{"paper_id":"b2e85104-54d3-418b-8125-b5b946140d8a","body_text":"R E S E A R C H Open Access\nEpigenetic role of the nuclear factor NF-Y\non ID gene family in endometrial tissues of\nwomen with endometriosis: a case control\nstudy\nShirin Amirteimouri 1,2,3, Manan Ashini 1,3, Fariba Ramazanali 4, Reza Aflatoonian 4, Parvaneh Afsharian 3 and\nMaryam Shahhoseini 2,3*\nAbstract\nBackground: A predominant difference between endometrial and normal cells is higher proliferation rate in the\nformer cells which is benign. The genes of inhibitor of differentiation ( ID) family play a major role in cell\nproliferation regulation which might be targeted by the nuclear transcription factor Y (NF-Y) for subsequent\nepigenetic modifications through the CCAAT box regulatory region. The present study was designed to investigate\nthe epigenetic role of NF-Y on ID gene family in endometrial tissue of patients with endometriosis.\nMaterials & methods: In this case-control study, 20 patients with endometriosis and 20 normal women were\nexamined for the relative expression of the NF-YA, NF-YB, NF-YC and ID genes by real-time PCR during the\nproliferative phase. The occupancy of NF-Y on CCAAT box region of ID genes was investigated using chromatin\nimmunoprecipitation (ChIP) followed by real-time PCR.\nResults: The NF-YA was over-expressed in eutopic endometrium during the proliferative phase. Although the\nexpression level of NF-YB and NF-YC were unchanged in eutopic samples, they were remarkably higher in ectopic\ngroup ( P<0.05). The ID2 and ID3 genes were up-regulated in ectopic and eutopic tissues, however ID1 and ID4\ngenes were down-regulated in these samples ( P<0.05). The ChIP analysis revealed significant enrichment of NF-Y on\nregulatory regions of ID2,3 genes in eutopic group, but reduced binding level of NF-Y to the ID1,3 promoters in\nectopic specimens ( P<0.05).\nConclusion: The ability of NF-Y to regulate ID genes via CCAAT box region suggests the possible role of NF-Y\ntranscription factor in epigenetic changes in endometrial tissues which may open novel avenues in finding new\ntherapeutic strategies.\nKeywords: Nuclear transcription factor Y, ID gene family, Endometriosis, Epigenetic\n© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0\nInternational License ( http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and\nreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to\nthe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver\n(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.\n* Correspondence: shahhoseini244@gmail.com;\nm.shahhoseini@royaninstitute.org\n2Reproductive Epidemiology Research Center, Royan Institute for\nReproductive Biomedicine, ACECR, P.O. Box: 19395-4644, Tehran, Iran\n3Department of Genetics, Reproductive Biomedicine Research Center, Royan\nInstitute for Reproductive Biomedicine, ACECR, P.O. Box: 19395-4644, Tehran,\nIran\nFull list of author information is available at the end of the article\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 \nhttps://doi.org/10.1186/s12958-019-0476-9\n\nBackground\nEndometriosis is an estrogen-dependent inflammatory\ndisease that is strongly associated with infertility and a-\nffects over 70 million women worldwide [ 1, 2]. Although\nthere is no single theory of pathogenesis to entirely\nexplain all the manifestations of endometriosis [ 3],\nSampson’s theory of retrograde dissemination of men-\nstrual debris has gained widespread acceptance as an\nexplanation for the initiating steps in the pathogenesis of\nendometriosis [ 4]. There are several leading theories,\nincluding altered immunity, coelomic metaplasia, and\nmetastatic spread attempting to explain the origin of\nendometriosis. Recent studies have also found genetic\nbasis for endometriosis [ 5]. None of these theories fully\nexplain the whole mechanisms associated with the\ndevelopment of disease and the actual cause remains\nunknown [ 6, 7]. Multiple factors including genetics,\nepigenetics, environmental modifications, aging, and di-\nverse anatomical or biochemical aberrations of uterine\nfunction are also involved in the development of\nendometriosis [ 8, 9].Accumulating evidence suggest that\nvarious epigenetic aberrations may play a significant role\nin the initiation and progression of endometriosis [ 10].\nEpigenetic modifications such as DNA methylation,\nchromatin modifications, and RNA interference refer to\nheritable changes in gene expression with no underlying\nalteration in the genetic sequence [ 11].\nNuclear transcription factor Y (NF-Y) is one of the\ntranscriptional regulation factors which mediates the\nabove-mentioned epigenetic modifications [ 12]. NF-Y\ncomplexes are trimeric proteins composed of NF-YA,\nNF-YB, and NF-YC subunits that play a crucial role in\nregulating eukaryotic gene expression. A heterodimer of\nNF-YB and NF-YC which are homologous in sequence\nto histonesH2B and H2A, respectively, interacts with\nNF-YA to form the heterotrimeric NF-Y complex [ 13].\nAll of these subunits are necessary for binding to the\ncore CCAAT box, a cis element present in 30% of\neukaryotic promoters [ 14, 15]. Among the various DNA\nbinding proteins that interact with this sequence, NF-Y is\nthe only protein which needs all the CCAAT box nucleo-\ntides to be able to bind the DNA and has an extremely\nspecific interaction with this region [16]. NF-Y has been\nshown to (i) mediate the recruitment of polymerase II\nonto various CCAAT box-containing promoters to\npermit the transcriptional activation (a pioneering role\nin activation of transcription) [ 17], (ii) induce DNA\ncompaction that facilitates promoter-enhancer interac-\ntions, and (iii) regulate several cell cycle regulatory genes\nwhich are known to be critical for expression control\n[18, 19]. Although, it has been proved that the NF-Y\ncomplex is involved in critical biological processes\nincluding cell growth, proliferation/apoptosis balance,\ntumorigenesis (the elevated levels of NF-Y is associated\nwith breast [ 20], ovarian [ 21], prostate [ 22], and thyroid\n[23] cancers), and cell reaction to the stressors, the exact\nroles of NF-Y on regulatory regions of many develop-\nmental genes remain poorly understood [ 21, 24].\nThe inhibitor of differentiation ( ID) gene family\nconsisting of ID-1, ID-2, ID-3, and ID-4 isoforms are\nknown to be dominant negative regulators of differenti-\nation, but the positive regulators of cellular proliferation\n[25]. The ID helix-loop-helix (HLH) proteins lack the\nbasic DNA binding region and are functional inhibitors\nof the basic helix-loop-helix (bHLH) transcription fac-\ntors [ 26]. Recent data reported non-canonical functions\nfor ID proteins, such as binding to Rb family and\nbiochemical attributes including regulating cell fate,\nproliferation, differentiation, and migration [ 27, 28].\nSince the exact roles of NF-Y on regulatory regions of ID\ngenes are not still clarified, the current investigation was\nd e s i g n e dt oe v a l u a t et h ep o s s i b l ee p i g e n e t i cr o l eo fN F - Y\non ID gene family through CCAAT box region in endo-\nmetrial tissue of endometriosis and non-endometriosis\nwomen.\nMaterial & methods\nPatients and tissue collection\nTwenty patients with endometriosis (in stages III and\nIV), who underwent laparoscopic excision of ectopic\nendometrium lesions (ovarian endometrioma) were re-\ncruited for this study. The patients ranged in age from\n20 to 45 years and had regular menstrual cycles. The\nexclusion criteria for participation were: endometrial\nhyperplasia, benign masses like fibroids and polyps, in-\nflammatory diseases, autoimmune diseases, endocrine\ndiseases, cancers, sepsis, asthma, glomerulonephritis,\nosteoporosis, psoriasis, myocardial infarction, and\nleukemia. It should be mentioned that based on the en-\ntity of the study, all analyzed samples were representing\nwhole tissues, which are composed of a mixed popula-\ntion of cells (stromal, epithelial, and inflammatory).\nThe eutopic endometrium samples from these patients\nwere obtained by pipelle. All tissue samples, i.e. both\neutopic (20 samples) and ectopic (20 samples) endomet-\nrium, were collected, immediately divided into two\nseparate cryovials (one contained RNAlater (QIAGEN\nLtd) for RNA extraction and the other was used in ChIP\nassays), and stored at − 80 °C until performing the\nanalysis. All biopsies were performed by an experienced\ngynecologist at the Royan Institute for Reproductive\nBiomedicine.\nThe control group consisted of 20 women with no\nevidence of endometriosis and having at least one child\nby natural pregnancy. Endometrium samples were taken\nfrom normal women during diagnostic laparoscopy.\nFreshly recovered tissues also divided into two separate\ncryovials (one contained RNAlater (QIAGEN Ltd) for\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 2 of 9\n\nRNA extraction and the other was used in ChIP assays),\nand stored at − 80 °C until performing the analysis. The\nexclusion criteria for the women from the control group\nwere the same as for the patients. Before sampling, the\nnature of the study was explained and written informed\nconsent was obtained from all participants.\nRNA isolation\nEach tissue sample (50 mg approximately) preserved in\nRNALater was homogenized using scalpel blade and glass\nhomogenizer. Total RNA was extracted with TRIzol re-\nagent (Invitrogen, USA) according to the manufacturer ’s\ninstructions. Diethylpyrocarbonate (DEPC)-treated water\nwas used for the dilution of the RNA pellet. The approxi-\nmate concentration and purity of RNA was assessed by\noptical density [ 29] 260/280 ratios. To eliminate genomic\nDNA contamination from RNA samples, DNase I diges-\ntion was performed.\nReverse transcription (RT) and real-time polymerase chain\nreaction analysis\nIndividual RNA samples from ectopic, eutopic, and\ncontrol tissue samples ( n = 60) were reverse transcribed\ninto complementary DNA (cDNA). Standard RT was\ncarried out in reaction mixture containing 4 μLof 5X RT\nBuffer, 2 μLo fm i x e dd N T P s( 2 . 5 μm each), 1 μLo f\nRT-MULV enzyme, 1μL Random hexamer, 1 μLR N a s eI n -\nhibitor and 1 μg RNA template. The mixture was incu-\nb a t e d i n 2 5° C f o r 5m i n , 4 2° C f o r 6 0m i n a n d 7 0° C f o r 5\nmin. To study the relative mRNA expression of the NF-YA,\nNF-YB and NF-YC genes, real-time PCR was carried out\nusing Step One Plus ™ Real-time PCR System (Applied\nBiosystems International, Inc., Switzerland). Every target\ncDNA was co-amplified withglyceraldehyde-3-phosphate\ndehydrogenase (GAPDH) as endogenous control using\nspecific primers. Real-time PCR was performed in triplicate\nfor each sample according to the following conditions:\n5 μL of SYBR Premix Ex TaqII (Takara, Japan), 1μL of each\nprimer (5 pmol/μL), 11 μLH 2Oa n d2 μL cDNA (12.5 ng/\nμL) in a final volume of 20 μL for each reaction. The reac-\ntion conditions were 95 °C for 4 min, followed by 40 cycles\nat 95 °C for 10 s, 60 °C for 30 s and 72 °C for 30s and final\nextension of 72 °C for 10 min. The relative mRNA\nexpression was calculated for each sample according to the\n2−ΔΔ CTandGAPDHg e n ew a su s e da sn o r m a l i z e rf o rt h e\n2−ΔΔ CTcalculus.All primer sets used in qRT-PCR are shown\nin Table 1.\nChromatin immunoprecipitation-real-time PCR analysis\nFor ChIP assays, homogenized endometrial tissues were\ncross-linked with 1% formaldehyde and subjected to\nimmunoprecipitation after sonication. The ChIP\nexperiments were performed using the Orange ChIP kit\n(Diagenode, Belgium), according to the manufacturer ’s\ninstructions on three biological replicates. Real time\nPCR was used to amplify specific promoter DNA ( ID1–\n4) bound to the immunoprecipitated histones (NF-Y)\nafter reversing the histone-DNA cross-links (primers\nlisted in Table 1). All the samples were amplified in trip-\nlicate. Data were represented as the percentage of input\nDNA associated with immunoprecipitated NF-Y relative\nto input chromatin. A Rabbit polyclonal antibody against\nNF-Y (Abcam, ab6558) was used.\nStatistical analysis of real-time PCR\nAll the statistical analyses conducted using SPSS 16 soft-\nware and values were expressed as Mean ± SEM of three\nseparate biological experiments. The ANOVA test was\nperformed to compare the differences between eutopic,\nectopic, and control samples. Statistical significance was\ndefined as a P value of < 0.05.\nResults\nThe expression analysis of NF-YA, NF-YB and NF-YC genes,\nand ID gene family\nTo quantify the relative expression levels of NF-Y\n(NF-YA, NF-YB, and NF-YC) and ID (ID1–ID4) genes in\nectopic, eutopic, and control groups, quantitative\nreal-time PCR was performed (Figs. 1 and 2) (Table 2)\nduring the proliferative phase. As illustrated in Fig. 1a,\nthe expression level of NF-YA is increased in eutopic\nendometrium in comparison to control (3.39 ± 1.09\nversus 1.77 ± 0.29) ( P = 0.006) (Table 2). In addition, the\nexpression of NF-YA in eutopic tissues was greater than\nthe ectopic samples (2.41 ± 0.38) ( P = 0.039). The expres-\nsion level of NF-YB and NF-YC had no remarkable\nTable 1 Primer pairs used in this study\nGenes Primer Sequences (5 ′-3′) Product length (bp)\nNF-YA F: TTCTCCAGCAAGTTACAGTC 183\nR: ACCATCATGACCATCCCT\nNF-YB F: TGCCATCAAGAGAAACGG 151\nR: ACTGCTCCACCAATTCC\nNF-YC F: AGTATATCCGCTTAGCCCA 96\nR: TCTGTCTGTGTAATCTGTTGAG\nGAPDH F: CTCATTTCCTGGTATGACAACGA 122\nR: CTTCCTCTTGTGCTCTTGCT\nID1 F: CCTTGCTGTTCTGAAACCC 193\nR: GTGGAATGAGAGTGCGGA\nID2 F:TGATAGACGTGCCACCTTCC 103\nR: TCAGAATGAAGCCCGAGCC\nID3 F:CACAAGATAATTCCTGACGCCA 204\nR: AGTCCGCCTTTAGCCCAA\nID4 F:CGCACGGCTCTATAAATACA 160\nR:GTGTCCTAGTCACTCCCTT\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 3 of 9\n\nFig. 1 The expression profile of NF-Y subunits in endometriosis patients vs. control group in proliferative phase. Although the NF-YA overexpression in\neutopic tissue samples (n = 20) is evident (p = 0.006), there is no remarkable change in its expression level in ectopic specimens (n = 20) compared to\nnormal group (n =2 0 )(p = 0.730). The NF-YB and NF-YC were up-regulated in ectopic tissues (p =0 . 0 0 0a n d0 . 0 0 2 ,respectively), while remained\nunchanged in eutopic samples (p = 0.277 and 0.397, respectively). (The measures are provided as mean ± SEM)\nFig. 2 The expression profile of ID genes in endometriosis patients vs. control group in proliferative phase. The ID1 and ID4 expression levels\nwere reduced in both ectopic (n = 20) ( p = 0.001 and 0.015, respectively) and eutopic ( n = 20) (p = 0.025 and 0.019, respectively) samples in\ncomparison with control specimens ( n = 20). On the other hand, ID2 and ID3 were overexpressed in ectopic ( p = 0.0006 and 0.005, respectively)\nand eutopic tissues ( p = 0.012 and 0.004, respectively). (The measures are presented as mean ± SEM)\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 4 of 9\n\nchanges in eutopic tissue (1.88 ± 0.3 and 3.51 ± 0.97, re-\nspectively) in relation to control (1.01 ± 0.15 and 0.88 ±\n0.13, respectively)( P = 0.277 and P = 0.397, respectively)\n(Table 2). On the other hand, their expression signifi-\ncantly increased in ectopic group ( NF-YB: 3.81 ± 0.55,\nand NF-YC: 7.63 ± 2.05) during the proliferative phase\ncompared to that of control ( P = 0.000 and P = 0.002, re-\nspectively) (Table 2). NF-YB and NF-YC gene expression\nchanges in the ectopic tissues were significant compared\nto eutopic tissues (Fig. 1b and c).\nIn proliferative phase, the expression level of ID1, ID2,\nID3, and ID4 genes in control, ectopic, and eutopic\ngroups were assessed (Fig. 2a-c) (Table 2). The results\nindicated the down-regulation of ID1 and ID4 genes\nin both ectopic ( ID1: 0.05 ± 0.03, and ID4: 0.68 ± 0.01)\n(P =0 . 0 0 1 , a n dP = 0.015) and eutopic ( ID1:0 . 3 6 ±\n0.02, ID4: 0.56 ± 0.03) ( P =0 . 0 2 5 , a n d P = 0.019)\ntissues in proliferative phase (Fig. 2a, d) (T able 2).\nHowever, the expression level of ID2 and ID3 was\nobserved to be increased in ectopic ( ID2: 1.7 ± 0.00,\nID3:27.54 ± 0.4) ( P = 0.0006, and P = 0.005) and\neutopic ( ID2: 1.75 ± 0.01, ID3: 2.67 ± 0.09) ( P = 0.012,\nand P = 0.004) tissues (Fig. 2b, c) (Table 2).\nNF-Y incorporation on regulatory regions of ID genes in\nectopic and eutopic tissues of women with endometriosis\nTo gain insight into NF-Y-mediated transcriptional\nregulation of ID genes in endometriosis, we investigated\nthe occupancy of NF-Y complex on CCAAT regulatory\nregion and/ or its complementary sequence in eutopic,\nectopic, and normal tissues during the proliferative\nphase using ChIP analysis followed by real time PCR.\nThe ChIP analysis of the eutopic samples revealed sig-\nnificant enrichment of NF-Y on the CCAAT-containing\nregions of ID2, and ID3 promoters in the proliferative\nphase ( ID2: 0.45 ± 0.088, and ID3: 0.30 ± 0.037) in com-\nparison with the normal samples ( ID2: 0.14 ± 0.008, and\nID3: 0.19 ± 0.034) ( P = 0.014 and P = 0.025, respectively)\n(Fig. 3b, c) (Table 2). However, there was no remarkable\ndifference in NF-Y binding level to the regulatory\nregions of ID1gene between eutopic ( ID1: 0.34 ± 0.045)\nand control ( ID1: 0.25 ± 0.032) tissues ( P =0 . 1 9 5 )\n(Fig. 3a)( T a b l e2).\nComparing the level of NF-Y binding to the upstream\nregions of ID genes in ectopic and control specimens in\nproliferative phase, it was found that the binding level to\nthe ID1 and ID3 CCAAT boxes was decreased in ectopic\ntissue samples ( ID1: 0.05 ± 0.016, and ID3: 0.58 ± 0.02)\n(P =0 . 0 0 5 a n d P = 0.025, respectively )( F i g . 3a, c)\n(T able 2). In ectopic group, a slight increment of\nbinding to the ID2 upstream regions ( ID2:0 . 2 0 ±\n0.076) was observed which was not statistically\nsignificant ( P = 0.799) (Fig. 3b) (Table 2).\nEventually, NF-Y incorporation on the ID1, ID2 and\nID3 genes in eutopic group was remarkably greater than\nthe ectopic group ( P = 0.000, P = 0.045, and P = 0.000, re-\nspectively) (Fig. 3). However, the incorporation of NF-Y\nwas not identified on ID4 gene.\nDiscussion\nEndometriosis is a benign progressive disease with\nendometrial lesions leading to infertility in women of re-\nproductive age [ 30]. According to the recent investiga-\ntions, endometriosis is caused by several factors and the\nepigenetic plays a major role in development of the\ndisease [ 10, 31, 32].\nThe NF-Y is one of the factors responsible for epigen-\netic changes. This factor facilitates the interaction\nbetween promoter and the enhancers by binding to the\nCCAAT BOX regulatory region through affecting the\nDNA condensation. This is a crucial process in the ex-\npression regulation of genes with this motif [ 13, 33].\nAny changes in NF-Y (whether its expression or DNA\nbinding properties) is regarded as a disease causing\nfactor [ 13].\nThe current study revealed the up-regulation of NF-YB\nand NF-YC genes in ectopic tissue of endometriosis\npatients in the proliferative phase of the menstrual cycle\nTable 2 Expression analysis of genes encoding NFY complex\nsubunits and ID gene family members and the evaluation of\nNFY complex incorporation on ID genes upstream regions in\nnormal and endometrial ectopic and eutopic tissue specimens\nTissue Gene qPCR P-value ChIP-seq P-value\nEutopic NF-YA 3.39 ± 1.09 0.006\nNF-YB 1.88 ± 0.3 0.277\nNF-YC 3.51 ± 0.97 0.397\nID1 0.36 ± 0.02 0.025 0.34 ± 0.045 0.195\nID2 1.75 ± 0.01 0.012 0.45 ± 0.088 0.014\nID3 2.67 ± 0.09 0.004 0.30 ± 0.037 0.025\nID4 0.56 ± 0.03 0.019\nEctopic NF-YA 2.41 ± 0.38 0.730\nNF-YB 3.81 ± 0.55 0.000\nNF-YC 7.63 ± 2.05 0.002\nID1 0.05 ± 0.03 0.001 0.05 ± 0.016 0.005\nID2 1.7 ± 0.00 0.0006 0.20 ± 0.076 0.799\nID3 27.54 ± 0.4 0.005 0.58 ± 0.02 0.025\nID4 0.68 ± 0.01 0.015\nNormal NF-YA 1.77 ± 0.29\nNF-YB 1.01 ± 0.15\nNF-YC 0.88 ± 0.13\nID1 1 ± 0.03 0.25 ± 0.032\nID2 1 ± 0.01 0.14 ± 0.008\nID3 1 ± 0.03 0.19 ± 0.034\nID4 1 ± 0.01\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 5 of 9\n\nwhich was significant in comparison to the control\ngroup. The NF-YA gene expression was remarkably in-\ncreased in the endometrium of endometriosis patients\n(eutopic tissue) than that of the control group and the\naugmentation in this group was higher than the ectopic\ngroup.\nPrevious studies demonstrated that the cell growth\nand proliferation in endometriosis patients is increased\nin the proliferative phase [ 34]. It was also declared that\nsome signaling pathways, related to the increased cell\ndivision and survival, are more activated in endometrio-\ntic cells of these patients [ 35]. Furthermore, the eutopic\nand ectopic endometriums have less differentiated cells\nwhich results in decreased levels of apoptosis in such tis-\nsues [ 35]. NF-Y regulates the balance between prolifera-\ntion and differentiation states through the recruitment\nof RNA polymerase II and communication with tran-\nscription factors and the enzymes binding to the pro-\nmoter regions of cell cycle-regulated genes [ 13, 36, 37].\nIn present study, the binding level of NF-Y factor to\nthe regulatory regions of ID1, ID2, and ID3 genes in\nendometrium of the control and patient groups was\ncompared in the proliferative phase in order to epigen-\netic assessments.\nThe ID family genes ( ID1, ID2, ID3,a n d ID4) are major\nregulators of two important cell processes: the prolifera-\ntion and differentiation. These genes play important roles\nin signaling pathways, cell fate determination, cell death,\ntumorigenesis, cell cycle and others as a result of their\nability to restrain the differentiation and stimulate the pro-\nliferation [ 38–40]. An interesting feature of ID family\ngenes (which led us to select them for the current re-\nsearch) is the existence of CCAAT regulatory region or its\ncomplementary sequence (ATTGG) in their promoter\nwhich affects the regulated binding of NF-Y to this region.\nIt is worth to mention that among all the members of ID\ngene family, the ID4 is deficient in the presence of CCAA\nT sequence in its upstream region to be occupied by the\nNFY complex. The binding of NF-Y protein to the ID gene\npromoter implies that such connection is necessary for\ntranscription initiation in the cell division process [ 33].\nRegarding the results from quantitative comparison of\nID1, ID2, ID3, and ID4 gene expression between the\ncontrol and endometriosis groups in the proliferative\nphase, the ID2 and ID3 gene expression in both ectopic\nand eutopic tissues were significantly higher than the\ncontrol group and the expression level of ID1 and ID4\ngenes was decreased in the ectopic and also eutopic\ntissue.\nAmong the factors affecting the expression of ID gene\nfamily, c-Myc is a reasonable candidate for being\nresponsible for ID gene family expression changes in\nendometriosis patients. C-Myc, a multifunctional\nnuclear phosphoprotein, participates in the cell cycle\nFig. 3 Incorporation of NF-Y complex on the regulatory regions of a: ID1, b: ID2, and c: ID3 genes in endometriosis patients vs. control group in\nproliferative phase. The data shows statistically significant NFY complex enrichment on ID2 ( p = 0.014) and ID3 ( p = 0.025) promoters in eutopic\ngroup (n = 20), but notable reduction in NFY binding to ID1 ( p = 0.005) and ID3 ( p = 0.025) upstream regions in ectopic group ( n = 20) in\ncomparison with normal group ( n = 20). (The measures represent mean ± SEM)\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 6 of 9\n\nand apoptosis processes as a transcription factor regulat-\ning the expression of certain genes [ 41]. C-Myc contains\na binding site for ID genes’ promoter which has more\naffinity for ID2 promoter than others. However, it was\nclarified that ID3 promoter is also a target for this pro-\ntein in recent years [ 42, 43]. The previous investigations\nindicated that c-Myc factor increases the expression of\nthese genes. The studies revealed that the expression of\nc-Myc as a regulating factor for cell cycle is increased in\nthe eutopic and ectopic tissues of endometriosis patients\nin the proliferative phase in comparison to normal\npeople. The elevated level of c-Myc expression in endo-\nmetriosis patients seems to be related to the estrogen\nlevel increment and also TGF- β expression reduction\n[44]. Furthermore, it has formerly been disclosed that in\nendometrial tissues, there is an elevated level of ID2\ngene expression negatively affected by increased levels of\nTGF-β [45]. This expression pattern exhibits conformity\nto the expression of ID2 and ID3 in current study.\nRegarding the similar expression patterns, it can be\ninterpreted that c-Myc family is responsible for ID2 and\nID3 up-regulation in eutopic and ectopic tissues in the\nproliferative phase.\nMoreover, the helix-loop-helix (HLH) domain is\nconserved in all the members of ID family but the C-\nand N-terminal regions are different which provides the\npossibility of interaction between ID genes and different\nfactors resulting in various consequences [ 46]. The\nhematopoietic stem cell studies indicated that each\nmember of ID family participates in a certain phase of\nhematopoietic cell evolution. For example, once the cell\nis stimulated by inducing cytokines like Interleukine-3,\nInterleukine-6, and Erythropoietin, the ID1 gene is\nover-expressed suggesting the role ID1 plays in prolifera-\ntion and pluripotency maintenance of hematopoietic\nstem cells. ID1 gene also participates in cell fate\ndetermination in T cell or NK cell differentiation path-\nway but the expression of ID2 is not notably increased\nin this phase and is significantly elevated in final stages\n(granulocyte differentiation) instead [ 47].\nThe above mentioned differences also lead to various\nID family activities in different cells and tissues. For ex-\nample, the over-expression of ID1 gene in fetus cerebral\ncortex results in neural cell proliferation and ID4 gene is\nnecessary for mammary gland development [ 48–50].\nThe expression of ID1, ID2, and at a lesser amount the\nID3 genes were also investigated in several studies in-\ncluding prostate cancer researches and the relationship\nbetween their over-expression and cancer incidence was\nclearly perceived. On the other hand, some studies\ndeclared that the reduction of ID4 gene expression is re-\nsponsible for prostate cancer development. Other studies\nclarified that the ID4 gene expression in normal breast\nand stomach tissues is highly elevated in comparison to\ncancerous tissues denoting the tumor suppressive role\nfor this protein [ 51, 52].\nThe binding level of NF-Y protein complex to the\npromoter regions of ID1, ID2, and ID3 genes was dis-\nplayed through ChIP-Real-Time-PCR and according to\nthe results; it was considerably increased in eutopic\ngroup of endometriosis patients in proliferative phase.\nThe function of NF-Y transcription factor is regulated\nby post-translational molecular mechanisms. The regula-\ntion of NF-Y is accomplished at protein level and\nthrough the NF-YA subunit [ 16, 53, 54]. The protein\nlevel of NF-Y is increased and/ or decreased depending\non the cell status. It shows that the binding level of\nNF-Y protein fluctuates in cells and the regulation\nthrough NF-YA subunit prevents the whole complex\nfrom binding to the DNA.\nThe results indicated that the NF-YA is signifi-\ncantly over-expressed in eutopic tissue of endometri-\nosis patients and the binding level of NF-Y complex\nto the promoter regions of ID genes in eutopic\ntissue is elevated as well. This is significant as the\nDNA binding of NF-Y complex is accomplished\nthrough NF-YA subunit and it is the only subunit\npossessing the DNA binding domain which without\nthis domain the complex is not able to bind the\nCCAAT motif [ 55].\nComparing the binding level of NF-Y complex to the\npromoter regions of ID1, ID2, and ID3 genes with quan-\ntitative data from expression of ID1, ID2,a n d ID3 genes\nin control and endometriosis groups in proliferative\nphase, it was revealed that the level of NF-Y complex\nbinding to the ID2 promoter region in endometrium of\nendometriosis women (the eutopoic tissue) in prolifera-\ntive phase of the menstrual cycle is augmented in\ncomparison with the control group which is accompan-\nied by over-expression of this gene in the endometrium\nand endometrial lesions of endometriosis patients in\nproliferative phase.\nMoreover, a reduction in binding level of NF-Y to the\nID1 gene promoter was observed in endometrial lesions\n(ectopic tissue) in proliferative phase compared to the\ncontrol group.\nIn contrast, the NF-Y binding to the ID3 promoter\nregion in the endometrial lesions (ectopic tissue) in\nproliferative phase is significantly decreased compared\nto the control group which is contradictory to ID3 gene\nexpression data in the proliferative phase.\nThe studies demonstrated that CCAAT box sequence\n(the sequence which NF-Y binds to) is one of the most\ncommon elements in the upstream of eukaryotic pro-\nmoters. In addition to the CCAAT box motif, there are\nother conserved regions in class II eukaryotic promoters\nincluding GC-box and TATA-box [ 56]. Likewise, in\naddition to NF-Y protein, there are other proteins\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 7 of 9\n\ncomprising HSP-CBF, Y-BOX FACTORS, CTF/NF-1,\nand C/EBF to bind to this site of DNA [ 55].\nTherefore, the involvement of other conserved regula-\ntory regions and/ or other regulatory elements in the\nprocess of ID3 gene expression regulation in endometrial\nlesions (ectopic tissue) of endometriosis patients have a\ngreat likelihood. It was also determined that the genes\nwithout TATA box are more dependent to their CAT\nbox region [ 12, 16].\nThe ID2 gene has two CAT box regions and no TATA\nbox, while the ID1 and ID3 genes have only one CAT\nbox [ 33]. As the TATA box lacking genes are intensively\ndependent to their CAT box region, the role of NF-Y\nprotein in ID2 gene regulation and epigenetic in endo-\nmetriosis patients is more significant than its binding to\nthe ID1 and ID3 genes.\nConclusion\nThe altered levels of NF-YA, NF-YB, and NF-YC expres-\nsion resulted in some changes in the expression of ID\ngene family in both ectopic and eutopic tissues of endo-\nmetriosis patients in proliferative phase. Furthermore,\nthe incorporation of NF-Y complex on CCAAT box\nregion of ID1, ID2, and ID3 promoters was highly\nenhanced in endometriosis patients. Thus, it can be\nsuggested that NF-Y transcription factor has regulatory\nrole on ID gene family through CCAAT box region and\nis responsible for epigenetic changes in endometrial\ntissues of endometriosis patients.\nHowever, more investigations are required to clarify the\ndifferent underlying molecular regulatory mechanisms in\neutopic and ectopic endometriums in endometriosis\npatients which may open novel avenues in understanding\nof endometriosis pathophysiology and give rise to novel\ntherapeutic strategies.\nAbbreviations\nbHLH: Basic helix-loop-helix; c DNA: Complementary DNA; ChIP: Chromatin\nimmunoprecipitation; DEPEC: Diethylpyrocarbonate; HLH: Helix-loop-helix;\nID: Inhibitor of differentiation; NF-Y: Nuclear transcription factor Y; RT: Reverse\ntranscription\nAcknowledgements\nWe are thakful to all the participants of the study.\nFunding\nNot applicable.\nAvailability of data and materials\nData sharing is not applicable to this article as no datasets were generated\nor analysed during the current study.\nAuthors’ contributions\nShA: Data collection, Data analysis and interpretation, Drafting the\nmanuscript; MA: Data collection; FR: Critical revision of the manuscript; RA:\nFinal approval of the manuscript; PA: Data collection; MSh: Study design and\nSupervising the research. All authors read and approved the final manuscript.\nEthics approval and consent to participate\nThe study protocol was approved by Ethical Committee of Royan Institute\nfor Reproductive Biomedicine. Informed consent was obtained from all the\nparticipants for being included in the study.\nConsent for publication\nNot applicable.\nCompeting interests\nThe authors declare that they have no competing interests.\nPublisher’sN o t e\nSpringer Nature remains neutral with regard to jurisdictional claims in\npublished maps and institutional affiliations.\nAuthor details\n1Department of Basic Sciences and Advanced Technologies in biology,\nUniversity of Science and Culture, Tehran, Iran. 2Reproductive Epidemiology\nResearch Center, Royan Institute for Reproductive Biomedicine, ACECR, P.O.\nBox: 19395-4644, Tehran, Iran. 3Department of Genetics, Reproductive\nBiomedicine Research Center, Royan Institute for Reproductive Biomedicine,\nACECR, P.O. Box: 19395-4644, Tehran, Iran. 4Department of Endocrinology\nand Female Infertility, Reproductive Biomedicine Research Center, Royan\nInstitute for Reproductive Biomedicine, ACECR, Tehran, Iran.\nReceived: 2 January 2019 Accepted: 6 March 2019\nReferences\n1. Bulun SE. Mechanisms of disease endometriosis. Th e new england journal\no f medicine. 2009;360:268 –79.\n2. Nothnick W, Alali Z. Recent advances in the understanding of\nendometriosis: the role of inflammatory mediators in disease pathogenesis\nand treatment. F1000Research. 2016;5. https://doi.org/10.12688/\nf1000research.7504.1.\n3. Sourial S, Tempest N, Hapangama DK. Theories on the pathogenesis of\nendometriosis. International journal of reproductive medicine. 2014;2014.\n4. Sampson JA. Endometrial carcinoma of the ovary, arising in endometrial\ntissue in that organ. Arch Surg. 1925;10(1):1 –72.\n5. Pavone ME, Lyttle BM. Endometriosis and ovarian cancer: links, risks, and\nchallenges faced. Int J Women's Health. 2015;7:663.\n6. Acién P, Velasco I. Endometriosis: a disease that remains enigmatic. ISRN\nobstetrics and gynecology 2013;2013. https://doi.org/10.1155/2013/242149.\n7. Kumar R, Clerc A-C, Gori I, Russell R, Pellegrini C, Govender L, et al. Lipoxin\nA4 prevents the progression of de novo and established endometriosis in a\nmouse model by attenuating prostaglandin E2 production and estrogen\nsignaling. PLoS One. 2014;9(2):e89742.\n8. Forte A, Cipollaro M, Galderisi U. Genetic, epigenetic and stem cell\nalterations in endometriosis: new insights and potential therapeutic\nperspectives. Clin Sci. 2014;126(2):123 –38.\n9. Shao R, Cao S, Wang X, Feng Y, Billig H. The elusive and controversial roles\nof estrogen and progesterone receptors in human endometriosis.\nAm J Transl Res. 2014;6(2):104 –13.\n10. Guo S-W. Epigenetics of endometriosis. Mol Hum Reprod. 2009;15(10):587 –607.\n11. Nasu K, Kawano Y, Tsukamoto Y, Takano M, Takai N, Li H, et al. Aberrant\nDNA methylation status of endometriosis: epigenetics as the pathogenesis,\nbiomarker and therapeutic target. J Obstet Gynaecol Res. 2011;37(7):683 –95.\n12. Ly LL, Yoshida H, Yamaguchi M. Nuclear transcription factor Y and its roles\nin cellular processes related to human disease. Am J Cancer Res.\n2013;3(4):339–46.\n13. Dolfini D, Gatta R, Mantovani R. NF-Y and the transcriptional activation of\nCCAAT promoters. Crit Rev Biochem Mol Biol. 2012;47(1):29 –49.\n14. Dolfini D, Zambelli F, Pavesi G, Mantovani R. A perspective of promoter\narchitecture from the CCAAT box. Cell Cycle. 2009;8(24):4127 –37.\n15. Nardini M, Gnesutta N, Donati G, Gatta R, Forni C, Fossati A, et al. Sequence-\nspecific transcription factor NF-Y displays histone-like DNA binding and\nH2B-like ubiquitination. Cell. 2013;152(1):132 –43.\n16. Mantovani R. A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res.\n1998;26(5):1135–43.\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 8 of 9\n\n17. Shilovski ĭ I, Mazurov D, Khaitov M. The development of vector constructions\nfor respiratory syncitial virus (RSV) P-gene silencing. Patologicheskaia\nfiziologiia i eksperimental ’ naia terapiia. 2009;(4):11 –6.\n18. Guerra RF, Imperadori L, Mantovani R, Dunlap DD, Finzi L. DNA compaction\nby the nuclear factor-Y. Biophys J. 2007;93(1):176 –82.\n19. Dolfini D, Mantovani R. Targeting the Y/CCAAT box in cancer: YB-1 (YBX1)\nor NF-Y&quest. Cell Death & Differentiation. 2013;20(5):676 –85.\n20. Niida A, Smith AD, Imoto S, Tsutsumi S, Aburatani H, Zhang MQ, et al.\nIntegrative bioinformatics analysis of transcriptional regulatory programs in\nbreast cancer cells. BMC bioinformatics. 2008;9(1):404.\n21. Garipov A, Li H, Bitler BG, Thapa RJ, Balachandran S, Zhang R. NF-YA\nunderlies EZH2 upregulation and is essential for proliferation of human\nepithelial ovarian cancer cells. Mol Cancer Res 2013;11(4):360-369.\n22. Calvo A, Perez-Stable C, Segura V, Catena R, Guruceaga E, Nguewa P, et al.\nMolecular characterization of the G γ-globin-tag transgenic mouse model of\nhormone refractory prostate cancer: comparison to human prostate cancer.\nProstate. 2010;70(6):630 –45.\n23. Salvatore G, Nappi TC, Salerno P, Jiang Y, Garbi C, Ugolini C, et al. A cell\nproliferation and chromosomal instability signature in anaplastic thyroid\ncarcinoma. Cancer Res. 2007;67(21):10148 –58.\n24. Li G, Zhao H, Wang L, Wang Y, Guo X, Xu B. The animal nuclear factor Y: an\nenigmatic and important heterotrimeric transcription factor. Am J Cancer\nRes. 2018;8(7):1106–25.\n25. Chaudhary J, Sadler-Riggleman I, Ague JM, Skinner MK. The helix-loop-helix\ninhibitor of differentiation (ID) proteins induce post-mitotic terminally\ndifferentiated Sertoli cells to re-enter the cell cycle and proliferate. Biol\nReprod. 2005;72(5):1205–17.\n26. O'Toole PJ, Inoue T, Emerson L, Morrison IE, Mackie AR, Cherry RJ, et al. Id\nproteins negatively regulate basic helix-loop-helix transcription factor\nfunction by disrupting subnuclear compartmentalization. J Biol Chem.\n2003;278(46):45770–6.\n27. Zebedee Z, Hara E. Id proteins in cell cycle control and cellular senescence.\nOncogene. 2001;20(58):8317.\n28. Lasorella A, Benezra R, Iavarone A. The ID proteins: master regulators of\ncancer stem cells and tumour aggressiveness. Nat Rev Cancer.\n2014;14(2):77–91.\n29. Chaudhary J, Johnson J, Kim G, Skinner MK. Hormonal Regulation and\nDifferential Actions of the Helix-Loop-Helix Transcriptional Inhibitors of\nDifferentiation (Id1, Id2, Id3, and Id4) in Sertoli Cells. Endocrinology.\n2011;142(5):1727–36.\n30. Bulun SE. Endometriosis. N Engl J Med. 2009;360(3):268 –79.\n31. Samadieh Y, Favaedi R, Ramezanali F, Afsharian P, Aflatoonian R,\nShahhoseini M. Epigenetic dynamics of HOXA10 gene in infertile women\nwith endometriosis. Reprod Sci. 2018;26(1):1933719118766255.\n32. Hosseini E, Mehraein F, Shahhoseini M, Karimian L, Nikmard F, Ashrafi M, et\nal. Epigenetic alterations of CYP19A1 gene in cumulus cells and its\nrelevance to infertility in endometriosis. J Assist Reprod Genet.\n2016;33(8):1105–13.\n33. Moeinvaziri F, Shahhoseini M. Epigenetic role of CCAAT box-binding\ntranscription factor NF-Y on ID gene family in human embryonic carcinoma\ncells. IUBMB Life. 2015;67(11):880 –7.\n34. Wingfield M, Macpherson A, Healy DL, Rogers PA. Cell proliferation is\nincreased in the endometrium of women with endometriosis. Fertil Steril.\n1995;64(2):340–6.\n35. Giudice LC, Evers JL, Healy DL. Endometriosis: science and practice: John\nWiley & Sons; 2012.\n36. Gurtner A, Fuschi P, Magi F, Colussi C, Gaetano C, Dobbelstein M, et al. NF-Y\ndependent epigenetic modifications discriminate between proliferating and\npostmitotic tissue. PLoS One. 2008;3(4):e2047.\n37. Ceribelli M, Dolfini D, Merico D, Gatta R, Viganò AM, Pavesi G, et al. The\nhistone-like NF-Y is a bifunctional transcription factor. Mol Cell Biol. 2008;\n28(6):2047–58.\n38. Norton JD. ID helix-loop-helix proteins in cell growth, differentiation and\ntumorigenesis. J Cell Sci. 2000;113(22):3897 –905.\n39. Yokota Y. Id and development. Oncogene. 2001;20(58):8290 –8.\n40. Ruzinova MB, Benezra R. Id proteins in development, cell cycle and cancer.\nTrends Cell Biol. 2003;13(8):410 –8.\n41. Gearhart J, Pashos EE, Prasad MK. Pluripotency redux — advances in stem-\ncell research. N Engl J Med. 2007;357(15):1469 –72.\n42. Perk J, Iavarone A, Benezra R. Id family of helix-loop-helix proteins in cancer.\nNat Rev Cancer. 2005;5(8):603 –14.\n43. Lasorella A, Uo T, Iavarone A. Id proteins at the cross-road of development\nand cancer. Oncogene. 2001;20(58):8326 –33.\n44. Johnson MC, Torres M, Alves A, Bacallao K, Fuentes A, Vega M, et al.\nAugmented cell survival in eutopic endometrium from women with\nendometriosis: expression of c-myc, TGF-beta1 and bax genes. Reprod Biol\nEndocrinol. 2005;3(1):45.\n45. Young VJ, Ahmad SF, Brown JK, Duncan WC, Horne AW. Id2 mediates the\ntransforming growth factor- β1-induced Warburg-like effect seen in the\nperitoneum of women with endometriosis. MHR: Basic Sci Reprod Med.\n2016;22(9):648–54.\n46. Rockman SP, Currie SA, Ciavarella M, Vincan E, Dow C, Thomas RJ, et al. Id2\nis a target of the β-catenin/T cell factor pathway in colon carcinoma.\nJ Biol Chem. 2001;276(48):45113 –9.\n47. Kamalian L, Gosney JR, Forootan SS, Foster CS, Bao ZZ, Beesley C, et al.\nIncreased expression of id family proteins in small cell lung cancer and its\nprognostic significance. Clin Cancer Res. 2008;14(8):2318 –25.\n48. Wu Q, Hoffmann MJ, Hartmann FH, Schulz WA. Amplification and\noverexpression of the ID4 gene at 6p22. 3 in bladder cancer. Molecular\nCancer. 2005;4(1):16.\n49. Kim D, Franklyn J, Stratford A, Boelaert K, Watkinson J, Eggo M, et al.\nPituitary tumor-transforming gene regulates multiple downstream\nangiogenic genes in thyroid cancer. J Clin Endocrinol Metabol.\n2006;91(3):1119–28.\n50. Mern D, Hasskarl J, Burwinkel B. Inhibition of id proteins by a peptide\naptamer induces cell-cycle arrest and apoptosis in ovarian cancer cells.\nBr J Cancer. 2010;103(8):1237 –44.\n51. Chan ASW, Tsui WY, Chen X, Chu KM, Chan TL, Chan ASY, et al.\nDownregulation of ID4 by promoter hypermethylation in gastric\nadenocarcinoma. Oncogene. 2003;22(44):6946 –53.\n52. Welcsh PL, Lee MK, Gonzalez-Hernandez RM, Black DJ, Mahadevappa M,\nSwisher EM, et al. BRCA1 transcriptionally regulates genes involved in breast\ntumorigenesis. Proc Natl Acad Sci. 2002;99(11):7560 –5.\n53. Carey JP, Asirvatham AJ, Galm O, Ghogomu TA, Chaudhary J. Inhibitor of\ndifferentiation 4 (Id4) is a potential tumor suppressor in prostate cancer.\nBMC Cancer. 2009;9(1):173.\n54. Cooper CL, Newburger PE. Differential expression of id genes in multipotent\nmyeloid progenitor cells: id-1 is induced by early-and late-acting cytokines\nwhile id-2 is selectively induced by cytokines that drive terminal\ngranulocytic differentiation. J Cell Biochem. 1998;71(2):277 –85.\n55. Matuoka K, Chen KY. Nuclear factor Y (NF-Y) and cellular senescence. Exp\nCell Res. 1999;253(2):365 –71.\n56. Stewart JJ, Fischbeck JA, Chen X, Stargell LA. Non-optimal TATA elements\nexhibit diverse mechanistic consequences. J Biol Chem. 2006;281(32):22665–73.\nAmirteimouri et al. Reproductive Biology and Endocrinology           (2019) 17:32 Page 9 of 9","source_license":"CC0","license_restricted":false}