{"paper_id":"b01f1e3d-3688-495d-959b-d4fc52dfc5a6","body_text":"The effects of ethyl lauroyl arginine hydrochloride (ELAH) in nasal spray formula on SARS-Cov-2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The effects of ethyl lauroyl arginine hydrochloride (ELAH) in nasal spray formula on SARS-Cov-2 Harshad R. Thacore, Abdul Gaffar, Seiyoung Yun, Agnes L. Chenine, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-842564/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract SARS-CoV-2 and coronaviruses, enveloped RNA viruses, are major causes of acute human respiratory diseases. The aim of the study was to investigate the broad-spectrum antiviral effects of ethyl lauroyl arginine hydrochloride (ELAH) in in vitro and in vivo assays. Cell-based assays found that the pseudovirus VSV-SARS-CoV-2 was inhibited with an EC 50 of 15 micrograms/ml, with complete inhibition achieved at 110 micrograms/ml. The effects were comparable to those observed with anti-SARS-CoV-2 antibody neutralization assays against VSV-SARS-CoV-2. Intranasal administration of the Wuhan strain of SARS-CoV-2 treated in vitro with ELAH inhibited the disease symptoms caused by the virus in a Syrian hamster model compared to that caused by the same dose of virus treated in vitro with medium alone. Subgenomic RNA and total RNA viral load were concomitantly reduced in the treated animals compared with the control group. In cell-based studies, pretreatment of susceptible cells with 1–10 micrograms/ml ELAH inhibited the attachment of the virus to the cells, as measured by cytopathic and high-resolution scanning electron microscopy (SEM) effects, suggesting that the primary mode of ELAH action was due to preventing the attachment of the virus to the cells. Collectively, the data suggest that ELAH could be a promising agent for the prevention of SARS infection through nasopharyngeal surfaces. Infectious Diseases Drug Discovery, Design, & Development SARS-CoV-2 ethyl alauroyl arginine hydrochloride prevention Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction In December 2019, a novel coronavirus (SARS-CoV-2) emerged in Wuhan, China, and in a matter of months, the virus rapidly spread throughout the world (Koopmans M. 2020). The World Health Organization (WHO) declared the outbreak a pandemic in March 2020 (Koopmans M. 2020). This highly contagious respiratory disease, coronavirus disease 2019 (COVID-19), caused by SARS-CoV-2 virus enters the host via the respiratory route and infects the lungs and other organs of the body (Gandhi RT, and others, 2020). Since the port of entry of the virus is via the nasopharynx, we present data with regard to the efficacy of our nasal spray product in preventing the virus from causing a severe disease. The compound N-alpha-lauroyl-L-arginine ethyl ester monohydrochloride (LEAH or ELAH - FDA designation) is a derivative of lauric acid, arginine and ethanol. The main characteristic of this molecule is that it prevents the proliferation and colonization of microbial films in oral and nasal mucosal surfaces (Gallob, JT et al, 2015). ELAH is hydrolyzed in the human body by chemical and metabolic pathways, which break the molecule into natural compounds in the human diet (Hawkins, D.R., 2009t). The FDA has approved ELAH and classified it as a GRASE, generally recognized as safe and effective for use in meats and poultry as a food preservative (FDA 2005 GRAS notice. GRN 000164, no objection letter from FDA Sept 2005: The EFSA journal (20027)511;1-27). The antiviral and virucidal activity of arginine surfactants, such as L-Cocoyl-L- arginine ethyl ester, against herpes simples, influenza A and polioviruses has been extensively studied by Hasashi Yamasaki et al. (Yamasaki, H et al, 2011). However, they did not study the lauric acid ester of arginine in their studies. In this report, we present the results of in vitro and in vivo studies on SARS-CoV-2 virus. The effect of ELAH applied through a specific formulation for nasal delivery to arrest, block or prevent the colonization of the virus in the nasopharyngeal area and indicate that ELAH, due to its excellent safety profile, could be a useful agent for augmenting preventative measures for SARS-CoV-2 on mucosal and nasopharynx surfaces. Experimental Section Recombinant VSV: rVSV-dG SARS-CoV-2 S : The recombinant vesicular stomatitis virus (rVSV) whose glycoprotein gene (G) has been deleted is used as the base platform for IBT Bioservices’s pseudo type-based neutralization assay (Whitt 2010). The VSV-G glycoprotein is transiently expressed by transfection to produce virus particles. To create a pseudotype virus, VSV-G is substituted with the SARS-CoV-2 spike protein lacking the last eighteen amino acids of the cytoplasmic domain. The resulting virus, rVSV-ΔG SARS-CoV-2 S, also expresses firefly luciferase and can be handled at biosafety level 2 (BSL-2). Infection efficiency was measured by quantification of luciferase activity reading the relative light units (RLU). Briefly, rVSV-ΔG SARS-CoV-2 S was preincubated with and without ELAH along with SARS-CoV-2 seropositive rat sample (IBT Bioservices)used as internal assay control. Rats serum was obtained after immunizing rats in house with SAR-CoV-2 spike protein and added to Vero cells .. After 24-hours infection, firefly luciferase activity wasmeasured and the 50% inhibitory dose (ID 50 ) defined as the reciprocal of the serologic reagent dilution that caused a 50% reduction in RLUs compared to virus control wells was determined. Formula for nasal spray : The formula contains 0.1% ELAH, glycerin, xylitol (moisturizing agents), 1,2-hexanediol, polyvinyl pyrrolidone, PEG-40 hydrogenated castor oil, phenoxyethanol and cupric gluconate as preservatives, citric acid for buffer and deionized distilled water (COVIXYL-V). Neutralization Assay : Vero cells were seeded at 60,000 cells/well in 96-well flat bottom black cell culture plates in Dulbecco’s modified Eagle medium (DMEM) containing 10% serum and incubated overnight. Four dilutions of ELAH were prepared in 1% serum medium at two times (2X) the final intended concentration. Virus dilution and ELAH/virus mix preincubation : rVSV-SARS-CoV-2 S was diluted 1:10 in 1% serum medium to obtain a final dilution of 1:20 in 2.5 ml and 175 µl of virus inoculum was then mixed to 175 µl of each ELAH concentrations for 350 µl final; 350 µl of virus only was also prepared. All mixtures were incubated for 1 hour at 37°C and 5% CO2. All the medium was removed from the 96-well black plates, and 100 µl of each virus/TA (testing article) mixture was added in triplicate to the Vero cells. One hundred microliters of virus only and 100 µl of 1% serum medium were also added to a minimum of 6 wells and incubated for 24 hours at 37°C and 5% CO2. Firefly luciferase readout : 100 µl of Bright-Glo reagent was added to each well as instructed by the manufacturer. Plates were read immediately in our luminometer, and the relative light unit (RLU) was measured. Animal Model Studies : The Syrian golden hamster was chosen as the animal model for this study based on in-house data and recent publications indicating that SARS-CoV-2 productively replicates in this model and that aspects of COVID-19 are recapitulated (Tostanoski, L, H,2020 and others). A total of 21 male and female Golden Syrian hamsters (6-8 weeks old, approximately 100 g of weight) were purchased from Envigo (Indianapolis, IN, barrier 202C). The animals were received in good condition. Animal acclimation and husbandry followed the procedures and practices outlined in the IACUC Study Protocol. The animal study was conducted in BIOQUAL’s animal facility, BIOQUAL’s facilities are OLAW assured (A-3086-01), USDA registered (51R 036), and have Full AAALAC Accreditation (File no. 624). Additionally, BIOQUAL has CDC/USDA approval for working with restricted BSL-2 and BSL-3 Select Agents and has approved ABSL/BSL-3 facilities and training for working with infectious agents under containment. Housing and handling of the animals were performed in accordance with the animal welfare requirements and accreditations stated above. Based on the final study plan, BIOQUAL prepared, submitted, and received approval for the IACUC protocol. BIOQUAL Study Directors of both Animal/Veterinary Services and Laboratory Services reviewed the IACUC protocol submission to ensure that all scheduled procedures were consistent with the approved final study plan. This nonclinical study was performed under the BIOQUAL Institutional Animal Care and Use Committee approved Protocol (IACUC Protocol Number: 20-153P) and was conducted in accordance with the Study Protocol and BIOQUAL Standard Operating Procedures (SOPs). Experimental design and grouping: A study design was prepared in collaboration with BIOQUAL and Merck research scientists and finalized in a study protocol prior to the start of the study. In Study 1, retention of ELAH after a single administration followed by mock challenge was examined over time, while in Study 2, hamsters challenged with virus treated in vitro either with medium or with ELAH were evaluated for infection and clinical outcome. Study 1 was conducted with a total of six animals divided equally into three groups. ELAH (50 µl per nare) was administered into each nare of the animals. Each animal then received 50 µl of DMEM containing 2% FBS per nostril after 10 min for Group 1, 15 min for Group 2 and 20 min for Group 3 to mimic mock infection. Leakage of solution was monitored for 10 min after each mock infection. For Study 2, a total of 15 animals divided equally into three groups were used. Group 1 animals were challenged with virus treated in vitro with undiluted ELAH; Group 2 animals were challenged with virus treated in vitro with diluted ELAH (dose diluted 1:1 in sterile PBS), and Group 3 animals were challenged with virus treated in vitro with medium alone. Each treatment was performed at 37°C in 5% CO2 for 10 min. Daily weights and BID observations during challenge periods SD 1, 2, 3, 4, 5, 6, 7, 10 and 14. Preparation and Administration Procedures : For Study 1, ELAH-COVIXYL-V solution was applied directly followed by DMEM containing 2% FBS. For Study 2, a vial of SARS-CoV-2 virus was thawed, and the virus was divided into groups: Group 1: Virus stock (0.2 ml) was diluted to 1.8 ml with medium by adding 1.6 ml of medium and 0.2 ml of ELAH-COVIXYL-V and incubated at 37°C in a 5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare). Group 2: ELAH-COVIXYL-V (0.5 ml) was diluted to 1 ml with 0.5 ml of sterile PBS. Virus stock (0.2 ml) was diluted to 1.8 ml with medium by adding 1.6 ml of medium and 0.2 ml of diluted ELAH-COVIXYL-V (1:1) and incubated at 37°C in a 5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare). Group 3 (Control): Virus stock (0.2 ml) was diluted to 2 ml by adding 1.8 ml of medium and incubated at 37°C in a 5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare). Challenge of hamsters with SARS-CoV-2: ELAH- or medium-treated SARS-CoV-2 was administered intranasally (IN) to anesthetized hamsters and performed in a BSL-3 laboratory. The administration of virus was conducted as follows: Using a calibrated pipettor, 0.05 mL of the viral inoculum was administered dropwise into each nostril, 0.1 ml per animal while the animal's head was tilted back so that the nostrils were pointing toward the ceiling. syringe into the first nostril and slowly the inoculum into the nasal passage, and then removed. This was repeated for the second nostril. The animal’s head was tilted back for approximately 20 seconds and then returned to its housing unit and monitored until fully recovered. Body weights were measured once daily during the challenge phase. The animals were monitored twice daily during the morning and afternoon for signs of COVID-19 disease (ruffled fur, hunched posture, labored breathing) during the study period, starting on the day of SARS-CoV-2 challenge, and the information was recorded on BIOQUAL clinical observation forms and/or the Pristima® database. The raw data for the body weights and the clinical observations were made and recorded. Specimen collection : Only oral swabs were collected on study days 1, 2, 3, 4, 5, 6, 7, 10 and 14 post challenge as per the study protocol. Scheduled euthanasia and necropsies were carried out for each nare. Specimen Processing for viral RNA and viral subgenomic RNA assays : For viral load assays of oral swabs, the samples were processed. Upon collection, the swabs were placed into 1 ml of PBS and then snap-frozen. Samples were then thawed, and an aliquot of the sample was used for RNA isolation following the manufacturer’s instructions (Qiagen, Cat. No. 57704). Viral RNA quantitation : The qRT-PCR assay was used for quantitation of viral RNA from the oral swabs using the primers and a probe specifically designed to amplify and bind to a conserved region of Nucleocapsid gene of Coronavirus (Forward primer: 5’-GAC CCC AAA ATC AGC GAA AT-3’; Reverse Primer: 5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’ and Probe: 5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’) as described elsewhere (Baum et al. REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters. science.sciencemag.org/cgi/content/full/science. abe2402/DC1). The signal was compared to a known standard curve and calculated to give copies per mL. For the qRT-PCR assay, viral RNA was first isolated from oral swabs using the Qiagen Min Elute virus spin kit (cat. no. 57704). To generate a control for the amplification reaction, RNA was isolated from the applicable COVID virus stock using the same procedure. The amount of RNA was determined from an O.D. reading at 260, using the estimate that 1.0 OD at A260 equals 40 µg/mL of RNA. With the number of bases known and the average base of RNA weighing 340.5 g/mole, the number of copies was then calculated, and the control was diluted accordingly. A final dilution of 10 8 copies per 3 µL was then divided into single use aliquots of 10 µL and stored at -80°C. For the master mix preparation, 2.5 mL of 2X buffer containing Taq-polymerase, obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), was added to a 15 mL tube. From the kit, 50 µL of RT and 100 µL of RNAse inhibitor were also added. The primer pair at a 2 µM concentration was then added in a volume of 1.5 mL. Finally, 0.5 mL of water and 350 µL of the probe at a concentration of 2 µM were added, and the tube was vortexed. For the reactions, 45 µL of the master mix and 5 µL of the sample RNA were added to the wells of a 96-well plate. All samples are tested in triplicate. The plates were sealed with a plastic sheet. For control curve preparation, samples of the control RNA were prepared to contain 10 6 to 10 7 copies per 3 µL. Eight (8) 10-fold serial dilutions of control RNA were prepared using RNAse-free water by adding 5 µL of the control to 45 µL of water and repeating this for 7 dilutions. This generated a standard curve with a range of 1 to 10 7 copies/reaction. For amplification, the plate was placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program: 48°C for 30 minutes, 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds, and 1 minute at 55°C. The number of copies of RNA per mL was calculated by extrapolation from the standard curve and multiplying by the reciprocal of 0.2 mL extraction volume. Subgenomic RNA quantitation : The method used for quantitation of subgenomic mRNA measured by an RT-qPCR assay was similar to what was described elsewhere (Wölfel R., Corman V.M., and others (2020)). The primers and probe selected from the N gene (Forward: 5’-CGATCTCTTGTAGATCTGTTCTC-3’; reverse: SG-N-R: 5’-GGTGAACCAAGACGCAGTAT-3’ and probe: 5’-FAM- TAACCAGAATGGAGAACGCAGTGGG -BHQ-3’) were similar to what was previously described (Li et al. 2021). The PCR signal obtained with the sample was compared to a known standard curve of plasmid containing the sequence of part of the messenger RNA and calculated to give copies per ml. To generate a control for the amplification reaction, a plasmid containing a portion of the N gene messenger RNA was used. A final dilution of 106 copies per 3 µl was then divided into single use aliquots of 10 µl and stored at -80°C until needed. The samples extracted for viral RNA were then amplified in duplicate to pick up sgRNA. Seven (7) 10-fold serial dilutions of control RNA were prepared by adding 5 µl of the control to 45 µl of water and repeating this for 7 dilutions, leading to the generation of a standard curve with a range of 1 to 10 6 copies/reaction. For amplification, the plate was placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program: 48°C for 30 minutes, 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds, and 1 minute at 55°C. A printout of the results is maintained in the laboratory notebook. The number of copies of RNA per ml was calculated by extrapolation from the standard curve and multiplying 0.2 mL of extracted volume. The effect of pretreatment of MRC-5 cells with ELAH on the replication of human coronavirus 229E : A human lung fibroblast MRC-5 (ATCC® CCL-171™) cell line grown in Eagle’s Minimum Essential Medium (EMEM) containing 2% fetal bovine serum and human coronavirus 229E (ATCC® VR-740™) was used in these experiments. Preliminary experiments were conducted to determine the cytotoxicity of ELAH on MRC-5 cell cultures. Serial 10-fold dilutions of ELAH starting with a stock solution containing 0.08% or 800 µg/ml ELAH or cell medium only as a control were added to MRC-5 cell cultures and incubated for 6 days. Cytotoxicity screening using bright field imaging was conducted to determine the lowest noncytotoxic concentration of ELAH in MRC-5 cell cultures under these experimental conditions. To assess the replication of human coronavirus 229E in MRC-5 cells pretreated with ELAH, the following experiment was conducted. Noncytotoxic concentrations of ELAH were added to MRC-5 cell cultures at 37°C for 10 minutes. The culture medium containing unbound ELAH was removed from treated cell cultures, and human coronavirus 229E was added to the cells and incubated at 35°C for an additional 2 h for the virus to adsorb to the cells. The virus inoculum was removed, and the cultures were washed with medium and reincubated for 4 days at 35°C. Appropriate controls, medium alone, were also included in the experiment. Virus yield from cultures pretreated with ELAH and control nontreated cells was assayed for virus yield by TCID 50 , and virus-induced cytopathic effect (CPE) was determined by bright field imaging using an Olympus BX63 microscope and Olympus cellsSens Dimension software of the ELAH-treated and control MRC-5 cell cultures. Inhibition of cytopathic effect by human coronavirus 229E in MRC-5 cells pretreated with ELAH as assessed by bright field microscopy : MRC-5 cells were seeded at 1x105 cells/ml in 4-chamber cell culture slides and incubated at 37°C for 4 days until approximately 85-90% confluency was obtained. Two concentrations of ELAH, 1 µg/ml and 10 µg/ml, in DMEM were added to the cells and incubated for 10 minutes at 37°C. Cell cultures treated with medium only were used as controls. ELAH was then removed from the cell cultures and infected with a 10^3 dilution of stock human coronavirus 229E (log 10 TCID 50 /ml 5.625), and cultures were reincubated at 35°C for 2 hours. Similarly, cells not treated with ELAH were also infected with 229E. After a 2-hour adsorption period, the unadsorbed virus was removed, and the cells were washed, refed with medium and incubated for 48 hours at 35°C. Control cultures were treated in a similar manner. After 48 hours, chamber cell cultures were imaged via bright field microscopy at a magnification of X63. Samples for scanning electron microscopy were fixed with 1 ml glutaraldehyde for 2 hours and processed according to Caldas et al. (2020). SEM imaging was conducted at the University of Wyoming’s Materials Characterization Laboratory. After samples underwent fixation, they were placed in a Kinney Vacuum KSE-2A-M Evaporator under 10^-4 Torr vacuum for 24 hours and then sputtered with a 5 nm thick gold coat using a Model 30000 Ladd Research Industries apparatus. Secondary electron and backscattered electron images were collected on a Quanta 250 scanning electron microscope under 10^-5 Torr vacuum using an accelerating voltage of 5 kV and spot sizes of 2 and 3. Electronic alignments on the electron gun (Gun Alignment, Final Lens Aperture Alignment, and Stigmator Alignment) were performed prior to imaging to optimize resolution. Results Effect of ELAH on the replication of rVSV-dG SARS-Covid-2S in Vero cells: A recombinant vesicular stomatitis virus (VSV) was used in which the glycoprotein gene (G) was deleted and substituted with full-length SARS-Covid-19 spike protein and a firefly luciferase as described in the Materials and Methods. This construct was able to infect, replicate and cause cytopathic effects in Vero cells as well as express firefly luciferase. The infection efficacy in Vero cells was measured by quantification of the luciferase activity reading the relative light units (RLU) on a luminometer. This construct was used to study the interaction of ELAH and the spike protein of SARS-Covid-19. Briefly, rVSV-dG SARS-Covid-2S was incubated with and without ELAH as well as with 2019 SARS-Covid-2 neutralizing antibody serum as a control for 1 hr at 37°C. Vero cells grown in 96-well flat bottom cell culture plates were infected in triplicate with virus incubated with or without ELAH as well as antiserum-treated virus and incubated for 24 hrs at 37°C. A minimum of six Vero cell cultures were infected with virus only, and six wells of uninfected cell cultures were used as controls. Firefly luciferase activity was then measured in all wells, and inactivation and neutralization titers were calculated by the RLU values. Neutralization titers (50% inhibitory dose, ID50) were defined as the reciprocal of the dilution that caused a 50% reduction in RLUs compared to virus control wells. The neutralization of rVSV-SARS-CoV-2 S by the 2019 anti-SARS-CoV-2 antiserum is presented in Figure 1. The results show that the antibodies bind to the spike protein in the construct and prevent its binding to Vero cell receptors, thus inhibiting replication. The results presented in Figure 2 show the inhibitory effect of ELAH on the replication of rVSV-SARS-CoV-2 S. Maximum inhibition of the replication of the virus, over 90%, was obtained at a concentration of 110 µg/ml ELAH (Figure 2). These results suggest that ELAH either binds to or alters the spike protein of the rVSV-SARS-CoV-2 S construct, thus preventing attachment to the receptor, entry and replication in Vero cells. Efficacy of ELAH as a nasal spray in preventing severe disease in Syrian Golden hamsters: Studies have shown that Syrian Golden hamsters are a useful animal model for studying the pathogenesis of SARS-CoV-2 (ref). SARS-COV-2 is a respiratory virus, and the nasal cavity is the main route of infection. A nasal spray is a possible route for the delivery of therapeutics as a preventive measure (ref). The following experiments were conducted in Syrian Golden hamsters to evaluate the efficacy of ELAH as a nasal spray in preventing clinical symptoms of SARS-CoV-2 infection. Retention of nasally administered ELAH in Syrian Golden hamsters (Study 1): Preliminary experiments were conducted to determine the retention of ELAH when administered nasally without side effects. As described in the Materials and Methods, 50 µl of ELAH was administered to each nare of a group of hamsters, and after 10, 15 and 20 minutes, 50 µl of medium containing 2% fetal bovine serum was administered to each nare of hamsters to mimic mock infection. No leakage of either ELAH medium was observed in experimental animals 10 minutes after mock infection. While some moisture around the nose is normal for this procedure, the amount of moisture could not be quantified. Pretreatment of SARS-CoV-2 with ELAH inhibited the ability of the virus to synthesize viral sgRNA and viral RNA and induce clinical symptoms in hamsters. It has been well documented that upon infection of hamsters with SARS-CoV-2 via the nasal route, one of the clinical symptoms observed is severe weight loss during the first few days of infection followed by recovery to normal weight (Tostanoski, L, H,2020). Weight loss has been associated with the presence of virus in the respiratory tract (Tostanoski, LH,2020). As described in the Materials and Methods, the animals were divided into groups. A constant amount of SARS-CoV-2 was incubated with two different concentrations of ELAH for 10 minutes at 37°C. As controls, the virus was incubated with medium under similar experimental conditions. Each of the groups of animals was challenged with 0.1 ml of treated or control mixtures (0.05 ml/nare). The body weights of each hamster were measured once daily, and the animals were also monitored twice daily for signs of COVID-19 disease as described in the Materials and Methods. The body weight changes observed in all animals during the course of 14 days are shown in Figure 3A. The results show that the animals infected with SARS-CoV-2 alone had a significant loss of weight during the first six days after challenge. These animals regained their original weight during the next eight days, as has been reported elsewhere (Tostanoski, L H,2020). In contrast, viruses treated with ELAH showed no significant weight loss during the 14-day course of the study. Similar results were also obtained with all females (Figure 3B) and male animals (Figure 3C). These results indicate that the treatment of SARS-CoV-2 with ELAH under these experimental conditions significantly inhibits the ability of the virus to induce weight loss, a major indicator of clinical disease. All three groups of animals were also tested for the number copies of subgenomic RNA (sgRNA) and region of the E gene messenger RNA from the coronavirus. The swabs were taken on days 1, 2, 3, 4, and 7 as described in the Materials and Methods. The results presented in Figure 4 show that in control group 3, all animals demonstrated significant copies of sgRNA except for both animals on day 4. In contrast, virus treated with undiluted ELAH (Group 1) prior to infection showed no detectable (<50 copies) copies of sg-RNA, except for one animal on day 1. In group 2, animals treated with 1:1 diluted ELAH, 4 out of 5 animals on day 4 were positive for the sgRNA, whereas three animals out four showed no detectable sgRNA on day 7. These results suggest that animals treated with ELAH significantly inhibit the synthesis of viral sgRNA synthesis, thus inhibiting the synthesis of progeny virions in ELAH-treated animals. The presence of viral load in the three groups of animals as determined by the number of VRNA copies/swab is shown in Figure 5. In control group 3, all animals except for one animal had an average of 9.4 copies of viral RNA/swab. In contrast, in the animals infected with a mixture of virus and a high concentration of ELAH for 10 minutes at 37°C prior to infection, 4 animals had nondetectable viral RNA copies/swabs, and 4 animals had fewer viral RNA copies/swabs than the average found in control animals. In group 2 animals treated with half the concentration of ELAH compared to group 1, no detectable viral load was found in 3 animals, and 2 animals had viral load below the average in the control animals. Four animals in this group had viral loads higher than the average. These results suggest that pretreatment of SARS-CoV-2 with ELAH prior to infection of these animals significantly reduced not only the presence of viral sgRNA but also the viral load. The effect of pretreatment of MRC-5 cells with ELAH on the replication of human coronavirus 229E. MRC-5 cell cultures were pretreated with noncytotoxic concentrations of ELAH (0.8 and 0.08 µg/ml) or with medium alone (control) for 10 minutes and infected with coronavirus 229E as described in the Materials and Methods. The results presented in Table 1 show a 0.25 and 0.5 log10 TCID50/ml drop in virus yield in cultures treated with 0.8 and 0.08 µg/ml ELAH, respectively, compared to the untreated control cultures. These results suggest that pretreatment of MRC-5 cells with nontoxic concentrations of ELAH for 10 minutes reduced virus replication and a lack of cytopathic effects. TABLE:1 Test item Concentration of active (dilution) Recovery (Log 10 TCID 50 /ml) Reduction (Log 10 TCID 50 /ml) Negative (virus) control N/A 5.625 N/A ELAH 0.8 ug/mL 5.375 0.25 0.08 ug/mL 5.125 0.50 Table 1. The effect of pretreatment of MRC-5 cells by ELAH on the replication of human coronavirus 229E: Log recovery and reduction results for human coronavirus 229E following 10-minute pretreatment of MRC-5 cells (ATCC® CCL-171™) with ELAH at two concentrations followed by 2-hour incubation with virus compared to the negative control. Following incubation, the cell media was aspirated to remove unbound virus, and the cells were rinsed and incubated at 35°C for 4 days with culture media. N/A = Not Applicable. Viral titer determined by TCID 50 . Inhibition of cytopathic effect (CPE) by human coronavirus 229E in MRC-5 cells pretreated with ELAH. Briefly, MRC-5 cells grown in chamber cell culture slides were pretreated for 10 minutes with two concentrations (1 µg/ml and 10 µg/ml) of ELAH and infected for 2 hours with human coronavirus 229E as described in the Materials and Methods. Appropriate controls were also included. The cells treated with medium only (cell control) Figure 6A. or with 10 µg/ml of ELAH (ELAH control) Figure 6C. showed normal fibroblast morphology of MRC-5 cells in culture. Cells infected with 229E (virus control) showed marked CPE, as evident by rounding of infected cells and their lack of adherence to the surface of the chamber slide (Figure 6B). In contrast, MRC-5 cells pretreated with either 10 µg/ml (Figure 6D) or 1 µg/ml ELAH (Figure 6E) showed no significant CPE, as evident by the characteristic fibroblast cell morphology of the cell monolayers. These results suggest that pretreatment of MRC-5 cells with either 10 µg/ml or 1 µg/ml ELAH for 10 minutes prior to 2 hours of infection with 229E human coronavirus significantly inhibits replication and thus virus-induced cytopathic effects. Following bright field imaging, samples were fixed and processed for SEM imaging at the University of Wyoming per Methods and Materials. High-resolution SEM. Images of control coronavirus 229E samples demonstrated virus attached to the surface of MRC-5 cells (Figure 7a). When compared to MRC-5 cell only controls (Figure 7b.) or MRC-5 cells pretreated with 10 µg/ml ELAH (Figure 7c.) virus was significantly reduced from the surface. These data suggest that 10 minutes of pretreatment of MRC-5 cells with ELAH 10 µg/mL prior to human coronavirus 229E challenge reduces viral entry and the cytopathic effects caused by the virus after 48 hours of incubation compared to controls. Discussion The primary mode of entry for severe respiratory syndrome coronavirus 2 is through the nasal area. While vaccines have been developed, other means, especially in the early stage of infections, are vitally important to arrest or reduce the transmission of virus through nasal passage. Effective antiviral therapies, especially in the early stage of infections, are vitally important to halt viral proliferation long enough for the immune system to respond to the virus, limit cellular damage inflicted by viral invasion and minimize genetic mutations caused by the high replication frequency of the virus, which might lead to therapeutic resistance. COVID-19 infections have been reported worldwide. While effective treatments have been developed, the current emphasis is on using facial masks, applying hand sanitizers and social distancing, and masks alone cannot protect against transmission through aerosols and droplets. Therefore, effective antiseptics used in the nasopharynx or oral route are needed to reduce or prevent transmission. We used ethyl lauroly arginine hydrochloride monohydrate salt, hereafter referred to as ELAH, which is a special formulation for nasal application to prevent viral transmission. The antiviral and antivirucidal activities of arginine esters have been extensively studied by Yamasaki (Yamasaki, H. and others, 2011), and they concluded that the Cocoyl derivative of arginine inhibited virus growth of herpes virus (HSV-1) and poliovirus (PV-1) at 0.01% and identified its potential application as a therapeutic or preventative medicine against HSV superficial infections. We used lauric acid derivatives of arginine ester, which were not investigated by Yamasaki et al, since they are approved for use as food preservatives for meats and poultry. The main characteristic of this molecule is its unique surface activity. It has been shown that at very low concentrations, it reduced the surface free energy of protein-coated surfaces in oral and other mucosal surfaces from 25 dynes/cm to 15 dynes/cm. It has been shown that when the surface energy is reduced to 15 dynes/cm, no attachment of biofilms is observed on protein-coated mucosal surfaces, which prevents microbial films in vitro and in vivo ( Glantz, PO 1969). Human clinical studies have confirmed these effects (Giersten and others, 2007, Gallob and other, 2015). Since ELAH is completely broken down in humans to body ingredients, arginine and lauric acid (Hawkins and other, 2009), it is an ideal ingredient for topical nasal applications. We initially tested against SARS-CoV-2 and found that its effectiveness was as good as that of serum antibodies to the virus. Serum antibodies to the virus are known to block viruses from attaching to susceptible cell surfaces (Tandon, R and others, 2020). This would indicate that the effect of ELAH could be blocking the susceptible surfaces on the cells. The Syrian hamster model has been validated as a model replicating human SARS-CoV-2 infections. The study conducted by Shrivastava (Shrivastava 20121) showed the natural course of symptoms of viral COVID-19. The viral load increased from Days 1 to 7; however, after Day 7, it started to decrease. Additionally, COVID-19-infected patients normally show respiratory symptoms during the first 4-6 days after infection due to viral replication, inflammation and nasal mucosal damage and start stabilizing after 6 days. Our in vivo study in Syrian hamsters showed a similar pattern as determined by weight loss and clinical symptoms. Concomitants to clinical picture viral load as measured by genomic RNA and total RNA decreased in the treated group vs the control group. The exact mechanism by which ELAH exerts its blocking effects on SAR-CoV-2 in vitro and in vivo cannot be determined by these studies. However, it is clear that effects could be perturbations in the virus and surface interactions with host cells. Similarity of the inhibition of pseudovirus to the serum antibody would indicate blocking effects at the surfaces. Ohatake, S. (Ohatake. S and others, 2010) proposed several mechanisms of the effects of arginine (breakdown product of ELAH). Three mechanisms were elucidated: structural changes in the viral spike proteins, virus aggregation and pore formation in the virus envelope. The most likely mechanism by which arginine inactivates the virus is most likely due to suppression of protein interactions with other molecules or surfaces. More importantly, they concluded that the effects of arginine were due to its weak interactions. Our studies on the pretreatment of susceptible cell surfaces with noncytotoxic concentrations of ELAH and SEM analysis suggest that the blocking action against the virus can be explained by blocking or modifying the surface characteristics of the cell, resulting in the prevention of the virus from entering the cells. References Caldas, LA, Cameiro FA, Higa LM, Monteriro FL, Peixoto da silva, G, Decosta LJ, Durigon EL, Tanuri A, Desouza W.: Ultrastructural analysis of SARS-Cov-2 interactions with the host cell via high resolution electron microscopy: Nature scientific report (2020) 10:16099. Gallob, J.T, Lynch.M, Charles.C, Ricci-Nattel, Mordas.C Gambogi, R,Revankar.R., Mutti.B, Labella, R (2015) Clinical periodontology 42,740-747: A randomized trial of ethyl lauroyl alginate-containing mouthwash in the control of gingivitis. Gandhi, RT, Lynch, DelRio. C., (2020) Mild to moderate Covid-19. New England Journal of medicine.383(18):1757-66 Giersten, E, Guggenheim, B, Gemur, B (2007): Antiplaque effects of ethyl lauroyl arginase in situ: J. Dental research 86 (special issue) abstract 2299 Glantz, PO (1981) ‘Adhesion in oral cavity’. In Fundamentals and application of surface interactions in the oral cavity (ed SA Leach) pp49-64. Information retrieval Ltd. London. Hawkins, DR, Rocabeyera, X, Ruckman, S, Segret, R, Shaw, D (2009): Metabolism and pharmacokinetics of ethyl N(alpha)-L- lauroyl arginate hydrochloride in human volunteers: Food and chemical toxicology.47,2711-2715. Li et al. (2021): In vitro and In vivo functions of SARS-Cov-2 infection-enhancing and neutralizing antibodies, Cell184(16):4203-4219 Koopmans, M. (2020) Novel coronavirus outbreak. What we know and what we don’t. Cell: 180:1034-6 Ohtake, S. Arakawa,T and Koyama,A H(2010):Arginine as a synergistic virucidal agent. Macromolecules.15(3);1408-1424. Shrivastava Vijay M, Maneby N. Clinical efficacy of an osmotic antiviral and anti-inflammatory polymeric nasal film to treat Covid-19 Early phase respiratory Symptoms. Open access Journal of clinical trials.2021 May18:13:11-20. Tandon R. Mitra D, Sharma P, McCandlees MG, Stray SJ, Bates JT, Marshall GD: Effective screening of SARS-CoV-2 neutralizing antibodies in patient serum using lentivirus particles pseudo typed with SARS-CoV-2 spike glycoprotein. (2020) Nature Scientific report: 10:19076 Tostanoski LH, Wegman F, Martinot AJ, Loos C, McMahan K, Mercado NB, Yu J, Chan CN Bondoc S, Starke CE and thirty-three others(2020). Nature Medicine Letters. https://doi.org/10.1038/s41591-020-107 Whitt,MA(2010): Generation of VSV Pseudotypes Recombinant delta-G-VSV for studies of virus entry, identification of inhibitors, and immune responses to vaccines:J. Virol methods:169(2):365-74 Wofel,VM,Guggemos,W.,Scilmair,M,Zange,S.MullerMA,Neimeyer,D.JonesTC,VollarP., Rothe, C. (2020)” virological Assessment of Hospitalized Patients with Covid-2019”. Nature 581-(7809)465-69 Yamasaki, Tsujimoto K, Ikeda K, Suzuki Y, Arakawa T and Koyama AH (2011): Antiviral and Virucidal activities of N (alpha)-Cocoyl-L- Arginine ethyl ester: Advances in Virology: article ID 572868, pages 6. Declarations Conflict of interest : Dr. Thacore is a consultant in virology for Salvacion USA Inc. with no financial interest in the company; Drs. Gaffar and Yun are part of Salvacion USA Inc. which has interest in commercializing the spray; Drs. Chenine (IBT), Ferrari, Pal and Wattay (Bioqual) and Peterson (Perfectus) are independent contractors conducting the studies described in the communication. Author contributions : Drs. HT and AG wrote and edited the main manuscript text and supervised the experiments; Dr. SY developed the formulation. Drs. AC, MF, RP, LW and MP conducted respective studies. Additional Declarations Competing interest reported. Drs Abdul Gaffar and Yun have interest in commercializing nasal spray. Others author have no commercial interest and are independent contractors to conduct studies sponsored by Salvacion inc. Dr. Thacore is consultant for Salvacion Inc and has no commercial interrest Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-842564\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":52395548,\"identity\":\"a1ef4261-321b-4851-8d81-504b6882dff1\",\"order_by\":0,\"name\":\"Harshad R. Thacore\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"SUNY at Baffalo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Harshad\",\"middleName\":\"R.\",\"lastName\":\"Thacore\",\"suffix\":\"\"},{\"id\":52395549,\"identity\":\"7e516dc4-d7eb-4f76-88e2-831d0a77daae\",\"order_by\":1,\"name\":\"Abdul Gaffar\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIie2PvwrCMBCHT4S6FLrWpb5CgoP4NpFCnRzEpYNDJie1a50cfAF9gwsFswRcM4h/EDrrIk4idVGX1FEw33R33Mf9DsBi+VHOMUBQFPitUUkVQPNNqX6ndPhrUKJ4yeLIcbjrLuXkKG7xFlq1xBzQ1znluB70lkoS9FUO7XFWEktj63R2WG+WRoB0lAHRodloaHnheGfd+jwH7BTK/mRWyGZMuRgx5vkOoHheKXmfarfPxZTRxI1AcJW5RIXEqAQbueJ4ZQ2ntq5ebnEWECkO5jM+++xd83qBh+U7FovF8uc8AK5bUxIxYdHkAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Salvacion inc\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Abdul\",\"middleName\":\"\",\"lastName\":\"Gaffar\",\"suffix\":\"\"},{\"id\":52395550,\"identity\":\"68d7e591-8d4c-4e75-9851-993cd4a68373\",\"order_by\":2,\"name\":\"Seiyoung Yun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Daejeon Health Institute of Technology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seiyoung\",\"middleName\":\"\",\"lastName\":\"Yun\",\"suffix\":\"\"},{\"id\":52395551,\"identity\":\"2becf264-c011-45dc-8e5a-5132fe5a4e0b\",\"order_by\":3,\"name\":\"Agnes L. Chenine\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"IBT Bioservices\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Agnes\",\"middleName\":\"L.\",\"lastName\":\"Chenine\",\"suffix\":\"\"},{\"id\":52395552,\"identity\":\"5bfedbaf-8e1a-423f-97f3-78485b33e522\",\"order_by\":4,\"name\":\"Maria . G. Ferrari\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bioqual\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maria\",\"middleName\":\". G.\",\"lastName\":\"Ferrari\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-08-24 20:59:04\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-842564/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-842564/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":13829886,\"identity\":\"93b6a05f-2d89-41f1-b2ea-c4b5af2e7d23\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 14:57:15\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":17704,\"visible\":true,\"origin\":\"\",\"legend\":\" Inhibition of rVSV-SARS-2S replication in Vero cells by pretreatment with neutralizing antibody serum for 1 hour at 37°C.\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/9d073da1cb8dfa1f8c94f201.png\"},{\"id\":13829890,\"identity\":\"e41ce600-d504-4be7-8c37-005596343359\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 14:57:16\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":14763,\"visible\":true,\"origin\":\"\",\"legend\":\"Inhibitory effect of ELAH on the replication of rVSV-SARS-CoV-2S in Vero cells.\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/c064d3952954a6ec1adf4eb0.png\"},{\"id\":13830739,\"identity\":\"98c2e028-a3e0-46c1-bf07-f7952efb8245\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 15:03:16\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":37700,\"visible\":true,\"origin\":\"\",\"legend\":\"3A. Body weight changes observed in all animals throughout the course of the study. The body weights were measured daily post challenge until day 14. The data represent the mean percent change in body weight for each group from the starting body weight observed on day 0 post challenge. The error bars for the group means represent the standard error of the mean (SEM). 3B. Body weight changes were observed in all female animals throughout the course of the study, and body weights were measured daily post challenge until necropsy on day 4. The data represent the mean percent change in body weight for each group from the starting body weight observed on day 0 post challenge. The error bars for the group means represent the standard error of the mean (SEM). 3C. Body weight changes observed in all male animals throughout the course of the study. The body weights were measured daily post challenge until necropsy on day 4. The data represent the mean percent change in body weight for each group from the starting body weight observed on day 0 post challenge. The error bars for the group means represent the standard error of the mean (SEM).\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/43b19ab5c76d94b94823330f.png\"},{\"id\":13829887,\"identity\":\"306bacd5-f0bc-44c5-bb08-d06e2c884bc7\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 14:57:16\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":17104,\"visible\":true,\"origin\":\"\",\"legend\":\"Number of subgenomic RNA copies in control animals (Group 3) and animals treated with 50 µg/ml ELAH (Group 1) and 25 µg/ml ELAH (Group 2).\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/c0410247021e52209dd829ff.png\"},{\"id\":13829891,\"identity\":\"2f1dfacd-7bb2-4484-9c1e-30973e77554b\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 14:57:16\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":11512,\"visible\":true,\"origin\":\"\",\"legend\":\"Viral RNA load results are represented as geometric mean and geometric standard deviation.\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/58907e7f5e1eadbb35ef142a.png\"},{\"id\":13830542,\"identity\":\"723f7d7d-1929-44f7-aab1-756d55e23b83\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 15:00:16\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":415799,\"visible\":true,\"origin\":\"\",\"legend\":\"Inhibition of cytopathic effect by human coronavirus 229E in MRC-5 cells pretreated with ELAH: A. MRC-5 cells with medium only (cell control); B. MRC-5 cells infected with human coronavirus 229E; C. MRC-5 cells pretreated with 10 µg/ml ELAH for 10 minutes (ELAH control); D. MRC-5 cells pretreated with 10 µg/ml ELAH for 10 minutes prior to minutes prior to infection with 229E; EMRC-5 cells pretreated with 1 µg/ml EALH for 10 minutes prior to infection with 229E. Images obtained at x63 magnification.\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/87254f047b8da927f8720b6c.png\"},{\"id\":13830540,\"identity\":\"bf2d6ce6-c346-47e0-a1f5-e15b75bf5dba\",\"added_by\":\"auto\",\"created_at\":\"2021-09-21 15:00:16\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":376395,\"visible\":true,\"origin\":\"\",\"legend\":\"7a: Control. High-resolution SEM of MRC-5 cells after two hours of exposure to human coronavirus 229E (10E-3 dilution) and then rinsed to remove virus and 48 hours of incubation. Arrows showing viral particles on the cells, 5 µm magnification. 7b: Control. High-resolution SEM of MRC-5 cells only after 48 hours of incubation. Image 10 µm magnification. 7c: Control. High-resolution SEM of MRC-5 cells after 10 minutes of exposure to 10 µg/ml ELAH (nontoxic concentration) followed by unbound active ELAH removal and 2 hours of exposure to coronavirus 229E (10E-3 dilution) was performed. Then, the cells were rinsed to remove virus and incubated for 48 hours. Image 5 µm magnification.\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/f52e594d1876c793f8ae2346.png\"},{\"id\":13909797,\"identity\":\"8ed72f47-7f53-4448-b118-730897ff213d\",\"added_by\":\"auto\",\"created_at\":\"2021-09-23 13:57:18\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1150483,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-842564/v1/0e00d2ca-7836-459a-996c-168908812b78.pdf\"}],\"financialInterests\":\"Competing interest reported. Drs Abdul Gaffar and Yun have interest in commercializing nasal spray. Others author have no commercial interest and are independent contractors to conduct studies sponsored by Salvacion inc. Dr. Thacore is consultant for Salvacion Inc and has no commercial interrest\",\"formattedTitle\":\"The effects of ethyl lauroyl arginine hydrochloride (ELAH) in nasal spray formula on SARS-Cov-2\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eIn December 2019, a novel coronavirus (SARS-CoV-2) emerged in Wuhan, China,\\u0026nbsp;and in a matter of months,\\u0026nbsp;the virus rapidly spread throughout the world (Koopmans M. 2020). The World Health Organization (WHO) declared the outbreak a pandemic in March 2020 (Koopmans M. 2020). This highly contagious respiratory disease, coronavirus disease 2019 (COVID-19), caused by SARS-CoV-2 virus enters the host via the respiratory route and infects the lungs and other organs of the body (Gandhi RT, and others, 2020). Since the port of entry of the virus is via the nasopharynx, we present data with regard to the efficacy of our nasal spray product in preventing the virus from causing a severe disease.\\u003c/p\\u003e\\n\\u003cp\\u003eThe compound N-alpha-lauroyl-L-arginine ethyl ester monohydrochloride (LEAH or ELAH - FDA designation) is a derivative of lauric acid, arginine and ethanol. The main characteristic of this molecule is that it prevents the proliferation and colonization of microbial films in oral and nasal mucosal surfaces (Gallob, JT et al, 2015). ELAH is hydrolyzed in the human body by chemical and metabolic pathways, which break the molecule into\\u0026nbsp;natural\\u0026nbsp;compounds in the human diet (Hawkins, D.R., 2009t).\\u0026nbsp;The\\u0026nbsp;FDA has approved ELAH and classified it as a GRASE, generally recognized as safe and effective for use in meats and poultry as\\u0026nbsp;a\\u0026nbsp;food preservative (FDA 2005 GRAS notice. GRN 000164, no objection letter from FDA Sept 2005: The EFSA journal (20027)511;1-27).\\u003c/p\\u003e\\n\\u003cp\\u003eThe antiviral and virucidal activity of arginine surfactants, such as L-Cocoyl-L- arginine ethyl ester, against herpes simples, influenza A and polioviruses\\u0026nbsp;has been extensively studied by Hasashi Yamasaki et al.\\u0026nbsp;(Yamasaki, H et al, 2011). However, they did not study\\u0026nbsp;the\\u0026nbsp;lauric\\u0026nbsp;acid\\u0026nbsp;ester of arginine in their studies.\\u003c/p\\u003e\\n\\u003cp\\u003eIn this report, we present the results of \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo\\u003c/em\\u003e studies on SARS-CoV-2 virus. The effect of ELAH applied through a specific formulation for nasal delivery to arrest, block or prevent the colonization of the virus in the nasopharyngeal area and indicate that ELAH, due to its excellent safety profile, could be a useful agent for augmenting preventative measures for SARS-CoV-2 on mucosal and nasopharynx surfaces.\\u003c/p\\u003e\"},{\"header\":\"Experimental Section\",\"content\":\"\\u003cp\\u003e\\u003cu\\u003eRecombinant VSV: rVSV-dG SARS-CoV-2 S\\u003c/u\\u003e: The recombinant vesicular stomatitis virus (rVSV) whose glycoprotein gene (G) has been deleted is used as the base platform for IBT Bioservices\\u0026rsquo;s pseudo type-based neutralization assay (Whitt 2010). The VSV-G glycoprotein is transiently expressed by transfection to produce virus particles. To create a\\u0026nbsp;pseudotype\\u0026nbsp;virus, VSV-G is substituted with\\u0026nbsp;the\\u0026nbsp;SARS-CoV-2\\u0026nbsp;spike\\u0026nbsp;protein lacking the last\\u0026nbsp;eighteen\\u0026nbsp;amino acids of the cytoplasmic domain. The resulting virus,\\u0026nbsp;rVSV-\\u0026Delta;G SARS-CoV-2 S,\\u0026nbsp; also expresses firefly luciferase and can be handled at\\u0026nbsp;biosafety level\\u0026nbsp;2 (BSL-2). Infection efficiency was measured by quantification of luciferase activity reading the relative light units (RLU). Briefly, rVSV-\\u0026Delta;G SARS-CoV-2 S\\u0026nbsp;was preincubated\\u0026nbsp;with and without ELAH \\u0026nbsp;along with SARS-CoV-2 seropositive rat sample (IBT Bioservices)used as internal assay control. Rats serum was obtained after immunizing rats in house with SAR-CoV-2 spike protein and added to Vero cells .. After 24-hours infection, firefly luciferase activity wasmeasured and the 50% inhibitory dose (ID\\u003csub\\u003e50\\u003c/sub\\u003e) \\u0026nbsp;defined as the reciprocal of the serologic reagent dilution that caused a 50% reduction in RLUs compared to virus control wells was determined.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eFormula for nasal spray\\u003c/u\\u003e: The formula contains 0.1% ELAH, glycerin, xylitol (moisturizing agents), 1,2-hexanediol, polyvinyl pyrrolidone, PEG-40 hydrogenated castor oil, phenoxyethanol and cupric gluconate as preservatives, citric acid for buffer and deionized distilled water (COVIXYL-V).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eNeutralization Assay\\u003c/u\\u003e: Vero cells were seeded at 60,000 cells/well in 96-well flat bottom black cell culture plates in Dulbecco\\u0026rsquo;s modified Eagle medium (DMEM) containing 10% serum and incubated overnight. Four dilutions of ELAH were prepared in 1% serum medium at two times (2X) the final intended concentration.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eVirus dilution and ELAH/virus mix\\u0026nbsp;\\u003c/u\\u003e\\u003cu\\u003epreincubation\\u003c/u\\u003e: rVSV-SARS-CoV-2 S was diluted 1:10 in 1% serum medium to obtain a final dilution of 1:20 in 2.5 ml\\u0026nbsp;and\\u0026nbsp;175 \\u0026micro;l\\u0026nbsp;of virus inoculum was then mixed to\\u0026nbsp;175 \\u0026micro;l\\u0026nbsp;of each ELAH concentrations for\\u0026nbsp;350 \\u0026micro;l\\u0026nbsp;final;\\u0026nbsp;350 \\u0026micro;l\\u0026nbsp;of virus only was also prepared. All mixtures were incubated for 1\\u0026nbsp;hour at 37\\u0026deg;C and 5% CO2.\\u0026nbsp;All the medium was removed from the 96-well black plates,\\u0026nbsp;and\\u0026nbsp;100 \\u0026micro;l\\u0026nbsp;of each virus/TA (testing article)\\u0026nbsp;mixture was\\u0026nbsp;added in triplicate to the Vero cells.\\u0026nbsp;One hundred microliters\\u0026nbsp;of virus only and\\u0026nbsp;100 \\u0026micro;l\\u0026nbsp;of 1% serum medium were also added\\u0026nbsp;to\\u0026nbsp;a minimum of 6 wells and incubated for 24\\u0026nbsp;hours at 37\\u0026deg;C and 5% CO2.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eFirefly luciferase readout\\u003c/u\\u003e:\\u0026nbsp;100 \\u0026micro;l\\u0026nbsp;of Bright-Glo reagent was added to each well as instructed by the manufacturer. Plates were read immediately in our luminometer, and the relative light unit (RLU) was measured.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eAnimal Model Studies\\u003c/u\\u003e: The Syrian\\u0026nbsp;golden\\u0026nbsp;hamster was chosen as the animal model for this study based on in-house data and recent publications indicating that SARS-CoV-2 productively replicates in this model and\\u0026nbsp;that\\u0026nbsp;aspects of COVID-19 are recapitulated (Tostanoski, L, H,2020 and others). A total of 21 male and female Golden Syrian hamsters (6-8 weeks old, approximately 100 g of weight) were purchased from Envigo (Indianapolis, IN, barrier 202C). The animals were received in good condition.\\u0026nbsp;Animal\\u0026nbsp;acclimation and husbandry followed the procedures and practices outlined in the IACUC\\u0026nbsp;Study Protocol.\\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe animal study was conducted in BIOQUAL\\u0026rsquo;s animal facility, BIOQUAL\\u0026rsquo;s facilities are OLAW assured (A-3086-01), USDA registered (51R 036), and have Full AAALAC Accreditation (File no. 624). Additionally, BIOQUAL has CDC/USDA approval for working with restricted BSL-2 and BSL-3 Select Agents and has approved ABSL/BSL-3 facilities and training for working with infectious agents under containment. Housing and handling of the animals were performed in accordance with the animal welfare requirements and accreditations stated above.\\u0026nbsp;Based on the final study plan, BIOQUAL prepared, submitted, and received approval for the IACUC protocol. BIOQUAL Study Directors of both Animal/Veterinary Services and Laboratory Services reviewed the IACUC protocol submission to ensure that all scheduled procedures were consistent with the approved final study plan. This nonclinical study was performed under\\u0026nbsp;the BIOQUAL Institutional Animal Care and Use Committee approved Protocol (IACUC Protocol Number: 20-153P) and was conducted in accordance with the Study Protocol and BIOQUAL Standard Operating Procedures (SOPs).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eExperimental design and grouping:\\u003c/u\\u003e A study design was prepared in collaboration with BIOQUAL and Merck research scientists and finalized in a study protocol prior\\u0026nbsp;to\\u0026nbsp;the start of the study.\\u0026nbsp;In Study 1, retention of ELAH after\\u0026nbsp;a\\u0026nbsp;single administration followed by mock challenge was examined over time,\\u0026nbsp;while in Study 2,\\u0026nbsp;hamsters\\u0026nbsp;challenged with virus treated in vitro either with medium or with ELAH were evaluated for infection and clinical outcome.\\u003c/p\\u003e\\n\\u003cp\\u003eStudy 1 was conducted with a total of six animals divided equally into three groups.\\u0026nbsp;ELAH (50\\u0026nbsp;\\u0026micro;l\\u0026nbsp;per nare) was administered into each nare of the animals.\\u0026nbsp;Each animal then received 50\\u0026nbsp;\\u0026micro;l\\u0026nbsp;of DMEM containing 2% FBS per nostril after 10 min for Group 1, 15 min for Group 2 and 20 min for Group 3 to mimic mock infection.\\u0026nbsp;Leakage of solution was monitored for 10 min after each mock infection.\\u003c/p\\u003e\\n\\u003cp\\u003eFor Study 2, a total of 15 animals divided equally into three groups were used.\\u0026nbsp;Group 1 animals were challenged with virus treated \\u003cem\\u003ein vitro\\u003c/em\\u003e with undiluted ELAH; Group 2 animals were challenged with virus treated \\u003cem\\u003ein vitro\\u003c/em\\u003e with diluted ELAH (dose diluted 1:1 in sterile PBS),\\u0026nbsp;and Group 3 animals were challenged with virus treated in vitro with medium alone.\\u0026nbsp;Each treatment was performed at 37\\u0026deg;C in 5% CO2 for 10 min. Daily weights and BID observations during challenge\\u0026nbsp;periods\\u0026nbsp;SD 1, 2, 3, 4, 5, 6, 7, 10 and 14.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003ePreparation and Administration Procedures\\u003c/u\\u003e: For Study 1, ELAH-COVIXYL-V solution was applied directly followed by DMEM containing 2% FBS. For Study 2, a vial of SARS-CoV-2 virus was thawed, and the virus was divided into groups:\\u003c/p\\u003e\\n\\u003cp\\u003eGroup 1: Virus stock (0.2 ml) was diluted to 1.8 ml with medium by adding 1.6 ml of medium and 0.2 ml of ELAH-COVIXYL-V and incubated at 37\\u0026deg;C in\\u0026nbsp;a\\u0026nbsp;5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare).\\u003c/p\\u003e\\n\\u003cp\\u003eGroup 2: ELAH-COVIXYL-V (0.5 ml) was diluted to 1 ml with 0.5 ml of sterile PBS. Virus stock (0.2 ml) was diluted to 1.8 ml with medium by adding 1.6 ml of medium and 0.2 ml of diluted ELAH-COVIXYL-V (1:1) and incubated at 37\\u0026deg;C in\\u0026nbsp;a\\u0026nbsp;5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare).\\u003c/p\\u003e\\n\\u003cp\\u003eGroup 3 (Control): Virus stock (0.2 ml) was diluted to 2 ml by adding 1.8 ml of medium and incubated at 37\\u0026deg;C in\\u0026nbsp;a\\u0026nbsp;5% CO2 incubator for 10 min. Each animal was challenged nasally with 0.1 ml of virus (0.05 ml per nare).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eChallenge of hamsters with SARS-CoV-2:\\u0026nbsp;\\u003c/u\\u003eELAH-\\u0026nbsp;or medium-treated SARS-CoV-2 was administered intranasally (IN)\\u0026nbsp;to\\u0026nbsp;anesthetized hamsters and performed in a BSL-3 laboratory. The administration of virus was conducted as follows: Using a calibrated pipettor, 0.05 mL of the viral inoculum was administered dropwise into each nostril, 0.1 ml per animal while the animal\\u0026apos;s head was tilted back so that the nostrils were pointing\\u0026nbsp;toward\\u0026nbsp;the ceiling. syringe into the first nostril and slowly the inoculum into the nasal passage, and then removed. This was repeated for the second nostril. The animal\\u0026rsquo;s head was tilted back for\\u0026nbsp;approximately\\u0026nbsp;20 seconds and then returned to its housing unit and monitored until fully recovered. Body weights were measured once daily during the challenge phase. The animals were monitored twice daily during\\u0026nbsp;the\\u0026nbsp;morning and afternoon for signs of COVID-19 disease (ruffled fur, hunched posture, labored breathing) during the study period, starting on\\u0026nbsp;the\\u0026nbsp;day of SARS-CoV-2 challenge,\\u0026nbsp;and the information was recorded on BIOQUAL clinical observation forms and/or the Pristima\\u0026reg; database. The raw data for the body weights and the clinical observations were made and recorded.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eSpecimen collection\\u003c/u\\u003e: Only oral swabs were collected\\u0026nbsp;on study days 1, 2, 3, 4, 5, 6, 7, 10 and 14\\u0026nbsp;post challenge as per\\u0026nbsp;the\\u0026nbsp;study protocol. Scheduled euthanasia and necropsies were carried out for each\\u0026nbsp;nare.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eSpecimen Processing for viral RNA and viral\\u0026nbsp;\\u003c/u\\u003e\\u003cu\\u003esubgenomic\\u003c/u\\u003e\\u003cu\\u003e\\u0026nbsp;RNA assays\\u003c/u\\u003e: For viral load assays of oral swabs,\\u0026nbsp;the samples were processed. Upon collection,\\u0026nbsp;the swabs were placed into\\u0026nbsp;1\\u0026nbsp;ml\\u0026nbsp;of PBS and then snap-frozen. Samples were then thawed, and an aliquot of the sample was used for RNA isolation following the\\u0026nbsp;manufacturer\\u0026rsquo;s\\u0026nbsp;instructions (Qiagen, Cat. No. 57704).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eViral RNA quantitation\\u003c/u\\u003e: The qRT-PCR assay was used for quantitation of viral RNA from the oral swabs using the primers and a probe specifically designed to amplify and bind to a conserved region of Nucleocapsid gene of Coronavirus (Forward primer: 5\\u0026rsquo;-GAC CCC AAA ATC AGC GAA AT-3\\u0026rsquo;; Reverse Primer: 5\\u0026rsquo;-TCT GGT TAC TGC CAG TTG AAT CTG-3\\u0026rsquo; and Probe: 5\\u0026rsquo;-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3\\u0026rsquo;) as described elsewhere (Baum et al. REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters. science.sciencemag.org/cgi/content/full/science. abe2402/DC1).\\u0026nbsp;The signal was compared to a known standard curve and calculated to give copies per mL. For the qRT-PCR assay, viral RNA was first isolated from oral\\u0026nbsp;swabs\\u0026nbsp;using the Qiagen Min Elute virus spin kit (cat. no. 57704). To generate a control for the amplification reaction, RNA was isolated from the applicable\\u0026nbsp;COVID\\u0026nbsp;virus stock using the same procedure. The amount of RNA was determined from an O.D. reading at 260, using the estimate that 1.0 OD at A260 equals 40 \\u0026micro;g/mL of RNA. With the number of bases known and the average base of RNA weighing 340.5 g/mole, the number of copies\\u0026nbsp;was\\u0026nbsp;then calculated, and the control\\u0026nbsp;was\\u0026nbsp;diluted accordingly. A final dilution of 10\\u003csup\\u003e8\\u003c/sup\\u003e copies per 3 \\u0026micro;L was then divided into single use aliquots of 10 \\u0026micro;L and stored at -80\\u0026deg;C.\\u0026nbsp;For the master mix preparation, 2.5 mL of 2X buffer containing Taq-polymerase, obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), was added to a 15 mL tube. From the kit, 50 \\u0026micro;L of RT and 100 \\u0026micro;L of RNAse inhibitor\\u0026nbsp;were\\u0026nbsp;also added. The primer pair at\\u0026nbsp;a\\u0026nbsp;2 \\u0026micro;M concentration was then added in a volume of 1.5 mL.\\u0026nbsp;Finally, 0.5 mL of water and 350 \\u0026micro;L of the probe at a concentration of 2 \\u0026micro;M were added,\\u0026nbsp;and the tube\\u0026nbsp;was\\u0026nbsp;vortexed. For the reactions, 45 \\u0026micro;L of the master mix and 5 \\u0026micro;L of the sample RNA were added to the wells of a 96-well plate. All samples are tested in triplicate. The plates were sealed with a plastic sheet. For control curve preparation, samples of the control RNA were prepared to contain 10\\u003csup\\u003e6\\u003c/sup\\u003e to 10\\u003csup\\u003e7\\u003c/sup\\u003e copies per 3 \\u0026micro;L. Eight (8) 10-fold serial dilutions of control RNA were prepared using RNAse-free water by adding 5 \\u0026micro;L of the control to 45 \\u0026micro;L of water and repeating this for 7 dilutions. This generated a standard curve with a range of 1 to 10\\u003csup\\u003e7\\u003c/sup\\u003e copies/reaction. For amplification, the plate\\u0026nbsp;was\\u0026nbsp;placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program:\\u0026nbsp;48\\u0026deg;C\\u0026nbsp;for 30 minutes,\\u0026nbsp;95\\u0026deg;C\\u0026nbsp;for 10 minutes followed by 40 cycles of\\u0026nbsp;95\\u0026deg;C\\u0026nbsp;for 15 seconds, and 1 minute at\\u0026nbsp;55\\u0026deg;C. The number of copies of RNA per mL\\u0026nbsp;was\\u0026nbsp;calculated by extrapolation from the standard curve and multiplying by the reciprocal of 0.2 mL extraction volume.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eSubgenomic\\u003c/u\\u003e\\u003cu\\u003e\\u0026nbsp;RNA quantitation\\u003c/u\\u003e\\u003cstrong\\u003e:\\u003c/strong\\u003e The method\\u0026nbsp;used for quantitation of subgenomic mRNA measured by\\u0026nbsp;an\\u0026nbsp;RT-qPCR assay was similar to what was described elsewhere (W\\u0026ouml;lfel R., Corman V.M., and others (2020)).\\u003c/p\\u003e\\n\\u003cp\\u003eThe primers and probe selected from the N gene (Forward:\\u003c/p\\u003e\\n\\u003cp\\u003e5\\u0026rsquo;-CGATCTCTTGTAGATCTGTTCTC-3\\u0026rsquo;;\\u0026nbsp;reverse: SG-N-R: 5\\u0026rsquo;-GGTGAACCAAGACGCAGTAT-3\\u0026rsquo; and\\u0026nbsp;probe: 5\\u0026rsquo;-FAM- TAACCAGAATGGAGAACGCAGTGGG -BHQ-3\\u0026rsquo;) were similar to what was previously described (Li et al. 2021). The PCR signal obtained with the sample was compared to a known standard curve of plasmid containing the sequence of part of the messenger RNA and calculated to give copies per ml.\\u0026nbsp;To generate a control for the amplification reaction, a plasmid containing a portion of the N gene messenger RNA was used.\\u0026nbsp;A final dilution of 106 copies per 3 \\u0026micro;l was then divided into single use aliquots of 10 \\u0026micro;l and stored at -80\\u0026deg;C\\u0026nbsp;until needed. The samples extracted for\\u0026nbsp;viral\\u0026nbsp;RNA were then amplified in duplicate to pick up sgRNA. Seven (7) 10-fold serial dilutions of control RNA\\u0026nbsp;were\\u0026nbsp;prepared by adding 5 \\u0026micro;l of the control to 45 \\u0026micro;l of water and repeating this for 7 dilutions,\\u0026nbsp;leading to the generation of a standard curve with a range of 1 to 10\\u003csup\\u003e6\\u003c/sup\\u003e copies/reaction. For amplification, the plate\\u0026nbsp;was\\u0026nbsp;placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program:\\u0026nbsp;48\\u0026deg;C\\u0026nbsp;for 30 minutes,\\u0026nbsp;95\\u0026deg;C\\u0026nbsp;for 10 minutes followed by 40 cycles of\\u0026nbsp;95\\u0026deg;C\\u0026nbsp;for 15 seconds, and 1 minute at\\u0026nbsp;55\\u0026deg;C. A printout of the results is maintained in the laboratory notebook. The number of copies of RNA per ml was calculated by extrapolation from the standard curve and\\u0026nbsp;multiplying 0.2 mL\\u0026nbsp;of extracted volume.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eThe effect of\\u0026nbsp;\\u003c/u\\u003e\\u003cu\\u003epretreatment\\u003c/u\\u003e\\u003cu\\u003e\\u0026nbsp;of MRC-5 cells\\u0026nbsp;\\u003c/u\\u003e\\u003cu\\u003ewith\\u003c/u\\u003e\\u003cu\\u003e\\u0026nbsp;ELAH on the replication of human coronavirus 229E\\u003c/u\\u003e:\\u0026nbsp;A human lung fibroblast MRC-5 (ATCC\\u0026reg; CCL-171\\u0026trade;) cell line grown in Eagle\\u0026rsquo;s Minimum Essential Medium (EMEM) containing 2% fetal bovine serum and human coronavirus 229E (ATCC\\u0026reg; VR-740\\u0026trade;)\\u0026nbsp;was\\u0026nbsp;used in these experiments.\\u003c/p\\u003e\\n\\u003cp\\u003ePreliminary experiments were conducted to determine the cytotoxicity of ELAH on MRC-5 cell cultures. Serial 10-fold dilutions of ELAH starting with a stock solution containing 0.08% or 800\\u0026nbsp;\\u0026micro;g/ml\\u0026nbsp;ELAH or cell medium only as\\u0026nbsp;a\\u0026nbsp;control were added to MRC-5 cell cultures and incubated for 6 days. Cytotoxicity screening using bright field imaging was conducted to determine the lowest\\u0026nbsp;noncytotoxic\\u0026nbsp;concentration of ELAH\\u0026nbsp;in\\u0026nbsp;MRC-5 cell cultures under these experimental conditions.\\u003c/p\\u003e\\n\\u003cp\\u003eTo\\u0026nbsp;assess\\u0026nbsp;the replication of human coronavirus 229E in MRC-5 cells\\u0026nbsp;pretreated\\u0026nbsp;with ELAH, the following experiment was conducted.\\u0026nbsp;Noncytotoxic\\u0026nbsp;concentrations of ELAH were added to MRC-5 cell cultures at 37\\u0026deg;C for 10 minutes. The culture medium containing unbound ELAH was removed from treated cell cultures,\\u0026nbsp;and human coronavirus 229E was added to the cells and incubated at 35\\u0026deg;C for an additional 2 h for the virus to adsorb to the cells. The virus inoculum was removed, and the cultures\\u0026nbsp;were\\u0026nbsp;washed with medium and\\u0026nbsp;reincubated\\u0026nbsp;for 4 days at 35\\u0026deg;C. Appropriate controls, medium alone, were also included in the experiment. Virus yield from cultures pretreated with ELAH and control\\u0026nbsp;nontreated\\u0026nbsp;cells\\u0026nbsp;was\\u0026nbsp;assayed for virus yield by TCID\\u003csub\\u003e50\\u003c/sub\\u003e, and virus-induced cytopathic effect (CPE) was determined by bright field imaging using\\u0026nbsp;an\\u0026nbsp;Olympus BX63 microscope and Olympus cellsSens Dimension software of the ELAH-treated and control MRC-5 cell cultures.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eInhibition of cytopathic effect by human coronavirus 229E in MRC-5 cells\\u0026nbsp;\\u003c/u\\u003e\\u003cu\\u003epretreated\\u003c/u\\u003e\\u003cu\\u003e\\u0026nbsp;with ELAH as assessed by bright field microscopy\\u003c/u\\u003e: MRC-5 cells were seeded at\\u0026nbsp;1x105\\u0026nbsp;cells/ml in 4-chamber cell culture slides and incubated at 37\\u0026deg;C for 4 days until\\u0026nbsp;approximately\\u0026nbsp;85-90% confluency was obtained. Two concentrations of ELAH, 1\\u0026nbsp;\\u0026micro;g/ml\\u0026nbsp;and 10\\u0026nbsp;\\u0026micro;g/ml,\\u0026nbsp;in DMEM were added to the cells and incubated for 10 minutes at 37\\u0026deg;C. Cell cultures treated with medium only were used as controls. ELAH was then removed from the cell cultures and infected with\\u0026nbsp;a\\u0026nbsp;10^3 dilution of stock human coronavirus 229E (log\\u003csub\\u003e10\\u003c/sub\\u003eTCID\\u003csub\\u003e50\\u003c/sub\\u003e/ml 5.625), and cultures were reincubated at 35\\u0026deg;C for 2 hours. Similarly, cells not treated with ELAH were also infected with 229E. After a 2-hour adsorption period, the unadsorbed virus was removed, and the cells were washed, refed with medium and incubated for 48 hours at 35\\u0026deg;C. Control cultures were treated in a similar manner. After 48 hours, chamber cell cultures were imaged via bright field microscopy at a magnification of X63. Samples for scanning electron microscopy were fixed with 1 ml glutaraldehyde for 2 hours and processed according to Caldas et al. (2020). SEM imaging was conducted at the University of Wyoming\\u0026rsquo;s Materials Characterization Laboratory. After samples underwent fixation, they were placed in a Kinney Vacuum KSE-2A-M Evaporator under 10^-4 Torr vacuum for 24 hours and then sputtered with a 5 nm thick gold coat using a Model 30000 Ladd Research Industries apparatus. Secondary electron and backscattered electron images were collected on a Quanta 250 scanning electron microscope under 10^-5 Torr vacuum using an accelerating voltage of 5 kV and spot sizes of 2 and 3. Electronic alignments on the electron gun (Gun Alignment, Final Lens Aperture Alignment, and Stigmator Alignment) were performed prior to imaging to optimize resolution.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of ELAH on the replication of rVSV-dG SARS-Covid-2S in Vero cells:\\u003c/strong\\u003e A recombinant vesicular stomatitis virus (VSV) was used in which the glycoprotein gene (G) was deleted and substituted with full-length SARS-Covid-19 spike protein and a firefly\\u0026nbsp;luciferase\\u0026nbsp;as described in the Materials and Methods. This construct was able to infect, replicate and cause cytopathic\\u0026nbsp;effects\\u0026nbsp;in Vero cells as well as express firefly luciferase. The infection efficacy in Vero cells was measured by quantification of the luciferase activity reading the relative light units (RLU) on a luminometer. This construct was used to study the interaction of ELAH and the spike protein of SARS-Covid-19.\\u003c/p\\u003e\\n\\u003cp\\u003eBriefly, rVSV-dG SARS-Covid-2S was incubated with and without ELAH as well as with 2019 SARS-Covid-2 neutralizing antibody serum as a control for 1 hr at 37\\u0026deg;C. Vero cells grown in 96-well flat bottom cell culture plates were infected in triplicate with virus incubated with or without ELAH as well as antiserum-treated virus and incubated for 24 hrs at 37\\u0026deg;C. A minimum of six Vero cell cultures were infected with virus only, and six wells of uninfected cell cultures were used as controls. Firefly luciferase activity was then measured in all wells, and inactivation and neutralization titers were calculated by the RLU values. Neutralization titers (50% inhibitory dose, ID50) were defined as the reciprocal of the dilution that caused a 50% reduction in RLUs compared to virus control wells. The neutralization of rVSV-SARS-CoV-2 S by the 2019 anti-SARS-CoV-2 antiserum is presented in Figure 1. The results show that the antibodies bind to the spike protein in the construct and prevent its binding to Vero cell receptors, thus inhibiting replication. The results presented in Figure 2 show the inhibitory effect of ELAH on the replication of rVSV-SARS-CoV-2 S. Maximum inhibition of the replication of the virus, over 90%, was obtained at a concentration of 110 \\u0026micro;g/ml ELAH (Figure 2). These results suggest that ELAH either binds to or alters the spike protein of the rVSV-SARS-CoV-2 S construct, thus preventing attachment to the receptor, entry and replication in Vero cells.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEfficacy of ELAH as a nasal spray in preventing severe disease in Syrian Golden hamsters:\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eStudies have shown that Syrian Golden hamsters are a useful animal model for studying the pathogenesis of SARS-CoV-2 (ref). SARS-COV-2\\u0026nbsp;is\\u0026nbsp;a respiratory virus,\\u0026nbsp;and the nasal cavity is the main route of infection.\\u0026nbsp;A\\u0026nbsp;nasal spray is a possible route for\\u0026nbsp;the\\u0026nbsp;delivery of therapeutics as a preventive measure (ref).\\u0026nbsp;The following experiments were conducted in Syrian Golden hamsters to evaluate the efficacy of ELAH as a nasal spray in preventing clinical symptoms of SARS-CoV-2 infection.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eRetention of nasally administered ELAH in Syrian Golden hamsters (Study 1):\\u0026nbsp;\\u003c/strong\\u003ePreliminary experiments were conducted to determine the retention of ELAH when administered nasally without side effects. As described in the\\u0026nbsp;Materials\\u0026nbsp;and Methods, 50\\u0026nbsp;\\u0026micro;l\\u0026nbsp;of ELAH was administered\\u0026nbsp;to\\u0026nbsp;each nare of a group of hamsters,\\u0026nbsp;and after 10, 15 and 20 minutes, 50 \\u0026micro;l\\u0026nbsp;of medium containing 2% fetal bovine serum was administered\\u0026nbsp;to\\u0026nbsp;each nare of hamsters to mimic mock infection. No leakage of either ELAH medium was observed in experimental animals 10 minutes after mock infection. While some moisture around the nose is normal for this procedure, the amount of moisture could not be quantified.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePretreatment\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;of SARS-CoV-2 with ELAH inhibited the ability of the virus to synthesize viral sgRNA\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;and\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;viral RNA and induce clinical symptoms in hamsters.\\u0026nbsp;\\u003c/strong\\u003eIt has been well documented that\\u0026nbsp;upon\\u0026nbsp;infection of hamsters with SARS-CoV-2 via the nasal route, one of the clinical symptoms observed is severe weight loss during the first few days of infection followed by recovery to normal weight (Tostanoski, L, H,2020).\\u0026nbsp;Weight\\u0026nbsp;loss has been\\u0026nbsp;associated\\u0026nbsp;with the presence of virus in the respiratory tract (Tostanoski, LH,2020).\\u003c/p\\u003e\\n\\u003cp\\u003eAs described in the Materials and Methods, the animals were divided into groups. A constant amount of SARS-CoV-2 was incubated with two different concentrations of ELAH for 10 minutes at 37\\u0026deg;C. As controls, the virus was incubated with medium under similar experimental conditions. Each of the groups of animals was challenged with 0.1 ml of treated or control mixtures (0.05 ml/nare). The body weights of each hamster were measured once daily, and the animals were also monitored twice daily for signs of COVID-19 disease as described in the Materials and Methods. The body weight changes observed in all animals during the course of 14 days are shown in Figure 3A. The results show that the animals infected with SARS-CoV-2 alone had a significant loss of weight during the first six days after challenge. These animals regained their original weight during the next eight days, as has been reported elsewhere (Tostanoski, L H,2020). In contrast, viruses treated with ELAH showed no significant weight loss during the 14-day course of the study. Similar results were also obtained with all females (Figure 3B) and male animals (Figure 3C). These results indicate that the treatment of SARS-CoV-2 with ELAH under these experimental conditions significantly inhibits the ability of the virus to induce weight loss, a major indicator of clinical disease.\\u003c/p\\u003e\\n\\u003cp\\u003eAll three groups of animals were also tested for the number copies of subgenomic RNA (sgRNA) and region of the E gene messenger RNA from the coronavirus. The swabs were taken on days 1, 2, 3, 4, and 7 as described in the Materials and Methods. The results presented in Figure 4 show that in control group 3, all animals demonstrated significant copies of sgRNA except for both animals on day 4. In contrast, virus treated with undiluted ELAH (Group 1) prior to infection showed no detectable (\\u0026lt;50 copies) copies of sg-RNA, except for one animal on day 1. In group 2, animals treated with 1:1 diluted ELAH, 4 out of 5 animals on day 4 were positive for the sgRNA, whereas three animals out four showed no detectable sgRNA on day 7. These results suggest that animals treated with ELAH significantly inhibit the synthesis of viral sgRNA synthesis, thus inhibiting the synthesis of progeny virions in ELAH-treated animals.\\u003c/p\\u003e\\n\\u003cp\\u003eThe presence of viral load in the three groups of animals as determined by the number of VRNA copies/swab is shown in Figure 5. In control group 3, all animals except for one animal had an average of 9.4 copies of viral RNA/swab. In contrast, in the animals infected with a mixture of virus and a high concentration of ELAH for 10 minutes at 37\\u0026deg;C prior to infection, 4 animals had nondetectable viral RNA copies/swabs, and 4 animals had fewer viral RNA copies/swabs than the average found in control animals. In group 2 animals treated with half the concentration of ELAH compared to group 1, no detectable viral load was found in 3 animals, and 2 animals had viral load below the average in the control animals. Four animals in this group had viral loads higher than the average. These results suggest that pretreatment of SARS-CoV-2 with ELAH prior to infection of these animals significantly reduced not only the presence of viral sgRNA but also the viral load.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003epretreatment\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;of MRC-5 cells\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003ewith\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;ELAH on the replication of human coronavirus 229E.\\u0026nbsp;\\u003c/strong\\u003eMRC-5 cell cultures were pretreated with noncytotoxic concentrations of ELAH (0.8 and 0.08 \\u0026micro;g/ml) or with medium alone (control) for 10 minutes and infected with coronavirus 229E as described in the Materials and Methods. The results presented in Table 1 show a 0.25 and 0.5 log10 TCID50/ml drop in virus yield in cultures treated with 0.8 and 0.08 \\u0026micro;g/ml ELAH, respectively, compared to the untreated control cultures. These results suggest that pretreatment of MRC-5 cells with nontoxic concentrations of ELAH for 10 minutes reduced virus replication and a lack of cytopathic effects.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eTABLE:1\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable style=\\\"width:459.0pt;margin-left:4.5pt;border-collapse:collapse;border:none;\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width:117.0pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eTest item\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:121.5pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eConcentration\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eof active (dilution)\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:1.5in;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eRecovery\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e(Log\\u003csub\\u003e10\\u003c/sub\\u003eTCID\\u003csub\\u003e50\\u003c/sub\\u003e/ml)\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:112.5pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eReduction\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e(Log\\u003csub\\u003e10\\u003c/sub\\u003eTCID\\u003csub\\u003e50\\u003c/sub\\u003e/ml)\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width:117.0pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eNegative (virus) control\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:121.5pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eN/A\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:1.5in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e5.625\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:112.5pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eN/A\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width:117.0pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:26.5pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003eELAH\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:121.5pt;border:none;padding:0in 5.4pt 0in 5.4pt;height:26.5pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e0.8 ug/mL\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:1.5in;border:none;padding:0in 5.4pt 0in 5.4pt;height:26.5pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e5.375\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:112.5pt;border:none;padding:0in 5.4pt 0in 5.4pt;height:26.5pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e0.25\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width:121.5pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:27.0pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e0.08 ug/mL\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:1.5in;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:27.0pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e5.125\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width:112.5pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;height:27.0pt;\\\"\\u003e\\n \\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;text-align:center;'\\u003e\\u003cspan style=\\\"font-size:19px;\\\"\\u003e0.50\\u003c/span\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp style='margin:0in;font-size:16px;font-family:\\\"Calibri\\\",sans-serif;color:black;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:15px;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp style='margin-top:0in;margin-right:0in;margin-bottom:8.0pt;margin-left:0in;line-height:107%;font-size:15px;font-family:\\\"Calibri\\\",sans-serif;'\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003eTable 1.\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003eThe effect of\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003epretreatment\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003e\\u0026nbsp;of MRC-5 cells by ELAH on the replication of human coronavirus 229E:\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003eLog recovery and reduction results for human coronavirus 229E following 10-minute\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003epretreatment\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003e\\u0026nbsp;of MRC-5 cells (ATCC\\u0026reg; CCL-171\\u0026trade;) with ELAH at two concentrations followed by 2-hour incubation with virus compared to the negative control. Following incubation,\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003ethe\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003ecell media was aspirated to remove unbound virus,\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003eand the\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003ecells\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003ewere\\u0026nbsp;\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003erinsed and incubated\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003e\\u0026nbsp;at\\u003c/span\\u003e\\u003cspan style=\\\"font-size:19px;line-height:107%;\\\"\\u003e\\u0026nbsp;35\\u0026deg;C for 4 days with culture media. N/A = Not Applicable. Viral titer determined by TCID\\u003csub\\u003e50\\u003c/sub\\u003e.\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInhibition of cytopathic effect (CPE) by human coronavirus 229E in MRC-5 cells\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003epretreated\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;with ELAH.\\u0026nbsp;\\u003c/strong\\u003eBriefly, MRC-5 cells grown in chamber cell culture slides were pretreated for 10 minutes with two concentrations (1 \\u0026micro;g/ml and 10 \\u0026micro;g/ml) of ELAH and infected for 2 hours with human coronavirus 229E as described in the Materials and Methods. Appropriate controls were also included. The cells treated with medium only (cell control) Figure 6A. or with 10 \\u0026micro;g/ml of ELAH (ELAH control) Figure 6C. showed normal fibroblast morphology of MRC-5 cells in culture. Cells infected with 229E (virus control) showed marked CPE, as evident by rounding of infected cells and their lack of adherence to the surface of the chamber slide (Figure 6B). In contrast, MRC-5 cells pretreated with either 10 \\u0026micro;g/ml (Figure 6D) or 1 \\u0026micro;g/ml ELAH (Figure 6E) showed no significant CPE, as evident by the characteristic fibroblast cell morphology of the cell monolayers. These results suggest that pretreatment of MRC-5 cells with either 10 \\u0026micro;g/ml or 1 \\u0026micro;g/ml ELAH for 10 minutes prior to 2 hours of infection with 229E human coronavirus significantly inhibits replication and thus virus-induced cytopathic effects. Following bright field imaging, samples were fixed and processed for SEM imaging at the University of Wyoming per Methods and Materials.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHigh-resolution SEM.\\u0026nbsp;\\u003c/strong\\u003eImages of control coronavirus 229E samples demonstrated virus attached to the surface of MRC-5 cells (Figure 7a). When compared to MRC-5 cell only controls (Figure 7b.) or MRC-5 cells\\u0026nbsp;pretreated\\u0026nbsp;with\\u0026nbsp;10 \\u0026micro;g/ml ELAH\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e(Figure 7c.) virus was significantly reduced from the surface. These data suggest that 10 minutes of pretreatment of MRC-5 cells with ELAH 10 \\u0026micro;g/mL prior to human coronavirus 229E challenge reduces viral entry and the cytopathic effects caused by the virus after 48 hours of incubation compared to controls.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe primary\\u0026nbsp;mode of entry for severe respiratory syndrome coronavirus 2 is through the nasal area. While vaccines have been developed, other means, especially in the early stage of infections, are vitally important to arrest or reduce\\u0026nbsp;the\\u0026nbsp;transmission of virus through nasal passage. Effective antiviral therapies, especially in the early stage of infections,\\u0026nbsp;are vitally important to halt viral proliferation long enough for the immune system to respond to the virus,\\u0026nbsp;limit cellular damage inflicted by viral invasion\\u0026nbsp;and\\u0026nbsp;minimize genetic mutations caused by the high replication frequency of the virus, which might lead to therapeutic resistance.\\u003c/p\\u003e\\n\\u003cp\\u003eCOVID-19 infections have been reported worldwide. While effective treatments\\u0026nbsp;have been\\u0026nbsp;developed, the current emphasis is on using facial masks, applying hand sanitizers and social distancing,\\u0026nbsp;and\\u0026nbsp;masks alone cannot protect against transmission through\\u0026nbsp;aerosols\\u0026nbsp;and droplets.\\u0026nbsp;Therefore, effective antiseptics used in\\u0026nbsp;the\\u0026nbsp;nasopharynx or oral route\\u0026nbsp;are\\u0026nbsp;needed to reduce or prevent transmission. We\\u0026nbsp;used\\u0026nbsp;ethyl lauroly arginine hydrochloride monohydrate salt,\\u0026nbsp;hereafter\\u0026nbsp;referred to as ELAH,\\u0026nbsp;which\\u0026nbsp;is a special formulation for nasal application to prevent viral transmission.\\u0026nbsp;The antiviral and antivirucidal\\u0026nbsp;activities of arginine esters have been extensively studied by Yamasaki (Yamasaki, H. and others, 2011),\\u0026nbsp;and they concluded that the Cocoyl derivative of arginine inhibited virus growth of herpes virus (HSV-1) and\\u0026nbsp;poliovirus\\u0026nbsp;(PV-1) at 0.01% and identified its potential application as a therapeutic or preventative medicine against HSV superficial infections. We used lauric acid\\u0026nbsp;derivatives\\u0026nbsp;of arginine ester,\\u0026nbsp;which were\\u0026nbsp;not investigated by Yamasaki et al, since\\u0026nbsp;they are\\u0026nbsp;approved for use as food preservatives for meats and poultry. The main characteristic of this molecule is\\u0026nbsp;its\\u0026nbsp;unique surface activity. It has been shown that at very low\\u0026nbsp;concentrations, it\\u0026nbsp;reduced\\u0026nbsp;the\\u0026nbsp;surface free energy of protein-coated surfaces in oral and other mucosal surfaces from 25 dynes/cm to 15 dynes/cm. It has been shown that when\\u0026nbsp;the\\u0026nbsp;surface energy is reduced to 15 dynes/cm,\\u0026nbsp;no attachment of biofilms is observed on protein-coated mucosal surfaces,\\u0026nbsp;which\\u0026nbsp;prevents\\u0026nbsp;microbial films \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo (\\u003c/em\\u003eGlantz, PO 1969). Human clinical studies\\u0026nbsp;have\\u0026nbsp;confirmed these effects (Giersten and others, 2007, Gallob and other, 2015). Since ELAH is completely broken down in humans to body ingredients,\\u0026nbsp;arginine and lauric acid (Hawkins and other, 2009), it is an ideal ingredient for topical nasal applications.\\u003c/p\\u003e\\n\\u003cp\\u003eWe\\u0026nbsp;initially\\u0026nbsp;tested against SARS-CoV-2 and found\\u0026nbsp;that\\u0026nbsp;its effectiveness was as good as\\u0026nbsp;that of\\u0026nbsp;serum antibodies to the virus. Serum antibodies to the virus\\u0026nbsp;are\\u0026nbsp;known to block viruses from attaching\\u0026nbsp;to\\u0026nbsp;susceptible cell surfaces (Tandon, R and others, 2020).\\u0026nbsp;This would indicate\\u0026nbsp;that\\u0026nbsp;the effect of ELAH could be blocking the susceptible surfaces on the cells.\\u003c/p\\u003e\\n\\u003cp\\u003eThe\\u0026nbsp;Syrian hamster model has been validated as\\u0026nbsp;a\\u0026nbsp;model replicating human SARS-CoV-2 infections. The study conducted by Shrivastava (Shrivastava 20121) showed the natural course of symptoms of viral COVID-19.\\u0026nbsp;The viral\\u0026nbsp;load increased from\\u0026nbsp;Days\\u0026nbsp;1 to 7;\\u0026nbsp;however,\\u0026nbsp;after\\u0026nbsp;Day 7, it started to decrease.\\u0026nbsp;Additionally, COVID-19-infected patients normally show respiratory symptoms during\\u0026nbsp;the\\u0026nbsp;first 4-6 days after infection due to viral replication, inflammation and nasal mucosal damage and start stabilizing after 6 days. Our \\u003cem\\u003ein\\u003c/em\\u003e \\u003cem\\u003evivo\\u003c/em\\u003e study in Syrian hamsters showed\\u0026nbsp;a\\u0026nbsp;similar pattern as determined by weight loss and clinical symptoms. Concomitants to clinical picture viral load as measured by genomic RNA and total RNA decreased in the treated group vs the control group.\\u003c/p\\u003e\\n\\u003cp\\u003eThe exact mechanism by which ELAH exerts its blocking effects on SAR-CoV-2 \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo\\u003c/em\\u003e cannot be determined by these studies. However, it is clear that effects could be perturbations in the virus and surface interactions with host cells. Similarity of the inhibition of pseudovirus to the serum antibody would indicate blocking effects at the surfaces. Ohatake, S. (Ohatake. S and others, 2010) proposed several mechanisms of the effects of arginine (breakdown product of ELAH). Three mechanisms were elucidated: structural changes in the viral spike proteins, virus aggregation and pore formation in the virus envelope. The most likely mechanism by which arginine inactivates the virus is most likely due to suppression of protein interactions with other molecules or surfaces. More importantly, they concluded that the effects of arginine were due to its weak interactions.\\u003c/p\\u003e\\n\\u003cp\\u003eOur studies on the\\u0026nbsp;pretreatment\\u0026nbsp;of susceptible cell surfaces with\\u0026nbsp;noncytotoxic concentrations\\u0026nbsp;of ELAH and SEM analysis\\u0026nbsp;suggest that\\u0026nbsp;the blocking action against the virus can be explained\\u0026nbsp;by\\u0026nbsp;blocking or modifying\\u0026nbsp;the\\u0026nbsp;surface\\u0026nbsp;characteristics\\u0026nbsp;of the cell,\\u0026nbsp;resulting in the prevention of the virus from entering the cells.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003cp\\u003eCaldas, LA, Cameiro FA, Higa LM, Monteriro FL, Peixoto da silva, G, Decosta LJ, Durigon EL, Tanuri A, Desouza W.: Ultrastructural analysis of SARS-Cov-2 interactions with the host cell via high resolution electron microscopy: Nature scientific report (2020) 10:16099.\\u003c/p\\u003e\\n\\u003cp\\u003eGallob, J.T, Lynch.M, Charles.C, Ricci-Nattel, Mordas.C Gambogi, R,Revankar.R., Mutti.B, Labella, R (2015) Clinical periodontology 42,740-747: A randomized trial of ethyl lauroyl alginate-containing mouthwash in the control of gingivitis.\\u003c/p\\u003e\\n\\u003cp\\u003eGandhi, RT, Lynch, DelRio. C., (2020) Mild to moderate Covid-19. New England Journal of medicine.383(18):1757-66\\u003c/p\\u003e\\n\\u003cp\\u003eGiersten, E, Guggenheim, B, Gemur, B (2007): Antiplaque effects of ethyl lauroyl arginase in situ: J. Dental research 86 (special issue) abstract 2299\\u003c/p\\u003e\\n\\u003cp\\u003eGlantz, PO (1981) \\u0026lsquo;Adhesion in oral cavity\\u0026rsquo;. In Fundamentals and application of surface interactions in the oral cavity (ed SA Leach) pp49-64. Information retrieval Ltd. London.\\u003c/p\\u003e\\n\\u003cp\\u003eHawkins, DR, Rocabeyera, X, Ruckman, S, Segret, R, Shaw, D (2009): Metabolism and pharmacokinetics of ethyl N(alpha)-L- lauroyl arginate hydrochloride in human volunteers: Food and chemical toxicology.47,2711-2715.\\u003c/p\\u003e\\n\\u003cp\\u003eLi et al. (2021): In vitro and In vivo functions of SARS-Cov-2 infection-enhancing and neutralizing antibodies, Cell184(16):4203-4219\\u003c/p\\u003e\\n\\u003cp\\u003eKoopmans, M. (2020) Novel coronavirus outbreak. What we know and what we don\\u0026rsquo;t. Cell: 180:1034-6\\u003c/p\\u003e\\n\\u003cp\\u003eOhtake, S.\\u0026nbsp;Arakawa,T and Koyama,A H(2010):Arginine as\\u0026nbsp;a synergistic virucidal agent. Macromolecules.15(3);1408-1424.\\u003c/p\\u003e\\n\\u003cp\\u003eShrivastava Vijay M, Maneby N. Clinical efficacy of an osmotic antiviral and anti-inflammatory polymeric nasal film to treat Covid-19 Early phase respiratory Symptoms. Open access Journal of clinical trials.2021 May18:13:11-20.\\u003c/p\\u003e\\n\\u003cp\\u003eTandon R. \\u0026nbsp; Mitra D, Sharma P, McCandlees MG, Stray SJ, Bates JT, Marshall GD: Effective screening of SARS-CoV-2 neutralizing antibodies in patient serum using lentivirus particles pseudo typed with SARS-CoV-2 spike glycoprotein. (2020) Nature Scientific report: 10:19076\\u003c/p\\u003e\\n\\u003cp\\u003eTostanoski LH, Wegman F, Martinot AJ, Loos C, McMahan K, Mercado NB, Yu J,\\u0026nbsp;Chan CN Bondoc S, Starke CE and thirty-three others(2020). Nature Medicine\\u0026nbsp;Letters.\\u0026nbsp;\\u003ca href=\\\"about%3Ablank\\\"\\u003ehttps://doi.org/10.1038/s41591-020-107\\u003c/a\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWhitt,MA(2010): Generation of VSV Pseudotypes Recombinant delta-G-VSV for studies of virus entry, identification of inhibitors, and immune responses to vaccines:J.\\u0026nbsp;Virol methods:169(2):365-74\\u003c/p\\u003e\\n\\u003cp\\u003eWofel,VM,Guggemos,W.,Scilmair,M,Zange,S.MullerMA,Neimeyer,D.JonesTC,VollarP., Rothe, C.\\u0026nbsp;(2020)\\u0026rdquo; virological Assessment of Hospitalized Patients with Covid-2019\\u0026rdquo;.\\u0026nbsp;Nature 581-(7809)465-69\\u003c/p\\u003e\\n\\u003cp\\u003eYamasaki, Tsujimoto K, Ikeda K, Suzuki Y, Arakawa T and Koyama AH (2011): Antiviral and Virucidal activities of N (alpha)-Cocoyl-L- Arginine ethyl ester: Advances in Virology: article ID 572868, pages 6.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e\\u003cu\\u003eConflict of interest\\u003c/u\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e:\\u003c/strong\\u003e Dr. Thacore is a consultant in virology for Salvacion USA Inc. with no financial interest in the company; Drs. Gaffar and Yun are part of Salvacion USA Inc. which has interest in commercializing the spray; Drs. Chenine (IBT), Ferrari, Pal and Wattay (Bioqual) and Peterson (Perfectus) are independent contractors conducting the studies described in the communication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cu\\u003eAuthor contributions\\u003c/u\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e:\\u003c/strong\\u003e Drs. HT and AG wrote and edited the main manuscript text and supervised the experiments; Dr. SY developed the formulation. Drs. AC, MF, RP, LW and MP conducted respective studies.\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"SARS-CoV-2, ethyl alauroyl arginine hydrochloride, prevention\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-842564/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-842564/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSARS-CoV-2 and coronaviruses, enveloped RNA viruses, are major causes of acute human respiratory diseases. The aim of the study was to investigate the broad-spectrum antiviral effects of ethyl lauroyl arginine hydrochloride (ELAH) in in vitro and in vivo assays. Cell-based assays found that the pseudovirus VSV-SARS-CoV-2 was inhibited with an EC\\u003csub\\u003e50\\u003c/sub\\u003e of 15 micrograms/ml, with complete inhibition achieved at 110 micrograms/ml. The effects were comparable to those observed with anti-SARS-CoV-2 antibody neutralization assays against VSV-SARS-CoV-2. Intranasal administration of the Wuhan strain of SARS-CoV-2 treated in vitro with ELAH inhibited the disease symptoms caused by the virus in a Syrian hamster model compared to that caused by the same dose of virus treated in vitro with medium alone. Subgenomic RNA and total RNA viral load were concomitantly reduced in the treated animals compared with the control group. In cell-based studies, pretreatment of susceptible cells with 1\\u0026ndash;10 micrograms/ml ELAH inhibited the attachment of the virus to the cells, as measured by cytopathic and high-resolution scanning electron microscopy (SEM) effects, suggesting that the primary mode of ELAH action was due to preventing the attachment of the virus to the cells. Collectively, the data suggest that ELAH could be a promising agent for the prevention of SARS infection through nasopharyngeal surfaces.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The effects of ethyl lauroyl arginine hydrochloride (ELAH) in nasal spray formula on SARS-Cov-2\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-09-21 14:57:14\",\"doi\":\"10.21203/rs.3.rs-842564/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":2}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"7f090528-4919-44df-85a2-39fd20259063\",\"owner\":[],\"postedDate\":\"September 21st, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":7327073,\"name\":\"Infectious Diseases\"},{\"id\":7327074,\"name\":\"Drug Discovery, Design, \\u0026 Development\"}],\"tags\":[],\"updatedAt\":\"2021-09-21T14:57:14+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2021-09-21 14:57:14\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-842564\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-842564\",\"identity\":\"rs-842564\",\"version\":[\"v1\"]},\"buildId\":\"WrCJVZZCHTDjtuVLN7oU0\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}