{"paper_id":"b7282f2a-0737-43ab-bf3e-2395d02b3db2","body_text":"Executioner caspases degrade essential mediators of pathogen-host interactions to inhibit growth of intracellular Listeria monocytogenes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Executioner caspases degrade essential mediators of pathogen-host interactions to inhibit growth of intracellular Listeria monocytogenes Michael Walch, Marilyne Lavergne, Raffael Schaerer, Safaa Bouheraoua, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4655845/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Jan, 2025 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Abstract Cell death mediated by executioner caspases is essential during organ development and for organismal homeostasis. The mechanistic role of activated executioner caspases in antibacterial defense during infections with intracellular bacteria, such as Listeria monocytogenes , remains elusive. Cell death upon intracellular bacterial infections is considered altruistic to deprive the pathogens of their protective niche. To establish infections in a human host Listeria monocytogenes deploy virulence mediators, including membranolytic listeriolysin O, allowing phagosomal escape and cell-to-cell spread. Here, by means of chemical and genetical modifications, we show that the executioner caspases-3 and − 7 efficiently inhibit growth of intracellular Listeria monocytogenes in host cells. Comprehensive proteomics revealed multiple caspase-3 substrates in the Listeria secretome, including listeriolysin O and various other proteins crucially involved in pathogen-host interactions. Listeria secreting caspase-uncleavable listeriolysin O gained significant growth advantage in epithelial cells. With that, we uncovered an underappreciated defense barrier and a non-canonical role of executioner caspases to degrade virulence mediators, thus impairing intracellular Listeria growth. Biological sciences/Immunology/Infectious diseases Health sciences/Pathogenesis/Immunopathogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction To survive in the host, pathogenic bacteria evolved multiple effectors that allow specific interactions with the host to form a protective niche. The virulence strategy of Listeria monocytogenes ( Lm ) is characterized by uptake even in non-phagocytic cells, such as epithelial cells. After uptake, they avoid lethal lysosomal degradation by a phagosomal escape mechanism, which is promoted by their key virulence mediator, listeriolysin O (LLO). In the cytosol, Lm specifically interact with the actin cytoskeleton to gain motility for cell-to-cell spread, a process that is again mediated by LLO ( 1 ). By successfully doing so, Lm cause a life-threatening disease in humans, particularly in the immunocompromised and during pregnancy ( 2 ). Immune proteases have been recognized to display crucial internal barrier function in antibacterial defense. Neutrophil effector proteases have been demonstrated to be critical for the elimination of gram + and gram- bacteria in in vitro and in vivo models ( 3 – 6 ). These proteases were demonstrated to target bacterial proteins related to virulence ( 7 ), including LLO ( 8 ). Our work revealed that the lymphocytic effector proteases, the granzymes, target bacterial proteins to inhibit their growth ( 9 ), including virulence mediators ( 10 ). The induction of programed host cell death, particularly its lytic forms, necroptosis and pyroptosis, is widely recognized to act as an innate antibacterial defense barrier ( 11 ). Less defined in antibacterial defense is the role of apoptosis ( 12 ), which is the immunologically silent, non-lytic form of programmed cell death, characterized by DNA fragmentation, chromatin condensation, membrane blebbing and cytoskeletal breakdown. This process relies on an intracellular cascade of the caspases. Initiator caspases-8 and − 9 are activated by extrinsic factors, such as death receptor activation by tumor necrosis factor alpha (TNF-α) ( 13 ), intrinsic mediators, such as mitochondrial cytochrome C release ( 14 ), or by the granzymes ( 15 ). Upon initiation, the executioner caspases-3, -6 and − 7 are activated and they then cleave vital substrates resulting in apoptosis ( 16 ). Apoptosis in the context of bacterial infections is considered as altruistic death, depriving intracellular bacteria of their protected niche. In this study, we have asked specifically if activated executioner caspases engage in more direct interactions with intracellular bacteria to inhibit their growth. Results Executioner caspases activity is induced by Lm infection and inhibits their intracellular growth To experimentally confirm executioner caspases activity upon infection, we infected HeLa cells with WT or LLO-deficient Lm and monitored executioner caspases (DEVDase) activity using the chromogenic caspase-3 and − 7 substrate, Ac-DEVD-pNA (Fig. 1A). We also infected HeLa cells with Salmonella enterica serovar Typhimurium, in which caspase-3 activation was already mechanistically explored ( 17 ). WT Listeria and Salmonella but not LLO-deficient Lm led to significant increase of DEVDase activity 5 hours postinfection. The colorimetric data were confirmed by western blot analysis using antibodies against the active forms of the initiator caspase-9, the executioner caspase-7 and the 89 kDa cleavage fragment of Parp1, which results upon caspase-3 cleavage ( 18 ) (Fig. 1B), as well as caspase-3 (Fig. 1C). Infections with virulent Salmonella and Listeria increased the signal intensity of cleaved Parp1, active caspase-9 and caspase-7 already after 5 hours, as well as of caspase-3 (monitored 16 hours postinfection). The LLO-deficient Listeria strain did not show caspase-9 activity or Parp1 cleavage but showed faint caspase-7 activation after 16 hours, suggesting that it needs LLO for efficient caspase activation. Caspase activation was strongly reduced using the caspases-3 and − 7 inhibitor DEVD-fmk or with pan-caspase inhibitor zVAD treatment indicating specificity of the detection. Most importantly, the inhibition of executioner caspase activity in Lm -infected HeLa cells with DEVD-fmk or zVAD increased growth of intracellular Lm whereas the treatment with TNF-a reduced the bacterial burden as compared to untreated cells (Fig. 1G). High DEVDase activity upon Lm infection and TNF-a does not cause visible signs of cell death To assess morphological signs of cell death upon Lm infection in presence of the proapoptotic agent TNF-a, we used fluorescent DEVD to indicate active caspases by microscopy. Strikingly, around half of the cells displayed bright cytoplasmic DEVD staining after 7 hours upon Lm infection and TNF-a treatment (Figs. 2A and 2D). However, the nuclear morphology and cytoskeleton organization of the infected cells did not display obvious apoptotic features, similar to negative control HeLa cells (Fig. 2B). This was in stark contrast to STS treatment, leading to nuclear caspase translocation ( 19 ), as well as chromatin condensation and actin cytoskeleton breakdown ( 20 ) (Figs. 2C-D). In addition, in Lm -infected cells treated with TNF-a, only a few cells bound the Cytodeath® M30 antibody detecting cleaved cytokeratin-18 in early apoptotic cells ( 21 ) (Fig. 2E). Even in cells showing active Lm proliferation, cytokeratin-18 remained unaffected (arrow in Fig. 2E). This was again in sharp contrast to STS-treated cells when most of the cells stained positive for M30. Host cells lacking executioner caspases are less resistant to bacterial infection As the chemical inhibition of caspases is prone to off-target effects, executioner caspases were deleted in HeLa cells using CRISPR/Cas9 technology. For this purpose, HeLa cells (a commercial caspase-3 knockout (KO) and the corresponding parental line) were nucleofected with Cas9/guide RNA ribonucleoproteins (RNPs) directed to caspase-7 before cloning deletion lines by limited dilutions (Fig. 3A). In the single KO lines, caspase activity was markedly but not statistically significantly reduced in Lm- treated cells in absence or presence of TNF-a (Fig. 3B). Only the simultaneous deletion of caspase-3 and − 7 in HeLa cells led to significant reduction of DEVDase activity after Lm infections; this was particularly obvious in host cells that were simultaneously treated with TNF-a. To reveal the remaining DEVDase activity in single caspase-3 or caspase-7 KO lines, we assessed intracellular Lm growth with and without TNF-a treatment. In these experiments, CFUs were calculated from bacterial growth curves as illustrated in the supplementary Figures S1 . While TNF-a significantly reduced the bacterial burden in the parental HeLa line (WT), bacterial growth was not significantly affected by TNF-a in caspase deleted host cells (Fig. 3C). Only HeLa cells lacking both caspases-3 and − 7 were less resistant to intracellular Lm growth than the WT line in absence of TNF-a (Fig. 3D). Of note, though executioner activity in HeLa cells was highly increased upon gram- Salmonella infections (Fig. 1A), their growth in caspase-3/7 KO cells was not significantly affected (data not shown), suggesting strain specificity of this caspase-mediated defense mechanism in epithelial cells. To study the impact of the host cell type, we additionally deleted caspase-3 and − 7 in the monocyte-like human cell line THP-1. While the depletion of caspase-7 was complete, a weak band in the caspase-3 immunoblot still appeared after multiple rounds of nucleofection and limited dilution cloning (Fig. 3E) that was also reflected by the largely unchanged DEVDase activity upon Lm infection in these lines (Fig. 3F). In contrast to HeLa cells, simultaneous TNF-a treatment did not enhance DEVDase activity neither in the WT cells nor the KO lines. However, there was an increase of the bacterial burden in caspase-7 deficient, Lm- and surprisingly also Salmonella -infected THP-1 cells that was again not affected by simultaneous TNF-a treatment (Figs. 3G and H). Caspase-3 degrades Listeria supernatant proteins involved in pathogen-host interactions We next studied if the proteolytic activity of executioner caspases – and with that, bacterial substrate degradation – might contribute to bacterial growth inhibition. Caspase accessibility was hypothesized to favor degradation of bacterial proteins that are released into the cytoplasm. Therefore, we performed unbiased proteomics approaches to identify caspase-3 substrates in cell-free Lm supernatants. Comparative 2-dimensional (2D) SDS-PAGE identified 29 proteins whose intensities changed by at least a factor 2 upon caspase-3 treatment in three replicate analyses (Fig. 4A). To backup these findings using an alternative approach, we additionally analyzed the caspase-3 degradome in Lm supernatants by terminal amine isotopic labeling of substrates (TAILS) ( 22 ). TAILS analysis revealed 88 supernatant proteins that were detected as cleaved in three independent replicate samples (Fig. 4B). To our surprise, the overlap of the two analyses was only partial (9 proteins, Fig. 4C), presumably due to major differences in the sensitivities of the assays. All substrates of the two approaches are listed in Table 1. Overlapping proteins are highlighted, including the Lm virulence factor listeriolysin O (LLO). As the substrate selection criteria in the two approaches were highly stringent (found in 3 replicate samples), we decided to run the bioinformatics analyses with the pooled substrate list of 108 proteins. We first screened the substrate list for pathways that are significantly enriched according to their false discovery rate (FDR) and ordered them by fold enrichment (Fig. 4D). The top enriched pathways include ATP-binding cassette (ABC) transporter complexes, PrfA-dependent virulence factors and peptidoglycan hydrolases, all essential for full virulence in vivo ( 23 – 25 ). A pathway network analysis revealed a high interconnectivity between the enriched pathways (Fig. 3E), clearly suggesting targeted substrate selection by caspase-3. Gene Ontology (GO) cellular component analysis indicated as expected on top the extracellular region (Fig. 4F). However, the enrichment of membrane proteins and cytoplasmic proteins in a proteomics analysis of cell-free bacterial supernatant was unexpected. This was also indicated in the protein-protein interaction (PPI) network analysis by the STRING software with most proteins being neither extracellular nor periplasmic (Figure S2 ) ( 26 ). The PPI analysis though with an enrichment p-value of 1.08e-12 proofed to be highly significant, contracting a random set of proteins. For the virulence mediators LLO and Iap, an extracellular endopeptidase ( 27 ), the proteomics data were experimentally validated. Caspase-3 efficiently and dose-dependently cleaved LLO in Lm supernatants (Fig. 4G), as well as LLO and Iap as purified proteins (Fig. 4H). The detected cleavage fragments of LLO (c-term 52 kDa) and Iap (c-term 45.1 kDa) correspond to the top score sites according to SitePrediction ( 28 ) (Figure S3A), as well as to ScreenCap3 ( 29 ). A caspase uncleavable LLO mutant renders Lm more virulent in HeLa cells To test if executioner caspase-mediated degradation of LLO directly affects intracellular bacteria growth, we generated a Listeria line that secretes caspases-3 and − 7 uncleavable, recombinant LLO in ΔLLO Lm . Cleavage SitePrediction software predicted top score sites at the aspartate positions D62 (caspase-3) and D416 (caspase-7) in the LLO sequence (Figure S3A). Comparison with the LLO structure revealed that these sites are well accessible as potential protease targets ( 30 ) (Figure S3B). Therefore, we replaced these potential cleavage site aspartates with glutamates and integrated the mutated LLO into the chromosome of ΔLLO Lm to generate Lm LLOc3/7 (Fig. 5A). The treatment of supernatants from Lm LLOwt and Lm LLOc3/7 with caspases-3 or -7 confirmed protection of the mutated protein (Fig. 5B). As the D62 to E point mutation is within the PEST domain critical for activity ( 31 ), we tested the hemolytic activity in the supernatants. The activity of the mutated LLO was indeed significantly decreased (Fig. 5C). However, contrary to the LLOwt supernatants, neither caspase-3 nor caspase-7 affected the hemolytic activity of LLOc3/7 (Fig. 5D). Due to this difference in the hemolytic activities, we could not directly compare the virulent growth of these two lines in host cells. To circumvent this difficulty, we compared the growth upon treatment with zVAD where all caspase activity is blocked (Fig. 5E). Indeed, in the LLOc3/7 mutant strain, the time differences to the zVAD controls in untreated and particularly in TNF-α treated conditions were significantly reduced as compared to LLOwt Lm , indicating a growth advantage mediated by caspase-uncleavable LLO (Fig. 5F). Discussion In this study, we present compelling evidence for an underappreciated host defense mechanism against intracellular Lm that is mediated by executioner caspases-3 and − 7. Executioner caspase activity is robustly activated in HeLa cells upon infection with virulent Lm , presumably via the intrinsic pathway and the activation of caspase-9. Caspase activity can be additionally enhanced by simultaneous TNF-a treatment. It was reported earlier that Lm infection triggers nucleosomal DNA fragmentation in mouse hepatocytes ( 32 ), presumably mediated by caspase-3 ( 33 ). Also, caspase-7 activation upon Lm infection in murine macrophage was demonstrated to exert a cytoprotective effect on the host cells ( 34 ). Though remarkably high caspase activity was recorded in the Lm infection experiments, particularly in presence of TNF-a, HeLa cells stayed viable according to nuclear morphology, cytoskeleton organization, plasma membrane integrity and mitochondrial metabolization rate, at least at low multiplicities of infection (MOI ≤ 1). More importantly, we additionally demonstrate that the chemical inhibition of DEVDase activity or the genetic depletion of both caspases-3 and − 7 decreases the resistance of HeLa cells against intracellular Lm . Surprisingly, caspase depletion did not affect resistance to Salmonella Typhimurium that highly induces executioner caspase activity, and crucial virulence effectors (SipA, SifA) are degraded by active caspase-3 ( 17 , 35 ). However, in contrast to Lm , effector cleavage might be even beneficial for the dissemination of Salmonella , suggesting major species-specific differences in caspase-mediated anti-bacterial defense. Interestingly, in the monocytic acute leukemia line, THP-1, the single knock-out of caspase-7 led to increased intracellular bacteria growth of both Lm and Salmonella . Caspase-7, though structurally closely related to caspase-3, has a dual role in cell death and inflammation. Unlike caspase-3, it is activated by inflammatory processes, including active caspase-1 ( 36 ). Active caspase-7, independently of caspase-1, was detected upon Lm infection ( 34 ), as well as during intracellular Salmonella and Legionella pneumophila infections, downstream of caspase-1 ( 37 – 39 ). Remarkably, caspase-7-deficient mice allowed increased growth of L. pneumophila in their macrophages in vitro , and in their lungs in vivo ( 40 ). Substantial replication of L. pneumophila was also observed in dendritic cells of caspase-3-deficient mice ( 41 ), suggesting that some gram- bacteria are also susceptible to executioner caspase activity. A crucial role of caspases-3 and − 7 in immune defense against Lm was additionally demonstrated by the increased growth of a mutant strain that secretes caspase-uncleavable LLO in HeLa cells. LLO is also a substrate of human granzyme B ( 10 ). This overlap in substrate selection by granzyme B in general is not uncommon, as it shares cleavage specificity after aspartate residues with the caspases ( 42 ) and activates numerous caspases by direct cleavage, including caspase-3 ( 43 ) and caspase-7 ( 44 ). To induce apoptosis, granzyme B can directly process numerous caspase substrates, such as Parp1, NuMA, DNA-PK or ICAD ( 45 , 46 ). Comprehensive proteomics analysis of caspase-3 substrates in the Lm secretome identified proteins critically involved in pathogen-host interactions and virulence. The top enriched pathways include membrane transport, in particular via the ATP-binding cassette (ABC) transporter complex ( 47 ), the PrfA-dependent virulence factors LLO, ActA, PlcA and PlcB ( 48 ), peptidoglycan catabolic hydrolases, such as Iap, and proteins anchored to the outer surface via Gly-Trp (GW)-domains, including InlB ( 49 ), all pathways critical for full Lm virulence in a host. The pathways and the overall protein substrate network proofed to be remarkably interconnected with highly significantly enriched interactions, indicating a targeted attack of caspase-3 on proteins that are essential for pathogen-host interactions. The top subcellular localization was as expected the extracellular region. However, the screen revealed in addition a multitude of membrane and cytoplasmic proteins. A potential interpretation of the presence of these types of proteins in cell-free supernatants is provided by the comparison of the caspase-3 substrate list with a recent independent proteomics analysis of Lm membrane vesicles ( 50 ). 93.1% of the caspase-3 substrates were also found with high confidence (in three replicate analyses) in highly purified membrane vesicles. To conclude how the release of membrane vesicles mediates Lm virulence and how the caspases interfere with it needs extensive further study. In conclusion, this study identifies the executioner caspases as a novel innate immune barrier against intracellular growing Lm . This barrier is established by the targeted degradation of a multitude of bacterial proteins that are critically involved in pathogen-host interactions, therefore inhibiting virulent growth. Methods and materials Human cells and cell culture conditions HeLa cells were cultured in DMEM (Pan Biotech, P04-04510), supplemented with 10% FBS (Sigma) and 1% antibiotic/antimycotic solution (Thermo Fisher). THP-1 cells were cultured in RPMI-1640 (Pan Biotech, P04-18500), supplemented with 10% FBS (Sigma), 50 µM 2-mercaptoethanol (Sigma), and 1% antibiotic/antimycotic solution (Thermo Fisher). Bacterial Strains Listeria monocytogenes 10403S and 10403S ΔLLO, and Salmonella enterica serovar Typhimurium SL1344 used for infections were grown to mid-log in appropriate medium (Brain Heart Infusion (Millipore, 53286) + 50 µg/ml streptomycin for Listeria ; Luria broth (Sigma, L3022) + 50 µg/ml streptomycin for Salmonella ). 50 µg/ml kanamycin was added to grow mutant Listeria (pIMK2 transfected) ( 51 )). Gene modification by CRISPR/Cas9 methodology and clone selection limiting dilution The gene editing was based on the nucleofection (4D Nucleofector System, Lonza) of preformed Cas9-guideRNA-ribonucleoprotein (RNP) complexes into target cell line (HeLa, THP-1) according to manufacturer`s recommendations (IDT). Three guides per gene were tested and the efficiency of knockdown was assessed by western blot. The cells that displayed most efficient knockdown (usually around 50%) were used for downstream dilution assays. HeLa cell gene edits were started using a commercial caspase-3 KO and the corresponding parental lines (abcam, ab255370, ab255448). Most efficient guide sequences were GATCGTTGTAGAAGTCTAAC for caspase-3 (in THP-1 cells) and GATATGTAGGCACTCGGTCC for caspase-7. Monoclonal cell populations were selected by seeding in an average of 0.5 cells in 100 µl in 96-well plates for 7 days before subcloning in repeated standard limiting dilution assays. Generation of a caspase uncleavable LLO mutant Full-length (including the natural ribosome binding site and signal peptide) LLO was PCR amplified from the chromosome of Listeria 10403S and cloned into the bacterial expression vector pGEX4Ti (Sigma) using the BamH1 and Xho1 restriction sites. Cleavage sites for caspase-3 and − 7 were predicted using the SitePrediction software ( 28 ). The top score cleavage site aspartic acids for caspases-3 and − 7 were mutated to glutamic acid by sequential two-step overlap PCRs ( 52 ), and correct point mutations confirmed by sequencing (Microsynth AG, Balgach, Switzerland). Wild-type and mutated LLO were cloned into the integration vector pIMK2 ( 51 ) at the BamH1/Xho1 sites, electroporated into LLO-deficient Lm 10403S and then selected on kanamycin BHI agar plates to generate the lines Lm LLOwt and Lm LLOc3/7. Hemolysis assays Serial dilutions (10-80fold) of Lm culture supernatant were incubated with human red blood cells at a hematocrit of 0.4% in hemolysis buffer (100 mM NaCl, 40 mM NaPO 4 , 0.5 mg/ml BSA, pH = 5.5) in u-bottomed microtiter plates at 37°C for 15 minutes. After the incubation, the plate was spun (500 x g, 3 minutes) and the supernatant was transferred to a flat-bottomed microtiter plate. Hemolysis was assessed by absorbance readings at 405 nm in a plate reader (Synergy H1, Biotek). Specific hemolysis was normalized to positive control lysis induced by 0.1% Triton X-100, corrected by the spontaneous hemoglobin release in buffer only conditions. For some experiments, a 10fold dilutions of the Lm culture supernatants were pretreated with 2U/µl of purified caspase-3 (see below) or commercial caspase-7 (Enzo Life Sciences) for 4 hours at 37°C before the assessment of the hemolytic activity. Bacterial infections, colony forming unit (CFU), growth assays, DEVDase activity assessment and caspase activation Before infections, overnight cultures of bacteria were diluted 1:50 in fresh broth and grown to mid-log, then were washed with PBS and resuspended in infection medium (RPMI + 1% BSA + appropriate antibiotics as above). Cell density was estimated by OD600 spectrometry (OD 600 = 0.1 corresponds to ~ 2x10 7 bacteria/ml) and confirmed by CFU assay. HeLa and THP-1 cells were infected with Lm 10403S and Salmonella enterica serovar Typhimurium SL1344 for 60 minutes at indicated multiplicity of infection (MOI) in 24-well plates in triplicates. The infected cells were washed throuroughly with PBS and then further incubated with gentamicin (25 µg/ml) in infection medium. For some experiments, particularly when using higher MOIs due to cytopathic effects and subsequent susceptibility to gentamicin, gentamicin treatment was only for 30 minutes, followed by further incubation in gentamicin-free infection medium that was exchanged every 4 hours. In some experiments, 20 µM zVAD, 20 µM zDVED-fmk or 10ng/ml TNF-a was added. At indicated times, samples were washed with PBS and then hypotonically lysed by adding ice-cold sterile water for 45 minutes on ice. For CFU assays, lysates were serially diluted in broth and spread on LB-Agar plates containing the appropriate antibiotics. Colonies were enumerated after 24 hours at 37°C. For the growth assays, lysates were 10fold diluted in flat-bottomed 96-well plates and the OD at wavelength 600 nm was measured every 15 minutes while discontinuous shaking in heat-controlled plate reader for 24 hours at 37°C (Synergy H1, BioTek). For the colorimetric DEVDase activity measurement (only in HeLa cells), lysates were cleared by centrifugation, and the supernatants were 10fold diluted into caspase assay buffer (50 mM Tris, pH 7.5, 0.3% NP-40, 1 mM DTT) containing 200 µM Ac-DEVD-pNA (Sigma). Cleavage was monitored colorimetrically at 405 nm after 4 hours at 37°C. Due to general lower DEVDase activity in THP-1 cells, DEVDase activity was measured fluorometrically. For this purpose, TF3-DEVD-FMK (Cell Meter™ Live Cell Caspase-3/7 Binding Assay Kit, AAT Bioquest) at 1:150 ratio was added to the cells 60 minutes before the experimental endpoint. Cells were washed twice for 3 minutes in Washing Buffer (Kit component B) before fluorescent intensity was monitored in the well area scanning mode at Ex/Em = 550/595 nm in the Synergy H1 plate reader. Caspase activation in the lysates was directly detected by western blot using antibodies against active caspases-3, -7 and − 9, as well as cleaved Parp1 (Cleaved Caspase Antibody Sampler Kit #9929, Cell Signaling) according to manufacturer`s recommendations. Assessment of host cell viability by MTS assay, LDH release and microscopy 2 hours before the experimental endpoint, MTS reagent (MTS Assays Kit, abcam) was added (1:10 ratio) to host cells (treated as above), the absorbance was then measured at 490 nm wavelength. Cells were gently spun (300 x g, 3 minutes) before the supernatant was transferred into flat-bottomed 96-well plates for the assessment of LDH release (Cytotoxicity Detection kit, Roche) according to the manufacturer`s recommendations. To some wells, Triton X-100 (Sigma) was added to a final concentration of 0.1% before the centrifugation to determine the maximal release. For microscopy, HeLa cells were seeded in culture medium at a density of 10 5 cells in 200 µl on glass coverslips in 24-well plates overnight, and then infected and treated in infection medium with Listeria as above. 1 hour before fixation, FITC-DEVD-fmk (abcam) was added to the cells to a final concentration of 60 µM. The cells were then fixed and washed twice with PBS before staining with phalloidin-AF647 (250 nM, ThermoFisher) and Hoechst (1 µg/ml, Sigma) for 30 minutes at room temperature in the dark. Additionally, HeLa cells were infected and treated as above with Lm , prestained with 2 µM CFSE (Sigma) for 30 minutes on ice. To assess early cell death, infected cells were fixed in cold methanol (-20°C) for 15 minutes, washed twice with PBS and then stained with the CytoDEATH M30 antibody (Roche) and Hoechst (1 µg/ml, Sigma) for 1 hour at room temperature in the dark. After the primary antibody, cells were washed with PBS and then counterstained with anti-mouse IgG-AF594 (R&D Systems) for 30 minutes at room temperature. As positive control to induce cell death in these experiments, some wells were treated with 0.1 µg/ml staurosporine (STS). All stained cover slips were washed twice with PBS before mounting in Vectashield (Vectorlabs) and analysis by confocal microscopy (Leica SP5). Caspase-3 purification Recombinant, human caspase-3 was purified from E. coli as described ( 53 , 54 ). In brief, the pET21b-Caspase-3 plasmid (Addgene) was transformed into BL-21 E. coli . These cells were grown to a density of A 600nm = 0.6–0.8 at 37°C and 220 rpm in 500ml of induction medium (20 g/l Tryptone, 10 g/l yeast extract, 5 g/l NaCl, 0.4% glucose, 1 mM MgCl 2 , 0.1 mM CaCl2) containing 0.1 mg/ml ampicillin. Isopropyl-1-thio-b-D-galactopyranoside (IPTG, 1 mM) was added, and the culture was shaken at 25°C, 200 rpm for 3 hours. Cells were pelleted (centrifugation 3000 x g for 12 minutes) and resuspended in 50 ml of His binding buffer (100 mM Tris-HCl, 20 mM imidazole, and 500 mM NaCl, pH 8.0) containing 0.1 mg/ml lysozyme and 0.1% Triton X-100. The cells are incubated for 40 minutes on ice and vortexed every 10 minutes. Then, the cells underwent three freeze-thaw cycles and a sonication to make the sample less viscous. After centrifugation (17’000 x g for 47 minutes at 4°C), the supernatant was harvested and 50ml of His binding buffer were added to dilute it. After filtration with a 0.22 µm filter, the supernatant was loaded onto a 5ml HisTrap HP column (Cytiva, 17524801) equilibrated with His binding buffer. The purified caspase-3 protein was eluted from the column using a linear imidazole gradient (until 1 M imidazole). A sample of each fraction were used for a gel electrophoresis and Coomassie staining to select the fraction containing the caspase-3 protein. These fractions were mixed and concentrated using a 3 kDa MWCO Amicon filter (Millipore, UFC9003), and the buffer was changed by caspase-3 buffer (50 mM HEPES, pH 7.4, 0.1% CHAPS, 10 mM DTT, 100 mM NaCl, 1 mM EDTA and 10% sucrose). Assessment of caspase-3 substrate cleavage in the Lm secretome by comparative 2D SDS-PAGE and TAILS proteomics Lm were grown to mid-log in 100 ml of BHI medium supplemented with 50 µg/ml streptomycin. Then, the bacteria were grown in 100 ml of RPMI-1640 medium (Pan Biotech, P04-18500) supplemented with 50 µg/ml streptomycin for 4 hours at 37°C at 180 rpm. The supernatant was harvested after centrifugation of the bacterial culture (4000 rpm for 15 minutes) and filtered with a 0.22 µm filter. The supernatant proteins were concentrated by ultrafiltration using a 3 kDa MWCO Amicon filter (Millipore, UFC9003), and the RPMI was exchanged by caspase-3 assay buffer (20 mM HEPES, pH 7.4, 0.1% CHAPS, 5 mM DTT, 2 mM EDTA). 50 µg of supernatant proteins were treated or not with 500 µg/ml of caspase-3 for 24 hours at 37°C and then precipitated by trichloroacetic acid precipitation. The samples were used either for 2D SDS-PAGE or TAILS proteomics assays. For 2D SDS-PAGE, the precipitated proteins were resuspended into 300 µl of 2-D sample solution (7M urea, 2M thiourea, 4% (w/v) CHAPS, 40mM DTT, 0.2% (w/v) Bio-Lyte® ampholytes pH3-10) and passively loaded into a 17cm immobilized pH gradient (IPG) strip pH3-10 for 16 hours (Bio-rad, 1632007). The proteins were then separated according to their isoelectric pH by isoelectric focusing. Thereafter, the IPG strip was treated with 1% w/v dithiothreitol (DTT) and 4% w/v iodoacetamide (IAA) for reduction and alkylation of proteins respectively. The proteins were then separated according to their molecular weight by electrophoresis. For this, the strip was placed on the top of a 12% polyacrylamide gel and fixed with 0.5% agarose solution. The 2D SDS-PAGE experiments have been carried out with the Bio-rad materials according to the provided instructions. For the visualization of protein spots, the gel was first fixed and then stained in silver stain (Silver stain plus kit, Bio-Rad, 1610449). Pictures of the stained gels were taken with the Perfection V850 Pro scanner (Epson). The Delta2D (DECODON) software was used to analyze the gel pictures and select the spots to pick up for mass spectrometry (MS) analysis. Spots whose intensities changed by at least a factor 2 upon caspase-3 treatment in three replicate analyses were selected for MS analysis. Before MS analysis, each spot was destained and the proteins were digested by trypsin, extracted from the gel pieces, and cleaned up. For the TAILS, a protocol adapted from Kleifeld et al (2011) was used. Briefly, the precipitated proteins were resuspended into 50 µl of TAILS buffer (2.5 M GuHCl, 250 mM HEPES, pH 7.8). The proteins were denaturated with 1 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) for 1 hour at 65°C, and alkylated with 5 mM chloroacetamide (CAA) for 30 minutes at 65°C. The N-termini were labelled with stable isotopes (TMTsixplex™ Isobaric Label Reagent Set, ThermoFisher, 90061) for 1 hour at room temperature. The quench labelling reaction was then done with a final concentration of 100 mM ammonium bicarbonate (NH 4 HCO 3 ), for 30 minutes at room temperature. The clean-up of samples was performed by the addition of ice-cold acetone (7 volumes) and methanol (1 volume), followed by the incubation of samples for 2 hours at -80°C. After centrifugation at 4’700 rpm for 20 minutes, the protein pellet was washed with 5 mL of ice-cold methanol and then resolubilized with 100 mM NaOH solution (as little as possible), followed by the addition of HEPES buffer, pH 7.8, to a final concentration of 100 mM. Trypsin (Promega, V5113) was added at a 1:100 ratio (enzyme/substrate), and the mixture was incubated at 37°C for 18 hours. Adjust the pH of the samples to pH 6–7 using 2 M HCl. Add fivefold excess (w/w) of hyperbranched polyglycerol-aldehydes (HPG-ALD) polymer (Flintbox) and 5 M NaBH 3 CN to a final concentration of 50 mM NaBH 3 CN and incubate at least 16 hours at 37°C. Thereafter, the polymer is separated from the unbounded peptides by ultrafiltration using a 30 kDa MWCO Amicon filter (Millipore, UFC5030). The TAILS samples were acidified to pH < 2 using 10% trifluoroacetic acid (TFA) and cleaned up. For this, the proteins were loaded onto a column made of C18 solid phase extraction (SPE) disks (Empore, 66883-u). The samples were washed twice with 0.1% formic acid, eluted with a solution of 80% acetonitrile, 0.1% TFA, and completely dried under vacuum. Mass spectrometry analysis and data extraction Liquid Chromatography Mass Spectrometry/ Mass Spectrometry (LC-MS/MS) measurements were performed on a Q Exactive HF-X mass spectrometer (Thermo Scientific) coupled to an EASY-nLC 1000 nanoflow-HPLC (Thermo Scientific). Peptides were separated on a fused silica HPLC-column tip (75 µm inner diameter (New Objective), self-packed with ReproSil-Pur 120 C18-AQ, 1.9 µm particle size (Dr. Maisch GmbH) to a length of 20 cm) using a gradient of A (0.1% formic acid in H 2 O) and B (0.1% formic acid in 80% acetonitrile in H 2 O): samples were loaded with 0% B with a flow rate of 600 nL/min; peptides were separated by 5–30% B within 85 min with a flow rate of 250 nL/min. Spray voltage was set to 2.3 kV and the ion-transfer tube temperature to 250°C; no sheath and auxiliary gas were used. The mass spectrometer was operated in the data-dependent mode; after each MS scan (mass range m/z = 370–1750; resolution: 120,000), a maximum of twelve MS/MS scans were performed using an isolation window of 1.6, a normalized collision energy of 28%, a target Automatic Gain Control of 1e5 and a resolution of 30,000. MS raw files were analyzed with the MaxQuant software ( 55 ), using the UniProt full-length Listeria monocytogenes proteome (UP000001288), additionally including common contaminants (e.g., keratin) and trypsin, as reference. Carbamidomethylcysteine was set as fixed modification and protein amino-terminal acetylation and oxidation of methionine were set as variable modifications. The MS/MS tolerance was set to 20 ppm and three missed cleavages were allowed using Trypsin/P as enzyme specificity. Peptide and protein false discovery rates (FDR), based on a forward-reverse database, were set to 0.01, minimum peptide length was set to 7, and minimum number of unique peptides for identification of proteins was set to one. The “match-between-run” option was used with a time window of 0.7 min. MS raw files of TAILS experiment were processed using Proteome Discoverer software (Thermo Scientific) following the protocol of Madzharova et al. ( 56 ). Experimental validation of the proteomics data Cleavage of native LLO was experimentally confirmed by treating cell free Lm culture supernatant (as above) with indicated concentrations of purified caspase-3 at 37°C and analyzed by immunoblot using rabbit anti-LLO antibodies (Abcam). In addition, LLO-GST and Iap-GST fusion proteins using the constructs, pGEX4Ti-LLO or pGEX4Ti-Iap, respectively, in E. coli BL21 were purified on a GST column (GSTtrap HP, GE Healthcare) following the manufacture`s recommendation. These fusion proteins were treated with indicated concentrations of caspase-3 for 4 hours and analyzed on Coomassie stained SDS-PAGE. Statistics All experiments were performed in triplicates and were at least three times independently repeated. Data are presented as means ± SEM. Comparisons between the different groups were performed with two-tailed unpaired Student`s t tests (using Microsoft Excel). P values of less than 0.05 were considered significant. For the growth experiments in Figs. 2C-D and G-H, significant differences refer to the measured raw data of lag times before calculation of CFUs. Declarations Acknowledgements We want to thank Marianne Blanchard for excellent technical support, and Dirk Bumann, Biozentrum, University of Basel, Switzerland, for providing Salmonella Typhimurium SL1344. pIMK2 was a kind gift from Colin Hill, School of Microbiology, University College Cork, Ireland. Funding : This work was partially supported by the Swiss National Science Foundation (grant # 310030_169928 to MW; 31003A_182729 to PYM), the Vontobel Foundation, Novartis Foundation for Medical-Biological Research, the Kurt and Senta Herrmann Foundation, and the Research Pool of the University of Fribourg (to MW). Author’s contributions : MW conceived and conceptualized the study by providing the methodology and design of most assays. ML, RS, SDG, SB, MB, OA, TM, TS, LC, AF, PM, MS conducted the investigation. MW, ML, RS, MS, DK, and PYM analyzed the data. MW wrote the original draft of the manuscript. ML, RS, DK and PYM wrote, reviewed, and edited the manuscript. MW supervised the study. Declaration of interests : The authors have nothing to disclose. Data and materials availability The proteomics dataset generated and analyzed during in this study is available in table S1. All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. All materials are available under request to the corresponding author. References P. Cossart, Illuminating the landscape of host-pathogen interactions with the bacterium Listeria monocytogenes. Proceedings of the National Academy of Sciences of the United States of America 108, 19484–19491 (2011). V. Ramaswamy et al. , Listeria–review of epidemiology and pathogenesis. J Microbiol Immunol Infect 40, 4–13 (2007). B. Korkmaz, T. Moreau, F. Gauthier, Neutrophil elastase, proteinase 3 and cathepsin G: physicochemical properties, activity and physiopathological functions. Biochimie 90, 227–242 (2008). T. O. Hirche et al. , Neutrophil elastase mediates innate host protection against Pseudomonas aeruginosa. J Immunol 181, 4945–4954 (2008). I. Hahn et al. , Cathepsin G and neutrophil elastase play critical and nonredundant roles in lung-protective immunity against Streptococcus pneumoniae in mice. Infect Immun 79, 4893–4901 (2011). K. Steinwede et al. , Cathepsin G and neutrophil elastase contribute to lung-protective immunity against mycobacterial infections in mice. J Immunol 188, 4476–4487 (2012). Y. Weinrauch, D. Drujan, S. D. Shapiro, J. Weiss, A. Zychlinsky, Neutrophil elastase targets virulence factors of enterobacteria. Nature 417, 91–94 (2002). E. Arnett et al. , The Pore-Forming Toxin Listeriolysin O Is Degraded by Neutrophil Metalloproteinase-8 and Fails To Mediate Listeria monocytogenes Intracellular Survival in Neutrophils. Journal of immunology, (2013). M. Walch et al. , Cytotoxic cells kill intracellular bacteria through granulysin-mediated delivery of granzymes. Cell 157, 1309–1323 (2014). D. López León et al. , Granzyme B Attenuates Bacterial Virulence by Targeting Secreted Factors. Iscience 23, (2020). I. Jorgensen, M. Rayamajhi, E. A. Miao, Programmed cell death as a defence against infection. Nature Reviews Immunology 17, 151–164 (2017). S. M. Behar, V. Briken, Apoptosis inhibition by intracellular bacteria and its consequence on host immunity. Current Opinion in Immunology 60, 103–110 (2019). H. Wajant, K. Pfizenmaier, P. Scheurich, Tumor necrosis factor signaling. Cell death and differentiation 10, 45–65 (2003). C. Garrido et al. , Mechanisms of cytochrome c release from mitochondria. Cell death and differentiation 13, 1423–1433 (2006). D. Chowdhury, J. Lieberman, Death by a thousand cuts: granzyme pathways of programmed cell death. Annu Rev Immunol 26, 389–420 (2008). A. Lawen, Apoptosis - an introduction. Bioessays 25, 888–896 (2003). C. V. Srikanth et al. , Salmonella pathogenesis and processing of secreted effectors by caspase-3. Science 330, 390–393 (2010). A. H. Boulares et al. , Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis - Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells. Journal of Biological Chemistry 274, 22932–22940 (1999). L. Faleiro, Y. Lazebnik, Caspases disrupt the nuclear-cytoplasmic barrier. Journal of Cell Biology 151, 951–959 (2000). S. R. White et al. , Initiation of apoptosis by actin cytoskeletal derangement in human airway epithelial cells. American Journal of Respiratory Cell and Molecular Biology 24, 282–294 (2001). C. Caulin, G. S. Salvesen, R. G. Oshima, Caspase cleavage of keratin 18 and reorganization of intermediate filaments during epithelial cell apoptosis. Journal of Cell Biology 138, 1379–1394 (1997). O. Kleifeld et al. , Identifying and quantifying proteolytic events and the natural N terminome by terminal amine isotopic labeling of substrates. Nature Protocols 6, 1578–1611 (2011). K. J. Tanaka, S. Song, K. Mason, H. W. Pinkett, Selective substrate uptake: The role of ATP-binding cassette (ABC) importers in pathogenesis. Biochim Biophys Acta Biomembr 1860, 868–877 (2018). A. de las Heras, R. J. Cain, M. K. Bielecka, J. A. Vazquez-Boland, Regulation of Listeria virulence: PrfA master and commander. Current Opinion in Microbiology 14, 118–127 (2011). A. Vermassen et al. , Cell Wall Hydrolases in Bacteria: Insight on the Diversity of Cell Wall Amidases, Glycosidases and Peptidases Toward Peptidoglycan. Frontiers in Microbiology 10, 331 (2019). D. Szklarczyk et al. , The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic acids research 51, D638-D646 (2023). S. Pilgrim, A. Kolb-Mäurer, I. Gentschev, W. Goebel, M. Kuhn, Deletion of the gene encoding p60 in leads to abnormal cell division and loss of actin-based motility. Infection and immunity 71, 3473–3484 (2003). J. Verspurten, K. Gevaert, W. Declercq, P. Vandenabeele, SitePredicting the cleavage of proteinase substrates. Trends in Biochemical Sciences 34, 319–323 (2009). S. C. Fu, K. Imai, T. Sawasaki, K. Tomii, ScreenCap3: Improving prediction of caspase-3 cleavage sites using experimentally verified noncleavage sites. Proteomics 14, 2042–2046 (2014). S. Koster et al. , Crystal structure of listeriolysin O reveals molecular details of oligomerization and pore formation. Nature Communications 5, (2014). A. L. Decatur, D. A. Portnoy, A PEST-like sequence in listeriolysin O essential for pathogenicity. Science 290, 992–995 (2000). H. W. Rogers, M. P. Callery, B. Deck, E. R. Unanue, Listeria monocytogenes induces apoptosis of infected hepatocytes. Journal of immunology 156, 679–684 (1996). C. E. McDougal, J. D. Sauer,: The Impact of Cell Death on Infection and Immunity. Pathogens 7, (2018). S. K. B. Cassidy et al. , Membrane Damage during Listeria monocytogenes Infection Triggers a Caspase-7 Dependent Cytoprotective Response. PLoS pathogens 8, (2012). S. Patel, D. M. Wall, A. Castillo, B. A. McCormick, Caspase-3 cleavage of Salmonella type III secreted effector protein SifA is required for localization of functional domains and bacterial dissemination. Gut Microbes 10, 172–187 (2019). M. Lamkanfi, T. D. Kanneganti, Caspase-7: A protease involved in apoptosis and inflammation. International Journal of Biochemistry & Cell Biology 42, 21–24 (2010). M. Lamkanfi et al. , Targeted Peptidecentric Proteomics Reveals Caspase-7 as a Substrate of the Caspase-1 Inflammasomes. Molecular & Cellular Proteomics 7, 2350–2363 (2008). K. Nozaki et al. , Caspase-7 activates ASM to repair gasdermin and perforin pores. Nature 606, 960–967 (2022). A. V. Goncalves et al. , Gasdermin-D and Caspase-7 are the key Caspase-1/8 substrates downstream of the NAIP5/NLRC4 inflammasome required for restriction of Legionella pneumophila. PLoS pathogens 15, e1007886 (2019). A. Akhter et al. , Caspase-7 Activation by the Nlrc4/Ipaf Inflammasome Restricts Legionella pneumophila Infection. PLoS pathogens 5, (2009). C. V. Nogueira et al. , Rapid Pathogen-Induced Apoptosis: A Mechanism Used by Dendritic Cells to Limit Intracellular Replication of Legionella pneumophila. PLoS pathogens 5, (2009). M. Poe et al. , Human cytotoxic lymphocyte granzyme B. Its purification from granules and the characterization of substrate and inhibitor specificity. The Journal of biological chemistry 266, 98–103 (1991). A. J. Darmon, D. W. Nicholson, R. C. Bleackley, Activation of the apoptotic protease CPP32 by cytotoxic T-cell-derived granzyme B. Nature 377, 446–448 (1995). A. M. Chinnaiyan et al. , Cytotoxic T-cell-derived granzyme B activates the apoptotic protease ICE-LAP3. Current biology: CB 6, 897–899 (1996). F. Andrade et al. , Granzyme B directly and efficiently cleaves several downstream caspase substrates: implications for CTL-induced apoptosis. Immunity 8, 451–460 (1998). D. A. Thomas, C. Du, M. Xu, X. Wang, T. J. Ley, DFF45/ICAD can be directly processed by granzyme B during the induction of apoptosis. Immunity 12, 621–632 (2000). V. G. Lewis, M. P. Ween, C. A. McDevitt, The role of ATP-binding cassette transporters in bacterial pathogenicity. Protoplasma 249, 919–942 (2012). A. Renzoni, P. Cossart, S. Dramsi, PrfA, the transcriptional activator of virulence genes, is upregulated during interaction of with mammalian cells and in eukaryotic cell extracts. Molecular microbiology 34, 552–561 (1999). H. Bierne, P. Cossart, InIB, a surface protein of that behaves as an invasin and a growth factor. Journal of cell science 115, 3357–3367 (2002). C. Coelho et al. , virulence factors, including listeriolysin O, are secreted in biologically active extracellular vesicles. Journal of Biological Chemistry 294, 1202–1217 (2019). I. R. Monk, C. G. Gahan, C. Hill, Tools for functional postgenomic analysis of listeria monocytogenes. Applied and environmental microbiology 74, 3921–3934 (2008). K. L. Heckman, L. R. Pease, Gene splicing and mutagenesis by PCR-driven overlap extension. Nature Protocols 2, 924–932 (2007). P. R. E. Mittl et al. , Structure of recombinant human CPP32 in complex with the tetrapeptide Acetyl-Asp-Val-Ala-Asp fluoromethyl ketone. Journal of Biological Chemistry 272, 6539–6547 (1997). H. R. Stennicke, G. S. Salvesen, Caspases: preparation and characterization. Methods 17, 313–319 (1999). J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnology 26, 1367–1372 (2008). E. Madzharova, F. Sabino, U. Auf dem Keller, Exploring Extracellular Matrix Degradomes by TMT-TAILS N-Terminomics. Methods in molecular biology 1944, 115–126 (2019). Tables Table 1 is available in the Supplementary Files section. Additional Declarations There is no duality of interest Supplementary Files Table1ProteomicssubstratelistTAILSvs2DSDSPAGE.pdf Table 1 Lavergneetal.SupplementaryFigures.pdf Lavergneetal.Westernblots.pdf Cite Share Download PDF Status: Published Journal Publication published 30 Jan, 2025 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4655845\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":322326755,\"identity\":\"510161ae-8569-4fde-a69b-2d9500400e3f\",\"order_by\":0,\"name\":\"Michael Walch\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYDACZgY2IGkBYjUwM1QwMLAxH2BgYGwgqEWCAaSMmeEMUAtbAgEtDMhaGNtAfAJadNuZnz34USHBYHD8YOPnwnmH8/jYeB8w/NyBW4vZYTZzw54zQC1nEpulZ247XMzGxm7A2HsGnxYeNgneNgkGswOJbcy82w4ntsm3MUBciEeL5N9/QC3nHwK1zAFqYWMjrEWatwGo5QbIlgaitLCZScsck+Cxv/GwWZrnWDpYy8FefFrOH34m+abGRk6yP/ngZ54a68T5bWyMD37i0QIDPCi8A4Q1jIJRMApGwSjABwBKcEgnlqEwngAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0001-7284-3291\",\"institution\":\"Faculty of Science and Medicine, Department of Oncology, Microbiology and Immunology, University of Fribourg\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"\",\"lastName\":\"Walch\",\"suffix\":\"\"},{\"id\":322326756,\"identity\":\"62311a5c-9172-4942-8655-27c85c89cb43\",\"order_by\":1,\"name\":\"Marilyne Lavergne\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Marilyne\",\"middleName\":\"\",\"lastName\":\"Lavergne\",\"suffix\":\"\"},{\"id\":322326757,\"identity\":\"c271d919-1c7e-45f2-8524-56070b274320\",\"order_by\":2,\"name\":\"Raffael Schaerer\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Raffael\",\"middleName\":\"\",\"lastName\":\"Schaerer\",\"suffix\":\"\"},{\"id\":322326758,\"identity\":\"066261df-51f3-4717-a8ef-4faa84ee54b3\",\"order_by\":3,\"name\":\"Safaa Bouheraoua\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Safaa\",\"middleName\":\"\",\"lastName\":\"Bouheraoua\",\"suffix\":\"\"},{\"id\":322326759,\"identity\":\"a4f5eea8-1610-4e68-a653-7f058d701029\",\"order_by\":4,\"name\":\"Oluwadamilola Adenuga\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Oluwadamilola\",\"middleName\":\"\",\"lastName\":\"Adenuga\",\"suffix\":\"\"},{\"id\":322326760,\"identity\":\"e1719e65-a74d-47f0-a243-54ac792242b4\",\"order_by\":5,\"name\":\"Tanja Muralt\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tanja\",\"middleName\":\"\",\"lastName\":\"Muralt\",\"suffix\":\"\"},{\"id\":322326761,\"identity\":\"657c57a1-7f6e-49c3-a29f-fc7b9cbada46\",\"order_by\":6,\"name\":\"Tiffany Schaerer\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tiffany\",\"middleName\":\"\",\"lastName\":\"Schaerer\",\"suffix\":\"\"},{\"id\":322326762,\"identity\":\"3d306b83-c4dd-4c32-a842-2ec1a8ced191\",\"order_by\":7,\"name\":\"Léa Chèvre\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Léa\",\"middleName\":\"\",\"lastName\":\"Chèvre\",\"suffix\":\"\"},{\"id\":322326763,\"identity\":\"8b9aa00f-6b13-49d6-b7d1-919b96016df1\",\"order_by\":8,\"name\":\"Alessandro Failla\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alessandro\",\"middleName\":\"\",\"lastName\":\"Failla\",\"suffix\":\"\"},{\"id\":322326764,\"identity\":\"349afc3d-0d59-49f6-a59e-4dc50d5a0115\",\"order_by\":9,\"name\":\"Patricia Matthey\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Patricia\",\"middleName\":\"\",\"lastName\":\"Matthey\",\"suffix\":\"\"},{\"id\":322326765,\"identity\":\"488dade9-3da2-47ae-bdf4-0918551ff6a7\",\"order_by\":10,\"name\":\"Michael Stumpe\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"\",\"lastName\":\"Stumpe\",\"suffix\":\"\"},{\"id\":322326766,\"identity\":\"ea411e66-9a1d-4044-8909-d5593b6b2157\",\"order_by\":11,\"name\":\"Dieter Kressler\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Fribourg\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dieter\",\"middleName\":\"\",\"lastName\":\"Kressler\",\"suffix\":\"\"},{\"id\":322326767,\"identity\":\"70254664-e084-40cb-8728-0b1480edd067\",\"order_by\":12,\"name\":\"Pierre-Yves Mantel\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Fribourg, Switzerland\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Pierre-Yves\",\"middleName\":\"\",\"lastName\":\"Mantel\",\"suffix\":\"\"},{\"id\":322326768,\"identity\":\"dc5d1d62-1aba-476d-9a73-888ab490c647\",\"order_by\":13,\"name\":\"Sara De Grandis\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Fribourg, Switzerland\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sara\",\"middleName\":\"\",\"lastName\":\"De Grandis\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-06-28 15:55:48\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4655845/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4655845/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41419-025-07365-x\",\"type\":\"published\",\"date\":\"2025-01-30T05:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":63462137,\"identity\":\"cf4dbf5a-2d70-419c-9036-c6d8c32cb02d\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:41\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":187310,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExecutioner caspases activity is induced by \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eListeria monocytogenes\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e infection in viable host cells that inhibits intracellular growth.\\u003c/strong\\u003e (\\u003cstrong\\u003eA\\u003c/strong\\u003e) HeLa cells were treated with staurosporine (STS, 0.1 mg/ml) or infected with virulent \\u003cem\\u003eLm\\u003c/em\\u003e (WT, strain 10403S), listeriolysin O deficient \\u003cem\\u003eLm\\u003c/em\\u003e (ΔLLO) or \\u003cem\\u003eSalmonella enterica\\u003c/em\\u003e serovar Typhimurium (SL1344) at a MOI of 1 for 1 hour before extracellular bacteria were removed by gentamicin treatment. After further culture, the cells were lysed at indicated time points before caspase activity in the lysates was assessed using the chromogenic dye DEVD-pNA. Averages +/- SEM of three independent experiments are shown. HeLa cells infected with indicated bacteria as above +/- DEVD (20 mM), zVAD (20 mM) or STS (0.1 mg/ml) treatment were lysed at the indicated time points and their lysates were assessed by western blot for active caspases-9 and -7, as well as the caspase-3-cleavage fragment of Parp1 (\\u003cstrong\\u003eB\\u003c/strong\\u003e) or active caspase-3 after 16 hours (\\u003cstrong\\u003eC\\u003c/strong\\u003e). a-tubulin served as loading control. Representative blots of three independent experiments are shown. DEVDase activity (\\u003cstrong\\u003eD\\u003c/strong\\u003e), MTS metabolic activity (\\u003cstrong\\u003eE\\u003c/strong\\u003e) and LDH release (\\u003cstrong\\u003eF\\u003c/strong\\u003e) were assessed in HeLa cells infected as above for 16 hours with \\u003cem\\u003eLm\\u003c/em\\u003e WT, \\u003cem\\u003eLm\\u003c/em\\u003e ΔLLO or in uninfected cells +/- TNF-a (10ng/ml) +/- zVAD (20 mM) treatment. Average +/- SEM of three independent experiments is shown. (\\u003cstrong\\u003eG\\u003c/strong\\u003e) HeLa cells were infected with \\u003cem\\u003eLm\\u003c/em\\u003e WT as above +/- DEVD-fmk (20 mM), zVAD (20 mM) or TNF-a (10ng/ml) treatment. At indicated times, cells were lysed, and \\u003cem\\u003eLm\\u003c/em\\u003ewere enumerated by CFU assay. Average +/- SEM of three independent experiments is presented. Asterisks indicate significant differences to untreated controls. P values are * \\u0026lt;0.05, ** \\u0026lt;0.01 and *** \\u0026lt;0.005.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/579798bbf6ee32d74917011c.png\"},{\"id\":63462134,\"identity\":\"a11dde24-b752-4f55-a9ff-f11372de3946\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:41\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":952735,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDEVDase activity is induced by \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLm\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e infection in presence of TNF-a without visible signs of cell death.\\u003c/strong\\u003e HeLa cells were infected with \\u003cem\\u003eLm\\u003c/em\\u003e at a MOI of 1 in presence of TNF-a (\\u003cstrong\\u003eA\\u003c/strong\\u003e), left without any manipulations (\\u003cstrong\\u003eB\\u003c/strong\\u003e), or treated with STS (0.1 mg/ml) (\\u003cstrong\\u003eC\\u003c/strong\\u003e) for 7 hours before staining the cells with FITC-DEVD-fmk for another hour. After fixation, the cells were counterstained with Hoechst and 647-phallodin, then analyzed by confocal microscopy and quantified (\\u003cstrong\\u003eD\\u003c/strong\\u003e) by counting five visible fields (n ~50) in three independent experiments. Presented are average +/- SEM. Significant differences are indicated. P values are * \\u0026lt;0.05, ** \\u0026lt;0.01 and *** \\u0026lt;0.005. (\\u003cstrong\\u003eE\\u003c/strong\\u003e) In HeLa cells, infected with green fluorescent \\u003cem\\u003eLm\\u003c/em\\u003e (white arrow) in presence of TNF-a, or treated with STS (0.1 mg/ml) for 7 hours, cytokeratin-18 cleavage was assessed using the M30 Cytodeath® antibody and microscopic analysis. In all panels, bars are 20 mm. Depicted are representative images from three independent experiments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/8d8223b087cb4d0ddd91419a.png\"},{\"id\":63462135,\"identity\":\"bb2220cd-9276-45d9-a635-53d6a35f7999\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:41\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":70938,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHost cells depleted of executioner caspases are less resistant to intracellular bacterial growth.\\u003c/strong\\u003e Parental HeLa or commercial caspase-3 KO (C3) cells (abcam) were nucleofected with Cas9/guide RNA ribonucleoproteins (RNPs) targeting caspase-7 before enriching for deletion lines by limited dilutions. Knockout was confirmed by immunoblot using anti caspase-3, caspase-7 and α-tubulin antibodies (\\u003cstrong\\u003eA\\u003c/strong\\u003e). Caspase-deficient and parental HeLa cells were infected with WT \\u003cem\\u003eListeria \\u003c/em\\u003eat MOI 0.1 for 16 hours +/- TNF-α before the cells were lysed and DEVDase activity was measured using DEVD-pNA (\\u003cstrong\\u003eB\\u003c/strong\\u003e), and CFU were calculated from bacterial growth curves as shown in Figure S2 (\\u003cstrong\\u003eC\\u003c/strong\\u003eand \\u003cstrong\\u003eD\\u003c/strong\\u003e). Averages +/- SEM of three independent experiments are shown.\\u003c/p\\u003e\\n\\u003cp\\u003eTHP-1 cells were nucleofected with Cas9/guide RNPs targeting caspase-3 or -7 before cloning by limited dilutions and assessment by western blot (\\u003cstrong\\u003eE\\u003c/strong\\u003e). Cells were infected with \\u003cem\\u003eLm\\u003c/em\\u003eat the MOI of 0.1 for 16 hours +/- TNF-α before the cells were lysed and DEVDase activity using fluorescent DEVD-fmk (\\u003cstrong\\u003eF\\u003c/strong\\u003e), and CFU were determined as above (\\u003cstrong\\u003eG\\u003c/strong\\u003e). WT and caspase-7 KO THP-1 cells were additionally infected with SL1344 at a MOI of 0.001 +/- TNF-α for 16 hours before intracellular CFU were calculated from growth curves as shown in Figure S2 (\\u003cstrong\\u003eH\\u003c/strong\\u003e). Averages +/- SEM of three independent experiments are shown and significant differences between groups are indicated by asterisks. P values are * \\u0026lt;0.05, ** \\u0026lt;0.01 and *** \\u0026lt;0.005.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/d5b92807e89ddeb8dc6f20b0.png\"},{\"id\":63462912,\"identity\":\"b2fe8600-abe4-45e7-acfa-054c9a5725a4\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:47:41\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":410368,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCaspase-3 targets multiple vital \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLm\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003epathways related to pathogen-host interactions.\\u003c/strong\\u003e Cell-free \\u003cem\\u003eLm\\u003c/em\\u003e supernatants were treated with purified caspase-3 before analysis by comparative 2D SDS-PAGE (\\u003cstrong\\u003eA\\u003c/strong\\u003e, analyzed spots are indicated on the non-treated gel) or by TAILS degradomics (\\u003cstrong\\u003eB\\u003c/strong\\u003e, Venn Diagram). The overlap in proteins is depicted in \\u003cstrong\\u003eC\\u003c/strong\\u003e. All proteins are listed in supplementary Table 1 and the protein network analysis is indicated in Figure S3. Gene ontology analysis using ShinyGO 0.80 software revealed several significantly enriched pathways (\\u003cstrong\\u003eD\\u003c/strong\\u003e) that demonstrated to be highly interconnected (\\u003cstrong\\u003eE\\u003c/strong\\u003e). Two pathways (green nodes) are considered connected if they share at least 20% genes. Darker nodes represent more significantly enriched gene sets and bigger nodes are larger gene sets. Thicker edges indicate more overlapped genes. (\\u003cstrong\\u003eF\\u003c/strong\\u003e) Gene ontology analysis indicates significant enrichment in cellular component. Dashed line shows the FDR cut-off p-value of 0.05. Caspase-3-mediated degradation (concentrations from 25 mg/ml to 100 mg/ml for 4 hours) of LLO in \\u003cem\\u003eLm\\u003c/em\\u003e supernatant was confirmed by western blot (\\u003cstrong\\u003eG\\u003c/strong\\u003e), and of purified GST-tagged LLO and Iap by Coomassie stained SDS-PAGE (\\u003cstrong\\u003eH\\u003c/strong\\u003e). Full-length protein, cleavage fragments and caspase-3 are indicated by arrow heads.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/9e6ee6be55f9b9fa696a6942.png\"},{\"id\":63462130,\"identity\":\"3d2c3485-50a4-4c7e-abfd-9a010ca9eb0a\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:40\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":39491,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eA \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLm\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e line secreting caspases-3 and -7-uncleavable LLO is more virulent in HeLa cells.\\u003c/strong\\u003e Culture supernatants of ΔLLO \\u003cem\\u003eLm\\u003c/em\\u003e, transfected with indicated pIMK2 constructs (\\u003cstrong\\u003eA\\u003c/strong\\u003e), were treated with caspase-3 or caspase-7 for 4 hours (\\u003cstrong\\u003eB\\u003c/strong\\u003e). Secretion and caspase-mediated cleavage of LLO were assessed by LLO immunoblots. Detection of Iap served as loading control in (\\u003cstrong\\u003eA\\u003c/strong\\u003e). (\\u003cstrong\\u003eC\\u003c/strong\\u003e), Human red blood cells were treated with serial dilutions (\\u003cstrong\\u003eC\\u003c/strong\\u003e) or caspase-treated (\\u003cstrong\\u003eD\\u003c/strong\\u003e) \\u003cem\\u003eLm\\u003c/em\\u003esupernatants containing LLOwt or LLOc3/7 for 15 minutes at 37° C. Hemoglobin release was measured spectrophotometrically at 405 nm wavelength and average +/- SEM of three independent experiments is presented. (\\u003cstrong\\u003eE\\u003c/strong\\u003e), HeLa cells were infected with indicated \\u003cem\\u003eLm\\u003c/em\\u003e mutants +/- zVAD +/- TNF-α treatment before the intracellular bacterial load was assessed by growth curves assay. Arrows indicate the differences in delay times to the zVAD controls to reach the threshold OD of 0.1 that is plotted in (\\u003cstrong\\u003eF\\u003c/strong\\u003e). Average +/- SEM of the delay time normalized to zVAD controls in three independent experiments is shown. Significant differences between indicated groups are marked by asterisks. P values are * \\u0026lt;0.05, ** \\u0026lt;0.01 and *** \\u0026lt;0.005.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/d54a81609c346cabb21ce62a.png\"},{\"id\":75925718,\"identity\":\"d2c3ed8c-ca07-47d4-8c4d-9f1c2d9904f1\",\"added_by\":\"auto\",\"created_at\":\"2025-02-10 15:13:47\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3335853,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/715064a2-d1ac-4347-a04d-f4b5ea3e17d0.pdf\"},{\"id\":63462131,\"identity\":\"98820c21-4baf-4e07-bfd2-ec1bcd578620\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:41\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":176032,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTable 1\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Table1ProteomicssubstratelistTAILSvs2DSDSPAGE.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/b7b753c17f6985f6ca820f89.pdf\"},{\"id\":63462138,\"identity\":\"395c2f9c-efad-403d-aa26-d8fb0db48d44\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:39:41\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":2050273,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Lavergneetal.SupplementaryFigures.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/68b3e4dc89daa3b0866af457.pdf\"},{\"id\":63463470,\"identity\":\"8ddf4840-a154-4816-ae24-d22f712f550c\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 11:55:41\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":558396,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Lavergneetal.Westernblots.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4655845/v1/2f03a4edc054cddf72691a7f.pdf\"}],\"financialInterests\":\"There is no duality of interest\",\"formattedTitle\":\"Executioner caspases degrade essential mediators of pathogen-host interactions to inhibit growth of intracellular Listeria monocytogenes\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eTo survive in the host, pathogenic bacteria evolved multiple effectors that allow specific interactions with the host to form a protective niche. The virulence strategy of \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e (\\u003cem\\u003eLm\\u003c/em\\u003e) is characterized by uptake even in non-phagocytic cells, such as epithelial cells. After uptake, they avoid lethal lysosomal degradation by a phagosomal escape mechanism, which is promoted by their key virulence mediator, listeriolysin O (LLO). In the cytosol, \\u003cem\\u003eLm\\u003c/em\\u003e specifically interact with the actin cytoskeleton to gain motility for cell-to-cell spread, a process that is again mediated by LLO (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). By successfully doing so, \\u003cem\\u003eLm\\u003c/em\\u003e cause a life-threatening disease in humans, particularly in the immunocompromised and during pregnancy (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eImmune proteases have been recognized to display crucial internal barrier function in antibacterial defense. Neutrophil effector proteases have been demonstrated to be critical for the elimination of gram\\u0026thinsp;+\\u0026thinsp;and gram- bacteria in \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo\\u003c/em\\u003e models (\\u003cspan additionalcitationids=\\\"CR4 CR5\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). These proteases were demonstrated to target bacterial proteins related to virulence (\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e), including LLO (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). Our work revealed that the lymphocytic effector proteases, the granzymes, target bacterial proteins to inhibit their growth (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e), including virulence mediators (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe induction of programed host cell death, particularly its lytic forms, necroptosis and pyroptosis, is widely recognized to act as an innate antibacterial defense barrier (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). Less defined in antibacterial defense is the role of apoptosis (\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e), which is the immunologically silent, non-lytic form of programmed cell death, characterized by DNA fragmentation, chromatin condensation, membrane blebbing and cytoskeletal breakdown. This process relies on an intracellular cascade of the caspases. Initiator caspases-8 and \\u0026minus;\\u0026thinsp;9 are activated by extrinsic factors, such as death receptor activation by tumor necrosis factor alpha (TNF-α) (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e), intrinsic mediators, such as mitochondrial cytochrome C release (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e), or by the granzymes (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e). Upon initiation, the executioner caspases-3, -6 and \\u0026minus;\\u0026thinsp;7 are activated and they then cleave vital substrates resulting in apoptosis (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). Apoptosis in the context of bacterial infections is considered as altruistic death, depriving intracellular bacteria of their protected niche. In this study, we have asked specifically if activated executioner caspases engage in more direct interactions with intracellular bacteria to inhibit their growth.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eExecutioner caspases activity is induced by\\u003c/b\\u003e \\u003cb\\u003eLm\\u003c/b\\u003e \\u003cb\\u003einfection and inhibits their intracellular growth\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo experimentally confirm executioner caspases activity upon infection, we infected HeLa cells with WT or LLO-deficient \\u003cem\\u003eLm\\u003c/em\\u003e and monitored executioner caspases (DEVDase) activity using the chromogenic caspase-3 and \\u0026minus;\\u0026thinsp;7 substrate, Ac-DEVD-pNA (Fig.\\u0026nbsp;1A). We also infected HeLa cells with \\u003cem\\u003eSalmonella enterica\\u003c/em\\u003e serovar Typhimurium, in which caspase-3 activation was already mechanistically explored (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). WT \\u003cem\\u003eListeria\\u003c/em\\u003e and \\u003cem\\u003eSalmonella\\u003c/em\\u003e but not LLO-deficient \\u003cem\\u003eLm\\u003c/em\\u003e led to significant increase of DEVDase activity 5 hours postinfection. The colorimetric data were confirmed by western blot analysis using antibodies against the active forms of the initiator caspase-9, the executioner caspase-7 and the 89 kDa cleavage fragment of Parp1, which results upon caspase-3 cleavage (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e) (Fig.\\u0026nbsp;1B), as well as caspase-3 (Fig.\\u0026nbsp;1C). Infections with virulent \\u003cem\\u003eSalmonella\\u003c/em\\u003e and \\u003cem\\u003eListeria\\u003c/em\\u003e increased the signal intensity of cleaved Parp1, active caspase-9 and caspase-7 already after 5 hours, as well as of caspase-3 (monitored 16 hours postinfection). The LLO-deficient \\u003cem\\u003eListeria\\u003c/em\\u003e strain did not show caspase-9 activity or Parp1 cleavage but showed faint caspase-7 activation after 16 hours, suggesting that it needs LLO for efficient caspase activation. Caspase activation was strongly reduced using the caspases-3 and \\u0026minus;\\u0026thinsp;7 inhibitor DEVD-fmk or with pan-caspase inhibitor zVAD treatment indicating specificity of the detection.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eMost importantly, the inhibition of executioner caspase activity in \\u003cem\\u003eLm\\u003c/em\\u003e-infected HeLa cells with DEVD-fmk or zVAD increased growth of intracellular \\u003cem\\u003eLm\\u003c/em\\u003e whereas the treatment with TNF-a reduced the bacterial burden as compared to untreated cells (Fig.\\u0026nbsp;1G).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eHigh DEVDase activity upon\\u003c/b\\u003e \\u003cb\\u003eLm\\u003c/b\\u003e \\u003cb\\u003einfection and TNF-a does not cause visible signs of cell death\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo assess morphological signs of cell death upon \\u003cem\\u003eLm\\u003c/em\\u003e infection in presence of the proapoptotic agent TNF-a, we used fluorescent DEVD to indicate active caspases by microscopy. Strikingly, around half of the cells displayed bright cytoplasmic DEVD staining after 7 hours upon \\u003cem\\u003eLm\\u003c/em\\u003e infection and TNF-a treatment (Figs.\\u0026nbsp;2A and 2D). However, the nuclear morphology and cytoskeleton organization of the infected cells did not display obvious apoptotic features, similar to negative control HeLa cells (Fig.\\u0026nbsp;2B). This was in stark contrast to STS treatment, leading to nuclear caspase translocation (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e), as well as chromatin condensation and actin cytoskeleton breakdown (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e) (Figs.\\u0026nbsp;2C-D). In addition, in \\u003cem\\u003eLm\\u003c/em\\u003e-infected cells treated with TNF-a, only a few cells bound the Cytodeath\\u0026reg; M30 antibody detecting cleaved cytokeratin-18 in early apoptotic cells (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e) (Fig.\\u0026nbsp;2E). Even in cells showing active \\u003cem\\u003eLm\\u003c/em\\u003e proliferation, cytokeratin-18 remained unaffected (arrow in Fig.\\u0026nbsp;2E). This was again in sharp contrast to STS-treated cells when most of the cells stained positive for M30.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHost cells lacking executioner caspases are less resistant to bacterial infection\\u003c/h2\\u003e \\u003cp\\u003eAs the chemical inhibition of caspases is prone to off-target effects, executioner caspases were deleted in HeLa cells using CRISPR/Cas9 technology. For this purpose, HeLa cells (a commercial caspase-3 knockout (KO) and the corresponding parental line) were nucleofected with Cas9/guide RNA ribonucleoproteins (RNPs) directed to caspase-7 before cloning deletion lines by limited dilutions (Fig.\\u0026nbsp;3A). In the single KO lines, caspase activity was markedly but not statistically significantly reduced in \\u003cem\\u003eLm-\\u003c/em\\u003etreated cells in absence or presence of TNF-a (Fig.\\u0026nbsp;3B). Only the simultaneous deletion of caspase-3 and \\u0026minus;\\u0026thinsp;7 in HeLa cells led to significant reduction of DEVDase activity after \\u003cem\\u003eLm\\u003c/em\\u003e infections; this was particularly obvious in host cells that were simultaneously treated with TNF-a. To reveal the remaining DEVDase activity in single caspase-3 or caspase-7 KO lines, we assessed intracellular Lm growth with and without TNF-a treatment. In these experiments, CFUs were calculated from bacterial growth curves as illustrated in the supplementary Figures \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e. While TNF-a significantly reduced the bacterial burden in the parental HeLa line (WT), bacterial growth was not significantly affected by TNF-a in caspase deleted host cells (Fig.\\u0026nbsp;3C). Only HeLa cells lacking both caspases-3 and \\u0026minus;\\u0026thinsp;7 were less resistant to intracellular \\u003cem\\u003eLm\\u003c/em\\u003e growth than the WT line in absence of TNF-a (Fig.\\u0026nbsp;3D). Of note, though executioner activity in HeLa cells was highly increased upon gram- \\u003cem\\u003eSalmonella\\u003c/em\\u003e infections (Fig.\\u0026nbsp;1A), their growth in caspase-3/7 KO cells was not significantly affected (data not shown), suggesting strain specificity of this caspase-mediated defense mechanism in epithelial cells. To study the impact of the host cell type, we additionally deleted caspase-3 and \\u0026minus;\\u0026thinsp;7 in the monocyte-like human cell line THP-1. While the depletion of caspase-7 was complete, a weak band in the caspase-3 immunoblot still appeared after multiple rounds of nucleofection and limited dilution cloning (Fig.\\u0026nbsp;3E) that was also reflected by the largely unchanged DEVDase activity upon \\u003cem\\u003eLm\\u003c/em\\u003e infection in these lines (Fig.\\u0026nbsp;3F). In contrast to HeLa cells, simultaneous TNF-a treatment did not enhance DEVDase activity neither in the WT cells nor the KO lines. However, there was an increase of the bacterial burden in caspase-7 deficient, \\u003cem\\u003eLm-\\u003c/em\\u003e and surprisingly also \\u003cem\\u003eSalmonella\\u003c/em\\u003e-infected THP-1 cells that was again not affected by simultaneous TNF-a treatment (Figs.\\u0026nbsp;3G and H).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eCaspase-3 degrades\\u003c/b\\u003e \\u003cb\\u003eListeria\\u003c/b\\u003e \\u003cb\\u003esupernatant proteins involved in pathogen-host interactions\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWe next studied if the proteolytic activity of executioner caspases \\u0026ndash; and with that, bacterial substrate degradation \\u0026ndash; might contribute to bacterial growth inhibition. Caspase accessibility was hypothesized to favor degradation of bacterial proteins that are released into the cytoplasm. Therefore, we performed unbiased proteomics approaches to identify caspase-3 substrates in cell-free \\u003cem\\u003eLm\\u003c/em\\u003e supernatants. Comparative 2-dimensional (2D) SDS-PAGE identified 29 proteins whose intensities changed by at least a factor 2 upon caspase-3 treatment in three replicate analyses (Fig.\\u0026nbsp;4A). To backup these findings using an alternative approach, we additionally analyzed the caspase-3 degradome in \\u003cem\\u003eLm\\u003c/em\\u003e supernatants by terminal amine isotopic labeling of substrates (TAILS) (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). TAILS analysis revealed 88 supernatant proteins that were detected as cleaved in three independent replicate samples (Fig.\\u0026nbsp;4B). To our surprise, the overlap of the two analyses was only partial (9 proteins, Fig.\\u0026nbsp;4C), presumably due to major differences in the sensitivities of the assays. All substrates of the two approaches are listed in Table\\u0026nbsp;1. Overlapping proteins are highlighted, including the \\u003cem\\u003eLm\\u003c/em\\u003e virulence factor listeriolysin O (LLO). As the substrate selection criteria in the two approaches were highly stringent (found in 3 replicate samples), we decided to run the bioinformatics analyses with the pooled substrate list of 108 proteins. We first screened the substrate list for pathways that are significantly enriched according to their false discovery rate (FDR) and ordered them by fold enrichment (Fig.\\u0026nbsp;4D). The top enriched pathways include ATP-binding cassette (ABC) transporter complexes, PrfA-dependent virulence factors and peptidoglycan hydrolases, all essential for full virulence \\u003cem\\u003ein vivo\\u003c/em\\u003e (\\u003cspan additionalcitationids=\\\"CR24\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). A pathway network analysis revealed a high interconnectivity between the enriched pathways (Fig.\\u0026nbsp;3E), clearly suggesting targeted substrate selection by caspase-3. Gene Ontology (GO) cellular component analysis indicated as expected on top the extracellular region (Fig.\\u0026nbsp;4F). However, the enrichment of membrane proteins and cytoplasmic proteins in a proteomics analysis of cell-free bacterial supernatant was unexpected. This was also indicated in the protein-protein interaction (PPI) network analysis by the STRING software with most proteins being neither extracellular nor periplasmic (Figure \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003e) (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e). The PPI analysis though with an enrichment p-value of 1.08e-12 proofed to be highly significant, contracting a random set of proteins.\\u003c/p\\u003e \\u003cp\\u003eFor the virulence mediators LLO and Iap, an extracellular endopeptidase (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e), the proteomics data were experimentally validated. Caspase-3 efficiently and dose-dependently cleaved LLO in \\u003cem\\u003eLm\\u003c/em\\u003e supernatants (Fig.\\u0026nbsp;4G), as well as LLO and Iap as purified proteins (Fig.\\u0026nbsp;4H). The detected cleavage fragments of LLO (c-term 52 kDa) and Iap (c-term 45.1 kDa) correspond to the top score sites according to SitePrediction (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e) (Figure S3A), as well as to ScreenCap3 (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eA caspase uncleavable LLO mutant renders\\u003c/b\\u003e \\u003cb\\u003eLm\\u003c/b\\u003e \\u003cb\\u003emore virulent in HeLa cells\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo test if executioner caspase-mediated degradation of LLO directly affects intracellular bacteria growth, we generated a \\u003cem\\u003eListeria\\u003c/em\\u003e line that secretes caspases-3 and \\u0026minus;\\u0026thinsp;7 uncleavable, recombinant LLO in ΔLLO \\u003cem\\u003eLm\\u003c/em\\u003e. Cleavage SitePrediction software predicted top score sites at the aspartate positions D62 (caspase-3) and D416 (caspase-7) in the LLO sequence (Figure S3A).\\u003c/p\\u003e \\u003cp\\u003eComparison with the LLO structure revealed that these sites are well accessible as potential protease targets (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e) (Figure S3B). Therefore, we replaced these potential cleavage site aspartates with glutamates and integrated the mutated LLO into the chromosome of ΔLLO \\u003cem\\u003eLm\\u003c/em\\u003e to generate \\u003cem\\u003eLm\\u003c/em\\u003eLLOc3/7 (Fig.\\u0026nbsp;5A). The treatment of supernatants from \\u003cem\\u003eLm\\u003c/em\\u003eLLOwt and \\u003cem\\u003eLm\\u003c/em\\u003eLLOc3/7 with caspases-3 or -7 confirmed protection of the mutated protein (Fig.\\u0026nbsp;5B). As the D62 to E point mutation is within the PEST domain critical for activity (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e), we tested the hemolytic activity in the supernatants. The activity of the mutated LLO was indeed significantly decreased (Fig.\\u0026nbsp;5C). However, contrary to the LLOwt supernatants, neither caspase-3 nor caspase-7 affected the hemolytic activity of LLOc3/7 (Fig.\\u0026nbsp;5D). Due to this difference in the hemolytic activities, we could not directly compare the virulent growth of these two lines in host cells. To circumvent this difficulty, we compared the growth upon treatment with zVAD where all caspase activity is blocked (Fig.\\u0026nbsp;5E). Indeed, in the LLOc3/7 mutant strain, the time differences to the zVAD controls in untreated and particularly in TNF-α treated conditions were significantly reduced as compared to LLOwt \\u003cem\\u003eLm\\u003c/em\\u003e, indicating a growth advantage mediated by caspase-uncleavable LLO (Fig.\\u0026nbsp;5F).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn this study, we present compelling evidence for an underappreciated host defense mechanism against intracellular \\u003cem\\u003eLm\\u003c/em\\u003e that is mediated by executioner caspases-3 and \\u0026minus;\\u0026thinsp;7. Executioner caspase activity is robustly activated in HeLa cells upon infection with virulent \\u003cem\\u003eLm\\u003c/em\\u003e, presumably via the intrinsic pathway and the activation of caspase-9. Caspase activity can be additionally enhanced by simultaneous TNF-a treatment. It was reported earlier that \\u003cem\\u003eLm\\u003c/em\\u003e infection triggers nucleosomal DNA fragmentation in mouse hepatocytes (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e), presumably mediated by caspase-3 (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). Also, caspase-7 activation upon \\u003cem\\u003eLm\\u003c/em\\u003e infection in murine macrophage was demonstrated to exert a cytoprotective effect on the host cells (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e). Though remarkably high caspase activity was recorded in the \\u003cem\\u003eLm\\u003c/em\\u003e infection experiments, particularly in presence of TNF-a, HeLa cells stayed viable according to nuclear morphology, cytoskeleton organization, plasma membrane integrity and mitochondrial metabolization rate, at least at low multiplicities of infection (MOI\\u0026thinsp;\\u0026le;\\u0026thinsp;1).\\u003c/p\\u003e \\u003cp\\u003eMore importantly, we additionally demonstrate that the chemical inhibition of DEVDase activity or the genetic depletion of both caspases-3 and \\u0026minus;\\u0026thinsp;7 decreases the resistance of HeLa cells against intracellular \\u003cem\\u003eLm\\u003c/em\\u003e. Surprisingly, caspase depletion did not affect resistance to \\u003cem\\u003eSalmonella\\u003c/em\\u003e Typhimurium that highly induces executioner caspase activity, and crucial virulence effectors (SipA, SifA) are degraded by active caspase-3 (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). However, in contrast to \\u003cem\\u003eLm\\u003c/em\\u003e, effector cleavage might be even beneficial for the dissemination of \\u003cem\\u003eSalmonella\\u003c/em\\u003e, suggesting major species-specific differences in caspase-mediated anti-bacterial defense. Interestingly, in the monocytic acute leukemia line, THP-1, the single knock-out of caspase-7 led to increased intracellular bacteria growth of both \\u003cem\\u003eLm\\u003c/em\\u003e and \\u003cem\\u003eSalmonella\\u003c/em\\u003e. Caspase-7, though structurally closely related to caspase-3, has a dual role in cell death and inflammation. Unlike caspase-3, it is activated by inflammatory processes, including active caspase-1 (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e). Active caspase-7, independently of caspase-1, was detected upon \\u003cem\\u003eLm\\u003c/em\\u003e infection (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e), as well as during intracellular \\u003cem\\u003eSalmonella\\u003c/em\\u003e and \\u003cem\\u003eLegionella pneumophila\\u003c/em\\u003e infections, downstream of caspase-1 (\\u003cspan additionalcitationids=\\\"CR38\\\" citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e). Remarkably, caspase-7-deficient mice allowed increased growth of \\u003cem\\u003eL. pneumophila\\u003c/em\\u003e in their macrophages \\u003cem\\u003ein vitro\\u003c/em\\u003e, and in their lungs \\u003cem\\u003ein vivo\\u003c/em\\u003e (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e). Substantial replication of \\u003cem\\u003eL. pneumophila\\u003c/em\\u003e was also observed in dendritic cells of caspase-3-deficient mice (\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e), suggesting that some gram- bacteria are also susceptible to executioner caspase activity.\\u003c/p\\u003e \\u003cp\\u003eA crucial role of caspases-3 and \\u0026minus;\\u0026thinsp;7 in immune defense against \\u003cem\\u003eLm\\u003c/em\\u003e was additionally demonstrated by the increased growth of a mutant strain that secretes caspase-uncleavable LLO in HeLa cells. LLO is also a substrate of human granzyme B (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). This overlap in substrate selection by granzyme B in general is not uncommon, as it shares cleavage specificity after aspartate residues with the caspases (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e) and activates numerous caspases by direct cleavage, including caspase-3 (\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e) and caspase-7 (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e). To induce apoptosis, granzyme B can directly process numerous caspase substrates, such as Parp1, NuMA, DNA-PK or ICAD (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eComprehensive proteomics analysis of caspase-3 substrates in the \\u003cem\\u003eLm\\u003c/em\\u003e secretome identified proteins critically involved in pathogen-host interactions and virulence. The top enriched pathways include membrane transport, in particular via the ATP-binding cassette (ABC) transporter complex (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e), the PrfA-dependent virulence factors LLO, ActA, PlcA and PlcB (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e), peptidoglycan catabolic hydrolases, such as Iap, and proteins anchored to the outer surface via Gly-Trp (GW)-domains, including InlB (\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e), all pathways critical for full \\u003cem\\u003eLm\\u003c/em\\u003e virulence in a host. The pathways and the overall protein substrate network proofed to be remarkably interconnected with highly significantly enriched interactions, indicating a targeted attack of caspase-3 on proteins that are essential for pathogen-host interactions. The top subcellular localization was as expected the extracellular region. However, the screen revealed in addition a multitude of membrane and cytoplasmic proteins. A potential interpretation of the presence of these types of proteins in cell-free supernatants is provided by the comparison of the caspase-3 substrate list with a recent independent proteomics analysis of \\u003cem\\u003eLm\\u003c/em\\u003e membrane vesicles (\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e). 93.1% of the caspase-3 substrates were also found with high confidence (in three replicate analyses) in highly purified membrane vesicles. To conclude how the release of membrane vesicles mediates \\u003cem\\u003eLm\\u003c/em\\u003e virulence and how the caspases interfere with it needs extensive further study.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study identifies the executioner caspases as a novel innate immune barrier against intracellular growing \\u003cem\\u003eLm\\u003c/em\\u003e. This barrier is established by the targeted degradation of a multitude of bacterial proteins that are critically involved in pathogen-host interactions, therefore inhibiting virulent growth.\\u003c/p\\u003e\"},{\"header\":\"Methods and materials\",\"content\":\"\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHuman cells and cell culture conditions\\u003c/h2\\u003e \\u003cp\\u003eHeLa cells were cultured in DMEM (Pan Biotech, P04-04510), supplemented with 10% FBS (Sigma) and 1% antibiotic/antimycotic solution (Thermo Fisher).\\u003c/p\\u003e \\u003cp\\u003eTHP-1 cells were cultured in RPMI-1640 (Pan Biotech, P04-18500), supplemented with 10% FBS (Sigma), 50 \\u0026micro;M 2-mercaptoethanol (Sigma), and 1% antibiotic/antimycotic solution (Thermo Fisher).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBacterial Strains\\u003c/h2\\u003e \\u003cp\\u003e \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e 10403S and 10403S ΔLLO, and \\u003cem\\u003eSalmonella enterica\\u003c/em\\u003e serovar Typhimurium SL1344 used for infections were grown to mid-log in appropriate medium (Brain Heart Infusion (Millipore, 53286)\\u0026thinsp;+\\u0026thinsp;50 \\u0026micro;g/ml streptomycin for \\u003cem\\u003eListeria\\u003c/em\\u003e; Luria broth (Sigma, L3022)\\u0026thinsp;+\\u0026thinsp;50 \\u0026micro;g/ml streptomycin for \\u003cem\\u003eSalmonella\\u003c/em\\u003e). 50 \\u0026micro;g/ml kanamycin was added to grow mutant \\u003cem\\u003eListeria\\u003c/em\\u003e (pIMK2 transfected) (\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e)).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGene modification by CRISPR/Cas9 methodology and clone selection limiting dilution\\u003c/h2\\u003e \\u003cp\\u003eThe gene editing was based on the nucleofection (4D Nucleofector System, Lonza) of preformed Cas9-guideRNA-ribonucleoprotein (RNP) complexes into target cell line (HeLa, THP-1) according to manufacturer`s recommendations (IDT). Three guides per gene were tested and the efficiency of knockdown was assessed by western blot. The cells that displayed most efficient knockdown (usually around 50%) were used for downstream dilution assays. HeLa cell gene edits were started using a commercial caspase-3 KO and the corresponding parental lines (abcam, ab255370, ab255448). Most efficient guide sequences were GATCGTTGTAGAAGTCTAAC for caspase-3 (in THP-1 cells) and GATATGTAGGCACTCGGTCC for caspase-7. Monoclonal cell populations were selected by seeding in an average of 0.5 cells in 100 \\u0026micro;l in 96-well plates for 7 days before subcloning in repeated standard limiting dilution assays.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGeneration of a caspase uncleavable LLO mutant\\u003c/h2\\u003e \\u003cp\\u003eFull-length (including the natural ribosome binding site and signal peptide) LLO was PCR amplified from the chromosome of \\u003cem\\u003eListeria\\u003c/em\\u003e 10403S and cloned into the bacterial expression vector pGEX4Ti (Sigma) using the BamH1 and Xho1 restriction sites. Cleavage sites for caspase-3 and \\u0026minus;\\u0026thinsp;7 were predicted using the SitePrediction software (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). The top score cleavage site aspartic acids for caspases-3 and \\u0026minus;\\u0026thinsp;7 were mutated to glutamic acid by sequential two-step overlap PCRs (\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e), and correct point mutations confirmed by sequencing (Microsynth AG, Balgach, Switzerland). Wild-type and mutated LLO were cloned into the integration vector pIMK2 (\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e) at the BamH1/Xho1 sites, electroporated into LLO-deficient \\u003cem\\u003eLm\\u003c/em\\u003e 10403S and then selected on kanamycin BHI agar plates to generate the lines \\u003cem\\u003eLm\\u003c/em\\u003eLLOwt and \\u003cem\\u003eLm\\u003c/em\\u003eLLOc3/7.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHemolysis assays\\u003c/h2\\u003e \\u003cp\\u003eSerial dilutions (10-80fold) of \\u003cem\\u003eLm\\u003c/em\\u003e culture supernatant were incubated with human red blood cells at a hematocrit of 0.4% in hemolysis buffer (100 mM NaCl, 40 mM NaPO\\u003csub\\u003e4\\u003c/sub\\u003e, 0.5 mg/ml BSA, pH\\u0026thinsp;=\\u0026thinsp;5.5) in u-bottomed microtiter plates at 37\\u0026deg;C for 15 minutes. After the incubation, the plate was spun (500 x g, 3 minutes) and the supernatant was transferred to a flat-bottomed microtiter plate. Hemolysis was assessed by absorbance readings at 405 nm in a plate reader (Synergy H1, Biotek). Specific hemolysis was normalized to positive control lysis induced by 0.1% Triton X-100, corrected by the spontaneous hemoglobin release in buffer only conditions. For some experiments, a 10fold dilutions of the \\u003cem\\u003eLm\\u003c/em\\u003e culture supernatants were pretreated with 2U/\\u0026micro;l of purified caspase-3 (see below) or commercial caspase-7 (Enzo Life Sciences) for 4 hours at 37\\u0026deg;C before the assessment of the hemolytic activity.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBacterial infections, colony forming unit (CFU), growth assays, DEVDase activity assessment and caspase activation\\u003c/h2\\u003e \\u003cp\\u003eBefore infections, overnight cultures of bacteria were diluted 1:50 in fresh broth and grown to mid-log, then were washed with PBS and resuspended in infection medium (RPMI\\u0026thinsp;+\\u0026thinsp;1% BSA\\u0026thinsp;+\\u0026thinsp;appropriate antibiotics as above). Cell density was estimated by OD600 spectrometry (OD\\u003csub\\u003e600\\u003c/sub\\u003e\\u0026thinsp;=\\u0026thinsp;0.1 corresponds to ~\\u0026thinsp;2x10\\u003csup\\u003e7\\u003c/sup\\u003e bacteria/ml) and confirmed by CFU assay.\\u003c/p\\u003e \\u003cp\\u003eHeLa and THP-1 cells were infected with \\u003cem\\u003eLm\\u003c/em\\u003e 10403S and \\u003cem\\u003eSalmonella enterica\\u003c/em\\u003e serovar Typhimurium SL1344 for 60 minutes at indicated multiplicity of infection (MOI) in 24-well plates in triplicates. The infected cells were washed throuroughly with PBS and then further incubated with gentamicin (25 \\u0026micro;g/ml) in infection medium. For some experiments, particularly when using higher MOIs due to cytopathic effects and subsequent susceptibility to gentamicin, gentamicin treatment was only for 30 minutes, followed by further incubation in gentamicin-free infection medium that was exchanged every 4 hours. In some experiments, 20 \\u0026micro;M zVAD, 20 \\u0026micro;M zDVED-fmk or 10ng/ml TNF-a was added. At indicated times, samples were washed with PBS and then hypotonically lysed by adding ice-cold sterile water for 45 minutes on ice.\\u003c/p\\u003e \\u003cp\\u003eFor CFU assays, lysates were serially diluted in broth and spread on LB-Agar plates containing the appropriate antibiotics. Colonies were enumerated after 24 hours at 37\\u0026deg;C.\\u003c/p\\u003e \\u003cp\\u003eFor the growth assays, lysates were 10fold diluted in flat-bottomed 96-well plates and the OD at wavelength 600 nm was measured every 15 minutes while discontinuous shaking in heat-controlled plate reader for 24 hours at 37\\u0026deg;C (Synergy H1, BioTek).\\u003c/p\\u003e \\u003cp\\u003eFor the colorimetric DEVDase activity measurement (only in HeLa cells), lysates were cleared by centrifugation, and the supernatants were 10fold diluted into caspase assay buffer (50 mM Tris, pH 7.5, 0.3% NP-40, 1 mM DTT) containing 200 \\u0026micro;M Ac-DEVD-pNA (Sigma). Cleavage was monitored colorimetrically at 405 nm after 4 hours at 37\\u0026deg;C. Due to general lower DEVDase activity in THP-1 cells, DEVDase activity was measured fluorometrically. For this purpose, TF3-DEVD-FMK (Cell Meter\\u0026trade; Live Cell Caspase-3/7 Binding Assay Kit, AAT Bioquest) at 1:150 ratio was added to the cells 60 minutes before the experimental endpoint. Cells were washed twice for 3 minutes in Washing Buffer (Kit component B) before fluorescent intensity was monitored in the well area scanning mode at Ex/Em\\u0026thinsp;=\\u0026thinsp;550/595 nm in the Synergy H1 plate reader.\\u003c/p\\u003e \\u003cp\\u003eCaspase activation in the lysates was directly detected by western blot using antibodies against active caspases-3, -7 and \\u0026minus;\\u0026thinsp;9, as well as cleaved Parp1 (Cleaved Caspase Antibody Sampler Kit #9929, Cell Signaling) according to manufacturer`s recommendations.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of host cell viability by MTS assay, LDH release and microscopy\\u003c/h2\\u003e \\u003cp\\u003e2 hours before the experimental endpoint, MTS reagent (MTS Assays Kit, abcam) was added (1:10 ratio) to host cells (treated as above), the absorbance was then measured at 490 nm wavelength.\\u003c/p\\u003e \\u003cp\\u003eCells were gently spun (300 x g, 3 minutes) before the supernatant was transferred into flat-bottomed 96-well plates for the assessment of LDH release (Cytotoxicity Detection kit, Roche) according to the manufacturer`s recommendations. To some wells, Triton X-100 (Sigma) was added to a final concentration of 0.1% before the centrifugation to determine the maximal release.\\u003c/p\\u003e \\u003cp\\u003eFor microscopy, HeLa cells were seeded in culture medium at a density of 10\\u003csup\\u003e5\\u003c/sup\\u003e cells in 200 \\u0026micro;l on glass coverslips in 24-well plates overnight, and then infected and treated in infection medium with \\u003cem\\u003eListeria\\u003c/em\\u003e as above. 1 hour before fixation, FITC-DEVD-fmk (abcam) was added to the cells to a final concentration of 60 \\u0026micro;M. The cells were then fixed and washed twice with PBS before staining with phalloidin-AF647 (250 nM, ThermoFisher) and Hoechst (1 \\u0026micro;g/ml, Sigma) for 30 minutes at room temperature in the dark.\\u003c/p\\u003e \\u003cp\\u003eAdditionally, HeLa cells were infected and treated as above with \\u003cem\\u003eLm\\u003c/em\\u003e, prestained with 2 \\u0026micro;M CFSE (Sigma) for 30 minutes on ice. To assess early cell death, infected cells were fixed in cold methanol (-20\\u0026deg;C) for 15 minutes, washed twice with PBS and then stained with the CytoDEATH M30 antibody (Roche) and Hoechst (1 \\u0026micro;g/ml, Sigma) for 1 hour at room temperature in the dark. After the primary antibody, cells were washed with PBS and then counterstained with anti-mouse IgG-AF594 (R\\u0026amp;D Systems) for 30 minutes at room temperature.\\u003c/p\\u003e \\u003cp\\u003eAs positive control to induce cell death in these experiments, some wells were treated with 0.1 \\u0026micro;g/ml staurosporine (STS).\\u003c/p\\u003e \\u003cp\\u003eAll stained cover slips were washed twice with PBS before mounting in Vectashield (Vectorlabs) and analysis by confocal microscopy (Leica SP5).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCaspase-3 purification\\u003c/h2\\u003e \\u003cp\\u003eRecombinant, human caspase-3 was purified from \\u003cem\\u003eE. coli\\u003c/em\\u003e as described (\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e). In brief, the pET21b-Caspase-3 plasmid (Addgene) was transformed into BL-21 \\u003cem\\u003eE. coli\\u003c/em\\u003e. These cells were grown to a density of A\\u003csub\\u003e600nm\\u003c/sub\\u003e\\u0026thinsp;=\\u0026thinsp;0.6\\u0026ndash;0.8 at 37\\u0026deg;C and 220 rpm in 500ml of induction medium (20 g/l Tryptone, 10 g/l yeast extract, 5 g/l NaCl, 0.4% glucose, 1 mM MgCl\\u003csub\\u003e2\\u003c/sub\\u003e, 0.1 mM CaCl2) containing 0.1 mg/ml ampicillin. Isopropyl-1-thio-b-D-galactopyranoside (IPTG, 1 mM) was added, and the culture was shaken at 25\\u0026deg;C, 200 rpm for 3 hours. Cells were pelleted (centrifugation 3000 x g for 12 minutes) and resuspended in 50 ml of His binding buffer (100 mM Tris-HCl, 20 mM imidazole, and 500 mM NaCl, pH 8.0) containing 0.1 mg/ml lysozyme and 0.1% Triton X-100. The cells are incubated for 40 minutes on ice and vortexed every 10 minutes. Then, the cells underwent three freeze-thaw cycles and a sonication to make the sample less viscous. After centrifugation (17\\u0026rsquo;000 x g for 47 minutes at 4\\u0026deg;C), the supernatant was harvested and 50ml of His binding buffer were added to dilute it. After filtration with a 0.22 \\u0026micro;m filter, the supernatant was loaded onto a 5ml HisTrap HP column (Cytiva, 17524801) equilibrated with His binding buffer. The purified caspase-3 protein was eluted from the column using a linear imidazole gradient (until 1 M imidazole). A sample of each fraction were used for a gel electrophoresis and Coomassie staining to select the fraction containing the caspase-3 protein. These fractions were mixed and concentrated using a 3 kDa MWCO Amicon filter (Millipore, UFC9003), and the buffer was changed by caspase-3 buffer (50 mM HEPES, pH 7.4, 0.1% CHAPS, 10 mM DTT, 100 mM NaCl, 1 mM EDTA and 10% sucrose).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eAssessment of caspase-3 substrate cleavage in the\\u003c/b\\u003e \\u003cb\\u003eLm\\u003c/b\\u003e \\u003cb\\u003esecretome by comparative 2D SDS-PAGE and TAILS proteomics\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eLm\\u003c/em\\u003e were grown to mid-log in 100 ml of BHI medium supplemented with 50 \\u0026micro;g/ml streptomycin. Then, the bacteria were grown in 100 ml of RPMI-1640 medium (Pan Biotech, P04-18500) supplemented with 50 \\u0026micro;g/ml streptomycin for 4 hours at 37\\u0026deg;C at 180 rpm. The supernatant was harvested after centrifugation of the bacterial culture (4000 rpm for 15 minutes) and filtered with a 0.22 \\u0026micro;m filter. The supernatant proteins were concentrated by ultrafiltration using a 3 kDa MWCO Amicon filter (Millipore, UFC9003), and the RPMI was exchanged by caspase-3 assay buffer (20 mM HEPES, pH 7.4, 0.1% CHAPS, 5 mM DTT, 2 mM EDTA). 50 \\u0026micro;g of supernatant proteins were treated or not with 500 \\u0026micro;g/ml of caspase-3 for 24 hours at 37\\u0026deg;C and then precipitated by trichloroacetic acid precipitation. The samples were used either for 2D SDS-PAGE or TAILS proteomics assays.\\u003c/p\\u003e \\u003cp\\u003eFor 2D SDS-PAGE, the precipitated proteins were resuspended into 300 \\u0026micro;l of 2-D sample solution (7M urea, 2M thiourea, 4% (w/v) CHAPS, 40mM DTT, 0.2% (w/v) Bio-Lyte\\u0026reg; ampholytes pH3-10) and passively loaded into a 17cm immobilized pH gradient (IPG) strip pH3-10 for 16 hours (Bio-rad, 1632007). The proteins were then separated according to their isoelectric pH by isoelectric focusing. Thereafter, the IPG strip was treated with 1% w/v dithiothreitol (DTT) and 4% w/v iodoacetamide (IAA) for reduction and alkylation of proteins respectively. The proteins were then separated according to their molecular weight by electrophoresis. For this, the strip was placed on the top of a 12% polyacrylamide gel and fixed with 0.5% agarose solution. The 2D SDS-PAGE experiments have been carried out with the Bio-rad materials according to the provided instructions. For the visualization of protein spots, the gel was first fixed and then stained in silver stain (Silver stain plus kit, Bio-Rad, 1610449). Pictures of the stained gels were taken with the Perfection V850 Pro scanner (Epson). The Delta2D (DECODON) software was used to analyze the gel pictures and select the spots to pick up for mass spectrometry (MS) analysis. Spots whose intensities changed by at least a factor 2 upon caspase-3 treatment in three replicate analyses were selected for MS analysis. Before MS analysis, each spot was destained and the proteins were digested by trypsin, extracted from the gel pieces, and cleaned up.\\u003c/p\\u003e \\u003cp\\u003eFor the TAILS, a protocol adapted from Kleifeld et al (2011) was used. Briefly, the precipitated proteins were resuspended into 50 \\u0026micro;l of TAILS buffer (2.5 M GuHCl, 250 mM HEPES, pH 7.8). The proteins were denaturated with 1 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) for 1 hour at 65\\u0026deg;C, and alkylated with 5 mM chloroacetamide (CAA) for 30 minutes at 65\\u0026deg;C. The N-termini were labelled with stable isotopes (TMTsixplex\\u0026trade; Isobaric Label Reagent Set, ThermoFisher, 90061) for 1 hour at room temperature. The quench labelling reaction was then done with a final concentration of 100 mM ammonium bicarbonate (NH\\u003csub\\u003e4\\u003c/sub\\u003eHCO\\u003csub\\u003e3\\u003c/sub\\u003e), for 30 minutes at room temperature. The clean-up of samples was performed by the addition of ice-cold acetone (7 volumes) and methanol (1 volume), followed by the incubation of samples for 2 hours at -80\\u0026deg;C. After centrifugation at 4\\u0026rsquo;700 rpm for 20 minutes, the protein pellet was washed with 5 mL of ice-cold methanol and then resolubilized with 100 mM NaOH solution (as little as possible), followed by the addition of HEPES buffer, pH 7.8, to a final concentration of 100 mM. Trypsin (Promega, V5113) was added at a 1:100 ratio (enzyme/substrate), and the mixture was incubated at 37\\u0026deg;C for 18 hours. Adjust the pH of the samples to pH 6\\u0026ndash;7 using 2 M HCl. Add fivefold excess (w/w) of hyperbranched polyglycerol-aldehydes (HPG-ALD) polymer (Flintbox) and 5 M NaBH\\u003csub\\u003e3\\u003c/sub\\u003eCN to a final concentration of 50 mM NaBH\\u003csub\\u003e3\\u003c/sub\\u003eCN and incubate at least 16 hours at 37\\u0026deg;C. Thereafter, the polymer is separated from the unbounded peptides by ultrafiltration using a 30 kDa MWCO Amicon filter (Millipore, UFC5030). The TAILS samples were acidified to pH\\u0026thinsp;\\u0026lt;\\u0026thinsp;2 using 10% trifluoroacetic acid (TFA) and cleaned up. For this, the proteins were loaded onto a column made of C18 solid phase extraction (SPE) disks (Empore, 66883-u). The samples were washed twice with 0.1% formic acid, eluted with a solution of 80% acetonitrile, 0.1% TFA, and completely dried under vacuum.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMass spectrometry analysis and data extraction\\u003c/h2\\u003e \\u003cp\\u003eLiquid Chromatography Mass Spectrometry/ Mass Spectrometry (LC-MS/MS) measurements were performed on a Q Exactive HF-X mass spectrometer (Thermo Scientific) coupled to an EASY-nLC 1000 nanoflow-HPLC (Thermo Scientific). Peptides were separated on a fused silica HPLC-column tip (75 \\u0026micro;m inner diameter (New Objective), self-packed with ReproSil-Pur 120 C18-AQ, 1.9 \\u0026micro;m particle size (Dr. Maisch GmbH) to a length of 20 cm) using a gradient of A (0.1% formic acid in H\\u003csub\\u003e2\\u003c/sub\\u003eO) and B (0.1% formic acid in 80% acetonitrile in H\\u003csub\\u003e2\\u003c/sub\\u003eO): samples were loaded with 0% B with a flow rate of 600 nL/min; peptides were separated by 5\\u0026ndash;30% B within 85 min with a flow rate of 250 nL/min. Spray voltage was set to 2.3 kV and the ion-transfer tube temperature to 250\\u0026deg;C; no sheath and auxiliary gas were used. The mass spectrometer was operated in the data-dependent mode; after each MS scan (mass range \\u003cem\\u003em/z\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;370\\u0026ndash;1750; resolution: 120,000), a maximum of twelve MS/MS scans were performed using an isolation window of 1.6, a normalized collision energy of 28%, a target Automatic Gain Control of 1e5 and a resolution of 30,000. MS raw files were analyzed with the MaxQuant software (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e), using the UniProt full-length \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e proteome (UP000001288), additionally including common contaminants (e.g., keratin) and trypsin, as reference. Carbamidomethylcysteine was set as fixed modification and protein amino-terminal acetylation and oxidation of methionine were set as variable modifications. The MS/MS tolerance was set to 20 ppm and three missed cleavages were allowed using Trypsin/P as enzyme specificity. Peptide and protein false discovery rates (FDR), based on a forward-reverse database, were set to 0.01, minimum peptide length was set to 7, and minimum number of unique peptides for identification of proteins was set to one. The \\u0026ldquo;match-between-run\\u0026rdquo; option was used with a time window of 0.7 min. MS raw files of TAILS experiment were processed using Proteome Discoverer software (Thermo Scientific) following the protocol of Madzharova et al. (\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExperimental validation of the proteomics data\\u003c/h2\\u003e \\u003cp\\u003eCleavage of native LLO was experimentally confirmed by treating cell free \\u003cem\\u003eLm\\u003c/em\\u003e culture supernatant (as above) with indicated concentrations of purified caspase-3 at 37\\u0026deg;C and analyzed by immunoblot using rabbit anti-LLO antibodies (Abcam).\\u003c/p\\u003e \\u003cp\\u003eIn addition, LLO-GST and Iap-GST fusion proteins using the constructs, pGEX4Ti-LLO or pGEX4Ti-Iap, respectively, in \\u003cem\\u003eE. coli\\u003c/em\\u003e BL21 were purified on a GST column (GSTtrap HP, GE Healthcare) following the manufacture`s recommendation. These fusion proteins were treated with indicated concentrations of caspase-3 for 4 hours and analyzed on Coomassie stained SDS-PAGE.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistics\\u003c/h2\\u003e \\u003cp\\u003eAll experiments were performed in triplicates and were at least three times independently repeated. Data are presented as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. Comparisons between the different groups were performed with two-tailed unpaired Student`s t tests (using Microsoft Excel). \\u003cem\\u003eP\\u003c/em\\u003e values of less than 0.05 were considered significant. For the growth experiments in Figs.\\u0026nbsp;2C-D and G-H, significant differences refer to the measured raw data of lag times before calculation of CFUs.\\u003c/p\\u003e \"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe want to thank Marianne Blanchard for excellent technical support, and Dirk Bumann, Biozentrum, University of Basel, Switzerland, for providing \\u003cem\\u003eSalmonella\\u0026nbsp;\\u003c/em\\u003eTyphimurium\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eSL1344. pIMK2 was a kind gift from Colin Hill, School of Microbiology, University College Cork, Ireland.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e:\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was partially supported by the Swiss National Science Foundation (grant # 310030_169928 to MW; 31003A_182729 to PYM), the Vontobel Foundation, Novartis Foundation for Medical-Biological Research, the Kurt and Senta Herrmann Foundation, and the Research Pool of the University of Fribourg (to MW).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor\\u0026rsquo;s contributions\\u003c/strong\\u003e:\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eMW conceived and conceptualized the study by providing the methodology and design of most assays. ML, RS, SDG, SB, MB, OA, TM, TS, LC, AF, PM, MS conducted the investigation. MW, ML, RS, MS, DK, and PYM analyzed the data. MW wrote the original draft of the manuscript. ML, RS, DK and PYM wrote, reviewed, and edited the manuscript. MW supervised the study.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of interests\\u003c/strong\\u003e:\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have nothing to disclose.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData and materials availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe proteomics dataset generated and analyzed during in this study is available in table S1. All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. All materials are available under request to the corresponding author.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eP. Cossart, Illuminating the landscape of host-pathogen interactions with the bacterium Listeria monocytogenes. Proceedings of the National Academy of Sciences of the United States of America 108, 19484\\u0026ndash;19491 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eV. Ramaswamy \\u003cem\\u003eet al.\\u003c/em\\u003e, Listeria\\u0026ndash;review of epidemiology and pathogenesis. J Microbiol Immunol Infect 40, 4\\u0026ndash;13 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eB. Korkmaz, T. Moreau, F. Gauthier, Neutrophil elastase, proteinase 3 and cathepsin G: physicochemical properties, activity and physiopathological functions. Biochimie 90, 227\\u0026ndash;242 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eT. O. Hirche \\u003cem\\u003eet al.\\u003c/em\\u003e, Neutrophil elastase mediates innate host protection against Pseudomonas aeruginosa. J Immunol 181, 4945\\u0026ndash;4954 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eI. Hahn \\u003cem\\u003eet al.\\u003c/em\\u003e, Cathepsin G and neutrophil elastase play critical and nonredundant roles in lung-protective immunity against Streptococcus pneumoniae in mice. Infect Immun 79, 4893\\u0026ndash;4901 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. Steinwede \\u003cem\\u003eet al.\\u003c/em\\u003e, Cathepsin G and neutrophil elastase contribute to lung-protective immunity against mycobacterial infections in mice. J Immunol 188, 4476\\u0026ndash;4487 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eY. Weinrauch, D. Drujan, S. D. Shapiro, J. Weiss, A. Zychlinsky, Neutrophil elastase targets virulence factors of enterobacteria. Nature 417, 91\\u0026ndash;94 (2002).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eE. Arnett \\u003cem\\u003eet al.\\u003c/em\\u003e, The Pore-Forming Toxin Listeriolysin O Is Degraded by Neutrophil Metalloproteinase-8 and Fails To Mediate Listeria monocytogenes Intracellular Survival in Neutrophils. Journal of immunology, (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Walch \\u003cem\\u003eet al.\\u003c/em\\u003e, Cytotoxic cells kill intracellular bacteria through granulysin-mediated delivery of granzymes. Cell 157, 1309\\u0026ndash;1323 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. L\\u0026oacute;pez Le\\u0026oacute;n \\u003cem\\u003eet al.\\u003c/em\\u003e, Granzyme B Attenuates Bacterial Virulence by Targeting Secreted Factors. \\u003cem\\u003eIscience\\u003c/em\\u003e 23, (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eI. Jorgensen, M. Rayamajhi, E. A. Miao, Programmed cell death as a defence against infection. Nature Reviews Immunology 17, 151\\u0026ndash;164 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. M. Behar, V. Briken, Apoptosis inhibition by intracellular bacteria and its consequence on host immunity. Current Opinion in Immunology 60, 103\\u0026ndash;110 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eH. Wajant, K. Pfizenmaier, P. Scheurich, Tumor necrosis factor signaling. Cell death and differentiation 10, 45\\u0026ndash;65 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. Garrido \\u003cem\\u003eet al.\\u003c/em\\u003e, Mechanisms of cytochrome c release from mitochondria. Cell death and differentiation 13, 1423\\u0026ndash;1433 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. Chowdhury, J. Lieberman, Death by a thousand cuts: granzyme pathways of programmed cell death. Annu Rev Immunol 26, 389\\u0026ndash;420 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Lawen, Apoptosis - an introduction. Bioessays 25, 888\\u0026ndash;896 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. V. Srikanth \\u003cem\\u003eet al.\\u003c/em\\u003e, Salmonella pathogenesis and processing of secreted effectors by caspase-3. Science 330, 390\\u0026ndash;393 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. H. Boulares \\u003cem\\u003eet al.\\u003c/em\\u003e, Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis - Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells. Journal of Biological Chemistry 274, 22932\\u0026ndash;22940 (1999).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eL. Faleiro, Y. Lazebnik, Caspases disrupt the nuclear-cytoplasmic barrier. Journal of Cell Biology 151, 951\\u0026ndash;959 (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. R. White \\u003cem\\u003eet al.\\u003c/em\\u003e, Initiation of apoptosis by actin cytoskeletal derangement in human airway epithelial cells. American Journal of Respiratory Cell and Molecular Biology 24, 282\\u0026ndash;294 (2001).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. Caulin, G. S. Salvesen, R. G. Oshima, Caspase cleavage of keratin 18 and reorganization of intermediate filaments during epithelial cell apoptosis. Journal of Cell Biology 138, 1379\\u0026ndash;1394 (1997).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO. Kleifeld \\u003cem\\u003eet al.\\u003c/em\\u003e, Identifying and quantifying proteolytic events and the natural N terminome by terminal amine isotopic labeling of substrates. Nature Protocols 6, 1578\\u0026ndash;1611 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. J. Tanaka, S. Song, K. Mason, H. W. Pinkett, Selective substrate uptake: The role of ATP-binding cassette (ABC) importers in pathogenesis. Biochim Biophys Acta Biomembr 1860, 868\\u0026ndash;877 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. de las Heras, R. J. Cain, M. K. Bielecka, J. A. Vazquez-Boland, Regulation of Listeria virulence: PrfA master and commander. Current Opinion in Microbiology 14, 118\\u0026ndash;127 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Vermassen \\u003cem\\u003eet al.\\u003c/em\\u003e, Cell Wall Hydrolases in Bacteria: Insight on the Diversity of Cell Wall Amidases, Glycosidases and Peptidases Toward Peptidoglycan. Frontiers in Microbiology 10, 331 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. Szklarczyk \\u003cem\\u003eet al.\\u003c/em\\u003e, The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic acids research 51, D638-D646 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. Pilgrim, A. Kolb-M\\u0026auml;urer, I. Gentschev, W. Goebel, M. Kuhn, Deletion of the gene encoding p60 in leads to abnormal cell division and loss of actin-based motility. Infection and immunity 71, 3473\\u0026ndash;3484 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJ. Verspurten, K. Gevaert, W. Declercq, P. Vandenabeele, SitePredicting the cleavage of proteinase substrates. Trends in Biochemical Sciences 34, 319\\u0026ndash;323 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. C. Fu, K. Imai, T. Sawasaki, K. Tomii, ScreenCap3: Improving prediction of caspase-3 cleavage sites using experimentally verified noncleavage sites. Proteomics 14, 2042\\u0026ndash;2046 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. Koster \\u003cem\\u003eet al.\\u003c/em\\u003e, Crystal structure of listeriolysin O reveals molecular details of oligomerization and pore formation. Nature Communications 5, (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. L. Decatur, D. A. Portnoy, A PEST-like sequence in listeriolysin O essential for pathogenicity. Science 290, 992\\u0026ndash;995 (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eH. W. Rogers, M. P. Callery, B. Deck, E. R. Unanue, Listeria monocytogenes induces apoptosis of infected hepatocytes. Journal of immunology 156, 679\\u0026ndash;684 (1996).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. E. McDougal, J. D. Sauer,: The Impact of Cell Death on Infection and Immunity. \\u003cem\\u003ePathogens\\u003c/em\\u003e 7, (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. K. B. Cassidy \\u003cem\\u003eet al.\\u003c/em\\u003e, Membrane Damage during Listeria monocytogenes Infection Triggers a Caspase-7 Dependent Cytoprotective Response. PLoS pathogens 8, (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. Patel, D. M. Wall, A. Castillo, B. A. McCormick, Caspase-3 cleavage of Salmonella type III secreted effector protein SifA is required for localization of functional domains and bacterial dissemination. Gut Microbes 10, 172\\u0026ndash;187 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Lamkanfi, T. D. Kanneganti, Caspase-7: A protease involved in apoptosis and inflammation. International Journal of Biochemistry \\u0026amp; Cell Biology 42, 21\\u0026ndash;24 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Lamkanfi \\u003cem\\u003eet al.\\u003c/em\\u003e, Targeted Peptidecentric Proteomics Reveals Caspase-7 as a Substrate of the Caspase-1 Inflammasomes. Molecular \\u0026amp; Cellular Proteomics 7, 2350\\u0026ndash;2363 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. Nozaki \\u003cem\\u003eet al.\\u003c/em\\u003e, Caspase-7 activates ASM to repair gasdermin and perforin pores. Nature 606, 960\\u0026ndash;967 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. V. Goncalves \\u003cem\\u003eet al.\\u003c/em\\u003e, Gasdermin-D and Caspase-7 are the key Caspase-1/8 substrates downstream of the NAIP5/NLRC4 inflammasome required for restriction of Legionella pneumophila. PLoS pathogens 15, e1007886 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Akhter \\u003cem\\u003eet al.\\u003c/em\\u003e, Caspase-7 Activation by the Nlrc4/Ipaf Inflammasome Restricts Legionella pneumophila Infection. PLoS pathogens 5, (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. V. Nogueira \\u003cem\\u003eet al.\\u003c/em\\u003e, Rapid Pathogen-Induced Apoptosis: A Mechanism Used by Dendritic Cells to Limit Intracellular Replication of Legionella pneumophila. PLoS pathogens 5, (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Poe \\u003cem\\u003eet al.\\u003c/em\\u003e, Human cytotoxic lymphocyte granzyme B. Its purification from granules and the characterization of substrate and inhibitor specificity. The Journal of biological chemistry 266, 98\\u0026ndash;103 (1991).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. J. Darmon, D. W. Nicholson, R. C. Bleackley, Activation of the apoptotic protease CPP32 by cytotoxic T-cell-derived granzyme B. Nature 377, 446\\u0026ndash;448 (1995).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. M. Chinnaiyan \\u003cem\\u003eet al.\\u003c/em\\u003e, Cytotoxic T-cell-derived granzyme B activates the apoptotic protease ICE-LAP3. Current biology: CB 6, 897\\u0026ndash;899 (1996).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eF. Andrade \\u003cem\\u003eet al.\\u003c/em\\u003e, Granzyme B directly and efficiently cleaves several downstream caspase substrates: implications for CTL-induced apoptosis. Immunity 8, 451\\u0026ndash;460 (1998).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. A. Thomas, C. Du, M. Xu, X. Wang, T. J. Ley, DFF45/ICAD can be directly processed by granzyme B during the induction of apoptosis. Immunity 12, 621\\u0026ndash;632 (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eV. G. Lewis, M. P. Ween, C. A. McDevitt, The role of ATP-binding cassette transporters in bacterial pathogenicity. Protoplasma 249, 919\\u0026ndash;942 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Renzoni, P. Cossart, S. Dramsi, PrfA, the transcriptional activator of virulence genes, is upregulated during interaction of with mammalian cells and in eukaryotic cell extracts. Molecular microbiology 34, 552\\u0026ndash;561 (1999).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eH. Bierne, P. Cossart, InIB, a surface protein of that behaves as an invasin and a growth factor. Journal of cell science 115, 3357\\u0026ndash;3367 (2002).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. Coelho \\u003cem\\u003eet al.\\u003c/em\\u003e, virulence factors, including listeriolysin O, are secreted in biologically active extracellular vesicles. Journal of Biological Chemistry 294, 1202\\u0026ndash;1217 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eI. R. Monk, C. G. Gahan, C. Hill, Tools for functional postgenomic analysis of listeria monocytogenes. Applied and environmental microbiology 74, 3921\\u0026ndash;3934 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. L. Heckman, L. R. Pease, Gene splicing and mutagenesis by PCR-driven overlap extension. Nature Protocols 2, 924\\u0026ndash;932 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eP. R. E. Mittl \\u003cem\\u003eet al.\\u003c/em\\u003e, Structure of recombinant human CPP32 in complex with the tetrapeptide Acetyl-Asp-Val-Ala-Asp fluoromethyl ketone. Journal of Biological Chemistry 272, 6539\\u0026ndash;6547 (1997).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eH. R. Stennicke, G. S. Salvesen, Caspases: preparation and characterization. Methods 17, 313\\u0026ndash;319 (1999).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJ. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnology 26, 1367\\u0026ndash;1372 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eE. Madzharova, F. Sabino, U. Auf dem Keller, Exploring Extracellular Matrix Degradomes by TMT-TAILS N-Terminomics. Methods in molecular biology 1944, 115\\u0026ndash;126 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003eTable 1 is available in the Supplementary Files section.\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4655845/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4655845/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eCell death mediated by executioner caspases is essential during organ development and for organismal homeostasis. The mechanistic role of activated executioner caspases in antibacterial defense during infections with intracellular bacteria, such as \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e, remains elusive. Cell death upon intracellular bacterial infections is considered altruistic to deprive the pathogens of their protective niche. To establish infections in a human host \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e deploy virulence mediators, including membranolytic listeriolysin O, allowing phagosomal escape and cell-to-cell spread. Here, by means of chemical and genetical modifications, we show that the executioner caspases-3 and \\u0026minus;\\u0026thinsp;7 efficiently inhibit growth of intracellular \\u003cem\\u003eListeria monocytogenes\\u003c/em\\u003e in host cells. Comprehensive proteomics revealed multiple caspase-3 substrates in the \\u003cem\\u003eListeria\\u003c/em\\u003e secretome, including listeriolysin O and various other proteins crucially involved in pathogen-host interactions. \\u003cem\\u003eListeria\\u003c/em\\u003e secreting caspase-uncleavable listeriolysin O gained significant growth advantage in epithelial cells. With that, we uncovered an underappreciated defense barrier and a non-canonical role of executioner caspases to degrade virulence mediators, thus impairing intracellular \\u003cem\\u003eListeria\\u003c/em\\u003e growth.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Executioner caspases degrade essential mediators of pathogen-host interactions to inhibit growth of intracellular Listeria monocytogenes\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-08-28 11:39:36\",\"doi\":\"10.21203/rs.3.rs-4655845/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"aaccd08f-c48b-46b8-9097-4ed31ed530bc\",\"owner\":[],\"postedDate\":\"August 28th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":34084031,\"name\":\"Biological sciences/Immunology/Infectious diseases\"},{\"id\":34084032,\"name\":\"Health sciences/Pathogenesis/Immunopathogenesis\"}],\"tags\":[],\"updatedAt\":\"2025-02-10T15:09:03+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-4655845\",\"link\":\"https://doi.org/10.1038/s41419-025-07365-x\",\"journal\":{\"identity\":\"cell-death-and-disease\",\"isVorOnly\":false,\"title\":\"Cell Death \\u0026 Disease\"},\"publishedOn\":\"2025-01-30 05:00:00\",\"publishedOnDateReadable\":\"January 30th, 2025\"},\"versionCreatedAt\":\"2024-08-28 11:39:36\",\"video\":\"\",\"vorDoi\":\"10.1038/s41419-025-07365-x\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41419-025-07365-x\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4655845\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4655845\",\"identity\":\"rs-4655845\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}