{"paper_id":"b055ce5b-bb73-4f07-94de-1e19235336e0","body_text":"Infertility is a universal health issue, with an estimated 15% of couples experiencing infertility worldwide [ 1 ]. Endometrial disorders, including endometriosis and chronic inflammation, are the major reasons for female infertility. Endometriosis afflicts more than 10% of reproductive women, and those with stage III/IV endometriosis experience significantly lower rates of implantation and pregnancy [ 2 ,  3 ]. In addition, women with severe endometriosis have lower pregnancy rates compared with women with mild endometriosis [ 4 ]. Despite multiple IVF (in vitro fertilization) treatments, 10–15% of women still fail to achieve pregnancy, which is defined as recurrent implantation failure (RIF) [ 5 ]. The underlying mechanisms behind endometrial disorders remain unclear.\nA growing body of evidence shows that epigenetic aberrations, including DNA methylation [ 6 ], histone acetylation [ 7 ], and noncoding RNAs [ 8 ,  9 ], might contribute to endometrial disorders. m 6 A, the most prevalent RNA modification in eukaryotes, plays important roles in RNA splicing, translocation, stability, and translation [ 10 ]. The functional effects of m 6 A are mediated by “writer”, “eraser”, and “reader” proteins [ 11 ]. The writer complex, consisting of a core METTL3-METTL14 m 6 A methyltransferase along with regulatory subunits, such as KIAA1429, RBM15, RBM15B, WTAP, and ZC3H13, catalyzes the m 6 A methylation of mRNA [ 10 ]. The eraser enzymes, including FTO and ALKBH5, mediate the reversal of this methylation. m 6 A methylated transcripts are recognized by reader proteins including the YTH family (YTHDF1/2/3 and YTHDC1/2), HNRNPA2/B1, HNRNPC, HNRNPG (RBMX), the insulin-like growth factor 2 mRNA-binding protein family IGF2BP1/2/3 [ 10 ]. Several studies have revealed the association of m 6 A modification with gametogenesis and fertility for both sexes [ 12 ,  13 ]. m 6 A modification has also been implicated in the pathogenesis of endometrium-related diseases. Reduced levels of m 6 A appeared to play an oncogenic role in patients with endometrial cancer by activating the AKT pathway [ 14 ]. Through extensive mining of public databases, Zhai et al. revealed that m 6 A levels are reduced in the endometrium and myometrium of women suffering from adenomyosis compared with endometrium from healthy candidates [ 15 ]. The dysregulation of m 6 A regulators has also been observed in endometriosis [ 16 ]. METTL3-dependent m 6 A is engaged in the maturation of primary microRNA126 mediated by DGCR8, which further increased the migration and invasion of endometrial stromal cells in endometriosis [ 17 ]. However, the function of m 6 A modification in infertility and uterine biology remains unknown.\nThrough extensive public database mining, we observed in this study that the mRNA of  METTL3  was decreased in endometrium from infertile women with endometriosis or RIF. Using uterine-specific  Mettl3 -deficient mice, we demonstrated that METTL3-mediated m 6 A modification is critical for implantation and decidualization. Mechanistically, loss of the m 6 A-modified sites might lead to estrogen dominance and progesterone resistance. We found that loss of  Mettl3  stabilizes the mRNA of estrogen target genes, such as  Elf3  and  Celsr2 , leading to hyperactivation of estrogen response. We also provide evidence in favor of METTL3 playing an important role in maintaining PR level and then driving c-Myc expression which is conducive to decidualization. Collectively, our findings contribute to the understanding of the etiology of female infertility, providing a molecular framework that might be useful for diagnostic and therapeutic strategies for infertility.\n\nTo address whether m 6 A regulators play a role in endometriosis-related infertility, we acquired gene expression profiles of endometrial tissue from the Gene Expression Omnibus (GEO) database. From the analysis of the expression level of m 6 A regulators in dataset  GSE120103 , which includes fertile women with stage IV endometriosis and infertile women with stage IV endometriosis, we found that most m 6 A regulators, including  METTL3, CBLL1, ALKBH5, FTO, YTHDC1, YTHDF2, IGF2BP2, HNRNPA2B1, HNRNPC , and  LRPPRC , were significantly downregulated, while  ZC3H13  and  IGF2BP1  were significantly upregulated in infertile group versus fertile group (Fig.  1A , and Supplementary Fig.  1A ). From the analysis of the expression level of m 6 A regulators in the endometrium of women with RIF using dataset  GSE58144 , we found that  METTL3, YTHDC2, YTHDF3, HNRNPC , and  FMR1  were significantly decreased, while  ZC3H13  were significantly increased in RIF patients compared with healthy controls (Fig.  1B , and Supplementary Fig.  1B ). These results suggest that m 6 A regulators play an important role in both endometriosis-related infertility and RIF. Further analysis of the correlation between decreased  METTL3  expression and disease using receiver operating characteristic (ROC) curves demonstrated that the area under the curve (AUC) for reduced endometrial  METTL3  expression was 0.9136 (95% confidence interval (CI), 77.5% to 100%) in infertile patients with stage IV endometriosis (Fig.  1C ), indicating downregulation of endometrial  METTL3  could well distinguish infertile from fertile endometriosis patients. Similarly, the AUC value for RIF was 0.6321 (95% CI, 53% to 73.5%) (Fig.  1D ), indicating that reduced endometrial  METTL3  could well distinguish RIF patients from healthy controls. Collectively, these results suggested that the reduction of METTL3 might be associated with infertility. Fig. 1 Expression landscape of  METTL3  in the endometrium of infertile women with endometriosis or recurrent implantation failure. A  Expression landscape of  METTL3  in the endometrium of fertile ( n  = 9) and infertile ( n  = 9) women with stage IV endometriosis in dataset  GSE120103 . Data are presented as mean ± SD, *** P  < 0.001, relative to “Fertile stage IV Endometriosis” group.  B  Expression landscape of  METTL3  in the endometrium of women with RIF following in vitro fertilization (IVF) treatment ( n  = 43) and healthy control women ( n  = 72) 7 days after the putative luteinizing hormone surge ( GSE58144 ). Data are presented as mean ± SD, * P  < 0.05, relative to control. ROC curve evaluation of the relationship between decreased expression of  METTL3  and infertile stage IV endometriosis ( C ), or RIF ( D ).\nA  Expression landscape of  METTL3  in the endometrium of fertile ( n  = 9) and infertile ( n  = 9) women with stage IV endometriosis in dataset  GSE120103 . Data are presented as mean ± SD, *** P  < 0.001, relative to “Fertile stage IV Endometriosis” group.  B  Expression landscape of  METTL3  in the endometrium of women with RIF following in vitro fertilization (IVF) treatment ( n  = 43) and healthy control women ( n  = 72) 7 days after the putative luteinizing hormone surge ( GSE58144 ). Data are presented as mean ± SD, * P  < 0.05, relative to control. ROC curve evaluation of the relationship between decreased expression of  METTL3  and infertile stage IV endometriosis ( C ), or RIF ( D ).\nMouse models allow us to study the sequence of events involved in the occurrence and progression of diseases. To study the role of METTL3 in the uterus during pregnancy, we generated a mouse model with conditional deletion of  Mettl3  in  Pgr -positive cells (Fig.  2A ). To do so, we started with mice carrying homozygous alleles of  Mettl3  with loxP sites placed in exon 2 and exon 3.  Mettl3 flox/flox  mice were mated to mice carrying a  Pgr -Cre allele, in which Cre is knocked into the  Pgr  locus allowing Cre protein expression to be driven by the native  Pgr  promoter [ 18 ]. We produced  Mettl3 flox/flox Pgr cre/+  ( Mettl3  cKO) mice, eliminating the expression of  Mettl3  in tissues expressing the progesterone receptor (PR), i.e., epithelium, stroma, and myometrium of the uterus [ 18 ]. Ablation of  Mettl3  in the uterus was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) (Fig.  2B ), and immunofluorescence (Fig.  2C ). We observed vaginal plugs in  Mettl3  cKO mice indicating that mating behavior was normal in these females. Female fertility was assessed by mating  Mettl3  cKO and control females with wild-type (WT) males continuously for 6 months and tracking the number of litters and pups produced by each female. The control females were fertile (average number of pups/litter: 6.6 ± 0.4), whereas  Mettl3  cKO females were sterile and did not produce any pups during the 6 months mating trial (Fig.  2D ). Four stages of mouse estrous cycle were observed in  Mettl3  cKO mice by vaginal smears (Fig.  2E ). The examination of the reproductive duct in  Mettl3  cKO mice did not exhibit any significant alterations compared with the controls (Fig.  2F ). Also, no significant histology differences were found in the uterus (Fig.  2G ), vagina (Fig.  2H ), ampullar oviduct (Fig.  2I ), or ovary (Fig.  2J ) of  Mettl3  cKO mice compared with the control mice. And serum levels of estradiol-17β (E2) and progesterone (P4) in  Mettl3 -deficient mice and control mice were comparable (Fig.  2K, L ). Superovulation of 6-week-old mice showed no significant difference in the quantity of oocytes released between  Mettl3  cKO and control mice (Fig.  2M ). These results suggest that infertility in  Mettl3  cKO mice is primarily due to a uterine functional defect. Fig. 2 Uterine  Mettl3  deficiency induces complete implantation failure resulting in female infertility but displaying normal ovarian function. A  Illustration of the  Mettl3  conditional allele with loxP sites placed flanking exon 2 and exon 3.  B  Relative  Mettl3  mRNA level in the uteri of  Mettl3  cKO ( n  = 7) and control ( n  = 8) mice on GD4. Data are presented as mean ± SD, *** P  < 0.001, relative to control.  C  Immunofluorescence of METTL3 and CK8 in the uteri of  Mettl3  cKO and control mice on GD4. Nuclei were stained with DAPI. Scale bars: 75 μm.  D  Female fertility was assessed. Data are presented as mean ± SD.  E  Vaginal smear assays of  Mettl3  cKO mice confirmed each stage of the normal estrous cycle. Scale bars: 100 μm.  F  Gross morphology of female reproductive tracts in  Mettl3  cKO and control mice at 8 weeks of age. HE staining of the cross-sections of the uterus ( G ), vagina ( H ), oviduct ( I ), and ovary ( J ) in control and  Mettl3  cKO mice at 8 weeks of age. Serum concentrations of E2 ( K ) or P4 ( L ) in  Mettl3  cKO ( n  ≥ 9) and control mice ( n  ≥ 5) were analyzed and shown as mean ± SD.  M  Number of oocytes collected from superovulated  Mettl3  cKO ( n  = 6) and control females ( n  = 8).  N  Representative photographs of control uterus ( n  = 6) with implantation sites and  Mettl3 cKO  uterus ( n  = 5) without blue bands on GD5. Scale bars, 1 cm.  O  The number of implantation sites in ( N ) were counted and are reported as mean ± SD, *** P  < 0.001, relative to control.\nA  Illustration of the  Mettl3  conditional allele with loxP sites placed flanking exon 2 and exon 3.  B  Relative  Mettl3  mRNA level in the uteri of  Mettl3  cKO ( n  = 7) and control ( n  = 8) mice on GD4. Data are presented as mean ± SD, *** P  < 0.001, relative to control.  C  Immunofluorescence of METTL3 and CK8 in the uteri of  Mettl3  cKO and control mice on GD4. Nuclei were stained with DAPI. Scale bars: 75 μm.  D  Female fertility was assessed. Data are presented as mean ± SD.  E  Vaginal smear assays of  Mettl3  cKO mice confirmed each stage of the normal estrous cycle. Scale bars: 100 μm.  F  Gross morphology of female reproductive tracts in  Mettl3  cKO and control mice at 8 weeks of age. HE staining of the cross-sections of the uterus ( G ), vagina ( H ), oviduct ( I ), and ovary ( J ) in control and  Mettl3  cKO mice at 8 weeks of age. Serum concentrations of E2 ( K ) or P4 ( L ) in  Mettl3  cKO ( n  ≥ 9) and control mice ( n  ≥ 5) were analyzed and shown as mean ± SD.  M  Number of oocytes collected from superovulated  Mettl3  cKO ( n  = 6) and control females ( n  = 8).  N  Representative photographs of control uterus ( n  = 6) with implantation sites and  Mettl3 cKO  uterus ( n  = 5) without blue bands on GD5. Scale bars, 1 cm.  O  The number of implantation sites in ( N ) were counted and are reported as mean ± SD, *** P  < 0.001, relative to control.\nBlastocyst implantation into the uterus is an essential step for the establishment of pregnancy. To identify the stage-specific failure of pregnancy in  Mettl3  cKO females, we subsequently analyzed the implantation status in  Mettl3  cKO females. Chicago Blue dye was injected to visualize the number and location of implanted embryos in the uterus on gestation day (GD) 5. The uterine horns of WT control mice had an average of 7.83 ± 0.99 implantation sites that appeared normally spaced per pregnant female, whereas  Mettl3  cKO mice had no grossly visible implantation sites on GD5 (Fig.  2N, O ). These results clearly indicate that uterine METTL3 is indispensable for normal embryo implantation.\nTo reveal the underlying causes accounting for the defective implantation failure in  Mettl3  cKO mice, we investigated whether ablation of  Mettl3  alters uterine receptivity and decidualization. We first examined the proliferation versus differentiation status of uterine cells using Ki67 immunostaining at pre-implantation. As shown in Fig.  3A , in control mice, cell proliferation was reduced in epithelial cells before embryo attachment and increased in stromal cells in preparation for implantation on GD4 (Fig.  3A, B ). However, the proliferative responses in stromal compartments of the uterus from  Mettl3  cKO mice were significantly reduced on GD4 compared with the control mice (Fig.  3A, B ). E-cadherin, a cell polarity and cell junction marker, showed higher apical expression in  Mettl3  cKO mice compared with the controls (Fig.  3C, D ). These observations collectively indicated abnormal uterine receptivity in  Mettl3  cKO mice in peri-implantation. Fig. 3 Ablation of  Mettl3  causes infertility due to compromised uterine receptivity and decidualization. Representative immunofluorescence images ( A ) and the percentage ( B ) of Ki67 +  epithelial cells and stromal cells in uterine of  Mettl3  cKO and control mice on GD4. Data were calculated using 11 images from 3 control mice and 14 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( C ) and quantification of E-cadherin ( D ) in uterine epithelial cells of  Mettl3  cKO and control mice on GD4. Fluorescence intensities of uterine epithelial E-cadherin were calculated using 6 images from 3 control mice and 12 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( E ) and the percentage ( F ) of Ki67 +  epithelial cells and stromal cells in uterine of  Mettl3  cKO and control mice following induction of artificial pregnancy (pollard experiment). Data were calculated using 12 images from 3 control mice and 7 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( G ) and quantification of E-cadherin ( H ) in uterine epithelial cells of  Mettl3  cKO and control mice following induction of artificial pregnancy. Fluorescence intensities of uterine epithelial E-cadherin were calculated using 12 images from 3 control mice and 15 images from 3  Mettl3  cKO mice.  A ,  C ,  E ,  G  Nuclei were stained with DAPI. Scale bars: 75 μm.  I  Immunohistochemistry of METTL3 with paraffin sections from pregnant females on GD0 and GD5. Sections are counterstained with hematoxylin. Brown staining denotes METTL3 +  cells. Scale bars: 100 μm.  J  Representative pictures showing the gross morphology of oil-treated uterine horns (left horn) and untreated uterine horns (right horn) from control ( n  = 6) and  Mettl3  cKO mice ( n  = 6) collected 5 days after oil injection. Scale bars: 1 cm.  K  The weight per unit length of oil-injected and untreated uterine horns in ( J ). Data are presented as mean ± SD, ** P  < 0.01.  L  Histology of control and  Mettl3  cKO mice uterus in ( J ), as measured by HE staining, Scale bars 200 μm.  M  Relative mRNA levels of decidualization marker genes ( Wnt4 ,  Bmp8a ,  Bmp2 ,  Prl8a2 ) in the uterine horns of control and  Mettl3  cKO mice in ( J ).  B ,  D ,  F ,  H ,  M  Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, relative to control and unstimulated.\nRepresentative immunofluorescence images ( A ) and the percentage ( B ) of Ki67 +  epithelial cells and stromal cells in uterine of  Mettl3  cKO and control mice on GD4. Data were calculated using 11 images from 3 control mice and 14 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( C ) and quantification of E-cadherin ( D ) in uterine epithelial cells of  Mettl3  cKO and control mice on GD4. Fluorescence intensities of uterine epithelial E-cadherin were calculated using 6 images from 3 control mice and 12 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( E ) and the percentage ( F ) of Ki67 +  epithelial cells and stromal cells in uterine of  Mettl3  cKO and control mice following induction of artificial pregnancy (pollard experiment). Data were calculated using 12 images from 3 control mice and 7 images from 3  Mettl3  cKO mice. Representative immunofluorescence images ( G ) and quantification of E-cadherin ( H ) in uterine epithelial cells of  Mettl3  cKO and control mice following induction of artificial pregnancy. Fluorescence intensities of uterine epithelial E-cadherin were calculated using 12 images from 3 control mice and 15 images from 3  Mettl3  cKO mice.  A ,  C ,  E ,  G  Nuclei were stained with DAPI. Scale bars: 75 μm.  I  Immunohistochemistry of METTL3 with paraffin sections from pregnant females on GD0 and GD5. Sections are counterstained with hematoxylin. Brown staining denotes METTL3 +  cells. Scale bars: 100 μm.  J  Representative pictures showing the gross morphology of oil-treated uterine horns (left horn) and untreated uterine horns (right horn) from control ( n  = 6) and  Mettl3  cKO mice ( n  = 6) collected 5 days after oil injection. Scale bars: 1 cm.  K  The weight per unit length of oil-injected and untreated uterine horns in ( J ). Data are presented as mean ± SD, ** P  < 0.01.  L  Histology of control and  Mettl3  cKO mice uterus in ( J ), as measured by HE staining, Scale bars 200 μm.  M  Relative mRNA levels of decidualization marker genes ( Wnt4 ,  Bmp8a ,  Bmp2 ,  Prl8a2 ) in the uterine horns of control and  Mettl3  cKO mice in ( J ).  B ,  D ,  F ,  H ,  M  Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, relative to control and unstimulated.\nTo further ascertain the role of METTL3 in uterine receptivity, E2 and P4 were administered to ovariectomized control and  Mettl3  cKO mice to mimic early pregnancy (pollard experiment) (Supplementary Fig.  2A ). As expected, sequential E2 and P4 treatment induced uterine stromal cell proliferation in control mice (Fig.  3E, F ). However, neither uterine stromal cells nor epithelial cells displayed a proliferative response in  Mettl3 -deficient mice (Fig.  3E, F ). Increased E-cadherin expression was also detected in the luminal epithelium of  Mettl3  cKO mice compared with the controls in the pollard experiment (Fig.  3G, H ). These data support the hypothesis that  Mettl3  deficiency causes endometrial receptivity abnormalities.\nIn response to implantation, stromal cells surrounding the mucosal crypt where the embryo resides proliferate extensively and differentiate into polyploid decidual cells. As METTL3 protein level in the uterus was substantially increased from GD0 to GD5 (Fig.  3I ), we next examined the impact of  Mettl3  ablation on decidualization using an artificial decidualization model (Supplementary Fig.  2B ). The control mice displayed a decidual uterine horn that responded well to the artificial induction. However,  Mettl3  ablation entirely preclude decidualization (Fig.  3J, K ), which was further confirmed by histological analysis (Fig.  3L ). We also observed a significant decrease in the expression of decidualization markers, including  Wnt4 ,  Bmp8a ,  Bmp2 , and  Prl8a2  in the uterus of  Mettl3  cKO mice (Fig.  3M ). Taken together, these data suggest that  Mettl3  cKO mice were sterile as a result of defective uterine receptivity and decidualization.\nTo understand the molecular basis of the implantation failure phenotype in  Mettl3  cKO mice, we performed an RNA-seq analysis of the uterine tissue of  Mettl3  cKO and control mice on GD4. Global gene expression profiles of  Mettl3  cKO versus control mice were analyzed. 922 genes were differentially expressed, including 572 up-regulated genes and 350 down-regulated genes in the uterus of  Mettl3  cKO mice compared with control mice (Fig.  4A ). GO enrichment analysis showed that the up-regulated genes were mainly enriched in the regulation of epithelium, such as “Regulation of morphogenesis of an epithelium”, “Morphogenesis of a branching epithelium”, “Mesonephric epithelium development”, and “Cell junction maintenance” (Fig.  4B ), while down-regulated genes were mainly involved in “Wnt signaling pathway”, “Regulation of actin filament-based process”, “Regulation of actin cytoskeleton organization” (Fig.  4C ). GSEA analysis of MSigDB gene sets was performed (Fig.  4D, E ). Specifically, the term “REACTOME REPRODUCTION” was observed negatively enriched in  Mettl3  cKO mice compared with the controls (Fig.  4D ). And the term “REACTOME CELL CELL JUNCTION ORGANIZATION” was enriched in  Mettl3  cKO mice compared with the controls (Fig.  4E ). These results suggested that METTL3 regulates luminal epithelial remodeling during the window of implantation, which is consistent with enhanced E-cadherin expression in the uterus of  Mettl3  cKO mice (Fig.  3C, G ). Moreover, cell proliferation-related terms, including “WP CELL CYCLE”, “REACTOME DNA REPLICATION”, “HALLMARK E2F TARGETS” were suppressed in  Mettl3  cKO mice (Fig.  4E ), which is consistent with the decreased proliferation in uterine stromal cells (Fig.  3A, E ). Interestingly, among the significantly dysregulated genes, 42 genes associated with uterine receptivity and implantation were shown in the heatmap (Fig.  4F ), including E2-responsive genes ( Igfbp5 ,  Greb1 ,  Ltf ,  Wnt4 ,  Lcn2 ,  Sprr2f, Celsr2 ,  Muc1, Elf3 ,  Fzd10 ), P4-responsive genes ( Mmp9 ,  Lamc3 ,  Fst ,  Maob ,  Srd5a1 ,  Myd88 ,  Pfkfb3 ,  Lrp2 ,  Hdc ,  Gldc ,  Jam2 ,  Runx1 ,  Cebpb ,  Cebpd ,  Osmr ,  Mmp11 ,  Sox17 ,  Ihh ,  Cldn3 ,  Msx1 ,  Msx2 ,  Cited4 ,  Sox7 ,  Galnt12 ), LE-specific genes ( Hdc ,  Jam2 ,  Cldn7 ), GE-specific genes ( Foxa2 ), hedgehog signaling-associated genes ( Ptch2 ,  Ihh ), Pan-uterine epithelial-associated genes ( Lamc3 ,  Maob ,  Srd5a1 ,  Myd88 ,  Pfkfb3 ,  Lrp2 ,  Gldc ,  Ltf ,  Sox17 ,  Ihh ,  Cldn3 ,  Cited4 ,  Sprr2f ,  Muc1 ), other uterine receptivity- and implantation-related genes ( Irf4 ,  Cyp3a59 ,  Foxo1 ,  Gadd45a ,  Cyp3a57 ). We believe that deregulated E2/P4-responsive genes in  Mettl3  cKO mice might be responsible for compromised uterine receptivity and decidualization. Fig. 4 Transcriptome profile of the uteri in  Mettl3  cKO mice and control mice at the preimplantation stage. A  Volcano plot depicting genes upregulated (red) or downregulated (blue) 1.5-fold or more in the uterus of  Mettl3  cKO mice vs control on GD4. A heatmap of differentially expressed genes is shown on the right ( n  = 3 mice per group). GO terms of the upregulated genes ( B ) and downregulated genes ( C ) in the uterus of  Mettl3  cKO mice compared with that of control mice.  D  GSEA of “REACTOME_REPRODUCTION” gene set in the uterus of  Mettl3  cKO mice relative to control mice.  E  GSEA analysis of the indicated gene sets in the uterus of  Mettl3  cKO mice relative to control mice . F  Heatmap of differentially expressed uterine receptivity-related genes between  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.\nA  Volcano plot depicting genes upregulated (red) or downregulated (blue) 1.5-fold or more in the uterus of  Mettl3  cKO mice vs control on GD4. A heatmap of differentially expressed genes is shown on the right ( n  = 3 mice per group). GO terms of the upregulated genes ( B ) and downregulated genes ( C ) in the uterus of  Mettl3  cKO mice compared with that of control mice.  D  GSEA of “REACTOME_REPRODUCTION” gene set in the uterus of  Mettl3  cKO mice relative to control mice.  E  GSEA analysis of the indicated gene sets in the uterus of  Mettl3  cKO mice relative to control mice . F  Heatmap of differentially expressed uterine receptivity-related genes between  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.\nThe implantation window in mouse uterus occurs between GD4 and GD5 and is characterized by a transition from an E2-dominant proliferative state to a P4-responsive state [ 19 – 21 ]. GSEA analysis revealed that “HALLMARK ESTROGEN RESPONSE EARLY”, “HALLMARK ESTROGEN RESPONSE LATE” were positively enriched in the uterus of  Mettl3  cKO mice (Fig.  4E ). Concomitantly, the majority of E2 responsive genes were found to be upregulated in the uterus of  Mettl3  cKO mice compared with the controls (Fig.  5A ). And RT-qPCR results further indicated that both E2-target epithelial genes ( Muc1 ,  Ltf, Elf3, Celsr2 ) and stromal genes ( Wnt4, Fzd10 ) were significantly upregulated in the  Mettl3 -deficient uterus (Fig.  5B ). We then measured uterine ER protein level in mice on GD4 using immunohistochemistry (Fig.  5C ) and western blot (Fig.  5D ) and in the pollard experiment using immunofluorescence staining (Fig.  5E ), and found that uterine ER level in  Mettl3  cKO mice was not significantly altered compared with control mice (Fig.  5C–E ). Fig. 5 Loss of  Mettl3  leads to overactivation of estrogen signaling. A  Heatmap of uterine E2-responsive genes in  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.  B  Relative mRNA levels of E2-regulated genes in control ( n  = 8) and  Mettl3  cKO ( n  = 7) females on GD4.  C  Immunohistochemistry of hormone receptor ER with uterine sections from  Mettl3  cKO and control females on GD4. Sections are counterstained with hematoxylin. Brown staining denotes ER +  cells. Scale bars: 100 μm.  D  Immunoblotting analysis was conducted to compare uterine ER protein levels in control mice ( n  = 3) and  Mettl3  cKO mice ( n  = 3) on GD4. The experiments were repeated three times. α/β-tubulin was used as the loading control. Values are expressed as the mean ± SD.  E  Representative immunofluorescence images and quantification of ER in the uterus of  Mettl3  cKO and control mice following induction of artificial pregnancy. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine ER were calculated using 10 images from 3 control mice and 14 images from 3  Mettl3  cKO mice. Results are representative of 3 independent experiments. Integrative Genomics Viewer (IGV) tracks displaying transcripts and m 6 A peaks distribution of  Elf3  ( F ) and  Celsr2  ( H ) mRNAs in m 6 A-seq. The high-confidence m 6 A site is marked as an arrow. m 6 A enrichment in  Elf3  ( G ) and  Celsr2  ( I ) mRNA in the uterus of  Mettl3  cKO ( n  = 3) and control mice ( n  = 3), as determined by m 6 A-RIP-qPCR. RNA stability assay. The relative mRNA levels of  Elf3  ( J ) and  Celsr2  ( L ) were detected by RT-qPCR. The remaining mRNAs were normalized to  t  = 0. ( n  = 3 per group, biological repeated 3 times). RT-qPCR analysis of  Elf3  ( K ) and  Celsr2  ( M ) mRNA abundance. Relative expression was normalized to  t  = 0 of control uterine cells ( n  = 3 per group, biological repeated 3 times). Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001.\nA  Heatmap of uterine E2-responsive genes in  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.  B  Relative mRNA levels of E2-regulated genes in control ( n  = 8) and  Mettl3  cKO ( n  = 7) females on GD4.  C  Immunohistochemistry of hormone receptor ER with uterine sections from  Mettl3  cKO and control females on GD4. Sections are counterstained with hematoxylin. Brown staining denotes ER +  cells. Scale bars: 100 μm.  D  Immunoblotting analysis was conducted to compare uterine ER protein levels in control mice ( n  = 3) and  Mettl3  cKO mice ( n  = 3) on GD4. The experiments were repeated three times. α/β-tubulin was used as the loading control. Values are expressed as the mean ± SD.  E  Representative immunofluorescence images and quantification of ER in the uterus of  Mettl3  cKO and control mice following induction of artificial pregnancy. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine ER were calculated using 10 images from 3 control mice and 14 images from 3  Mettl3  cKO mice. Results are representative of 3 independent experiments. Integrative Genomics Viewer (IGV) tracks displaying transcripts and m 6 A peaks distribution of  Elf3  ( F ) and  Celsr2  ( H ) mRNAs in m 6 A-seq. The high-confidence m 6 A site is marked as an arrow. m 6 A enrichment in  Elf3  ( G ) and  Celsr2  ( I ) mRNA in the uterus of  Mettl3  cKO ( n  = 3) and control mice ( n  = 3), as determined by m 6 A-RIP-qPCR. RNA stability assay. The relative mRNA levels of  Elf3  ( J ) and  Celsr2  ( L ) were detected by RT-qPCR. The remaining mRNAs were normalized to  t  = 0. ( n  = 3 per group, biological repeated 3 times). RT-qPCR analysis of  Elf3  ( K ) and  Celsr2  ( M ) mRNA abundance. Relative expression was normalized to  t  = 0 of control uterine cells ( n  = 3 per group, biological repeated 3 times). Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001.\nTo define the possible targets regulated by m 6 A modification involved in the functional maintenance of endometrial receptivity and female fertility, m 6 A-seq of the uteri of  Mettl3  cKO mice and the control mice were conducted. The abundance of m 6 A modifications in CDS, 3′UTR, 5′UTR, start codon, and stop codon were profiled (Supplementary Fig.  3A, B ). After identifying the representative consensus of the m 6 A motif in the uterus of  Mettl3  cKO and control mice (Supplementary Fig.  3C ), global hypomethylation of m 6 A at the transcription level (Supplementary Fig.  3D ), we found that approximately 80% of methylated mRNAs contained 1 peak (Supplementary Fig.  3E ). And we defined 319 hypo-methylated m 6 A genes whose mRNA transcripts were identified as down-regulated ( p  < 0.05, Hypo-down) and 1020 hypo-methylated m 6 A genes along with up-regulated mRNA transcript ( p  < 0.05, Hypo-up) in  Mettl3  cKO mice compared with WT controls (Supplementary Fig.  3F ). Notably, the m 6 A level at 3’UTR of estrogen-responsive genes  Elf3  and  Celsr2  mRNA had substantially enriched m 6 A peaks in control uterus, but not in  Mettl3  cKO mice (Fig.  5F–I ). To ascertain the role of METTL3-mediated m 6 A modification in regulating the mRNA levels of  Elf3  and  Celsr2 , mRNA decay assays were performed, and the results demonstrated that loss of m 6 A modification did appreciably inhibit the decay of  Elf3  and  Celsr2  mRNAs (Fig.  5J–M ). Collectively, these results indicate that deficiency of METTL3-dependent m 6 A modification might increase the mRNA stability of E2-responsive genes, such as  Elf3  and  Celsr2 , leading to the overactivation of estrogen signaling in the uterus.\nThe P4 and E2-responsive signaling pathways are tightly regulated in the endometrium. E2 drives uterine epithelial proliferation. During pre-implantation, E2 level is low, P4 initiates stromal cell proliferation, and primes the uterus to be receptive. P4 resistance and E2 dominance are most likely to happen when the balance between P4 and E2 signaling is lost [ 22 ]. Apart from overactivated estrogen signaling,  Mettl3  deficiency also hampers uterine P4 response. Most of the P4-responsive genes were found to be significantly downregulated in the uterus of  Mettl3  cKO mice as illustrated in Fig.  6A . Some of these genes were confirmed by RT-qPCR. The expression of P4-target molecules such as  Lrp2  in the epithelium and  Hoxa10 ,  Fst , and  Il13ra2  in the stroma was markedly downregulated in  Mettl3  cKO mice compared with the control (Fig.  6B ). Furthermore, GSEA analysis revealed a negative enrichment of “WILCOX RESPONSE TO PROGESTERONE UP” pathway in the uterus of  Mettl3  cKO mice compared with their counterpart controls (Fig.  4E ). Interestingly, although serum P4 levels were comparable in  Mettl3- deficient mice and control mice (Fig.  2L ), P4 and E2 co-treatment did induce uterine stromal cell proliferation in OVX WT control mice but not in  Mettl3  cKO mice (Fig.  3E ), indicating that the loss of progesterone response in  Mettl3  cKO mice was not caused by decreased progesterone levels. P4 exerts its regulatory role by binding to its cognate receptor PR. To elucidate the possible reasons for progesterone resistance in  Mettl3  cKO mice, we examined the expression of uterine PR in GD4 pregnant mice (Fig.  6C ) and in the pollard model (Fig.  6D ), and found that the expression of PR was markedly decreased in the uteri of  Mettl3  cKO mice compared with the controls (Fig.  6C, D ). Taken together, these observations suggest that METTL3 affects the endometrial response to progesterone during pregnancy by maintaining the expression level of PR. Fig. 6 Progesterone resistance in  Mettl3 -deficient uteri could be due to reduced PR expression. A  Heatmap of uterine P4-responsive genes in  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.  B  Relative expression of mRNA for P4-regulated genes in control ( n  = 8) and  Mettl3  cKO ( n  = 7) females on GD4.  C  Immunohistochemistry of hormone receptor PR with uterine sections from  Mettl3  cKO and control females on GD4. Sections are counterstained with hematoxylin. Brown staining denotes PR +  cells. Scale bars: 100 μm.  D  Representative immunofluorescence images and quantification of PR in the uterus of  Mettl3  cKO and control mice following induction of artificial pregnancy. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine PR were calculated using 14 images from 3 control mice and 15 images from 3  Mettl3  cKO mice.  E  RT-qPCR of  Myc  mRNA expression in the uterus of control (n = 8) and  Mettl3  cKO mice ( n  = 7).  F  Representative immunofluorescence images and quantification of c-Myc in uterine epithelial and stromal cells of  Mettl3  cKO and control mice on GD4. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine c-Myc were calculated using 11 images from 3 control mice and 16 images from 3  Mettl3  cKO mice. Results are representative of 3 independent experiments.  G  GSEA analysis of “MYC-responsive genes” gene set in the uterus of  Mettl3  cKO mice relative to that in the uterus of control mice.  H  The isolated uterine stromal cells were stained with vimentin, and the purity was analyzed by flow cytometry.  I  RT-qPCR analysis was performed to examine the expression of  Myc ,  Prl ,  Prl8a2 ,  Rrm2 , and  Ldha  in uterine stromal cells of  Mettl3  cKO mice after transfection of  Myc  overexpression plasmid or control plasmid for in vitro decidualization (biological repeated three times). Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, relative to control.\nA  Heatmap of uterine P4-responsive genes in  Mettl3  cKO and control mice on GD4 generated from RNA-seq data.  B  Relative expression of mRNA for P4-regulated genes in control ( n  = 8) and  Mettl3  cKO ( n  = 7) females on GD4.  C  Immunohistochemistry of hormone receptor PR with uterine sections from  Mettl3  cKO and control females on GD4. Sections are counterstained with hematoxylin. Brown staining denotes PR +  cells. Scale bars: 100 μm.  D  Representative immunofluorescence images and quantification of PR in the uterus of  Mettl3  cKO and control mice following induction of artificial pregnancy. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine PR were calculated using 14 images from 3 control mice and 15 images from 3  Mettl3  cKO mice.  E  RT-qPCR of  Myc  mRNA expression in the uterus of control (n = 8) and  Mettl3  cKO mice ( n  = 7).  F  Representative immunofluorescence images and quantification of c-Myc in uterine epithelial and stromal cells of  Mettl3  cKO and control mice on GD4. Nuclei were stained with DAPI. Scale bars: 75 μm. Fluorescence intensities of uterine c-Myc were calculated using 11 images from 3 control mice and 16 images from 3  Mettl3  cKO mice. Results are representative of 3 independent experiments.  G  GSEA analysis of “MYC-responsive genes” gene set in the uterus of  Mettl3  cKO mice relative to that in the uterus of control mice.  H  The isolated uterine stromal cells were stained with vimentin, and the purity was analyzed by flow cytometry.  I  RT-qPCR analysis was performed to examine the expression of  Myc ,  Prl ,  Prl8a2 ,  Rrm2 , and  Ldha  in uterine stromal cells of  Mettl3  cKO mice after transfection of  Myc  overexpression plasmid or control plasmid for in vitro decidualization (biological repeated three times). Data are presented as mean ± SD, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, relative to control.\nTo further confirm the repressed PR signaling in  Mettl3  cKO mice, we detected the expression level of PR target gene  Myc  [ 23 ]. c-Myc is a transcription factor involved in cell proliferation and is required for uterine stromal cell proliferation during peri-implantation [ 24 – 26 ]. We found that  Myc  mRNA and protein levels were significantly reduced in GD4  Mettl3  cKO uterus compared with WT controls (Fig.  6E, F ). We also noticed a decrease in the c-Myc protein level in the uterus of  Mettl3  cKO mice compared with control mice in the pollard model (Supplementary Fig.  4A ). Using several MYC-target gene sets published previously [ 27 ,  28 ], GSEA revealed a significant decrease in MYC-target gene signatures in the uterus of  Mettl3- deficient mice (Fig.  6G  and Supplementary Fig.  4B, C ), indicating  Mettl3  deficiency resulted in a compromised c-Myc signaling pathway. Furthermore, under in vitro decidualization, overexpression of  Myc  in  Mettl3 -deficient stromal cells could significantly upregulate the expression of reliable marker genes for decidualization, including  Prl ,  Prl8a2, Rrm2  [ 26 ] and  Ldha  [ 29 ] (Fig.  6H, I ). These results indicated that  Mettl3 -deficient uteri show progesterone resistance due to reduced expression of PR and its downstream genes.\nTo investigate whether METTL3 functions through regulating the balance between E2 and P4 signaling in human endometrium, we analyzed the correlation between  METTL3  and  PGR, MYC , or  ELF3  in human endometrium from two independent cohorts,  GSE58144  and  GSE4888 .  PGR  and  METTL3  mRNA levels were positively correlated in human endometrium (Fig.  7A ), as well as the levels of  MYC  and  METTL3  (Fig.  7B ). However,  ELF3  and  METTL3  mRNA levels were negatively correlated in human endometrium as indicated (Fig.  7C ). The results above indicated that the expression of  PR ,  MYC ,  ELF3 , and  METTL3  is conserved between mouse and human. With this, a reasonable assumption might be that P4 resistance and E2 dominance could be related to the decrease of METTL3 in human endometrium in some disease conditions. Fig. 7 The levels of P4 and E2-dependent genes  PR ,  MYC, ELF3  are correlated with  METTL3  in human endometrium. A  Pearson’s correlation of mRNA levels between  PGR  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).  B  Pearson’s correlation of mRNA levels between  MYC  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).  C  Pearson’s correlation of levels between  ELF3  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).\nA  Pearson’s correlation of mRNA levels between  PGR  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).  B  Pearson’s correlation of mRNA levels between  MYC  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).  C  Pearson’s correlation of levels between  ELF3  and  METTL3  in human endometrium ( GSE58144  and  GSE4888 ).\n\nm 6 A methylation, regulating RNA stability, degradation, translation, alternative splicing, and gene expression, plays critical roles in various biological processes. m 6 A levels are elevated in the mouse uterus throughout pregnancy [ 30 ], suggesting m 6 A modifications are regulated by hormones. m 6 A demethylase FTO expression can be induced by estrogen in endometrial cancer via activation of the PI3K-Akt and MAPK pathways [ 31 ]. Our study reveals that  METTL3  expression is significantly decreased in endometrium from infertile women with endometriosis or recurrent implantation failure, suggesting that m 6 A modifications might be involved in the pathogenesis of infertility. However, the molecular mechanisms of METTL3 attenuation in the etiology and pathophysiology of infertility remain undetermined. Using  Mettl3  cKO mouse model, we provide evidence in favor that  Mettl3  loss causes infertility due to implantation failure.\nThe implantation window in mice occurs between GD4 and GD5, when the uterus becomes receptive [ 32 – 34 ], i.e., a reduction in the proliferation and polarity of uterine epithelial cells, as well as the induction of proliferation and decidualization of uterine stromal cells. E-cadherin, typically downregulated in the receptive epithelium, had stronger apical expression in the  Mettl3  cKO mice compared with the controls, indicating the abnormality of luminal epithelium differentiation during implantation. Meanwhile, persistent epithelial proliferation during the preimplantation stage results in implantation failure in several knockout mouse studies [ 35 ,  36 ]. In our study, a few of Ki67-positive cells were observed in the uterine epithelium of  Mettl3  cKO mice on GD4. Intriguingly, a significant reduction of Ki67-positive cells in the uterine stroma of the  Mettl3  cKO mice on GD4 was observed, indicating a defect in stromal cell proliferation in  Mettl3  cKO mice. Decidualization involves the differentiation of uterine stromal fibroblasts to decidual cells after embryo implantation, playing an important role in maintaining pregnancy. Decidualization defect of endometrial stromal cells has been regarded as a primary cause of endometriosis-related infertility [ 37 ,  38 ]. And our findings from decidualization experiments in  Mettl3  cKO mice support this notion.\nA receptive uterus is characterized by a uterine transition from an E2-dominant proliferative state to a P4-responsive state [ 19 – 21 ]. To ascertain the role of METTL3 in E2 and P4 responses, we performed GSEA analysis based on MSigDB gene sets, and found that “HALLMARK ESTROGEN RESPONSE EARLY”, “HALLMARK ESTROGEN RESPONSE LATE” were positively enriched, whereas “WILCOX RESPONSE TO PROGESTERONE UP” was negatively enriched in  Mettl3  cKO mice compared with the controls. We also profiled the level of E2 and P4 responsive genes in the uterus on GD4, and found that most of the E2 responsive genes were sharply upregulated, while most P4 responsive genes were significantly decreased. These results established the critical role of METTL3 as a mediator of both estrogen and progesterone signaling in the uterus.\nFor the E2 responsive genes, we found that  Elf3  mRNA level is significantly increased in  Mettl3  cKO mice, and its m 6 A enrichment at 3′UTR is sharply decreased. Further mRNA decay assays demonstrated an increase in  Elf3  mRNA stability in the absence of METTL3-dependent m 6 A modification. ELF3 is an m 6 A reader, which can directly bind to the m 6 A site at the 5′UTR of mRNAs participating in the translation initiation of specific genes. In addition, ELF3 binds to ERα in the absence of E2, but dissociates with ERα upon E2 treatment in a dose- and time-dependent manner [ 39 ], suggesting a possible feedback loop between ERα signaling and ELF3. Another E2-responsive gene  CELSR2  is negatively associated with the overall survival time of endometrial cancer patients [ 40 ].  CELSR2  deficiency impaired cell proliferation of hepatocytes [ 41 ], liver cancer cells [ 42 ], and Schwann cells [ 43 ]. Interestingly, uterine  Celsr2  in  Mettl3  cKO mice reflects a similar mRNA expression and m 6 A modification pattern to  Elf3 . Based on our mRNA decay assays, deficiency of METTL3-dependent m 6 A might increase the mRNA stability of  Celsr2 .\nE2 and P4 play a regulatory role by binding to their cognate receptors, ER and PR, respectively. Moreover, the level of hormone receptors can be regulated by m 6 A modification. ERα mRNA m 6 A methylation is significantly upregulated by R-2HG due to FTO degradation, which may then result in suppressing ERα protein expression via translational regulation, hence reducing cholangiocarcinoma [ 44 ]. The elevated Estrogen Related Receptor γ in chemoresistant cancer cells can be attributed to m 6 A-dependent splicing of precursor  ESRRG  mRNA [ 45 ]. However, we did not observe METTL3-dependent m 6 A methylation in  Esr1 ,  Esr2 ,  Esrra , and  Esrrb  mRNAs in mouse uterus (data not shown). In note, uterine ER level was not altered in  Mettl3  cKO mice compared with the controls. Endometrial stromal PR is mediated by E2/ER signaling [ 46 ]. And prior to conceptus implantation, PR expression is downregulated in the uterine epithelial compartment and is upregulated in uterine stromal cells [ 47 ]. Insufficient PR signaling hampers intimate stromal-epithelial crosstalk and thus uterine receptivity [ 48 ,  49 ]. We also found a sharp reduction of uterine stromal PR protein level in  Mettl3  cKO mice on GD4, and in the pollard experiment, when compared with the control mice. The results above indicated that METTL3 may regulate the P4 response of uterine stroma during pregnancy by upregulating PR.\nChIP-seq analysis identified PR-binding sites within  Myc  in the uterus of mice treated with P4 [ 23 ], implying that c-Myc is a target of PR. The Myc family proteins contain three well-defined members: c-Myc, N-Myc, and L-Myc. NDRG2 [ 50 ] and NDRG4 [ 51 ], downstream-regulated genes of N-Myc, are upregulated at implantation sites during early pregnancy in mice, and their downregulation inhibit the decidualization process of mouse endometrial stromal cells. c-Myc, a well-known oncoprotein, is a transcription factor involved in ribosome biogenesis, protein translation, cell-cycle progression, and metabolism, orchestrating a broad range of biological functions, such as cell proliferation, and differentiation [ 52 ]. On day 4 of pregnancy, an increase in c-Myc expression in uterine stromal cells was identified, accompanied by a robust proliferation of stromal cells [ 24 ]. E2 administration raised epithelial c-Myc levels and DNA synthesis rapidly [ 24 ,  25 ], and P4 administration elevated stromal c-Myc levels in vivo and in vitro [ 24 ,  26 ]. We detected a decrease in the protein levels of c-Myc in the uterus of  Mettl3  cKO mice, and  Myc  overexpression was able to partially restore the deficit of decidualization in vitro, further confirming that METTL3 may regulate the hormone response of uterine epithelial and stromal cells by influencing the expression of PR and its target genes.\nIn summary, this study provides evidence in favor of the critical role of METTL3-dependent m 6 A methylation in maintaining a balanced estrogen and progesterone signaling pathway, which is conducive to endometrial receptivity and female fertility, thereby providing insightful information for the pathology of infertility and pregnancy management.\n\nRIF gene expression profiles ( GSE58144 ) and endometriosis gene expression profiles ( GSE120103 ,  GSE4888 ) with clinical information were downloaded from GEO database ( https://www.ncbi.nlm.nih.gov/geo/ ) using “GEOquery” package (v2.64.2) in R software (v4.2.1). For data processing, the “limma” package (v3.52.2) was applied for background correction and quantile normalization of all the raw data files, and the expression values were then obtained. The probe set with max-average value was chosen as the expression value for the same gene with multiple probe sets. Barplots, ROC curves, and correlation analysis were drawn using “ggplot2” package (v3.4.0). The code used for GEO data processing is available at  https://github.com/wansh007/data-process .\nC57BL/6N- Mettl3 em1cyagen  ( Mettl3 flox/flox ) mice were generated by Cyagen Biosciences Inc (Guangzhou, China) using the CRISPR–Cas9-based genome-editing system.  Pgr-Cre  mice were obtained from Cyagen Biosciences Inc (Guangzhou, China). To generate  Mettl3  cKO mice,  Mettl3 flox/flox  mice were bred to mice carrying the  Pgr-Cre  knock-in allele to obtain  Mettl3 flox/flox \n Pgr Cre/+  mice ( Mettl3  cKO mice). The females were chosen for the indicated experiments. To reduce the effect of genetic background variability, littermate floxed and gene-deleted mice were used in the same experiments. All mice used in this study were housed in specific pathogen-free animal facilities in the Animal Resource Center at Jinan University, following the ethical guidelines of the Animal Ethics Committee of Jinan University (IACUC-20220418-03).\nUterine tissues were fixed in Paraformaldehyde Fix Solution (G1101-500ML, Servicebio) for 24 h and embedded in paraffin, and sectioned at 5 μm. Sections were dried at 60 °C for 30 min and stored at room temperature. Sections were deparaffinized and rehydrated in xylene, 100% ethanol, 90% ethanol, 85% ethanol, 75% ethanol and double distilled water, before HE, immunofluorescence and immunohistochemistry staining.\nFor HE staining, sections were stained with eosin (G1100, Solarbio) and hematoxylin (G1140, Solarbio). Images were captured using an Olympus BX53 microscope.\nFor immunofluorescence staining, antigen retrieval was carried out by heating the sections in sodium citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0) at 95 °C for 15 min. The sections were immersed in 3% H 2 O 2  for 45 min at room temperature to quench endogenous peroxidase, permeabilized in 0.2% Triton-100 in PBS for 45 min, and then blocked with 1% (w/v) BSA Fraction V (ST023, Beyotime) and 10% goat serum (v/v) (B900780, Proteintech) in PBS before the primary antibodies were added. Then the sections were incubated with the following primary antibodies against METTL3 (ab195352, Abcam), CK8 (DSHB, TROMA-I), Ki67 (ab15580, Abcam), E-Cadherin (3195S, Cell Signaling Technology), PR (8757 S, Cell Signaling Technology), ER-alpha (ab32063, Abcam), c-MYC (1:200, 10828-1-AP, Proteintech) overnight at 4 °C. Followed by incubation with the secondary antibodies: Alexa Fluor 488-conjugated affiniPure Goat anti-Rabbit IgG (H + L) (1:400, 115-585-146, Jackson ImmunoResearch), Alexa Fluor 594-conjugated affiniPure Donkey Anti-Rat IgG (H + L) (1:400, 712-585-153, Jackson ImmunoResearch), Alexa Fluor 594-conjugated affiniPure Goat anti-Mouse IgG (H + L) (1:400, 111-545-144, Jackson ImmunoResearch) for 1 h, and nuclei-staining with DAPI (1:1000, D9542, Sigma) for 10 min at room temperature. Images were taken using a Leica TCS SP8 confocal microscope.\nFor immunohistochemistry, antigen retrieval was performed and endogenous peroxide was blocked as aforementioned. After being blocked with 1% (w/v) BSA Fraction V (ST023, Beyotime) and 10% goat serum (v/v) (B900780, Proteintech) in PBS for 1 h, the primary antibodies were added. The sections were incubated with the following primary antibodies against METTL3 (1:800, ab195352, Abcam), PR (1:400, 9856S, Cell Signaling Technology), ER-alpha (1:400, ab32063, Abcam), Ki67 (1:2000, ab15580, Abcam) overnight at 4 °C. On the following day, the sections were incubated with biotinylated goat anti-Rabbit IgG (1:400, BA-1000-1.5, Vector Laboratories) for 1 h at room temperature. After several rinses in PBS, the sections were incubated with the Vectastain Elite ABC reagent (PK-6100, Vector Laboratories) for 30 min, and immunoreactive signals were developed using ImmPACT DAB EqV Peroxidase (HRP) Substrate (SK-4103, Vector Laboratories), and counterstained with hematoxylin. Images were captured using an Olympus BX53 microscope.\nImmunofluorescence images were analyzed using ImageJ (National Institutes of Health, v1.8.0_345). The level of E-Cadherin in uterine epithelial cells was determined by calculating the mean intensity of E-Cadherin signals. Similarly, the levels of ER, PR, and c-Myc in the uteri were determined by calculating the mean intensities of ER, PR, and c-Myc signals. The number of Ki67-positive (Ki67 + ) cells and the total number of epithelial or stromal cells were manually counted in several uterine sections from three mice in each group. Percentage of Ki67 +  epithelial cells and percentage of Ki67 +  epithelial cells were then calculated.\nProtein extraction and western blot analysis were performed as previously described [ 53 ]. Western blotting experiments were analyzed using the following antibodies against ER-alpha (1:1000, ab32063, Abcam), α/β-Tubulin (1:4000, 2148S, Cell Signaling Techology), goat anti-rabbit IgG-HRP (1:2500, AS006, Asbio Technology). The experiments were performed with 3 replicates.\nFemale mice at least 8 weeks old were mated with fertile wild-type males to induce pregnancy (vaginal plug = day 1 of pregnancy). Uteri on day 4 post-mating were collected fixed in Paraformaldehyde Fix Solution (G1101-500ML, Servicebio) for histology or flash-frozen for RT-qPCR analysis. Successful pregnancy was confirmed by flushing embryos from the uteri on GD4. Tail intravenous injection with 0.1 mL of 1% Chicago blue dye (C8679, Sigma-Aldrich) was applied to identify implantation sites on GD5. Female fertility was assessed by mating cohorts of  Mettl3  cKO ( n  = 12) and control ( n  = 10) mice individually with WT males proven breeders continuously for 6 months. The numbers of pups per litter per dam were recorded as mean ± SD.\nThe estrous cycle phases of  Mettl3  cKO and control mice (8–10 week) were determined by crystal violet staining of vaginal smears, as previously described [ 54 ]. Briefly, the vaginal cells were washed with 100 μL PBS and transferred to a dry glass slide using a pipette. The slide was air-dried and stained for 1 min with 1% crystal violet (V5265-500ML, Sigma), followed by three 1-min rinses in water. The slides were coated with neutral balsam (G8590-100ml, Solarbio) and viewed with an Olympus BX53 microscope.\nMouse blood samples were collected on GD4 in the morning and serum progesterone (P4), as well as estradiol-17β (E2) levels, were measured by Estradiol 2 Assay Kit (H102-1, NanJingJianCheng Bioengineering Institute, Nanjing, China) and Progesterone Assay Kit (H089, NanJingJianCheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s recommendations.\nMice were ovariectomized at 6 weeks of age and rested for 2 weeks to remove endogenous ovarian hormone in most experiments. For evaluating the effects of E2, a subcutaneous injection of 100 ng E2 (E8875, Sigma) was given to OVX mice and sacrificed 24 h after the last injection. The hormonal profile of pregnancy at the time of implantation was simulated using a “pollard” experiment scheme [ 55 ]. Briefly, mice were treated with daily subcutaneous injections of E2 (100 ng) for 2 days. Following this treatment and after 2 days of rest, the mice received a daily injection of P4 (1 mg) for 3 days. On the fourth day, mice were treated with 100 ng of E2 and 1 mg of P4. The mice were sacrificed 16 h after the E2 + P4 injection. The uteri were harvested for RT-qPCR and histology analysis.\nSuperovulation studies were conducted to assess ovarian function. To induce superovulation, 6-week-old mice were administrated 7.5 IU of pregnant mare serum gonadotropin (PMSG, hor-272, ProSpec). Human chorionic gonadotropin (hCG, 230734, sigma) (7.5 IU) was injected subcutaneously 48 h after PMSG injection. At 14 h post hCG injection, the ovaries and oviducts were surgically removed, and the cumulus-oocyte complexes mass was recovered from the oviduct and collected into M2 medium (Sigma) containing 1 mg/mL of hyaluronidase (H3506, Sigma) to dissociate the cumulus cells from oocytes. The numbers of oocytes were counted and recorded.\nIn vivo artificial decidual response was conducted similarly to that described previously [ 56 ]. Briefly, the ovariectomized mice were given daily subcutaneous injections of 100 ng of E2 (E8875, Sigma) prepared in sesame oil for 3 days (day 1–3). On day 6–8, mice were given a subcutaneous injection of 1 mg of P4 and 6.7 ng of E2 dissolved in sesame oil. Artificial decidualization was processed by intraluminal injection of 50 μL of sesame oil into the right uterine horn 6 h after the last injection of E2 and P4, with the left uterine horn acting as a negative control. Mice received daily E2 and P4 administration for 5 more days and sacrificed on day 14.\nUterine cells were isolated from day 4 pseudopregnant mice as previously described [ 57 ]. The uterine horns of control and  Mettl3  cKO mice were cut longitudinally, washed with HBSS, and digested with 1% (w/v) pancreatin (P7545, Sigma) and 6 mg/ml dispase II (Sigma) in HBSS for 1 h at 4 °C followed by 1 h at room temperature and 10 min at 37 °C. The tissues were rinsed with HBSS for three times, and the supernatant was filtered through a 100-μm nylon cell strainer and collected as epithelial cells. And the remaining tissues were further digested within 0.15 mg/ml collagenase I (17100017, Invitrogen) in HBSS at 37 °C for 30 min. The tissues were washed 3 times with HBSS. And the supernatant above was filtered through a 100-μm nylon cell strainer for the collection of uterine stromal cells. The uterine cells were cultured in DMEM/F12 (319-080-CL, Wisentbio) containing 2% charcoal-stripped FBS (04-201-1A, Biological Industries) and 15 mM HEPES (15630080, Thermo Fisher).\nTo induce stromal cells to undergo decidualization, the harvested stromal cells were cultured for 30 min, the medium was changed to remove unattached cells. And the cell culture was continued by adding fresh medium supplemented with P4 (1 μM) and E2 (10 nM) dissolved in ethanol for different time points. Transfection of  Myc  overexpression plasmid in  Mettl3  cKO uterine stromal cells was performed according to Lipo3000 protocol (L3000015, Life Technologies). For the six-well culture plate, 2 μg  Myc  overexpression plasmid (EX-Mm30812-M02, GeneCopoeia) or 2 μg control plasmid (EX-NEG-M02-B, GeneCopoeia) was used for the transfection. The cells were cultured with P4 (1 μM) and E2 (10 nM) for 2 days, and the mRNA levels of  Myc  and of decidualization-related genes were analyzed by RT-qPCR.\nTotal RNA was extracted from uterine tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The complementary DNAs (cDNAs) were synthesized with PrimeScript RT Master Mix (RR036A, Takara) by using 500 ng total RNAs according to the manufacturer’s instructions. Quantitative real-time PCR was performed to assess the expression of genes of interest with SYBR Green (RR820A, Takara) on a CFX Connect Real-Time PCR Detection System (Biorad). Experimental gene expression data were normalized to  Actb . The RT-qPCR primers are listed in Table  1 . Table 1 List of primer sequences for RT-qPCR. Primer name Sequences (5′-3′) Mettl3  Forward AACATCTGTGGCCCCTGAAC Mettl3  Reversed TGGCAAGACGGATGGAAACA Wnt4  Forward AGACGTGCGAGAAACTCAAAG Wnt4  Reversed GGAACTGGTATTGGCACTCCT Bmp8a  Forward CCTGGTCATGAGCTTCGTCA Bmp8a  Reversed AGCAGGGATCTGGGTTAGGT Bmp2  Forward TGCTTCTTAGACGGACTGCG Bmp2  Reversed CTGGGGAAGCAGCAACACTA Muc1  Forward GGCATTCGGGCTCCTTTCTT Muc1  Reversed TGGAGTGGTAGTCGATGCTAAG Ltf  Forward TGAGGCCCTTGGACTCTGT Ltf  Reversed ACCCACTTTTCTCATCTCGTTC Lif  Forward ATTGTGCCCTTACTGCTGCTG Lif  Reversed GCCAGTTGATTCTTGATCTGGT Wnt4  Forward GAGAACTGGAGAAGTGTGGCTG Wnt4  Reversed CTGTGAGAAGGCTACGCCATAG Fzd10  Forward CTGGCTTGCTACCTAGTCATCG Fzd10  Reversed TGCGTACCATGAGCTTCTCCAG Hoxa10  Forward GGCAGTTCCAAAGGCGAAAAT Hoxa10  Reversed GTCTGGTGCTTCGTGTAAGGG Fst  Forward TGCTGCTACTCTGCCAGTTC Fst  Reversed GTGCTGCAACACTCTTCCTTG Il13ra2  Forward ACCGAAATGTTGATAGCGACAG Il13ra2  Reversed ACAATGCTCTGACAAATGCGTA Lrp2  Forward AAAATGGAAACGGGGTGACTT Lrp2  Reversed GGCTGCATACATTGGGTTTTCA Ihh  Forward TCAAAGAGCTCACCCCCAAC Ihh  Reversed AGTTCAGACGGTCCTTGCAG Pgr  Forward TATGAGAACCCTTGACGGTGTTG Pgr  Reversed CAGGGCCTGGCTCTCGTT Myc  Forward TCGCTGCTGTCCTCCGAGTCC Myc  Reversed GGTTTGCCTCTTCTCCACAGAC Elf3  Forward TCCTCCGACTACCTTTGGCACT Elf3  Reversed ACTCCAGAACCTGGGTCTTCGA Celsr2  Forward CATGAAGGACCTCCAGGTGGAT Celsr2  Reversed CGTTGTGGCAAATGCTGCTGTC Prl  Forward CTGGCTACACCTGAAGACAAGG Prl  Reversed TCACTCGAGGACTGCACCAAAC Prl8a2  Forward ACCACAACCCATTCTCAGCTGG Prl8a2  Reversed TGTTCAGGTCCATGAGCTGGTG Rrm2  Forward TGCGAGGAGAATCTTCCAGGAC Rrm2  Reversed CGATGGGAAAGACAACGAAGCG Ldha  Forward ACGCAGACAAGGAGCAGTGGAA Ldha  Reversed ATGCTCTCAGCCAAGTCTGCCA Actb  Forward CACTGTCGAGTCGCGTCC Actb  Reversed CGCAGCGATATCGTCATCCA\nList of primer sequences for RT-qPCR.\nThe uteri of  Mettl3  cKO and control mice on GD4 were obtained for RNA-seq analysis. Total RNA was extracted from the uteri using TRIzol reagent (Invitrogen) following the manufacturer’s protocol. RNA purity and quantification were evaluated using the NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). The libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, USA) and sequenced on an Illumina Novaseq6000 platform (OE Biotech Co., Ltd., Shanghai, China). The clean reads were mapped to the mouse reference genome (GRCm38.p6) using HISAT2. FPKM of each gene was calculated using Cufflinks, and the read counts of each gene were obtained by HTSeq-count. Differential expression analysis was performed using the DESeq (v3.8) R package.  p  value < 0.05 and foldchange > 1.5 or foldchange <2/3 was set as the threshold for significantly differential expression. GO, KEGG, and GSEA analyses were conducted by clusterprofiler R package (v4.4.4). All the heatmaps were drawn by pheatmap R package (version 1.0.12). Z-score were calculated and scaled by row or column.\nFor m 6 A sequencing, the poly(A) RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module (NEB, cat.e6150, USA) under 86 °C 7 min. The cleaved RNA fragments were incubated for 2 h at 4 °C with anti-m 6 A antibody (202003, Synaptic Systems) in IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% IGEPAL CA-630). The IP RNA was reverse-transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase (1896649, Invitrogen), which was next used to synthesize U-labeled second-stranded DNAs with E. coli DNA polymerase I (m0209, NEB), RNase H (m0297, NEB) and dUTP Solution (R0133, Thermo Fisher). An A-base is then added to the blunt ends of each strand, preparing them for ligation to the indexed adapters. Each adapter contains a T-base overhang for ligating the adapter to the A-tailed fragmented DNA. Single- or dual-index adapters are ligated to the fragments, and size selection was performed with AMPureXP beads. After the heat-labile UDG enzyme (m0280, NEB) treatment of the U-labeled second-stranded DNAs, the ligated products are amplified with PCR by the following conditions: initial denaturation at 95 °C for 3 min; 8 cycles of denaturation at 98 °C for 15 s, annealing at 60 °C for 15 s, and extension at 72 °C for 30 s; and then final extension at 72 °C for 5 min. The average insert size for the final cDNA library was 300 ± 50 bp. At last, we performed the 2 × 150 bp paired-end sequencing (PE150) on an Illumina Novaseq6000 (LC-Bio Technology Co., Ltd., Hangzhou, China).\nFor the bioinformatic analysis of m 6 A-seq, fastp software (v0.19.4) was used to remove the reads that contained adapter contamination, low-quality bases and undetermined bases with default parameters. The sequence quality of IP and input samples were also verified using fastp. We used HISAT2 (v2.0.4) to map reads to the reference genome of mouse (GRCm38.p6). Mapped reads of IP and input libraries were provided for R package exomePeak (v2.13), which identifies m 6 A peaks. The bigwig format was converted from the bam format by bamcoverage tool in deeptools (version 2.5.4), and was adapted for visualization on the IGV software (v2.14.0). RPGC (reads per genomic content) method was used for normalization. MEME (v4.12.0) and HOMER (v4.10) were used for de novo and known motif finding followed by localization of the motif with respect to peak summit. Called peaks were annotated by intersection with gene architecture using R package ChIPseeker (v3.8). Then StringTie (v2.1.2) was used to perform expression level for all mRNAs from input libraries by calculating FPKM (total exon fragments/mapped reads (millions) × exon length (kB)). The differentially expressed mRNAs were selected with log 2 (fold change) >1 or log 2 (fold change) <−1 and  P  < 0.05 by R package edgeR (v3.38.4).\nPurified mRNAs of the uteri of  Mettl3  cKO mice and control mice were prepared and fragmented into ~100 nt by RNA fragmentation reagents (e6150, NEB). Immunoprecipitation was performed using anti-m 6 A antibody (202003, Synaptic Systems) as described previously. The enrichment of m 6 A was measured with quantitative RT-PCR. Primers for m 6 A-RIP-qPCR are listed in Table  2 . Table 2 List of primer sequences for m 6 A-RIP-qPCR. Primer name Sequences(5′-3′) Pgr  Forward TAGAGCAACCTGCAACCAGAA Pgr  Reversed AGCCCATTCTTACTCGTTCTCC Myc  Forward AACGACGAGAACAGTTGAAACAC Myc  Reversed AGCTCCTCCTCGAGTTAGGTC Elf3  Forward AATTAAGGATCGGGGCTGGAC Elf3  Reversed GCAACACAGGGAACACATCC Celsr2  Forward CTCTCCCAGGAACTGACAAGC Celsr2  Reversed AAACGGTTCATGCAGCATTTGG\nList of primer sequences for m 6 A-RIP-qPCR.\nTo assess mRNA stability, primary uterine cells were treated with actinomycin D (Sigma) at a final concentration of 5 μg/mL for 0 h, 2 h, and 4 h. Total RNA samples were extracted and subjected to RT-qPCR analysis. Results were normalized to the expression of  Actb . Fold differences in expression levels were calculated according to the 2 −ΔΔCT  method.\nStatistical analyses were performed using 2-tailed Student’s  t  test. Data are presented as mean ± SD.  P  values less than 0.05 were considered statistically significant. * P  < 0.05, ** P  < 0.01 and *** P  < 0.001.\n\nReproducibility checklist \n Supplementary Figures and Table \n Original Data File-Western blot results\nReproducibility checklist\nSupplementary Figures and Table\nOriginal Data File-Western blot results","source_license":"CC-BY-4.0","license_restricted":false}