Agglutinin Alexa Fluor® 488 conjugate (WGA-AF-488) was used to visualize the fungal chitin upon excitation, enabling the detection of the pathogen within infected stem tissue. This analysis confirmed clear fungal presence in susceptible Ae. tauschii and wheat genotypes, while resistant genotypes had little to no detectable pathogen presence (Supplementary Fig. 6). Phylogenetic and syntenic analysis suggests an evolutionary link between Pch4 and Pm3 , a powdery mildew resistance gene To explore the evolutionary relationship between Pch4 and other known NLR genes, we used RefPlantNLR and the NLRtracker pipeline to compare Pch4 and all NLRs within the reference genome assembly TA1675 with an experimentally validated NLR dataset 28 . Pch4 and several closely linked genes were observed to cluster with the Pm3 allelic series and its orthologs Pm8 and TmPm3 from rye ( Secale cereale ) and Triticum monoccocum , respectively (Fig. 4 a-b). These genes convey resistance to the foliar disease powdery mildew ( Blumeria graminis f. sp. Tritici ) and notably, are all located on the short arm of chromosome 1 in their respective species 29 , 30 . We therefore investigated the synteny of this locus across multiple grass species. We extracted a 4.64 Mb region surrounding Pch4 from Ae. tauschii accession TA1675 and aligned it to the reference genomes of wheat ( Triticum aestivum ), rye ( S . cereale ), T. monococcum and barley ( Hordeum vulgare ), which indicated broad conservation of the locus across species (Fig. 4 c). Pch4 shares homology with several Pm3 orthologs, with pairwise amino acid identities of 73.6%, 77.5% and 78% with TmPm3 , Pm8 and Pm3b respectively suggesting a shared ancestral origin (Fig. 4 d). The expansion and diversification of Pm3 orthologs across these genomes may have contributed to neofunctionalization as indicated by the distinct disease resistance functions of Pm3 and Pch4 . Genomics-assisted selection of pre-breeding germplasm for R gene pyramiding We compiled a list of all currently cloned R genes derived from Ae. tauschii L2, encompassing 14 resistance genes against foliar pathogens and one ( Cmc4 ) conferring pest resistance. Using sequencing data for the L2 diversity panel, we predicted the presence of these R genes, alongside Pch4 , across accessions (Fig. 5 ). Notably, Pch4 was predicted in 48 Ae. tauschii accessions, including four previously utilized as D subgenome donors in SHW lines. This resource will enable an informed selection of germplasm for the development of pre-breeding material enriched with resistance to multiple diseases, facilitating efficient introgression into elite wheat cultivars. For instance, SHW-143, derived from Ae. tauschii accession BW_01140, harbours seven cloned R genes conferring resistance to six diseases: Pch4, Stb16q, Rwt4, WTK4, Sr46, Sr66 and Yr28. The deployment of this SHW in breeding pipelines presents a valuable opportunity to introduce a suite of agronomically important R genes in a single breeding cycle. Discussion Eyespot is an economically important stem-base disease of wheat caused by two closely related soil-borne fungal pathogens, O. yallundae and O. acuformis 1 , 31 . Most commercial wheat cultivars exhibit only partial resistance, typically attributed to the Pch2 locus, which provides moderate resistance against both species but is more effective against O. acuformis 31 . Other known resistance sources include Pch1 , introgressed from Ae. ventricosa , and a QTL on chromosome 5A; however, both suffer from undesirable linkage drag that complicates their use in breeding 9 , 11 . The lack of cloned eyespot resistance genes has limited precision breeding efforts, leaving elite germplasm particularly vulnerable to O. yallundae . Wild relatives of wheat, especially Ae. tauschii , have proven to be a rich reservoir of R genes, particularly against foliar pathogens such as rusts, powdery mildew and blast 21 , 26 , 32 . Many of these genes have been cloned using k - mer GWAS, an approach that leverages multiple reference genomes to identify presence/absence variants and structural polymorphisms not captured in single-reference analyses 21 , 26 , 33 . This strategy has proven particularly effective in highly diverse wild plant species, enabling identification and refinement of resistance-associated haplotypes even when structural variation complicates alignment to reference genomes. Despite its success for the study of foliar diseases, Ae. tauschii has remained underexplored for resistance to soil-borne diseases, including eyespot. In this study, we identified Pch4 , a novel NLR gene from Ae. tauschii , as a major source of resistance to O. yallundae . To our knowledge, Pch4 represents the first cloned major R gene for eyespot resistance in cereals. Using k- mer GWAS on the Ae. tauschii L2 diversity panel, resistance was associated with a haplotype on chromosome 1DS containing two adjacent NLR genes. Of these, one showed a stronger correlation with the identified eyespot resistance, designated Pch4 , and was investigated as the primary candidate. Transgenic expression of the Pch4 candidate in the susceptible cultivar Chinese Spring confirmed that the gene confers robust, dominant resistance to O. yallundae , with a dosage-dependent effect observed in segregating populations. Our phylogenetic analysis revealed that Pch4 clusters with the well-characterized allelic series of powdery mildew resistance genes – Pm3 (wheat), Pm8 (rye), and TmPm3 ( Triticum monococcum ) – all of which reside on the short arm of chromosome 1 in their respective species 29 , 30 . Synteny analysis supports a shared ancestral origin of Pch4 and Pm3 alleles, which is particularly interesting since B. graminis is an obligate oomycete pathogen while O. yallundae is facultative fungal pathogen with an extended viability in soils in the absence of living host tissue. Therefore, the evolutionary relationship of Pch4 and Pm3 alleles suggests that diversification of NLR gene families can yield resistance against ecologically and phylogenetically distinct pathogens. A persistent challenge in deploying resistance from wild relatives is linkage drag, as well as regulatory hurdles associated with transgenic approaches in wheat 34 . Notably, Pch4 was absent from a global panel of bread wheat landraces, indicating that this allele was not captured during wheat domestication and polyploidization, and underscoring the narrow genetic base of modern wheat 21 . Synthetic hexaploid wheats (SHWs), generated by crossing durum wheat with diverse Ae. tauschii accessions, provide a practical bridge for introducing such novel genes into breeding programs 21 , 35 . Genomic analysis of SHWs revealed that several lines carry Pch4 , as well as multiple additional cloned R genes from Ae. tauschii , offering the potential for natural stacking of resistance loci. The increasing use of Ae. tauschii SHW in wheat breeding programs raises the tantalising possibility that this gene may already exist in elite backgrounds, free from undesirable linkage drag 27 , 36 . Although Pch4 accounts for most observed resistance to eyespot in Ae. tauschii L2, subsets of resistant accessions in both L1 and L2 lack the gene, suggesting additional unexplored resistance sources. These may be revealed through complementary approaches such as positional cloning, mutational genomics, or GWAS analyses on an expanded diversity panel. Moreover, while Pch4 specifically protects against O. yallundae , the potential for Ae. tauschii to harbour resistance against O. acuformis or other soil-borne pathogens remains unexplored and warrants further investigation. Together, our results provide the first genetic insight into eyespot resistance from Ae. tauschii and establish Pch4 as a deployable R gene for wheat breeding. The cloning of Pch4 expands the limited arsenal of soil-borne resistance genes in cereals and highlights the evolutionary flexibility of NLR clusters in Triticeae . Looking forward, future work should focus on: (1) elucidating the molecular mechanism of Pch4 -mediated recognition, (2) compare the structures of effectors from O. yallundae and B. graminis interacting with Pch4 and Pm3 alleles, respectively, to understand how this NLR gene family evolved to recognise distinct pathogens (3) surveying Ae. tauschii for additional soil-borne disease resistance genes, and (4) strategically combining Pch4 with other R genes to enhance durability. These findings emphasize the untapped potential of wild relatives in safeguarding global wheat production. Methods Plant materials The Ae. tauschii diversity panel germplasm and synthetic hexaploid wheat lines used in this study have previously been described and published 21 , 27 . The Ae. tauschii F 2 population was created by crossing accession BW_01185 with BW_01086 and advancing four F 1 progeny seed to F 2 . Experimental control wheat cultivars with varying responses to eyespot were obtained from the John Innes Centre and RAGT. The CS-Pch4 transgenic lines and all other germplasm used are detailed in Supplementary Table 14. V8 agar plate preparation for the eyespot pathogens To prepare 1 L of V8 agar, 200 ml of V8 juice ( https://www.amazon.co.uk/V8-Vegetable-Juice-Original-1L/dp/B016OW5KZC ), was combined with 800 ml sterile water and 15 g of agar. Solutions were autoclaved and allowed to cool sufficiently for handling, before dispensing into agar plates under sterile conditions. O. yallundae and O. acuformis isolate collection and cultivation O. yallundae isolate 20/848 was obtained from RAGT. This isolate was used for glasshouse phenotyping via dead oat inoculation. In brief, sterilised dead oats were inoculated with mycelium of isolate 20/848 and left to grow for several weeks until the mycelia were well developed. Oats were occasionally broken up by hand to increase inoculum mixing and speed up colonisation. Once visible mycelia could be seen ubiquitously throughout, the inoculum mix was ready for use. All other Oculimacula isolates were available at JIC (Supplementary Table 15). For growth room phenotyping, frozen agar mycelial stubs for all isolates were grown on V8 agar plates in the dark at 25°C for several weeks to bulk mycelia. If further inoculum was required, new plates were prepared using freshly cut mycelial stubs. Isolates were subject to quality control via ITS sequencing, with a maximum likelihood phylogenetic tree built using PhyML 3.0 37 (500 bootstraps) to confirm that the correct species were used in this study (Supplementary Fig. 7). To extract DNA, cultures were grown from a single mycelium plug in 10 ml of Potato Dextrose Broth (Formedium, UK). After 7 days, cultures were centrifuged, the supernatant removed, and ~ 250 mg of mycelial pellet was crushed in liquid nitrogen with pestle and mortar or with glass beads in a TissueLyser II (Qiagen, Germany). The disrupted tissue was then integrated into the workflow for the soil gDNA extraction kit, DNeasy® PowerSoil® Pro (Qiagen, Germany), following the manufacturer’s instructions. DNA quality and concentration were evaluated by Nanodrop and Qubit. ITS sequencing via PCR was carried out using primers TCCTCCGCTTATTGATATGC and GGAAGTAAAAGTCGTAACAAGG, with PCR products purified using the Machery-Nagel NucleoSpin kit (ID: 740609.50) 38 . ITS sequences were sequenced using Sanger sequencing by Eurofins. Ae. tauschii eyespot disease scale development Disease scoring utilised a modified version of an existing protocol 22 . For each biological replicate, the plant was uprooted, and cleaned to remove as much soil as possible, then given a disease severity score based upon the layers of sheath infected or penetrated; 0 = no infection detected, 1 = coleoptile infected, 2 = coleoptile penetrated, 3 = first sheath infected, etc. A score of 9 was determined to be the highest using this scale as plants observed with this level of disease represented near total infection of the entire stem, with individual layers of plant sheath nearly impossible to identify due to the deteriorated state of the diseased tissue. Glasshouse phenotyping Disease responses were assessed for the Ae. tauschii L2 diversity panel via a seedling bioassay in unheated, unlit, glasshouses in Cambridge from November 2022 to February 2023. Four seeds of each accession in addition to control wheat varieties were sown in three replicated trials by placing seed in rows atop compost. Seeds were inoculated with O. yallundae isolate 20/848 by applying a mixture of infected dead oats through which seedlings would grow, using an established method 39 . Plants were regularly watered to ensure a moist damp environment optimal for pathogen infection, with the plants deemed ready for phenotyping once the susceptible control wheat lines had reached a phenotype score of 9. Each plant was individually uprooted and washed to remove residual soil before phenotypic assessment. Growth room phenotyping Controlled environment rooms were used for all other phenotyping assays, including the Ae. tauschii L1 diversity panel, SHW and transgenic lines. Plants were grown at 10°C under a 10h day / 14h night cycle in JIC cereal mix and inoculated using an established method 40 . Briefly, seeds were sown in 96 well trays of JIC cereal mix, watered and allowed to germinate. At about 5–7 days of growth, ~ 1-inch-long PVC cylinders were placed over emerging plant shoots and slightly embedded in the soil to maintain their upright position. Once plants had reached a two-leaf growth stage, typically two weeks post seedling emergence, plants were individually inoculated with O. yallundae or O. acuformis via a pathogen containing agar slurry. This agar slurry was prepared using colonies of Oculimacula species grown on V8 media agar plates that were homogenised with water in a 2:1 ratio using a hand blender. A sterile syringe was used to fill the PVC cylinder surrounding each seedling until the entire stem base was in contact with the pathogen. Plants were watered thoroughly from the bottom of the tray and covered for the first 48 hours to increase humidity before being left to grow at 10°C under a 10h day / 14h night light cycle for 10 weeks, with scoring date determined by the level of disease severity in the susceptible wheat control line, Chinese Spring. k- mer based GWAS k -mer based GWAS was performed based on an established method 21 using the reference genome assembly TA1675 23 . For isolate 20/848 the phenotypic scores of each accession in the Ae. tauschii L2 diversity panel were averaged across the three replicated trials and inverted so that a lower value represents a more susceptible accession. Values deemed intermediate (between − 5.51 and − 7.5) were removed to produce a dataset of clearly susceptible and clearly resistant accessions. A negative log p- value significance threshold of 9.3, estimated previously 21 , was applied. Pch4 Kompetitive Allele-specific PCR markers development The Pch4 nucleotide sequence of resistant and susceptible alleles in lines BW_01185 and BW_01086 was aligned in Geneious to identify regions suitable for the design of KASP markers capable of differentiating between them. The markers were used to genotype the BW_01185 x BW_01086 F 2 population. To create markers capable of differentiating the alleles in a hexaploid wheat background, Pch4 was aligned to the wheat assembly Robigus, ( https://ensembl.gramene.org/Triticum_aestivum_robigus/Info/Index ) using BLASTn 24 to extract the A, B and D genome homoeologs. Alignment of these nucleotide sequences identified a region suitable to create KASP markers where both the common and differentiating markers were specific to the D genome. The homoeolog specific markers were validated using a SHW-BC F 5 population, NIAB-SHW-BC-219 (SHW-069 x Robigus). All KASP assays were set up using PACE® genotyping master mix, according to the manufacturer’s instructions ( https://3crbio.com/products/ ), and run using a standard touchdown PCR programme; 94°C for 15 minutes, 94°C for 20 seconds, 65°C for 1 minute (repeated x10, with temperature decreasing by 0.8°C each cycle to 57°C), 94°C for 20 seconds followed by 57°C for 1 minute (repeated x35). Additional cycles were added as required to achieve maximum separation between different genotypes. Plates were read using a PHERAstar microplate and analysed using KlusterCaller software. Fungal infection microscopy The fungal chitin visualisation technique was adapted from an existing protocol 41 . Tissue from the hypocotyl region of each plant was cut into lengths of ~ 5 mm length and embedded in 1.5 ml Eppendorf tubes filled with 7% low melting point agarose and set at 4°C for 2–4 hours. Embedded samples were sectioned using a VT1000 vibratome to a thickness of 200 µm and transferred onto microscope slides using forceps and cotton-buds. To visualise fungal chitin, samples were stained with Invitrogen Wheat Germ Agglutinin Alexa Fluor® 488 conjugate (WGA-AF-488) (50 mg/mL) for 20 minutes. Stained sections were washed twice with PBS to minimise background staining. Microscopic analysis was performed on a Zeiss Axio Zoom V16 microscope with a 1.0x/0.25 air objective. Using the Spectra 3 Light Engine, a cyan laser at 100% intensity was filtered through a 38 HE GFP (Alexa 488/GFP) filter block. To obtain higher contrast images, a ZEISS Apotome 3 was utilized for optical sectioning in GFP channels. Image acquisition and processing was performed with the Zeiss ZenBlue microscopy software ( www.zeiss.com ) through both monochrome and colour cameras with an exposure time of 200 ms. Pch4 gene cloning, domestication and transformation Fresh genomic DNA of Ae. tauschii accession BW_01016 was extracted from young leaf tissue using the Qiagen Plant DNeasy minikit (ID: 69104). The publicly available genome annotation for the Ae. tauschii reference assembly TA1675 was used to predict the start and stop codon for Pch4 , and the primers ES_GG_F and ES_GG_R (Supplementary Table 10) were designed 1kb up and downstream of the gene start and stop codons, respectively. Phusion polymerase (New England Biolabs (NEB), ID: M0530S) was used to amplify the target product using standard PCR amplified as per the manufacturer’s instructions (Tm60, 35x cycles). Briefly, a 100µ reaction was set up using DNA from BW_01016 as the template and amplified as per manufacturer’s instructions. The PCR product size was confirmed using a 1% agarose and ethidium bromide gel to confirm the target band size under UV light, before the product was excised and cleaned using a Machery-Nagel NucleoSpin kit (ID: 740609.50) A poly-A overhang was introduced onto the 3’ ends of the linear PCR product using Q5® High-Fidelity DNA Polymerase (Neb, ID: M0491S) before ligation into a pGEM®-T Easy Vector (Promega), according to the manufacturer’s instructions. The ligated vector was transformed into JM109 competent cells (Promega) using heat shock and screened via blue-white selection for successful transformants. A colony PCR was used to confirm the presence of the genomic Pch4 sequence in a colony using primer pair ES_GG_F and ES_GG_R, and correctly cloned transformants confirmed using nanopore sequencing from Plasmidsaurus ( https://www.plasmidsaurus.com ). To produce a gene construct amenable to golden gate assembly, four BpiI and one BsaI enzyme cut sites were domesticated by taking advantage of redundancies in the genetic code. In short, a suite of primers (ES_dom_1_F to ES_dom_12_R, Supplementary Table 10) with overhanging Bpil sites that enabled one directional seamless ligations was used to amplify five individual PCR products with single bp changes in the primer sequences that targeted each enzyme cut site. The pGEM- Pch4 plasmid was used as the template for fragment amplification, using the same PCR conditions as above. All DNA fragments were confirmed by visualisation on an agarose gel before gel excision and product clean up using the NucleoSpin kit. Fragments were assembled via Bpil golden gate assembly 42 directly into a level 0 vector pICH41308 (Addgene #47998). Successful domestication was confirmed via Plasmidsaurus whole plasmid sequencing. The golden gate assembly protocol was followed using restriction enzyme Bsal to combine a Rice actin 1 promotor with 5’ UTR (OsAct1) pICSL12014 (Addgene #125882), the Pch4 gDNA, and a 35S terminator with 3’ UTR pICH41414 (Addgene # 50337), into a level 1 position 3 vector (L1P3) pICH47822 (Addgene #48009). The L1P3 Pch4 plasmid was transferred to the JIC wheat transformation team, where it was assembled along with the Level 1 hygromycin selectable marker gene (Addgene # 165423) into the wheat transformation binary vector pGoldenGreenGate-M (pGGG-M) (Addgene # 165422) as previously described 43 . Wheat transformation was carried out following an established method 44 , resulting in two successful transformed T 0 plants with either one or six copies of the Pch4 transgene. Transformants and null controls were advanced to T 1 and T 2 for phenotyping. Gene copy number quantification was performed for the T 0 and T 1 plants by the JIC in house genotyping platform, using the hygromycin resistance gene that is introduced into wheat as a selectable marker alongside Pch4 for qRT-PCR and the previously outlined methodology 45 . NLR phylogenetics NLR genes and their corresponding NBARC domains from the Ae. tauschii reference genome TA1675 were identified using NLR-Annotator 46 . These sequences were concatenated with those from the RefPlantNLR dataset 28 and aligned using Clustal Omega 47 . Phylogenetic inference was performed with RAxML v8.2.12 48 using the Maximum Likelihood method under the JTT substitution model (command: raxmlHPC-PTHREADS-AVX2 -T 10 -s Pch4_clustal_allignment_070124.phy -n RefPlantNLR -m PROTGAMMAAUTO -f a -# 1000 -x 8153044963028367 -p 644124967711489). The resulting phylogenetic tree was visualized and edited using the iTOL suite 49 . Synteny analysis To investigate gene collinearity and identify orthologous relationships among grass genomes, the JCVI utility library was employed ( https://github.com/tanghaibao/jcvi ) to perform pairwise orthology detection and synteny screening. Analyses were conducted between the following genome pairs in progressive evolutionary order: Brachypodium distachyon vs. Hordeum vulgare , Hordeum vulgare vs. Secale cereale , Secale cereale vs. T. monococcum, T. monococcum vs. T. aestivum A genome, T. aestivum A vs. B genomes, T. aestivum B vs. D genomes, T. aestivum D genome vs. Aegilops tauschii. The reference genomes used are detailed in Supplementary Table 16. For synteny analysis, gene annotation files were converted into .bed format using the JCVI suite. For each file, the following steps were executed: The .gff3.gz files were decompressed using gunzip. Each .gff3 file was converted to BED format using the jcvi.formats.gff module of the JCVI utility suite. Specifically, the bed subcommand was used with the options --type = gene and --key = ID to extract gene features based on their unique identifiers. Files containing the coding sequences were modified using awk and sed commands so that gene names matched with the .bed files and all transcripts except the first were removed. For each genome pair, orthologs were identified using the jcvi.compara.catalog ortholog module with the --no_strip_names option to preserve original gene identifiers. Anchor files generated from this step were then refined using the jcvi.compara.synteny screen command to retain syntenic blocks with a minimum span of 30 genes and using the --simple flag for simplified filtering. Microsyteny was plotted using the jcvi.graphics.synteny module where the gene Aet.TA1675.r1.1D001090 was highlighted in green, while Aet.TA1675.r1.1D001100 and Aet.TA1675.r1.1D001300 were highlighted in orange (see Fig. 4 c). Cloned R gene prediction in Ae. tauschii L2 diversity panel The nucleotide sequences for cloned Ae. tauschii R genes (except where indicated below) were obtained from online data repositories (Supplementary Table 17). Each gene was used as the input query to search the available contig level whole-genome assemblies 21 and RenSeq assemblies 32 of the L2 diversity panel using BLASTn 24 . An R gene was determined to be present within an accession if the majority of the gene could be identified from the BLASTn 24 results with a percentage identity relative to the query of 99.5%. In multiple cases R genes were present across numerous contigs, requiring significant manual curation and care in order to determine R gene presence. For Stb16q and Lr39 , the R gene linked KASP markers reported in the literature 23 , 50 were used as the input query for search using BLASTn-short 24 . For Sr66 (SrTA1662), Sr33, Sr45, Sr46, Cmc4 and WTK4 genes, their presence within the panel had already been reported in previous studies 21 , 32 . The phylogenetic tree and gene presence was plotted in iToL, with colours added to distinguish associated disease resistance. Declarations Acknowledgements This work was supported by a John Innes Foundation fellowship to SA and by UKRI BBSRC through the Institute Strategic Programme grant BB/X010996/1 (Advancing Plant Health) and BB/P012574 (Plant Health). DG was supported by a BBSRC/RAGT Industrial-Collaborative Award in Science and Engineering fellowship. PN was supported by UKRI BBSRC through the Institute Strategic Programme grant BB/P016855/1 (Designing Future Wheat) and BB/X011003/1 (Delivering Sustainable Wheat). We are grateful to Kara Boyd (JIC) for assistance with plant husbandry work, and to Claire Domoney (JIC) and Mark Banfield (JIC) for reviewing the draft manuscript. The high-performance computing resources and services used in this work were supported by the Norwich Bioscience Institutes Partnership (NBIP) Computing infrastructure for Science (CiS) group. We are grateful to the John Innes Centre (JIC) Horticultural Services for plant greenhouse support and R. Goram at the JIC genotyping platform for genotyping support. We also thank RAGT Seeds for providing access to their greenhouses and resources for conducting the phenotyping work and thank Chris Burt for his constructive feedback. Lastly, we thank NIAB for providing us with seed of the synthetic hexaploid wheat backcross population, NIAB-SHW-BC-219. Contributions S.A. designed the research; D.G. and K.G. performed k -mer-based GWAS and refined the resistance mapping interval; D.G., A.P., C.M., R.B. conducted phenotyping of the diversity panel, and synthetic and transgenic wheat; P.N., A.S. and T.H., provided Oculimacula isolates and plant phenotyping support; D.G. designed the binary construct; S.H. and M.S. carried out wheat transformation; D.G. performed KASP marker analysis; N.T. conducted microscopic analysis; A.P.M and S.B. cultured Oculimacula isolates for sequencing to build the phylogenetic tree; R.M. generated the Ae. tauschii F 2 population; D.G., K.G. and S.A. drafted the manuscript; D.G., K.G., M.V. and S.A. designed the figures; All authors reviewed and approved the manuscript. Ethics declarations Competing interests The authors declare no competing interests. References Crous PW, Groenewald JZE, Gams W (2003) Eyespot of cereals revisited: ITS phylogeny reveals new species relationships. Eur J Plant Pathol 109:841–850. 10.1023/A:1026111030426 Burt C, Hollins TW, Powell N, Nicholson P (2010) Differential seedling resistance to the eyespot pathogens, Oculimacula yallundae and Oculimacula acuformis , conferred by Pch2 in wheat and among accessions of Triticum monococcum . Plant Pathol 59:819–828. 10.1111/j.1365-3059.2010.02307.x Ray RV, Crook MJ, Jenkinson P, Edwards SG (2006) Effect of eyespot caused by Oculimacula yallundae and O. acuformis , assessed visually and by competitive PCR, on stem strength associated with lodging resistance and yield of winter wheat. Journal Experimental Botany 57:2249–2257. 10.1093/jxb/erj192 Meyer N et al (2011) Diagnostic value of molecular markers linked to the eyespot resistance gene Pch1 in wheat. Euphytica 177:267–275. 10.1007/s10681-010-0266-0 Parnell S, Gilligan CA, Lucas JA, Bock CH, Van Den Bosch F (2008) Changes in fungicide sensitivity and relative species abundance in Oculimacula yallundae and O. acuformi s populations (eyespot disease of cereals) in Western Europe. Plant Pathol 57:509–517. 10.1111/j.1365-3059.2007.01786.x Hollins TW, Scott PR, Paine JR (1985) Morphology, benomyl resistance and pathogenicity to wheat and rye of isolates of Pseudocercosporella herpotrichoides . Plant Pathol 34:369–379. 10.1111/j.1365-3059.1985.tb01375.x Cadle MM, Murray TD, Jones SS (1997) Identification of resistance to Pseudocercosporella herpotrichoides in Triticum monococcum . Plant Dis 81:1181–1186. 10.1094/PDIS.1997.81.10.1181 Sheng H, Murray TD (2013) Identifying new sources of resistance to eyespot of wheat in Aegilops longissima . Plant Dis 97:346–353. 10.1094/PDIS-12-11-1048-RE Worland AJ, Law CN, Hollins TW, Koebner RMD, Giura A (1988) Location of a gene for resistance to eyespot (P seudocercosparella herpotrichoides ) on chromosome 7D of bread wheat. Plant Breeding 101:43–51. 10.1111/j.1439-0523.1988.tb00265.x de la Pena RC, Murray TD, Jones SS (1996) Linkage relations among eyespot resistance gene Pch2 , endopeptidase Ep–A1b, and RFLP marker Xpsr121 on chromosome 7A of wheat. Plant Breeding 115:273–275. 10.1111/j.1439-0523.1996.tb00916.x Murray TD, de la Pena RC, Yildirim A, Jones SS, Qualset CO (1994) A new source of resistance to Pseudocercosporella herpotrichoides , cause of eyespot disease of wheat, located on chromosome 4V of Dasypyrum villosum . Plant Breeding 113:281–286. 10.1111/j.1439-0523.1994.tb00737.x Muranty H, Jahier J, Tanguy A–M, Worland AJ, Law C (2002) Inheritance of resistance of wheat to eyespot at the adult stage. Plant Breeding 121:536–538. 10.1046/j.1439-0523.2002.00767.x Burt C, Hollins TW, Nicholson P (2011) Identification of a QTL conferring seedling and adult plant resistance to eyespot on chromosome 5A of Cappelle Desprez. Theor Appl Genet 122:119–128. 10.1007/s00122-010-1427-1 Pasquariello M, Berry S, Burt C, Uauy C, Nicholson P (2020) Yield reduction historically associated with the Aegilops ventricosa 7DV introgression is genetically and physically distinct from the eyespot resistance gene Pch1 . Theoretical and Applied Genetics 133, 707–717 10.1007/s00122-019-03502-1 Zanke CD et al (2017) Genome–wide association mapping of resistance to eyespot disease (P seudocercosporella herpotrichoides ) in European winter wheat ( Triticum aestivum L.) and fine–mapping of Pch1 . Theor Appl Genet 130:505–514. 10.1007/s00122-016-2830-z Lewien MJ, Murray TD, Jernigan KL, Garland–Campbell KA, Carter AH (2018) Genome–wide association mapping for eyespot disease in US Pacific Northwest winter wheat. PLoS ONE 13:e0194698. 10.1371/journal.pone.0194698 Burt C et al (2014) Mining the Watkins collection of wheat landraces for novel sources of eyespot resistance. Plant Pathol 63:1241–1250. 10.1111/ppa.12221 Thiele A, Schumann E, Peil A, Weber WE (2008) Eyespot resistance in wheat × Aegilops kotschyi backcross lines. Plant Breeding 121:29–35. 10.1046/j.1439-0523.2002.00669.x Yildirim A, Jones SS, Murray TD, Cox TS, Line RF (1995) Resistance to stripe rust and eyespot diseases of wheat in Triticum tauschii . Plant Dis 79:1230–1236. 10.1094/PD-79-1230 Hafeez AN et al (2021) Creation and judicious application of a wheat resistance gene atlas. Mol Plant 14:1053–1070. 10.1016/j.molp.2021.05.014 Gaurav K et al (2022) Population genomic analysis of Aegilops tauschii identifies targets for bread wheat improvement. Nat Biotechnol 40:422–431. 10.1038/s41587-021-01058-4 Scott PR (1971) The effect of temperature on eyespot ( Cercosporella herpotrichoides ) in wheat seedlings. Ann Appl Biol 68:169–175. 10.1111/j.1744-7348.1971.tb06453.x Cavalet–Giorsa E et al (2024) Origin and evolution of the bread wheat D genome. Nature 633:848–855. 10.1038/s41586-024-07808-z Camacho C et al (2009) BLAST+: architecture and applications. BMC Bioinformatics 10:421. 10.1186/1471-2105-10-421 Blum M et al (2021) The InterPro protein families and domains database: 20 years on. Nucleic Acids Res 49:D344–D354. 10.1093/nar/gkaa977 Arora S et al (2023) A wheat kinase and immune receptor form host-specificity barriers against the blast fungus. Nat Plants 9:385–392. 10.1038/s41477-023-01357-5 Wright TIC et al (2024) A new winter wheat genetic resource harbors untapped diversity from synthetic hexaploid wheat. Theor Appl Genet 137:73. 10.1007/s00122-024-04577-1 Kourelis J, Sakai T, Adachi H, Kamoun S (2021) RefPlantNLR is a comprehensive collection of experimentally validated plant disease resistance proteins from the NLR family. PLoS Biol 19:e3001124. 10.1371/journal.pbio.3001124 Hurni S et al (2013) Rye Pm8 and wheat Pm3 are orthologous genes and show evolutionary conservation of resistance function against powdery mildew. Plant J 76:957–969. 10.1111/tpj.12345 Zhao CZ et al (2016) Molecular cloning, functional verification, and evolution of TmPm3 , the powdery mildew resistance gene of Triticum monococcum L. Genet Mol Res 15(2). 10.4238/gmr.15028056 Burt C, Nicholson P (2011) Exploiting co-linearity among grass species to map the Aegilops ventricosa -derived Pch1 eyespot resistance in wheat and establish its relationship to Pch2 . Theor. Appl. Genet. 123, 1387–1400 10.1007/s00122-011-1674-9 Arora S et al (2019) Resistance gene cloning from a wild crop relative by sequence capture and association genetics. Nat Biotechnol 37:139–143. 10.1038/s41587-018-0007-9 Voichek Y, Weigel D (2020) Identifying genetic variants underlying phenotypic variation in plants without complete genomes. Nat Genet 52:534–540. 10.1038/s41588-020-0612-7 Rafiei F et al (2024) Facts, uncertainties, and opportunities in wheat molecular improvement. Heredity 133:371–380. 10.1038/s41437-024-00721-1 Ogbonnaya FC et al (2013) Synthetic Hexaploids: Harnessing Species of the Primary Gene Pool for Wheat Improvement. Plant Breeding Reviews, vol 37. Janick J., editor; Wiley-Blackwell, Hoboken, NJ, pp 35–122 Rosyara U et al (2019) Genetic Contribution of Synthetic Hexaploid Wheat to CIMMYT’s Spring Bread Wheat Breeding Germplasm. Sci Rep 9:12355. 10.1038/s41598-019-47936-5 Guindon S et al (2010) New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst Biol 59:307–321. 10.1093/sysbio/syq010 White TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications , Innis M. A., Gelfand D. H., Sninsky J. J. & White T. J., eds.; Academic Press: New York, 315–322 10.1016/B978-0-12-372180-8.50042-1 Bruehl GW, Nelson WL (1964) Technique for mass inoculations of winter wheat in the field with Cercosporella herpotrichoides . FJ Dis Reptr 48:863–865. https://www.cabidigitallibrary.org/doi/full/ 10.5555/19651101053 Chapman NH, Burt C, Nicholson P (2009) The identification of candidate genes associated with Pch2 eyespot resistance in wheat using cDNA-AFLP. Theor Appl Genet 118:1045–1057. 10.1007/s00122-009-0961-1 Djébali N, Jauneau A, Ameline-Torregrosa C, Chardon F, Jaulneau V, Mathé C, Bottin A, Cazaux M, Pilet-Nayel M-L, Baranger A, Aouani ME (2009) Partial resistance of Medicago truncatula to Aphanomyces euteiches is associated with protection of the root stele and is controlled by a major QTL rich in proteasome-related genes. Mol Plant-Microbe Interact 22:1043–1055. 10.1094/MPMI-22-9-1043 Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S (2011) A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLoS ONE 6:e16765. 10.1371/journal.pone.0016765 Smedley MA, Hayta S, Clarke M, Harwood WA (2021) CRISPR-Cas9 Based Genome Editing in Wheat. Curr Protoc 1:e65. 10.1002/cpz1.65 Hayta S, Smedley MA, Clarke M, Forner M, Harwood WA (2021) An efficient Agrobacterium-mediated transformation protocol for hexaploid and tetraploid wheat. Curr Protoc 1:e58. 10.1002/cpz1.58 Hayta S, Smedley MA, Demir SU et al (2019) An efficient and reproducible Agrobacterium -mediated transformation method for hexaploid wheat ( Triticum aestivum L). Plant Methods 15:121. 10.1186/s13007-019-0503-z Steuernagel B et al (2020) The NLR-Annotator tool enables annotation of the intracellular immune receptor repertoire. Plant Physiol 183:468–482. 10.1104/pp.19.01273 Sievers F et al (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539. 10.1038/msb.2011.75 Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313. 10.1093/bioinformatics/btu033 Letunic I, Bork P (2024) Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res 52:W78–W82. 10.1093/nar/gkae268 Saintenac C et al (2021) A wheat cysteine-rich receptor-like kinase confers broad-spectrum resistance against Septoria tritici blotch. Nat Commun 12:433. 10.1038/s41467-020-20685-0 Additional Declarations There is NO Competing Interest. Supplementary Files supplementarytables.xlsx Dataset 1 supplementaryfigures.pptx Supplementary figures Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8021535\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":561597370,\"identity\":\"89b58025-41a0-4e31-a28a-645d5c51df3c\",\"order_by\":0,\"name\":\"Sanu Arora\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYBAC+QYQaQAimA8YJEAEmfFqMTgAIitABFsCkVrA5BkQwWMAEySghf3sMQnGtnty5u1nPhQ8qGGQ52/gMTbAp0W+Jy8NqKXYWOZM7gaDhGMMhjMO8Bgn4LXmQI4ZUEtC4gwGoJbEBgbGDQw8xgfwajn/BqjlH1AL/5sHIC32hLXcgNkikcMA0pII0oLXYQY33hhbJLYlGEtIPDMA+kUiecZhtmL83u/PMbzxsS1BToI/+Znhjxob2/725s0SeB0GAlB3sAENlyAUK6iA+QEJikfBKBgFo2AEAQByNUKNom2HJwAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-6632-2171\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Sanu\",\"middleName\":\"\",\"lastName\":\"Arora\",\"suffix\":\"\"},{\"id\":561597371,\"identity\":\"4db937a7-7730-4c30-b138-38313b8482a5\",\"order_by\":1,\"name\":\"David Gilbert\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"King Abdullah University of Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"David\",\"middleName\":\"\",\"lastName\":\"Gilbert\",\"suffix\":\"\"},{\"id\":561597372,\"identity\":\"7b26a94b-4323-4eed-8aef-273ac24ea013\",\"order_by\":2,\"name\":\"Kumar Gaurav\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kumar\",\"middleName\":\"\",\"lastName\":\"Gaurav\",\"suffix\":\"\"},{\"id\":561597373,\"identity\":\"e40c0613-a38a-4796-aca8-400a2ac28fb7\",\"order_by\":3,\"name\":\"Nicolas Trenk\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-3328-6888\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nicolas\",\"middleName\":\"\",\"lastName\":\"Trenk\",\"suffix\":\"\"},{\"id\":561597374,\"identity\":\"30cc8582-7aa1-4543-8058-2904a59c619e\",\"order_by\":4,\"name\":\"Alberto Prieto\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"RAGT Seeds Ltd.\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alberto\",\"middleName\":\"\",\"lastName\":\"Prieto\",\"suffix\":\"\"},{\"id\":561597375,\"identity\":\"6876797b-1669-4d34-900d-7ae1f10f4f50\",\"order_by\":5,\"name\":\"Clare Moscrop\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"RAGT Seeds Ltd.\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Clare\",\"middleName\":\"\",\"lastName\":\"Moscrop\",\"suffix\":\"\"},{\"id\":561597376,\"identity\":\"ccefc422-77e6-4c5f-9b5c-c79d8f009da9\",\"order_by\":6,\"name\":\"Andrew Steed\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Andrew\",\"middleName\":\"\",\"lastName\":\"Steed\",\"suffix\":\"\"},{\"id\":561597377,\"identity\":\"4892b085-c1a3-409e-9066-ad66d65d2782\",\"order_by\":7,\"name\":\"Tom O'Hara\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tom\",\"middleName\":\"\",\"lastName\":\"O'Hara\",\"suffix\":\"\"},{\"id\":561597378,\"identity\":\"eaac277d-5063-42e6-b6a6-7540b51d929c\",\"order_by\":8,\"name\":\"Alba Pacheco-Moreno\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alba\",\"middleName\":\"\",\"lastName\":\"Pacheco-Moreno\",\"suffix\":\"\"},{\"id\":561597379,\"identity\":\"1445658e-8ef9-49bd-9c01-0a7cb49390e5\",\"order_by\":9,\"name\":\"Mishi Vachev\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mishi\",\"middleName\":\"\",\"lastName\":\"Vachev\",\"suffix\":\"\"},{\"id\":561597380,\"identity\":\"a995ae94-cb66-4297-8c39-92bc418ec088\",\"order_by\":10,\"name\":\"Samuel Bruty\",\"email\":\"\",\"orcid\":\"https://orcid.org/0009-0009-5395-4573\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Samuel\",\"middleName\":\"\",\"lastName\":\"Bruty\",\"suffix\":\"\"},{\"id\":561597381,\"identity\":\"d93ab722-095d-4881-af87-63b160b26983\",\"order_by\":11,\"name\":\"Sadiye Hayta\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-2920-4720\",\"institution\":\"JIC\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sadiye\",\"middleName\":\"\",\"lastName\":\"Hayta\",\"suffix\":\"\"},{\"id\":561597382,\"identity\":\"dfa07c54-a803-4027-b8b8-74d0bb1fd71b\",\"order_by\":12,\"name\":\"Mark Smedley\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-6162-4795\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mark\",\"middleName\":\"\",\"lastName\":\"Smedley\",\"suffix\":\"\"},{\"id\":561597383,\"identity\":\"0ed66829-840d-4786-b386-b290df5996cd\",\"order_by\":13,\"name\":\"Rose McNelly\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rose\",\"middleName\":\"\",\"lastName\":\"McNelly\",\"suffix\":\"\"},{\"id\":561597384,\"identity\":\"a2b88304-01b3-49c8-b603-30d74881e286\",\"order_by\":14,\"name\":\"Paul Nicholson\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-6458-8697\",\"institution\":\"John Innes Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Paul\",\"middleName\":\"\",\"lastName\":\"Nicholson\",\"suffix\":\"\"},{\"id\":561597385,\"identity\":\"e437f56c-5585-4ef4-9222-baf531dcdde6\",\"order_by\":15,\"name\":\"Ruth Bryant\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"RAGT Seeds Ltd.\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ruth\",\"middleName\":\"\",\"lastName\":\"Bryant\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-11-03 17:10:10\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8021535/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8021535/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":99374104,\"identity\":\"ec75dda2-b153-4a2a-9e76-72af9ad57af3\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":4216000,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/a9ce33220210ffb4114a424b.docx\"},{\"id\":99374103,\"identity\":\"bf929ab7-295f-447f-b439-f28ef7732863\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":14419,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"NCOMMS2593008T.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/2b1f2e5839f49a8f7e5b9411.json\"},{\"id\":99374113,\"identity\":\"cf6984ef-18b3-42bc-8e87-92f9940863da\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:09\",\"extension\":\"pptx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":160184432,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryfigures.pptx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/7ec45f00767956fc89f1e95d.pptx\"},{\"id\":99789267,\"identity\":\"e2471b3f-b750-4e52-84e3-c81ae6d792d0\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:49:15\",\"extension\":\"xml\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":152403,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"NCOMMS2593008T0enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/21f4c1c9aa2fdb3ba88b787d.xml\"},{\"id\":99374111,\"identity\":\"1a8c670a-5ad7-44a1-b121-33e46a003dc8\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:08\",\"extension\":\"xml\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":150568,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"NCOMMS2593008T0structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/0793e77f369caee0365660a4.xml\"},{\"id\":99374108,\"identity\":\"b84451d2-4375-458a-87b2-848610a268ea\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"html\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":172210,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/7870c55567114485a8f017a5.html\"},{\"id\":99374102,\"identity\":\"e9154f0a-4bc8-4f95-8955-36ffa79e8efa\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1301941,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eIdentification of a novel eyespot resistance interval\\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003e. \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003ea, \\u003c/strong\\u003e\\u003cem\\u003eAe. tauschii\\u003c/em\\u003e specific phenotyping scale for eyespot disease severity. \\u003cstrong\\u003eb, \\u003c/strong\\u003ePhenotypic mean (n = 12) for the \\u003cem\\u003eAe. tauschii \\u003c/em\\u003eL2 panel (in green, amber and orange) and wheat control varieties (blue). \\u003cstrong\\u003ec, \\u003c/strong\\u003eManhattan plot of the \\u003cem\\u003ek-\\u003c/em\\u003emer GWAS for eyespot disease resistance. The size of dots is proportional to the number of \\u003cem\\u003ek-\\u003c/em\\u003emers having a specific negative log \\u003cem\\u003ep\\u003c/em\\u003e-value and their colour indicates a positive (green) or negative (orange) correlation with the phenotype. A 0.7 Mb interval on Chr 1D shows a significant positive association with eyespot resistance. \\u003cstrong\\u003ed,\\u003c/strong\\u003e Zooming-in on the associated 0.7 Mb interval on Chr 1D reveals 12 genes (black triangles), including two NLRs\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001090\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003eand\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001100\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e,\\u003c/strong\\u003e highlighted in the figure, with the most significant \\u003cem\\u003ek\\u003c/em\\u003e-mers mapping to the former of the two.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/eac99b8ba056c010d30e7c6c.png\"},{\"id\":99374107,\"identity\":\"d8e062d6-681a-4823-b03a-c2468134d0bb\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":424203,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferentiating the two NLRs in \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePch4\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e resistance interval and prioritising one for functional validation. a,\\u003c/strong\\u003e MAFFT alignment of the two NLR candidate genes showed a pairwise nucleotide identity of 82.9% with dissimilarities indicated by black lines \\u003cstrong\\u003eb,\\u003c/strong\\u003e Phylogenetic tree of \\u003cem\\u003eAe. tauschii \\u003c/em\\u003eL2 accessions with the mean eyespot disease phenotype and the\\u003cem\\u003e \\u003c/em\\u003epresence of \\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001090\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e \\u003c/em\\u003eand \\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001100\\u003c/strong\\u003e\\u003c/em\\u003e indicated by the coloured boxes, black dots and black stars respectively. \\u003cstrong\\u003ec, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001090\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e \\u003c/em\\u003eis present in 38 accessions with significantly reduced disease phenotype score (median average phenotype = 5.04) compared to the 112 accessions having alternate alleles (median average phenotype = 8.92; Mann-Whitney U, p \\u0026lt; 2.22x10\\u003csup\\u003e-16\\u003c/sup\\u003e). \\u003cstrong\\u003ed,\\u003c/strong\\u003e \\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001100\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e \\u003c/em\\u003eshows a significant (Mann-Whitney U, p \\u0026lt; 4x10\\u003csup\\u003e-6\\u003c/sup\\u003e) but reduced association with eyespot resistance compared to \\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001090\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e. \\u003c/em\\u003e\\u003cstrong\\u003ee, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAet.TA1675.r1.1D001090\\u003c/strong\\u003e\\u003c/em\\u003e, the primary \\u003cem\\u003ePch4 \\u003c/em\\u003ecandidate,\\u003cem\\u003e \\u003c/em\\u003eencodes a two-exon canonical NLR\\u003cstrong\\u003e.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/817fa384593088c970aea26d.png\"},{\"id\":99374110,\"identity\":\"2ff6f5fa-8c8c-42dd-a2e7-7bcd89ebf247\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1003581,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePch4 \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003econfers eyespot resistance\\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003ein hexaploid wheat and exhibits a dosage dependent effect. a,\\u003c/strong\\u003e Representative phenotyping of resistant and susceptible diploid D genome donors, tetraploid parent and hexaploid synthetic and control lines. \\u003cstrong\\u003eb, \\u003c/strong\\u003e\\u003cem\\u003ePch4 \\u003c/em\\u003eresistance in a synthetic hexaploid background confers a similar level of protection against \\u003cem\\u003eO. yallundae\\u003c/em\\u003e as \\u003cem\\u003ePch1. \\u003c/em\\u003ePairwise comparisons were performed using Wilcoxon rank-sum tests with Benjamini-Hochberg correction for multiple testing. Significant differences were found between accessions containing \\u003cem\\u003ePch4 \\u003c/em\\u003e(BW_01115, median = 5; SHW-070, median = 5), or VPM1 (containing \\u003cem\\u003ePch1\\u003c/em\\u003e, median = 4) compared to Cappelle Desprez (containing \\u003cem\\u003ePch2 \\u003c/em\\u003eand \\u0026nbsp;QPch.jic-5A, median = 6) or accessions lacking any known eyespot resistance (BW_01030, median = 9; Hoh-506, median = 9; SHW-042, median = 9). \\u003cstrong\\u003ec, \\u003c/strong\\u003ePhenotyping of a biparental F\\u003csub\\u003e2\\u003c/sub\\u003e population derived from the BW_01185 x BW_01086 cross shows that \\u003cem\\u003ePch4 \\u003c/em\\u003eacts as a dosage dependent dominant gene with a single copy significantly reducing disease phenotype. A Kruskal-Wallis rank sum test was conducted to determine differences in phenotype scores among the three genotypes \\u003cem\\u003ePch4\\u003c/em\\u003e ++ (median= 5, n = 34), \\u003cem\\u003ePch4\\u003c/em\\u003e +- (median = 6, n = 75), and Pch4 -- (median = 9, n = 37), showing statistically significant differences between the groups (H(2) = 85.02, p \\u0026lt; 0.001). Post-hoc pairwise comparisons were performed using Wilcoxon rank-sum tests with Benjamini-Hochberg correction for multiple testing. Significant differences were found between genotypes Pch4 ++ and \\u003cem\\u003ePch4\\u003c/em\\u003e +- (p = 0.002), \\u003cem\\u003ePch4\\u003c/em\\u003e +- and \\u003cem\\u003ePch4\\u003c/em\\u003e -- (p \\u0026lt; 0.001), and \\u003cem\\u003ePch4\\u003c/em\\u003e ++ and \\u003cem\\u003ePch4\\u003c/em\\u003e -- (p \\u0026lt; 0.001). \\u003cstrong\\u003ed, \\u003c/strong\\u003e\\u003cem\\u003ePch4\\u003c/em\\u003e transgenic\\u003cstrong\\u003e \\u003c/strong\\u003eexpression cassette containing the \\u003cem\\u003eOsAtct1 \\u003c/em\\u003epromoter and 5’UTR, domesticated \\u003cem\\u003ePch4 \\u003c/em\\u003egenomic sequence and 35S\\u003cem\\u003e \\u003c/em\\u003eterminator and 3’UTR (not drawn to scale)\\u003cem\\u003e. \\u003c/em\\u003e\\u003cstrong\\u003ee, \\u003c/strong\\u003eDisease infection assays of T\\u003csub\\u003e2\\u003c/sub\\u003e sister lines show appreciable differences in disease severity depending on the presence or absence of \\u003cem\\u003ePch4. \\u003c/em\\u003e\\u003cstrong\\u003ef, \\u003c/strong\\u003eBar chart of T\\u003csub\\u003e2\\u003c/sub\\u003e sister lines (n = 8), pairwise comparisons were performed using Wilcoxon rank-sum tests with Benjamini-Hochberg correction for multiple testing. Significant differences were found for the comparison between \\u003cem\\u003ePch4 \\u003c/em\\u003econtaining transgenic cultivars (T\\u003csub\\u003e2\\u003c/sub\\u003e-1-\\u003cem\\u003ePch4+\\u003c/em\\u003e, median = 4.5; T\\u003csub\\u003e2\\u003c/sub\\u003e-2-\\u003cem\\u003ePch4+\\u003c/em\\u003e, median = 4) and transgenic nulls lacking \\u003cem\\u003ePch4\\u003c/em\\u003e (T\\u003csub\\u003e2\\u003c/sub\\u003e-3-\\u003cem\\u003ePch4-\\u003c/em\\u003e, median = 9; T\\u003csub\\u003e2\\u003c/sub\\u003e-4\\u003cem\\u003e-Pch4-,\\u003c/em\\u003e median = 9; p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/bdcb851d986311aed8fd2716.png\"},{\"id\":99789505,\"identity\":\"e9804a60-b964-459c-bad3-e9f4b437ba12\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:49:52\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":785627,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePch4\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003ebelongs to the same NLR lineage as \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePm3. \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003ea, \\u003c/strong\\u003ePhylogenetic tree of NLRs extracted from TA1675 and RefPlantNLR. \\u003cstrong\\u003eb\\u003c/strong\\u003e,\\u003cstrong\\u003e \\u003c/strong\\u003eZoom-in of phylogenetic clade containing \\u003cem\\u003ePch4 \\u003c/em\\u003eand \\u003cem\\u003ePm3 \\u003c/em\\u003eorthologs. \\u003cstrong\\u003ec\\u003c/strong\\u003e, Microsynteny plot of orthologous regions in \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, \\u003cem\\u003eT. aestivum, T. monococcum, S. cereale \\u003c/em\\u003eand \\u003cem\\u003eH. vulgare. \\u003c/em\\u003e\\u003cstrong\\u003ed,\\u003c/strong\\u003e MAFFT alignment of the amino acid sequences of \\u003cem\\u003ePch4, TmPm3, Pm3b \\u003c/em\\u003eand \\u003cem\\u003ePm8.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/e7d9aa9e42fa09c6c7142f48.png\"},{\"id\":99374109,\"identity\":\"da991e31-5c6a-4643-a233-4e11fb57c047\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":598187,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGenomics-assisted pyramiding of cloned \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAe. tauschii R\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e genes. \\u003c/strong\\u003ePhylogenetic tree of the \\u003cem\\u003eAe. tauschii \\u003c/em\\u003eL2 diversity panel with black dots representing the predicted presence of a cloned \\u003cem\\u003eR\\u003c/em\\u003e gene within an accession and stars indicating D subgenome donors used to create the NIAB synthetic hexaploids.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/df89ae3997fed678df1b1cf6.png\"},{\"id\":99801724,\"identity\":\"54d49324-b943-43a5-b3a0-0e65de4b6953\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 14:07:22\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5586697,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/439d5903-2871-4219-9002-bfea0e229fb0.pdf\"},{\"id\":99374101,\"identity\":\"8e212b88-e1f9-484b-aa63-acf1e0242e67\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:07\",\"extension\":\"xlsx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":71972,\"visible\":true,\"origin\":\"\",\"legend\":\"Dataset 1\",\"description\":\"\",\"filename\":\"supplementarytables.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/cea7618a7fb402b42654d8c3.xlsx\"},{\"id\":99374114,\"identity\":\"d2cae4f8-4f37-4d20-922a-0ad9e119ff53\",\"added_by\":\"auto\",\"created_at\":\"2026-01-02 07:19:09\",\"extension\":\"pptx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":160184432,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary figures\",\"description\":\"\",\"filename\":\"supplementaryfigures.pptx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8021535/v1/e7a6d4732f1c17f5f70432af.pptx\"}],\"financialInterests\":\"There is \\u003cb\\u003eNO\\u003c/b\\u003e Competing Interest.\",\"formattedTitle\":\"A novel NLR immune receptor from Aegilops tauschii confers resistance to wheat eyespot disease\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eTwo soil-borne pathogens of wheat, \\u003cem\\u003eOculimacula yallundae\\u003c/em\\u003e and \\u003cem\\u003eOculimacula acuformis\\u003c/em\\u003e, cause cereal eyespot, a stem-base disease prevalent in temperate regions\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e. When infected, susceptible wheat varieties can develop moderate to severe stem lesions that disrupt water and nutrient transport, leading to symptoms such as lodging and premature grain ripening, which can cause yield losses of up to 40%\\u003csup\\u003e2,3,4\\u003c/sup\\u003e. The two pathogens differ in fungicide response\\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e and host preference, with \\u003cem\\u003eO. yallundae\\u003c/em\\u003e being more aggressive on wheat than rye while \\u003cem\\u003eO. acuformis\\u003c/em\\u003e exhibits similar aggressiveness on both hosts\\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, wheat landraces and wild relatives are reported to have differential resistance to the two pathogens, suggesting that resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e and \\u003cem\\u003eO. acuformis\\u003c/em\\u003e may have partially independent genetic mechanisms\\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTo date, only a few resistance loci - \\u003cem\\u003ePch1\\u003c/em\\u003e, \\u003cem\\u003ePch2\\u003c/em\\u003e, \\u003cem\\u003ePch3\\u003c/em\\u003e and \\u003cem\\u003eQPch.jic-5A -\\u003c/em\\u003e effective against eyespot have been identified\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. \\u003cem\\u003ePch1\\u003c/em\\u003e, introgressed onto chromosome 7D from the wheat wild relative \\u003cem\\u003eAegilops ventricosa\\u003c/em\\u003e, is effective against both \\u003cem\\u003eOculimacula\\u003c/em\\u003e species and is widely deployed. However, its application has been hindered by linkage drag due to limited recombination within the translocated \\u003cem\\u003eAe. ventricosa\\u003c/em\\u003e segment\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. \\u003cem\\u003ePch2\\u003c/em\\u003e and \\u003cem\\u003eQPch.jic-5A\\u003c/em\\u003e were both identified in the wheat variety Cappelle Desprez. \\u003cem\\u003ePch2\\u003c/em\\u003e was found to provide effective resistance to \\u003cem\\u003eO. acuformis\\u003c/em\\u003e at the seedling stage but a significantly lower resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, while \\u003cem\\u003eQPch.jic-5A\\u003c/em\\u003e conferred resistance to both species at both seedling and adult stages\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. \\u003cem\\u003ePch3\\u003c/em\\u003e, identified on chromosome 4V in \\u003cem\\u003eDasypyrum villosum\\u003c/em\\u003e, is yet to be widely deployed, likely due to the undesirable linkage drag\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. Although the screening of multiple wheat and wild wheat diversity panels has revealed promising variation for eyespot resistance, it has not led to identification and deployment of any additional resistance loci\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eWheat wild relatives are a rich, largely untapped, source of disease resistance (\\u003cem\\u003eR\\u003c/em\\u003e) genes for improving the resilience of bread wheat against biotic threats. Analysis of the reported \\u003cem\\u003eR\\u003c/em\\u003e genes for wheat diseases reveal that over 40% of them have originated from wild species\\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. Among these, \\u003cem\\u003eAegilops tauschii\\u003c/em\\u003e, the progenitor of wheat D subgenome, stands out as a major contributor. Harnessing its genetic diversity has therefore become a key focus in wheat breeding programs. This wild species comprises three distinct genetic lineages - L1, L2 and L3 - with L2 being the primary donor to the wheat D subgenome\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. Of the 24 \\u003cem\\u003eAe. tauschii R\\u003c/em\\u003e genes identified to date that confer resistance to pathogens, 15 have been cloned, all of which confer resistance to foliar diseases (Supplementary Table\\u0026nbsp;1). Although \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e is also reported to harbour resistance against soil-borne pathogens infecting wheat, no \\u003cem\\u003eR\\u003c/em\\u003e genes underlying such resistance have yet been identified\\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigate the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e genetics underlying resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e. We report the cloning of the first \\u003cem\\u003eR\\u003c/em\\u003e gene conferring resistance to wheat eyespot, a nucleotide-binding domain and leucine-rich repeat (NLR) gene, designated \\u003cem\\u003ePch4\\u003c/em\\u003e. We discovered this \\u003cem\\u003eR\\u003c/em\\u003e gene by screening a sequence-configured \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e diversity panel with the pathogen, followed by \\u003cem\\u003ek-\\u003c/em\\u003emer based genome-wide association study (GWAS). We further demonstrate through synthetic hexaploid phenotyping and transgenic overexpression in a susceptible wheat cultivar that this wild wheat \\u003cem\\u003eR\\u003c/em\\u003e gene provides effective resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e in a hexaploid wheat background. With the cloning of the first \\u003cem\\u003eR\\u003c/em\\u003e gene against a soil-borne disease in \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, this work provides a roadmap for further exploration of resistance to soil-borne pathogens of wheat from the D subgenome progenitor.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eAssociation mapping identified eyespot resistance locus on chromosome 1DS\\u003c/p\\u003e \\u003cp\\u003eWe undertook glasshouse-based phenotyping of a diversity panel consisting of 151 \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 lines, using a single isolate of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, 20/848, which was isolated by RAGT Seeds from soil near Cambridge, UK. We adapted an existing phenotyping protocol to screen the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e diversity panel along with wheat control lines across three experimental repeats and developed an \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e specific disease severity scale (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea)\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003ePhenotypic analysis revealed that 32 \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e lines, 21.3% of the diversity panel, exhibited a strong resistance response, out of which 23 lines exhibited greater resistance than the most resistant hexaploid wheat control, \\u003cem\\u003eSkyfall\\u003c/em\\u003e, which carries \\u003cem\\u003ePch1\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). An additional 14 lines were categorized as having an intermediate response. Notably, several wheat control varieties carrying either \\u003cem\\u003ePch1\\u003c/em\\u003e or \\u003cem\\u003ePch2\\u003c/em\\u003e were classified as intermediate or susceptible in this assay indicating that these resistances are not equally effective in all backgrounds (Supplementary Table\\u0026nbsp;2).\\u003c/p\\u003e \\u003cp\\u003eWe conducted \\u003cem\\u003ek\\u003c/em\\u003e-mer based GWAS using the average phenotype scores of the L2 lines which were sequenced in a previous study\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e, except those with intermediate phenotype, and mapped the significantly associated \\u003cem\\u003ek\\u003c/em\\u003e-mers to the reference assembly of TA1675\\u003csup\\u003e23\\u003c/sup\\u003e. This mapping revealed a significantly associated peak of 0.7 Mb on chromosome 1DS spanning a region of 6.23 Mb to 6.93 Mb within which there were 12 annotated genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec-d, Supplementary Table\\u0026nbsp;3). Out of these genes, the most significantly associated \\u003cem\\u003ek\\u003c/em\\u003e-mers mapped to \\u003cb\\u003eAet.TA1675.r1.1D001090\\u003c/b\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed), which belongs to the NLR gene family typically associated with disease resistance in plants. There was only one other NLR gene in the associated interval, \\u003cb\\u003eAet.TA1675.r1.1D001100\\u003c/b\\u003e, which is located next to \\u003cb\\u003eAet.TA1675.r1.1D001090\\u003c/b\\u003e at a genomic distance of around 68 kb. We considered both these NLRs as potential candidates underlying the identified eyespot resistance.\\u003c/p\\u003e \\u003cp\\u003eComparison of the two NLR genes showed they shared 82.9% nucleotide identity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea) and 77.7% pairwise amino acid identity (Supplementary Fig.\\u0026nbsp;1). We checked for the presence of both the NLRs across the L2 diversity panel using BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Despite their physical proximity, the two genes are not perfectly linked and show differential correlation with the phenotype (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb-d). \\u003cb\\u003eAet.TA1675.r1.1D001090\\u003c/b\\u003e was present in 29 of 32 lines scored as resistant along with six intermediate lines and three susceptible lines, while \\u003cb\\u003eAet.TA1675.r1.1D001100\\u003c/b\\u003e was present in only 16 resistant, seven intermediate and nine susceptible lines, therefore, exhibiting a significantly weaker association with resistance (Supplementary Table\\u0026nbsp;4). Therefore, we focused on \\u003cb\\u003eAet.TA1675.r1.1D001090\\u003c/b\\u003e as the primary candidate gene for the identified eyespot resistance, hereby designated as \\u003cem\\u003ePch4\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eBased on the RNA-seq mapping to the annotated reference assembly of TA1675 and using InterPro\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e, the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate was ascertained to encode a 1447 amino acid sequence across two exons, with defined coiled-coil (CC), nucleotide-binding (NB), and leucine-rich repeat (LRR) domains (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ee). The alternate allele in the susceptible line AL8/78, annotated as \\u003cb\\u003eAET1Gv20020600\\u003c/b\\u003e, was found to differ significantly from the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate, with the two alleles sharing only 85% amino acid identity (Supplementary Fig.\\u0026nbsp;2).\\u003c/p\\u003e \\u003cp\\u003eWe assessed the broader effectiveness of \\u003cem\\u003ePch4\\u003c/em\\u003e resistance using historical data, where a single isolate of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, P84-8, was used to phenotype a diversity collection of \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e lines\\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e. Out of 78 \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 lines shared with our diversity panel, 18 were ascertained to carry \\u003cem\\u003ePch4\\u003c/em\\u003e based on the sequencing data, and all of them but one were reported to be resistant, indicating the potential effectiveness of \\u003cem\\u003ePch4\\u003c/em\\u003e against P84-8 (Supplementary Fig.\\u0026nbsp;3, Supplementary Table\\u0026nbsp;5). We also checked the presence of the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate in 117 diverse \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L1 lines using BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e and found four that carry the allele (Supplementary Fig.\\u0026nbsp;4a). L1 lines were screened with a single isolate of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, 16/847, and all four L1 lines ascertained to carry \\u003cem\\u003ePch4\\u003c/em\\u003e exhibited a strong resistance response (Supplementary Fig.\\u0026nbsp;4b, Supplementary Table\\u0026nbsp;6).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eValidation and characterisation of \\u003cem\\u003ePch4\\u003c/em\\u003e in hexaploid wheat and \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo assess the potential relevance of \\u003cem\\u003ePch4\\u003c/em\\u003e for wheat breeding programs, we first examined its allelic variation within the Watkins collection, a recently published diversity panel of wheat landraces sequenced using resistance gene enrichment sequencing\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e. A BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e search across 300 lines of this collection failed to identify any wheat lines carrying the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate allele, suggesting that this allele was likely not introduced into hexaploid wheat during the hybridisation of \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e with tetraploid wheat.\\u003c/p\\u003e \\u003cp\\u003eNext, we ascertained the presence of \\u003cem\\u003ePch4\\u003c/em\\u003e in synthetic hexaploid wheat (SHW) lines previously generated through direct hybridisation of \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e D subgenome donors with tetraploid wheat\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e (Supplementary Table\\u0026nbsp;7). We selected two contrasting lines for evaluation, both sharing a highly susceptible tetraploid donor, Hoh-506. The D subgenome donor of SHW-070 was a resistant \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accession carrying the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate allele, while that of SHW-042 was a susceptible \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accession carrying an alternate allele. To compare the effectiveness of \\u003cem\\u003ePch4\\u003c/em\\u003e relative to other known eyespot resistances, we phenotyped the SHWs alongside wheat varieties carrying either \\u003cem\\u003ePch1\\u003c/em\\u003e (VPM1) or a combination of \\u003cem\\u003ePch2\\u003c/em\\u003e and \\u003cem\\u003eQPch.jic-5A\\u003c/em\\u003e (Cappelle Desprez) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea, Supplementary Table\\u0026nbsp;8). Phenotyping using a mixed inoculum of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e demonstrated that \\u003cem\\u003ePch4\\u003c/em\\u003e conferred equally effective resistance in hexaploid wheat as in diploid \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e. The degree of resistance provided by \\u003cem\\u003ePch4\\u003c/em\\u003e was comparable to that of \\u003cem\\u003ePch1\\u003c/em\\u003e and significantly greater than the resistance conferred by the combined \\u003cem\\u003ePch2\\u003c/em\\u003e and \\u003cem\\u003eQPch.jic-5A\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb, Supplementary Table\\u0026nbsp;9).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo determine the inheritance pattern of \\u003cem\\u003ePch4\\u003c/em\\u003e, a biparental \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e F\\u003csub\\u003e2\\u003c/sub\\u003e population was generated by crossing the resistant line BW_01185, carrying \\u003cem\\u003ePch4\\u003c/em\\u003e, with the susceptible line BW_01086 that contains an alternate allele. Four F\\u003csub\\u003e1\\u003c/sub\\u003e plants were advanced to F\\u003csub\\u003e2\\u003c/sub\\u003e, generating a total of 164 F\\u003csub\\u003e2\\u003c/sub\\u003e seedlings, which were phenotyped in a growth cabinet bioassay using a mixed isolate inoculum of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e. Phenotypic data, and genotypic screening of recombinants using KASP markers designed to distinguish between parental alleles (Supplementary Tables\\u0026nbsp;10 and 11), suggested that resistance is inherited in a dominant manner. Heterozygotes exhibited significantly reduced disease severity compared to the susceptible parent, however, the homozygotes displayed a significantly higher degree of resistance compared to both heterozygotes and homozygotes with the BW_01086 \\u003cem\\u003ePch4\\u003c/em\\u003e allele, indicating a dosage dependent or incomplete dominance effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec). To further validate the dosage dependent effect, we tested our homoeolog-specific KASP marker in a SHW backcross (SHWBC) population, NIAB-SHW-BC-219, which was generated by crossing the \\u003cem\\u003ePch4\\u003c/em\\u003e carrying SHW-069 with the susceptible wheat variety Robigus\\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. The response of the SHWBC population to pathogen infection confirmed a dosage effect for \\u003cem\\u003ePch4\\u003c/em\\u003e, with homozygotes exhibiting significantly greater resistance than heterozygotes (Supplementary Fig.\\u0026nbsp;5, Supplementary Table\\u0026nbsp;12).\\u003c/p\\u003e \\u003cp\\u003eTo validate the function of the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate, we cloned its genomic sequence for stable transgenic expression in the susceptible wheat line Chinese Spring (CS) and placed it in a construct under the control of a rice actin promoter (\\u003cem\\u003eOsActin1\\u003c/em\\u003e) and a 35S terminator (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed). We obtained two positive independent T\\u003csub\\u003e0\\u003c/sub\\u003e lines carrying \\u003cem\\u003ePch4\\u003c/em\\u003e, which were advanced to T\\u003csub\\u003e2\\u003c/sub\\u003e for phenotyping. We designed a homoeologue specific KASP marker (Supplementary Table\\u0026nbsp;10) to develop sister lines from the same T\\u003csub\\u003e0\\u003c/sub\\u003e transgenic that were positive or negative for the presence of \\u003cem\\u003ePch4\\u003c/em\\u003e. Chinese Spring is highly susceptible to eyespot and therefore any reduction in phenotype score could be attributed to the presence of the transgene. Infection of T\\u003csub\\u003e2\\u003c/sub\\u003e plants using a mixed inoculum of \\u003cem\\u003eO. yallundae\\u003c/em\\u003e revealed that the lines containing the transgene were significantly more resistant to eyespot compared to zero copy plants (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee-f). To test whether \\u003cem\\u003ePch4\\u003c/em\\u003e confers species-specific resistance, we infected plants from the T\\u003csub\\u003e2\\u003c/sub\\u003e sister lines with a mixed inoculum of \\u003cem\\u003eO. acuformis\\u003c/em\\u003e. Both control and \\u003cem\\u003ePch4\\u003c/em\\u003e positive lines exhibited a highly susceptible response, showing that \\u003cem\\u003ePch4\\u003c/em\\u003e confers species-specific resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e (Supplementary Table\\u0026nbsp;13).\\u003c/p\\u003e \\u003cp\\u003eA browning of the coleoptile was frequently observed in the resistant \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, SHW and transgenic plants, likely reflecting a phenolic response to pathogen infection. To further validate that our visual phenotyping, based on pathogen penetration and stem lesion development through the successive plant tissue layers, accurately reflected pathogen infection, we employed fluorescence microscopy. Wheat Germ Agglutinin Alexa Fluor\\u0026reg; 488 conjugate (WGA-AF-488) was used to visualize the fungal chitin upon excitation, enabling the detection of the pathogen within infected stem tissue. This analysis confirmed clear fungal presence in susceptible \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e and wheat genotypes, while resistant genotypes had little to no detectable pathogen presence (Supplementary Fig.\\u0026nbsp;6).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003ePhylogenetic and syntenic analysis suggests an evolutionary link between \\u003cem\\u003ePch4\\u003c/em\\u003e and \\u003cem\\u003ePm3\\u003c/em\\u003e, a powdery mildew resistance gene\\u003c/p\\u003e \\u003cp\\u003eTo explore the evolutionary relationship between \\u003cem\\u003ePch4\\u003c/em\\u003e and other known NLR genes, we used RefPlantNLR and the NLRtracker pipeline to compare \\u003cem\\u003ePch4\\u003c/em\\u003e and all NLRs within the reference genome assembly TA1675 with an experimentally validated NLR dataset\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e. \\u003cem\\u003ePch4\\u003c/em\\u003e and several closely linked genes were observed to cluster with the \\u003cem\\u003ePm3\\u003c/em\\u003e allelic series and its orthologs \\u003cem\\u003ePm8\\u003c/em\\u003e and \\u003cem\\u003eTmPm3\\u003c/em\\u003e from rye (\\u003cem\\u003eSecale cereale\\u003c/em\\u003e) and \\u003cem\\u003eTriticum monoccocum\\u003c/em\\u003e, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea-b). These genes convey resistance to the foliar disease powdery mildew (\\u003cem\\u003eBlumeria graminis f. sp. Tritici\\u003c/em\\u003e) and notably, are all located on the short arm of chromosome 1 in their respective species\\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e. We therefore investigated the synteny of this locus across multiple grass species. We extracted a 4.64 Mb region surrounding \\u003cem\\u003ePch4\\u003c/em\\u003e from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accession TA1675 and aligned it to the reference genomes of wheat (\\u003cem\\u003eTriticum aestivum\\u003c/em\\u003e), rye (\\u003cem\\u003eS\\u003c/em\\u003e. \\u003cem\\u003ecereale\\u003c/em\\u003e), \\u003cem\\u003eT. monococcum\\u003c/em\\u003e and barley (\\u003cem\\u003eHordeum vulgare\\u003c/em\\u003e), which indicated broad conservation of the locus across species (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec). \\u003cem\\u003ePch4\\u003c/em\\u003e shares homology with several \\u003cem\\u003ePm3\\u003c/em\\u003e orthologs, with pairwise amino acid identities of 73.6%, 77.5% and 78% with \\u003cem\\u003eTmPm3\\u003c/em\\u003e, \\u003cem\\u003ePm8\\u003c/em\\u003e and \\u003cem\\u003ePm3b\\u003c/em\\u003e respectively suggesting a shared ancestral origin (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed). The expansion and diversification of \\u003cem\\u003ePm3\\u003c/em\\u003e orthologs across these genomes may have contributed to neofunctionalization as indicated by the distinct disease resistance functions of \\u003cem\\u003ePm3\\u003c/em\\u003e and \\u003cem\\u003ePch4\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eGenomics-assisted selection of pre-breeding germplasm for \\u003cem\\u003eR\\u003c/em\\u003e gene pyramiding\\u003c/p\\u003e \\u003cp\\u003eWe compiled a list of all currently cloned \\u003cem\\u003eR\\u003c/em\\u003e genes derived from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2, encompassing 14 resistance genes against foliar pathogens and one (\\u003cem\\u003eCmc4\\u003c/em\\u003e) conferring pest resistance. Using sequencing data for the L2 diversity panel, we predicted the presence of these \\u003cem\\u003eR\\u003c/em\\u003e genes, alongside \\u003cem\\u003ePch4\\u003c/em\\u003e, across accessions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). Notably, \\u003cem\\u003ePch4\\u003c/em\\u003e was predicted in 48 \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accessions, including four previously utilized as D subgenome donors in SHW lines.\\u003c/p\\u003e \\u003cp\\u003eThis resource will enable an informed selection of germplasm for the development of pre-breeding material enriched with resistance to multiple diseases, facilitating efficient introgression into elite wheat cultivars. For instance, SHW-143, derived from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accession BW_01140, harbours seven cloned \\u003cem\\u003eR\\u003c/em\\u003e genes conferring resistance to six diseases: \\u003cem\\u003ePch4, Stb16q, Rwt4, WTK4, Sr46, Sr66\\u003c/em\\u003e and \\u003cem\\u003eYr28.\\u003c/em\\u003e The deployment of this SHW in breeding pipelines presents a valuable opportunity to introduce a suite of agronomically important \\u003cem\\u003eR\\u003c/em\\u003e genes in a single breeding cycle.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eEyespot is an economically important stem-base disease of wheat caused by two closely related soil-borne fungal pathogens, \\u003cem\\u003eO. yallundae\\u003c/em\\u003e and \\u003cem\\u003eO. acuformis\\u003c/em\\u003e\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. Most commercial wheat cultivars exhibit only partial resistance, typically attributed to the \\u003cem\\u003ePch2\\u003c/em\\u003e locus, which provides moderate resistance against both species but is more effective against \\u003cem\\u003eO. acuformis\\u003c/em\\u003e\\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. Other known resistance sources include \\u003cem\\u003ePch1\\u003c/em\\u003e, introgressed from \\u003cem\\u003eAe. ventricosa\\u003c/em\\u003e, and a QTL on chromosome 5A; however, both suffer from undesirable linkage drag that complicates their use in breeding\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. The lack of cloned eyespot resistance genes has limited precision breeding efforts, leaving elite germplasm particularly vulnerable to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eWild relatives of wheat, especially \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, have proven to be a rich reservoir of \\u003cem\\u003eR\\u003c/em\\u003e genes, particularly against foliar pathogens such as rusts, powdery mildew and blast\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. Many of these genes have been cloned using \\u003cem\\u003ek\\u003c/em\\u003e\\u003cb\\u003e-\\u003c/b\\u003emer GWAS, an approach that leverages multiple reference genomes to identify presence/absence variants and structural polymorphisms not captured in single-reference analyses\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. This strategy has proven particularly effective in highly diverse wild plant species, enabling identification and refinement of resistance-associated haplotypes even when structural variation complicates alignment to reference genomes. Despite its success for the study of foliar diseases, \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e has remained underexplored for resistance to soil-borne diseases, including eyespot.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we identified \\u003cem\\u003ePch4\\u003c/em\\u003e, a novel NLR gene from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, as a major source of resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e. To our knowledge, \\u003cem\\u003ePch4\\u003c/em\\u003e represents the first cloned major \\u003cem\\u003eR\\u003c/em\\u003e gene for eyespot resistance in cereals. Using \\u003cem\\u003ek-\\u003c/em\\u003emer GWAS on the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 diversity panel, resistance was associated with a haplotype on chromosome 1DS containing two adjacent NLR genes. Of these, one showed a stronger correlation with the identified eyespot resistance, designated \\u003cem\\u003ePch4\\u003c/em\\u003e, and was investigated as the primary candidate. Transgenic expression of the \\u003cem\\u003ePch4\\u003c/em\\u003e candidate in the susceptible cultivar Chinese Spring confirmed that the gene confers robust, dominant resistance to \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, with a dosage-dependent effect observed in segregating populations.\\u003c/p\\u003e \\u003cp\\u003eOur phylogenetic analysis revealed that \\u003cem\\u003ePch4\\u003c/em\\u003e clusters with the well-characterized allelic series of powdery mildew resistance genes \\u0026ndash; \\u003cem\\u003ePm3\\u003c/em\\u003e (wheat), \\u003cem\\u003ePm8\\u003c/em\\u003e (rye), and \\u003cem\\u003eTmPm3\\u003c/em\\u003e (\\u003cem\\u003eTriticum monococcum\\u003c/em\\u003e) \\u0026ndash; all of which reside on the short arm of chromosome 1 in their respective species\\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e. Synteny analysis supports a shared ancestral origin of \\u003cem\\u003ePch4\\u003c/em\\u003e and \\u003cem\\u003ePm3\\u003c/em\\u003e alleles, which is particularly interesting since \\u003cem\\u003eB. graminis\\u003c/em\\u003e is an obligate oomycete pathogen while \\u003cem\\u003eO. yallundae\\u003c/em\\u003e is facultative fungal pathogen with an extended viability in soils in the absence of living host tissue. Therefore, the evolutionary relationship of \\u003cem\\u003ePch4\\u003c/em\\u003e and \\u003cem\\u003ePm3\\u003c/em\\u003e alleles suggests that diversification of NLR gene families can yield resistance against ecologically and phylogenetically distinct pathogens.\\u003c/p\\u003e \\u003cp\\u003eA persistent challenge in deploying resistance from wild relatives is linkage drag, as well as regulatory hurdles associated with transgenic approaches in wheat\\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, \\u003cem\\u003ePch4\\u003c/em\\u003e was absent from a global panel of bread wheat landraces, indicating that this allele was not captured during wheat domestication and polyploidization, and underscoring the narrow genetic base of modern wheat\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. Synthetic hexaploid wheats (SHWs), generated by crossing durum wheat with diverse \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accessions, provide a practical bridge for introducing such novel genes into breeding programs\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. Genomic analysis of SHWs revealed that several lines carry \\u003cem\\u003ePch4\\u003c/em\\u003e, as well as multiple additional cloned \\u003cem\\u003eR\\u003c/em\\u003e genes from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e, offering the potential for natural stacking of resistance loci. The increasing use of \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e SHW in wheat breeding programs raises the tantalising possibility that this gene may already exist in elite backgrounds, free from undesirable linkage drag\\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eAlthough \\u003cem\\u003ePch4\\u003c/em\\u003e accounts for most observed resistance to eyespot in \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2, subsets of resistant accessions in both L1 and L2 lack the gene, suggesting additional unexplored resistance sources. These may be revealed through complementary approaches such as positional cloning, mutational genomics, or GWAS analyses on an expanded diversity panel. Moreover, while \\u003cem\\u003ePch4\\u003c/em\\u003e specifically protects against \\u003cem\\u003eO. yallundae\\u003c/em\\u003e, the potential for \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e to harbour resistance against \\u003cem\\u003eO. acuformis\\u003c/em\\u003e or other soil-borne pathogens remains unexplored and warrants further investigation.\\u003c/p\\u003e \\u003cp\\u003eTogether, our results provide the first genetic insight into eyespot resistance from \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e and establish \\u003cem\\u003ePch4\\u003c/em\\u003e as a deployable \\u003cem\\u003eR\\u003c/em\\u003e gene for wheat breeding. The cloning of \\u003cem\\u003ePch4\\u003c/em\\u003e expands the limited arsenal of soil-borne resistance genes in cereals and highlights the evolutionary flexibility of NLR clusters in \\u003cem\\u003eTriticeae\\u003c/em\\u003e. Looking forward, future work should focus on: (1) elucidating the molecular mechanism of \\u003cem\\u003ePch4\\u003c/em\\u003e-mediated recognition, (2) compare the structures of effectors from \\u003cem\\u003eO. yallundae\\u003c/em\\u003e and \\u003cem\\u003eB. graminis\\u003c/em\\u003e interacting with \\u003cem\\u003ePch4\\u003c/em\\u003e and \\u003cem\\u003ePm3\\u003c/em\\u003e alleles, respectively, to understand how this NLR gene family evolved to recognise distinct pathogens (3) surveying \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e for additional soil-borne disease resistance genes, and (4) strategically combining \\u003cem\\u003ePch4\\u003c/em\\u003e with other \\u003cem\\u003eR\\u003c/em\\u003e genes to enhance durability. These findings emphasize the untapped potential of wild relatives in safeguarding global wheat production.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003ePlant materials\\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e diversity panel germplasm and synthetic hexaploid wheat lines used in this study have previously been described and published\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. The \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e F\\u003csub\\u003e2\\u003c/sub\\u003e population was created by crossing accession BW_01185 with BW_01086 and advancing four F\\u003csub\\u003e1\\u003c/sub\\u003e progeny seed to F\\u003csub\\u003e2\\u003c/sub\\u003e. Experimental control wheat cultivars with varying responses to eyespot were obtained from the John Innes Centre and RAGT. The \\u003cem\\u003eCS-Pch4\\u003c/em\\u003e transgenic lines and all other germplasm used are detailed in Supplementary Table\\u0026nbsp;14.\\u003c/p\\u003e \\u003cp\\u003eV8 agar plate preparation for the eyespot pathogens\\u003c/p\\u003e \\u003cp\\u003eTo prepare 1 L of V8 agar, 200 ml of V8 juice (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.amazon.co.uk/V8-Vegetable-Juice-Original-1L/dp/B016OW5KZC\\u003c/span\\u003e\\u003cspan address=\\\"https://www.amazon.co.uk/V8-Vegetable-Juice-Original-1L/dp/B016OW5KZC\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), was combined with 800 ml sterile water and 15 g of agar. Solutions were autoclaved and allowed to cool sufficiently for handling, before dispensing into agar plates under sterile conditions.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eO. yallundae\\u003c/em\\u003e and \\u003cem\\u003eO. acuformis\\u003c/em\\u003e isolate collection and cultivation\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eO. yallundae\\u003c/em\\u003e isolate 20/848 was obtained from RAGT. This isolate was used for glasshouse phenotyping via dead oat inoculation. In brief, sterilised dead oats were inoculated with mycelium of isolate 20/848 and left to grow for several weeks until the mycelia were well developed. Oats were occasionally broken up by hand to increase inoculum mixing and speed up colonisation. Once visible mycelia could be seen ubiquitously throughout, the inoculum mix was ready for use. All other \\u003cem\\u003eOculimacula\\u003c/em\\u003e isolates were available at JIC (Supplementary Table\\u0026nbsp;15). For growth room phenotyping, frozen agar mycelial stubs for all isolates were grown on V8 agar plates in the dark at 25\\u0026deg;C for several weeks to bulk mycelia. If further inoculum was required, new plates were prepared using freshly cut mycelial stubs.\\u003c/p\\u003e \\u003cp\\u003eIsolates were subject to quality control via ITS sequencing, with a maximum likelihood phylogenetic tree built using PhyML 3.0\\u003csup\\u003e37\\u003c/sup\\u003e (500 bootstraps) to confirm that the correct species were used in this study (Supplementary Fig.\\u0026nbsp;7). To extract DNA, cultures were grown from a single mycelium plug in 10 ml of Potato Dextrose Broth (Formedium, UK). After 7 days, cultures were centrifuged, the supernatant removed, and ~\\u0026thinsp;250 mg of mycelial pellet was crushed in liquid nitrogen with pestle and mortar or with glass beads in a TissueLyser II (Qiagen, Germany). The disrupted tissue was then integrated into the workflow for the soil gDNA extraction kit, DNeasy\\u0026reg; PowerSoil\\u0026reg; Pro (Qiagen, Germany), following the manufacturer\\u0026rsquo;s instructions. DNA quality and concentration were evaluated by Nanodrop and Qubit. ITS sequencing via PCR was carried out using primers TCCTCCGCTTATTGATATGC and GGAAGTAAAAGTCGTAACAAGG, with PCR products purified using the Machery-Nagel NucleoSpin kit (ID: 740609.50)\\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. ITS sequences were sequenced using Sanger sequencing by Eurofins.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e eyespot disease scale development\\u003c/p\\u003e \\u003cp\\u003eDisease scoring utilised a modified version of an existing protocol\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e. For each biological replicate, the plant was uprooted, and cleaned to remove as much soil as possible, then given a disease severity score based upon the layers of sheath infected or penetrated; 0\\u0026thinsp;=\\u0026thinsp;no infection detected, 1\\u0026thinsp;=\\u0026thinsp;coleoptile infected, 2\\u0026thinsp;=\\u0026thinsp;coleoptile penetrated, 3\\u0026thinsp;=\\u0026thinsp;first sheath infected, etc. A score of 9 was determined to be the highest using this scale as plants observed with this level of disease represented near total infection of the entire stem, with individual layers of plant sheath nearly impossible to identify due to the deteriorated state of the diseased tissue.\\u003c/p\\u003e \\u003cp\\u003eGlasshouse phenotyping\\u003c/p\\u003e \\u003cp\\u003eDisease responses were assessed for the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 diversity panel via a seedling bioassay in unheated, unlit, glasshouses in Cambridge from November 2022 to February 2023. Four seeds of each accession in addition to control wheat varieties were sown in three replicated trials by placing seed in rows atop compost. Seeds were inoculated with \\u003cem\\u003eO. yallundae\\u003c/em\\u003e isolate 20/848 by applying a mixture of infected dead oats through which seedlings would grow, using an established method\\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e. Plants were regularly watered to ensure a moist damp environment optimal for pathogen infection, with the plants deemed ready for phenotyping once the susceptible control wheat lines had reached a phenotype score of 9. Each plant was individually uprooted and washed to remove residual soil before phenotypic assessment.\\u003c/p\\u003e \\u003cp\\u003eGrowth room phenotyping\\u003c/p\\u003e \\u003cp\\u003eControlled environment rooms were used for all other phenotyping assays, including the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L1 diversity panel, SHW and transgenic lines. Plants were grown at 10\\u0026deg;C under a 10h day / 14h night cycle in JIC cereal mix and inoculated using an established method\\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. Briefly, seeds were sown in 96 well trays of JIC cereal mix, watered and allowed to germinate. At about 5\\u0026ndash;7 days of growth, ~\\u0026thinsp;1-inch-long PVC cylinders were placed over emerging plant shoots and slightly embedded in the soil to maintain their upright position. Once plants had reached a two-leaf growth stage, typically two weeks post seedling emergence, plants were individually inoculated with \\u003cem\\u003eO. yallundae\\u003c/em\\u003e or \\u003cem\\u003eO. acuformis\\u003c/em\\u003e via a pathogen containing agar slurry. This agar slurry was prepared using colonies of \\u003cem\\u003eOculimacula\\u003c/em\\u003e species grown on V8 media agar plates that were homogenised with water in a 2:1 ratio using a hand blender. A sterile syringe was used to fill the PVC cylinder surrounding each seedling until the entire stem base was in contact with the pathogen. Plants were watered thoroughly from the bottom of the tray and covered for the first 48 hours to increase humidity before being left to grow at 10\\u0026deg;C under a 10h day / 14h night light cycle for 10 weeks, with scoring date determined by the level of disease severity in the susceptible wheat control line, Chinese Spring.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ek-\\u003c/em\\u003emer based GWAS\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ek\\u003c/em\\u003e-mer based GWAS was performed based on an established method\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e using the reference genome assembly TA1675\\u003csup\\u003e23\\u003c/sup\\u003e. For isolate 20/848 the phenotypic scores of each accession in the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 diversity panel were averaged across the three replicated trials and inverted so that a lower value represents a more susceptible accession. Values deemed intermediate (between \\u0026minus;\\u0026thinsp;5.51 and \\u0026minus;\\u0026thinsp;7.5) were removed to produce a dataset of clearly susceptible and clearly resistant accessions. A negative log \\u003cem\\u003ep-\\u003c/em\\u003evalue significance threshold of 9.3, estimated previously\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e, was applied.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ePch4\\u003c/em\\u003e Kompetitive Allele-specific PCR markers development\\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003ePch4\\u003c/em\\u003e nucleotide sequence of resistant and susceptible alleles in lines BW_01185 and BW_01086 was aligned in Geneious to identify regions suitable for the design of KASP markers capable of differentiating between them. The markers were used to genotype the BW_01185 x BW_01086 F\\u003csub\\u003e2\\u003c/sub\\u003e population. To create markers capable of differentiating the alleles in a hexaploid wheat background, \\u003cem\\u003ePch4\\u003c/em\\u003e was aligned to the wheat assembly Robigus, (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://ensembl.gramene.org/Triticum_aestivum_robigus/Info/Index\\u003c/span\\u003e\\u003cspan address=\\\"https://ensembl.gramene.org/Triticum_aestivum_robigus/Info/Index\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) using BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e to extract the A, B and D genome homoeologs. Alignment of these nucleotide sequences identified a region suitable to create KASP markers where both the common and differentiating markers were specific to the D genome. The homoeolog specific markers were validated using a SHW-BC F\\u003csub\\u003e5\\u003c/sub\\u003e population, NIAB-SHW-BC-219 (SHW-069 x Robigus). All KASP assays were set up using PACE\\u0026reg; genotyping master mix, according to the manufacturer\\u0026rsquo;s instructions (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://3crbio.com/products/\\u003c/span\\u003e\\u003cspan address=\\\"https://3crbio.com/products/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), and run using a standard touchdown PCR programme; 94\\u0026deg;C for 15 minutes, 94\\u0026deg;C for 20 seconds, 65\\u0026deg;C for 1 minute (repeated x10, with temperature decreasing by 0.8\\u0026deg;C each cycle to 57\\u0026deg;C), 94\\u0026deg;C for 20 seconds followed by 57\\u0026deg;C for 1 minute (repeated x35). Additional cycles were added as required to achieve maximum separation between different genotypes. Plates were read using a PHERAstar microplate and analysed using KlusterCaller software.\\u003c/p\\u003e \\u003cp\\u003eFungal infection microscopy\\u003c/p\\u003e \\u003cp\\u003eThe fungal chitin visualisation technique was adapted from an existing protocol\\u003csup\\u003e\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e. Tissue from the hypocotyl region of each plant was cut into lengths of ~\\u0026thinsp;5 mm length and embedded in 1.5 ml Eppendorf tubes filled with 7% low melting point agarose and set at 4\\u0026deg;C for 2\\u0026ndash;4 hours. Embedded samples were sectioned using a VT1000 vibratome to a thickness of 200 \\u0026micro;m and transferred onto microscope slides using forceps and cotton-buds. To visualise fungal chitin, samples were stained with Invitrogen Wheat Germ Agglutinin Alexa Fluor\\u0026reg; 488 conjugate (WGA-AF-488) (50 mg/mL) for 20 minutes. Stained sections were washed twice with PBS to minimise background staining. Microscopic analysis was performed on a Zeiss Axio Zoom V16 microscope with a 1.0x/0.25 air objective. Using the Spectra 3 Light Engine, a cyan laser at 100% intensity was filtered through a 38 HE GFP (Alexa 488/GFP) filter block. To obtain higher contrast images, a ZEISS Apotome 3 was utilized for optical sectioning in GFP channels. Image acquisition and processing was performed with the Zeiss ZenBlue microscopy software (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.zeiss.com\\u003c/a\\u003e\\u003c/span\\u003e\\u003cspan address=\\\"http://www.zeiss.com\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) through both monochrome and colour cameras with an exposure time of 200 ms.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ePch4\\u003c/em\\u003e gene cloning, domestication and transformation\\u003c/p\\u003e \\u003cp\\u003eFresh genomic DNA of \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e accession BW_01016 was extracted from young leaf tissue using the Qiagen Plant DNeasy minikit (ID: 69104). The publicly available genome annotation for the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e reference assembly TA1675 was used to predict the start and stop codon for \\u003cem\\u003ePch4\\u003c/em\\u003e, and the primers ES_GG_F and ES_GG_R (Supplementary Table\\u0026nbsp;10) were designed 1kb up and downstream of the gene start and stop codons, respectively. Phusion polymerase (New England Biolabs (NEB), ID: M0530S) was used to amplify the target product using standard PCR amplified as per the manufacturer\\u0026rsquo;s instructions (Tm60, 35x cycles). Briefly, a 100\\u0026micro; reaction was set up using DNA from BW_01016 as the template and amplified as per manufacturer\\u0026rsquo;s instructions. The PCR product size was confirmed using a 1% agarose and ethidium bromide gel to confirm the target band size under UV light, before the product was excised and cleaned using a Machery-Nagel NucleoSpin kit (ID: 740609.50) A poly-A overhang was introduced onto the 3\\u0026rsquo; ends of the linear PCR product using Q5\\u0026reg; High-Fidelity DNA Polymerase (Neb, ID: M0491S) before ligation into a pGEM\\u0026reg;-T Easy Vector (Promega), according to the manufacturer\\u0026rsquo;s instructions. The ligated vector was transformed into JM109 competent cells (Promega) using heat shock and screened via blue-white selection for successful transformants. A colony PCR was used to confirm the presence of the genomic \\u003cem\\u003ePch4\\u003c/em\\u003e sequence in a colony using primer pair ES_GG_F and ES_GG_R, and correctly cloned transformants confirmed using nanopore sequencing from Plasmidsaurus (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.plasmidsaurus.com\\u003c/span\\u003e\\u003cspan address=\\\"https://www.plasmidsaurus.com\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eTo produce a gene construct amenable to golden gate assembly, four BpiI and one BsaI enzyme cut sites were domesticated by taking advantage of redundancies in the genetic code. In short, a suite of primers (ES_dom_1_F to ES_dom_12_R, Supplementary Table\\u0026nbsp;10) with overhanging Bpil sites that enabled one directional seamless ligations was used to amplify five individual PCR products with single bp changes in the primer sequences that targeted each enzyme cut site. The pGEM-\\u003cem\\u003ePch4\\u003c/em\\u003e plasmid was used as the template for fragment amplification, using the same PCR conditions as above. All DNA fragments were confirmed by visualisation on an agarose gel before gel excision and product clean up using the NucleoSpin kit. Fragments were assembled via Bpil golden gate assembly\\u003csup\\u003e\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e directly into a level 0 vector pICH41308 (Addgene #47998). Successful domestication was confirmed via Plasmidsaurus whole plasmid sequencing. The golden gate assembly protocol was followed using restriction enzyme Bsal to combine a Rice actin 1 promotor with 5\\u0026rsquo; UTR (OsAct1) pICSL12014 (Addgene #125882), the \\u003cem\\u003ePch4\\u003c/em\\u003e gDNA, and a 35S terminator with 3\\u0026rsquo; UTR pICH41414 (Addgene # 50337), into a level 1 position 3 vector (L1P3) pICH47822 (Addgene #48009).\\u003c/p\\u003e \\u003cp\\u003eThe L1P3 \\u003cem\\u003ePch4\\u003c/em\\u003e plasmid was transferred to the JIC wheat transformation team, where it was assembled along with the Level 1 hygromycin selectable marker gene (Addgene # 165423) into the wheat transformation binary vector pGoldenGreenGate-M (pGGG-M) (Addgene # 165422) as previously described\\u003csup\\u003e\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u003c/sup\\u003e. Wheat transformation was carried out following an established method\\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e, resulting in two successful transformed T\\u003csub\\u003e0\\u003c/sub\\u003e plants with either one or six copies of the \\u003cem\\u003ePch4\\u003c/em\\u003e transgene. Transformants and null controls were advanced to T\\u003csub\\u003e1\\u003c/sub\\u003e and T\\u003csub\\u003e2\\u003c/sub\\u003e for phenotyping. Gene copy number quantification was performed for the T\\u003csub\\u003e0\\u003c/sub\\u003e and T\\u003csub\\u003e1\\u003c/sub\\u003e plants by the JIC in house genotyping platform, using the hygromycin resistance gene that is introduced into wheat as a selectable marker alongside \\u003cem\\u003ePch4\\u003c/em\\u003e for qRT-PCR and the previously outlined methodology\\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eNLR phylogenetics\\u003c/p\\u003e \\u003cp\\u003eNLR genes and their corresponding NBARC domains from the \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e reference genome TA1675 were identified using NLR-Annotator\\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. These sequences were concatenated with those from the RefPlantNLR dataset\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e and aligned using Clustal Omega\\u003csup\\u003e\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e. Phylogenetic inference was performed with RAxML v8.2.12\\u003csup\\u003e48\\u003c/sup\\u003e using the Maximum Likelihood method under the JTT substitution model (command: raxmlHPC-PTHREADS-AVX2 -T 10 -s Pch4_clustal_allignment_070124.phy -n RefPlantNLR -m PROTGAMMAAUTO -f a -# 1000 -x 8153044963028367 -p 644124967711489). The resulting phylogenetic tree was visualized and edited using the iTOL suite\\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eSynteny analysis\\u003c/p\\u003e \\u003cp\\u003eTo investigate gene collinearity and identify orthologous relationships among grass genomes, the JCVI utility library was employed (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://github.com/tanghaibao/jcvi\\u003c/span\\u003e\\u003cspan address=\\\"https://github.com/tanghaibao/jcvi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to perform pairwise orthology detection and synteny screening. Analyses were conducted between the following genome pairs in progressive evolutionary order: \\u003cem\\u003eBrachypodium distachyon\\u003c/em\\u003e vs. \\u003cem\\u003eHordeum vulgare\\u003c/em\\u003e, \\u003cem\\u003eHordeum vulgare\\u003c/em\\u003e vs. \\u003cem\\u003eSecale cereale\\u003c/em\\u003e, \\u003cem\\u003eSecale cereale\\u003c/em\\u003e vs. \\u003cem\\u003eT. monococcum, T. monococcum\\u003c/em\\u003e vs. \\u003cem\\u003eT. aestivum\\u003c/em\\u003e A genome, \\u003cem\\u003eT. aestivum\\u003c/em\\u003e A vs. B genomes, \\u003cem\\u003eT. aestivum\\u003c/em\\u003e B vs. D genomes, \\u003cem\\u003eT. aestivum\\u003c/em\\u003e D genome vs. \\u003cem\\u003eAegilops tauschii.\\u003c/em\\u003e The reference genomes used are detailed in Supplementary Table\\u0026nbsp;16. For synteny analysis, gene annotation files were converted into .bed format using the JCVI suite. For each file, the following steps were executed: The .gff3.gz files were decompressed using gunzip. Each .gff3 file was converted to BED format using the jcvi.formats.gff module of the JCVI utility suite. Specifically, the bed subcommand was used with the options --type\\u0026thinsp;=\\u0026thinsp;gene and --key\\u0026thinsp;=\\u0026thinsp;ID to extract gene features based on their unique identifiers. Files containing the coding sequences were modified using awk and sed commands so that gene names matched with the .bed files and all transcripts except the first were removed.\\u003c/p\\u003e \\u003cp\\u003eFor each genome pair, orthologs were identified using the jcvi.compara.catalog ortholog module with the --no_strip_names option to preserve original gene identifiers. Anchor files generated from this step were then refined using the jcvi.compara.synteny screen command to retain syntenic blocks with a minimum span of 30 genes and using the --simple flag for simplified filtering. Microsyteny was plotted using the jcvi.graphics.synteny module where the gene \\u003cb\\u003eAet.TA1675.r1.1D001090\\u003c/b\\u003e was highlighted in green, while \\u003cb\\u003eAet.TA1675.r1.1D001100 and Aet.TA1675.r1.1D001300\\u003c/b\\u003e were highlighted in orange (see Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cp\\u003eCloned \\u003cem\\u003eR\\u003c/em\\u003e gene prediction in \\u003cem\\u003eAe. tauschii\\u003c/em\\u003e L2 diversity panel\\u003c/p\\u003e \\u003cp\\u003eThe nucleotide sequences for cloned \\u003cem\\u003eAe. tauschii R\\u003c/em\\u003e genes (except where indicated below) were obtained from online data repositories (Supplementary Table\\u0026nbsp;17). Each gene was used as the input query to search the available contig level whole-genome assemblies\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e and RenSeq assemblies\\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e of the L2 diversity panel using BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. An \\u003cem\\u003eR\\u003c/em\\u003e gene was determined to be present within an accession if the majority of the gene could be identified from the BLASTn\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e results with a percentage identity relative to the query of 99.5%. In multiple cases \\u003cem\\u003eR\\u003c/em\\u003e genes were present across numerous contigs, requiring significant manual curation and care in order to determine \\u003cem\\u003eR\\u003c/em\\u003e gene presence. For \\u003cem\\u003eStb16q\\u003c/em\\u003e and \\u003cem\\u003eLr39\\u003c/em\\u003e, the \\u003cem\\u003eR\\u003c/em\\u003e gene linked KASP markers reported in the literature\\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e were used as the input query for search using BLASTn-short\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. For \\u003cem\\u003eSr66 (SrTA1662), Sr33, Sr45, Sr46, Cmc4\\u003c/em\\u003e and \\u003cem\\u003eWTK4\\u003c/em\\u003e genes, their presence within the panel had already been reported in previous studies\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. The phylogenetic tree and gene presence was plotted in iToL, with colours added to distinguish associated disease resistance.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by a John Innes Foundation fellowship to SA and by UKRI BBSRC through the Institute Strategic Programme grant BB/X010996/1 (Advancing Plant Health) and BB/P012574 (Plant Health). DG was supported by a BBSRC/RAGT Industrial-Collaborative Award in Science and Engineering fellowship. PN was supported by UKRI BBSRC through the Institute Strategic Programme grant BB/P016855/1 (Designing Future Wheat) and BB/X011003/1 (Delivering Sustainable Wheat).\\u0026nbsp;We are grateful to Kara Boyd (JIC) for assistance with plant husbandry work, and to Claire Domoney (JIC) and Mark Banfield (JIC) for reviewing the draft manuscript. The high-performance computing resources and services used in this work were supported by the Norwich Bioscience Institutes Partnership (NBIP) Computing infrastructure for Science (CiS) group. We are grateful to the John Innes Centre (JIC) Horticultural Services for plant greenhouse support and R. Goram at the JIC genotyping platform for genotyping support. We also thank RAGT Seeds for providing access to their greenhouses and resources for conducting the phenotyping work and thank Chris Burt for his constructive feedback. Lastly, we thank NIAB for providing us with seed of the synthetic hexaploid wheat backcross population, NIAB-SHW-BC-219.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eContributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eS.A. designed the research; D.G. and K.G. performed \\u003cem\\u003ek\\u003c/em\\u003e-mer-based GWAS and refined the resistance mapping interval; D.G., A.P., C.M., R.B. conducted phenotyping of the diversity panel, and synthetic and transgenic wheat; P.N., A.S. and T.H., provided \\u003cem\\u003eOculimacula\\u003c/em\\u003e isolates and plant phenotyping support; D.G. designed the binary construct; S.H. and M.S. carried out wheat transformation; D.G. performed KASP marker analysis; N.T. conducted microscopic analysis; A.P.M and S.B. cultured \\u003cem\\u003eOculimacula\\u003c/em\\u003e isolates for sequencing to build the phylogenetic tree; R.M. generated the \\u003cem\\u003eAe. tauschii\\u0026nbsp;\\u003c/em\\u003eF\\u003csub\\u003e2\\u003c/sub\\u003e population; D.G., K.G. and S.A. drafted the manuscript; D.G., K.G., M.V. and S.A. designed the figures; All authors reviewed and approved the manuscript.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics declarations\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCompeting interests\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eCrous PW, Groenewald JZE, Gams W (2003) Eyespot of cereals revisited: ITS phylogeny reveals new species relationships. Eur J Plant Pathol 109:841\\u0026ndash;850. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1023/A:1026111030426\\u003c/span\\u003e\\u003cspan address=\\\"10.1023/A:1026111030426\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBurt C, Hollins TW, Powell N, Nicholson P (2010) Differential seedling resistance to the eyespot pathogens, \\u003cem\\u003eOculimacula yallundae\\u003c/em\\u003e and \\u003cem\\u003eOculimacula acuformis\\u003c/em\\u003e, conferred by \\u003cem\\u003ePch2\\u003c/em\\u003e in wheat and among accessions of \\u003cem\\u003eTriticum monococcum\\u003c/em\\u003e. Plant Pathol 59:819\\u0026ndash;828. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1365-3059.2010.02307.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2010.02307.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRay RV, Crook MJ, Jenkinson P, Edwards SG (2006) Effect of eyespot caused by \\u003cem\\u003eOculimacula yallundae\\u003c/em\\u003e and \\u003cem\\u003eO. acuformis\\u003c/em\\u003e, assessed visually and by competitive PCR, on stem strength associated with lodging resistance and yield of winter wheat. Journal Experimental Botany 57:2249\\u0026ndash;2257. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/jxb/erj192\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/jxb/erj192\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeyer N et al (2011) Diagnostic value of molecular markers linked to the eyespot resistance gene \\u003cem\\u003ePch1\\u003c/em\\u003e in wheat. Euphytica 177:267\\u0026ndash;275. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s10681-010-0266-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s10681-010-0266-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eParnell S, Gilligan CA, Lucas JA, Bock CH, Van Den Bosch F (2008) Changes in fungicide sensitivity and relative species abundance in \\u003cem\\u003eOculimacula yallundae\\u003c/em\\u003e and \\u003cem\\u003eO. acuformi\\u003c/em\\u003es populations (eyespot disease of cereals) in Western Europe. Plant Pathol 57:509\\u0026ndash;517. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1365-3059.2007.01786.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2007.01786.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHollins TW, Scott PR, Paine JR (1985) Morphology, benomyl resistance and pathogenicity to wheat and rye of isolates of \\u003cem\\u003ePseudocercosporella herpotrichoides\\u003c/em\\u003e. Plant Pathol 34:369\\u0026ndash;379. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1365-3059.1985.tb01375.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.1985.tb01375.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCadle MM, Murray TD, Jones SS (1997) Identification of resistance to \\u003cem\\u003ePseudocercosporella herpotrichoides\\u003c/em\\u003e in \\u003cem\\u003eTriticum monococcum\\u003c/em\\u003e. Plant Dis 81:1181\\u0026ndash;1186. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1094/PDIS.1997.81.10.1181\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PDIS.1997.81.10.1181\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSheng H, Murray TD (2013) Identifying new sources of resistance to eyespot of wheat in \\u003cem\\u003eAegilops longissima\\u003c/em\\u003e. Plant Dis 97:346\\u0026ndash;353. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1094/PDIS-12-11-1048-RE\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PDIS-12-11-1048-RE\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWorland AJ, Law CN, Hollins TW, Koebner RMD, Giura A (1988) Location of a gene for resistance to eyespot (P\\u003cem\\u003eseudocercosparella herpotrichoides\\u003c/em\\u003e) on chromosome 7D of bread wheat. Plant Breeding 101:43\\u0026ndash;51. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1439-0523.1988.tb00265.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1439-0523.1988.tb00265.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ede la Pena RC, Murray TD, Jones SS (1996) Linkage relations among eyespot resistance gene \\u003cem\\u003ePch2\\u003c/em\\u003e, endopeptidase Ep\\u0026ndash;A1b, and RFLP marker Xpsr121 on chromosome 7A of wheat. Plant Breeding 115:273\\u0026ndash;275. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1439-0523.1996.tb00916.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1439-0523.1996.tb00916.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurray TD, de la Pena RC, Yildirim A, Jones SS, Qualset CO (1994) A new source of resistance to \\u003cem\\u003ePseudocercosporella herpotrichoides\\u003c/em\\u003e, cause of eyespot disease of wheat, located on chromosome 4V of \\u003cem\\u003eDasypyrum villosum\\u003c/em\\u003e. Plant Breeding 113:281\\u0026ndash;286. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1439-0523.1994.tb00737.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1439-0523.1994.tb00737.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMuranty H, Jahier J, Tanguy A\\u0026ndash;M, Worland AJ, Law C (2002) Inheritance of resistance of wheat to eyespot at the adult stage. Plant Breeding 121:536\\u0026ndash;538. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1046/j.1439-0523.2002.00767.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1046/j.1439-0523.2002.00767.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBurt C, Hollins TW, Nicholson P (2011) Identification of a QTL conferring seedling and adult plant resistance to eyespot on chromosome 5A of Cappelle Desprez. Theor Appl Genet 122:119\\u0026ndash;128. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-010-1427-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-010-1427-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePasquariello M, Berry S, Burt C, Uauy C, Nicholson P (2020) Yield reduction historically associated with the \\u003cem\\u003eAegilops ventricosa\\u003c/em\\u003e 7DV introgression is genetically and physically distinct from the eyespot resistance gene \\u003cem\\u003ePch1\\u003c/em\\u003e. \\u003cem\\u003eTheoretical and Applied Genetics\\u003c/em\\u003e 133, 707\\u0026ndash;717 \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-019-03502-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-019-03502-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZanke CD et al (2017) Genome\\u0026ndash;wide association mapping of resistance to eyespot disease (P\\u003cem\\u003eseudocercosporella herpotrichoides\\u003c/em\\u003e) in European winter wheat (\\u003cem\\u003eTriticum aestivum\\u003c/em\\u003e L.) and fine\\u0026ndash;mapping of \\u003cem\\u003ePch1\\u003c/em\\u003e. Theor Appl Genet 130:505\\u0026ndash;514. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-016-2830-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-016-2830-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLewien MJ, Murray TD, Jernigan KL, Garland\\u0026ndash;Campbell KA, Carter AH (2018) Genome\\u0026ndash;wide association mapping for eyespot disease in US Pacific Northwest winter wheat. PLoS ONE 13:e0194698. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pone.0194698\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0194698\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBurt C et al (2014) Mining the Watkins collection of wheat landraces for novel sources of eyespot resistance. Plant Pathol 63:1241\\u0026ndash;1250. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/ppa.12221\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/ppa.12221\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThiele A, Schumann E, Peil A, Weber WE (2008) Eyespot resistance in wheat \\u0026times; \\u003cem\\u003eAegilops kotschyi\\u003c/em\\u003e backcross lines. Plant Breeding 121:29\\u0026ndash;35. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1046/j.1439-0523.2002.00669.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1046/j.1439-0523.2002.00669.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYildirim A, Jones SS, Murray TD, Cox TS, Line RF (1995) Resistance to stripe rust and eyespot diseases of wheat in \\u003cem\\u003eTriticum tauschii\\u003c/em\\u003e. Plant Dis 79:1230\\u0026ndash;1236. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1094/PD-79-1230\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PD-79-1230\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHafeez AN et al (2021) Creation and judicious application of a wheat resistance gene atlas. Mol Plant 14:1053\\u0026ndash;1070. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.molp.2021.05.014\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.molp.2021.05.014\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGaurav K et al (2022) Population genomic analysis of \\u003cem\\u003eAegilops tauschii\\u003c/em\\u003e identifies targets for bread wheat improvement. Nat Biotechnol 40:422\\u0026ndash;431. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41587-021-01058-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41587-021-01058-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScott PR (1971) The effect of temperature on eyespot (\\u003cem\\u003eCercosporella herpotrichoides\\u003c/em\\u003e) in wheat seedlings. Ann Appl Biol 68:169\\u0026ndash;175. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1744-7348.1971.tb06453.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1744-7348.1971.tb06453.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCavalet\\u0026ndash;Giorsa E et al (2024) Origin and evolution of the bread wheat D genome. Nature 633:848\\u0026ndash;855. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41586-024-07808-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41586-024-07808-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCamacho C et al (2009) BLAST+: architecture and applications. BMC Bioinformatics 10:421. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1471-2105-10-421\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1471-2105-10-421\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlum M et al (2021) The InterPro protein families and domains database: 20 years on. Nucleic Acids Res 49:D344\\u0026ndash;D354. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gkaa977\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkaa977\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArora S et al (2023) A wheat kinase and immune receptor form host-specificity barriers against the blast fungus. Nat Plants 9:385\\u0026ndash;392. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41477-023-01357-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41477-023-01357-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWright TIC et al (2024) A new winter wheat genetic resource harbors untapped diversity from synthetic hexaploid wheat. Theor Appl Genet 137:73. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-024-04577-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-024-04577-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKourelis J, Sakai T, Adachi H, Kamoun S (2021) RefPlantNLR is a comprehensive collection of experimentally validated plant disease resistance proteins from the NLR family. PLoS Biol 19:e3001124. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pbio.3001124\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pbio.3001124\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHurni S et al (2013) Rye \\u003cem\\u003ePm8\\u003c/em\\u003e and wheat \\u003cem\\u003ePm3\\u003c/em\\u003e are orthologous genes and show evolutionary conservation of resistance function against powdery mildew. Plant J 76:957\\u0026ndash;969. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/tpj.12345\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/tpj.12345\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao CZ et al (2016) Molecular cloning, functional verification, and evolution of \\u003cem\\u003eTmPm3\\u003c/em\\u003e, the powdery mildew resistance gene of \\u003cem\\u003eTriticum monococcum\\u003c/em\\u003e L. Genet Mol Res 15(2). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4238/gmr.15028056\\u003c/span\\u003e\\u003cspan address=\\\"10.4238/gmr.15028056\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBurt C, Nicholson P (2011) Exploiting co-linearity among grass species to map the \\u003cem\\u003eAegilops ventricosa\\u003c/em\\u003e-derived \\u003cem\\u003ePch1\\u003c/em\\u003e eyespot resistance in wheat and establish its relationship to \\u003cem\\u003ePch2\\u003c/em\\u003e. \\u003cem\\u003eTheor. Appl. Genet.\\u003c/em\\u003e 123, 1387\\u0026ndash;1400 \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-011-1674-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-011-1674-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArora S et al (2019) Resistance gene cloning from a wild crop relative by sequence capture and association genetics. Nat Biotechnol 37:139\\u0026ndash;143. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41587-018-0007-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41587-018-0007-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVoichek Y, Weigel D (2020) Identifying genetic variants underlying phenotypic variation in plants without complete genomes. Nat Genet 52:534\\u0026ndash;540. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41588-020-0612-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41588-020-0612-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRafiei F et al (2024) Facts, uncertainties, and opportunities in wheat molecular improvement. Heredity 133:371\\u0026ndash;380. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41437-024-00721-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41437-024-00721-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOgbonnaya FC et al (2013) Synthetic Hexaploids: Harnessing Species of the Primary Gene Pool for Wheat Improvement. Plant Breeding Reviews, vol 37. Janick J., editor; Wiley-Blackwell, Hoboken, NJ, pp 35\\u0026ndash;122\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRosyara U et al (2019) Genetic Contribution of Synthetic Hexaploid Wheat to CIMMYT\\u0026rsquo;s Spring Bread Wheat Breeding Germplasm. Sci Rep 9:12355. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-019-47936-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-019-47936-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuindon S et al (2010) New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst Biol 59:307\\u0026ndash;321. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/sysbio/syq010\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/sysbio/syq010\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWhite TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In \\u003cem\\u003ePCR Protocols: A Guide to Methods and Applications\\u003c/em\\u003e, Innis M. A., Gelfand D. H., Sninsky J. J. \\u0026amp; White T. J., eds.; Academic Press: New York, 315\\u0026ndash;322 \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/B978-0-12-372180-8.50042-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/B978-0-12-372180-8.50042-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBruehl GW, Nelson WL (1964) Technique for mass inoculations of winter wheat in the field with \\u003cem\\u003eCercosporella herpotrichoides\\u003c/em\\u003e. FJ Dis Reptr 48:863\\u0026ndash;865. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.cabidigitallibrary.org/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.cabidigitallibrary.org/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.5555/19651101053\\u003c/span\\u003e\\u003cspan address=\\\"10.5555/19651101053\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChapman NH, Burt C, Nicholson P (2009) The identification of candidate genes associated with \\u003cem\\u003ePch2\\u003c/em\\u003e eyespot resistance in wheat using cDNA-AFLP. Theor Appl Genet 118:1045\\u0026ndash;1057. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00122-009-0961-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00122-009-0961-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDj\\u0026eacute;bali N, Jauneau A, Ameline-Torregrosa C, Chardon F, Jaulneau V, Math\\u0026eacute; C, Bottin A, Cazaux M, Pilet-Nayel M-L, Baranger A, Aouani ME (2009) Partial resistance of \\u003cem\\u003eMedicago truncatula\\u003c/em\\u003e to \\u003cem\\u003eAphanomyces euteiches\\u003c/em\\u003e is associated with protection of the root stele and is controlled by a major QTL rich in proteasome-related genes. Mol Plant-Microbe Interact 22:1043\\u0026ndash;1055. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1094/MPMI-22-9-1043\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/MPMI-22-9-1043\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeber E, Engler C, Gruetzner R, Werner S, Marillonnet S (2011) A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLoS ONE 6:e16765. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pone.0016765\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0016765\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSmedley MA, Hayta S, Clarke M, Harwood WA (2021) CRISPR-Cas9 Based Genome Editing in Wheat. Curr Protoc 1:e65. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/cpz1.65\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/cpz1.65\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHayta S, Smedley MA, Clarke M, Forner M, Harwood WA (2021) An efficient Agrobacterium-mediated transformation protocol for hexaploid and tetraploid wheat. Curr Protoc 1:e58. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/cpz1.58\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/cpz1.58\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHayta S, Smedley MA, Demir SU et al (2019) An efficient and reproducible \\u003cem\\u003eAgrobacterium\\u003c/em\\u003e-mediated transformation method for hexaploid wheat (\\u003cem\\u003eTriticum aestivum\\u003c/em\\u003e L). Plant Methods 15:121. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s13007-019-0503-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s13007-019-0503-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSteuernagel B et al (2020) The NLR-Annotator tool enables annotation of the intracellular immune receptor repertoire. Plant Physiol 183:468\\u0026ndash;482. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1104/pp.19.01273\\u003c/span\\u003e\\u003cspan address=\\\"10.1104/pp.19.01273\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSievers F et al (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/msb.2011.75\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/msb.2011.75\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312\\u0026ndash;1313. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/bioinformatics/btu033\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/bioinformatics/btu033\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLetunic I, Bork P (2024) Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res 52:W78\\u0026ndash;W82. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gkae268\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkae268\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSaintenac C et al (2021) A wheat cysteine-rich receptor-like kinase confers broad-spectrum resistance against \\u003cem\\u003eSeptoria tritici\\u003c/em\\u003e blotch. Nat Commun 12:433. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-020-20685-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-020-20685-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"nature-portfolio\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Nature Portfolio\",\"twitterHandle\":\"\",\"acdcEnabled\":false,\"dfaEnabled\":false,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8021535/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8021535/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eEyespot, a stem-base soil-borne fungal disease, is an important constraint on wheat production in temperate regions. Resistance in wheat remains limited, with \\u003cem\\u003ePch1\\u003c/em\\u003e and \\u003cem\\u003ePch2\\u003c/em\\u003e being currently deployed in breeding but no underlying or associated gene identified to date. Here, we phenotyped a sequence-configured diversity panel of \\u003cem\\u003eAegilops tauschii\\u003c/em\\u003e, the D subgenome progenitor of bread wheat, with one of the two causative agents of eyespot, \\u003cem\\u003eOculimacula yallundae\\u003c/em\\u003e. A \\u003cem\\u003ek\\u003c/em\\u003e-mer-based genome-wide association mapping approach identified \\u003cem\\u003ePch4\\u003c/em\\u003e, a nucleotide-binding leucine-rich repeat (NLR) gene on chromosome 1DS. Transgenic wheat and synthetic hexaploids carrying \\u003cem\\u003ePch4\\u003c/em\\u003e showed strong resistance to the pathogen. Phylogenetic and synteny analyses revealed that \\u003cem\\u003ePch4\\u003c/em\\u003e belongs to the same NLR lineage as the cereal powdery mildew resistance gene \\u003cem\\u003ePm3\\u003c/em\\u003e, indicating a shared evolutionary origin. The discovery of \\u003cem\\u003ePch4\\u003c/em\\u003e expands the repertoire of available eyespot resistances and provides new opportunities for strategic stacking of resistance genes to enhance disease resilience in wheat.\\u003c/p\\u003e\",\"manuscriptTitle\":\"A novel NLR immune receptor from Aegilops tauschii confers resistance to wheat eyespot disease\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-01-02 07:19:02\",\"doi\":\"10.21203/rs.3.rs-8021535/v1\",\"editorialEvents\":[],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"nature-communications\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"NCOMMS\",\"sideBox\":\"Learn more about [Nature Communications](http://www.nature.com/ncomms/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://mts-ncomms.nature.com/\",\"title\":\"Nature Communications\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature Communications\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"3146956d-5d1b-4b42-a122-658aa852e891\",\"owner\":[],\"postedDate\":\"January 2nd, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[{\"id\":59795370,\"name\":\"Biological sciences/Plant sciences/Plant immunity\"},{\"id\":59795371,\"name\":\"Biological sciences/Plant sciences/Plant genetics\"},{\"id\":59795372,\"name\":\"Biological sciences/Plant sciences/Plant breeding\"}],\"tags\":[],\"updatedAt\":\"2026-01-02T07:19:02+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-01-02 07:19:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8021535\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8021535\",\"identity\":\"rs-8021535\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}