{"paper_id":"af338efc-63ae-450f-8f6b-541bd885a790","body_text":"Jundishapur J Microbiol. 2024 June; 17(6): e147025. https://doi.org/10.5812/jjm-147025.\nPublished online: 2024 August 26. Research Article\nCopyright ©  2024, Mohammadi et al. This open-access article is available under the Creative Commons Attribution 4.0 (CC BY 4.0) International License\n(https://creativecommons.org/licenses/by/4.0/), which allows for unrestricted use, distribution, and reproduction in any medium, provided that the original\nwork is properly cited.\nInteraction Between Endometriosis and Bacteria in Infertile Women at\nArash Women's General Hospital in Tehran\nAnis Mohammadi 1 , Ashraf Moini 2 , 3 , 4 , Sarvenaz Falsafi 1 , Mohammad Mehdi Feizabadi \n 5 , 6 , *\n1 Department of Microbiology, Faculty of Advanced Science and Technology, Tehran Medical Science, Islamic Azad university, Tehran, Iran\n2 Department of G ynecology and Obstetrics, Arash Women's Hospital, Tehran University of Medical Sciences, Tehran, Iran\n3 Breast Disease Research Center (BDRC), Tehran University of Medical Sciences, Tehran, Iran\n4 Department of Endocrinology and Female, Infertility at Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine,\nACECR, Tehran, Iran\n5 Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran\n6 Thorax Research Center, Tehran University of Medical Sciences, Tehran, Iran\n*Corresponding author: Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Email: mfeizabadi@tums.ac.ir\nReceived2024May8;Revised2024July12;Accepted2024July13.\nAbstract\nBackground: Endometriosis is a common disorder that affects 20 - 50% of infertile women. The disease correlates with the\npresence of lactobacilli and changes in the number of Gram-negative and Gram-positive bacteria.\nO bjectives: This article aims to investigate the interaction between endometriosis and certain bacteria.\nMethods: One hundred women between 18 and 40 years of age referred to the IVF department of Arash Women's Hospital in\nTehran were studied. Fifty of them were diagnosed with endometriosis, while the rest were referred for investigation or freezing\nof their gametes or embryos. Specimens were collected from endometrial tissue and the cervix using swabs. These specimens\nwere used for cultures and real-time PCR to quantify Lactobacillus.\nResults: Seventeen different Gram-positive and Gram-negative bacteria, as well as three yeasts, were isolated from women with\nand without endometriosis. The highest prevalence was related to Enterococcus faecalis, followed by Escherichia coli, Klebsiella\npneum oniae, Staphylococcus aureus, E. faecium, Proteus m irabilis, Edw ardsiella tarda, and Citrobacter spp. In cases with\nendometriosis, the relationship between the increase of Enterococcus spp., members of the Enterobacteriaceae family, and the\ndecrease of lactobacilli was significant (P < 0.05). Staphylococcus aureus was isolated from the cervix of three women with\nendometriosis. The bacterial profiles of the cervix and endometrium were very similar.\nConclusions: Considering the decrease of lactobacilli and the increase of other bacteria in people with endometriosis, it is\nrecommended to use Lactobacillus and other probiotics for the prevention and even treatment of this disease.\nKeyw ords:Endometriosis, Enterobacteriaceae,Infertility, Lactobacillus,Bacteria\n1. Background\nEndometriosis is a common female disorder\ncharacterized by endometrial-like tissue lesions outside\nthe uterus, affecting 10 - 15% of women of reproductive\nage and 20 - 50% of infertile women (1, 2). The frequency\nof this disorder among infertile Iranian women has\nbeen reported as 29% (3). Endometriosis appears during\nreproductive years and is associated with a wide range\nof symptoms (1). Despite extensive research, the\npathogenesis and molecular basis of this disease remain\nunknown. Identifying a single factor that explains the\npathogenesis of this disease is challenging [1]. It is\nbelieved that genetic and immunological factors (4),\nhormonal factors, and inflammation are involved in the\nregulation of endometriosis (5). Evidence suggests a\ncomplex two-way interaction between endometriosis\nand the microbiome (6).\nThe effect of microbiota on the epigenetic,\nimmunological, or biochemical functions of the host\nhas also been debated (4). Importantly, antibiotics and\nprobiotics have been found effective in the treatment of\nendometriosis, indicating a connection between the\n\nM oham m adi A et al.\n2 Jundishapur J Microbiol. 2024; 17(6): e147025.\nmicrobiome and this disease (7). Recent studies have\ndemonstrated changes in the microbiota of the genital\nsystem with the progression of endometriosis and the\nalleviation of disease symptoms with antibiotic therapy\n(7). Lactobacillus is the dominant bacterium in the\nfemale reproductive system. By modulating\ninflammatory processes and producing different\nmetabolites such as lactic acid, H2O2, and bacteriocin, it\ninhibits the colonization of pathogenic bacteria (8).\nEndometriosis progresses by reducing the number of\nlactobacilli and increasing the number of other bacteria\n(7).\n2. O bjectives\nThis study aims to examine the bacterial populations\nin the cervix and endometrium of women with\nendometriosis compared to women without the disease\nusing culture-based methods and to compare the\nfrequency of lactobacilli in patients with and without\nendometriosis using quantitative real-time PCR (qPCR)\nassay. By reliably quantifying bacteria, qPCR may\nimprove our understanding of the association between\nLactobacillus and endometriosis. Since there is a lack of\nunderstanding of the relationship between them,\nidentifying this relationship can help elucidate the\npathogenesis and ultimately lead to the development of\nnon-invasive testing and diagnosis. Additionally, it\nserves as a fundamental step toward developing new\ntreatment strategies.\n3. Methods\n3.1. Sam pling\nOne hundred women aged 18 to 40 who were\nreferred to the IVF Department of Arash Women's\nGeneral Hospital in Tehran from July 2021 to July 2022\nwere divided into two groups: Fifty women with\nultrasound-confirmed endometriosis who were seeking\ntreatment for infertility, and 50 healthy women in the\ncontrol group who were referred for egg donation.\nExclusion criteria included infection of the genital tract\nin the last 3 months, use of hormonal contraception or\nIUD, use of antibiotics or probiotics in the last 8 weeks,\nabnormal pap smear results in the last 3 years, vaginal\nbleeding, use of vaginal drugs in the last 3 weeks, and\nsexual activity in the last week. The treatment protocol\nfor both groups involved gonadotropin-releasing\nhormone (GnRH) agonists.\n3.2. Sam ple Collection\nThe samples were collected on the 3rd to 7th day after\nmenstruation. The endometrial samples were collected\nby a gynecologist using a pipelle (Medbar) under strict\naseptic conditions. For cervical sampling, during a\nspeculum examination, two separate dacron swabs were\ngently rotated in the cervix for five circles to obtain\nsecretions.\n3.3. DNA Extraction\nDNA was extracted from endometrial specimens\nusing the GeneAll kit as instructed by the supplier\n(GeneAll Biotechnology, Korea). The cervical specimens\nwere centrifuged at 3500 × g for 5 minutes at 4°C, and\nthen the sediments were used for DNA extraction using\nthe same kit. DNA samples were stored at -20°C.\n3.4. Quantitative Real tim e Polym erase Chain Reaction\nThe thermocycling conditions consisted of an initial\nmelting step at 95°C for 20 seconds, followed by 55°C for\n20 seconds, and 72°C for 20 seconds, in a total volume of\n20 μ L. This volume included 3 μ L DNA sample, 0.8 μ L of\neach primer (9) (0.4 μ mol/L), 10 μ L SYBR Green PCR\nmaster mix (2×), and 5.6 μ L double-distilled water. The\nexperimental data were performed at least in triplicate,\nand results were expressed as mean ± SEM. To prepare an\nexternal standard, the DNA was serially diluted in\ndouble-distilled water ranging from 106 to 103 copies\naccording to ABI guidelines on \"Creating Standard\nCurves with Genomic DNA Templates for Use in\nQuantitative PCR.\" Aliquots of each dilution were stored\nat -20°C until use. A non-template control was used in\neach qPCR experiment as a negative control.\n3.5. Polym erase Chain Reaction for Detection of 16S rRNA\nGenes\nThe samples that were negative for 16S Lactobacillus\nwere checked with two primers (10, 11) listed in Table 1 to\nensure the correctness of the extraction. The PCR\namplification mixture was 25 μ L, with an initial\ndenaturation step at 94°C for 5 minutes, followed by 40\ncycles at 94°C for 1 minute, 60°C for 1 minute, and 72°C\nfor 1.5 minutes, and a final extension step at 72°C for 10\n\nM oham m adi A et al.\nJundishapur J Microbiol. 2024; 17(6): e147025. 3\nTable 1. Nucleotide Sequences and Predicted Size of Polymerase Chain Reaction Products\nPrim er Sequence (5 ′  – 3 ′ ) Product Length Reference\n16S rRNA 126 (9)\nF-lacto GAGGCAGCAGTAGGGAATCTTC\nR-lacto GGCCAGTTACTACCTCTATCCTTCTTC\n16S rRNA 189 (10)\nF GGGACCCGCACAAGCGGTGG\nR GGGTTGCGCTCGTTGCGGGA\n16S rRNA 1549 (11)\nF AGAGTTTGATCCTGGCTGGCTCAG\nR GGTTACCTTGTTACGACTT\nminutes. Each analysis included bacterial positive and\nnegative controls.\n3.6. Isolation and Identification of M icroorganism s\nThe samples were cultured in two ways. The first\ngroup was cultured immediately after sampling, and\nthe second group was incubated in Thioglycollate Broth\nmedium (QUELAB company, Canada) for 48 hours at 37ºC\nand then cultured on the appropriate medium. The\nsamples were first examined in nutrient media such as\nblood agar and chocolate agar. Colonies grown on these\nmedia were then recultured on several different\nselective and specific media, such as eosin methylene\nblue (EMB) and mannitol salt agar, and incubated for 24\nto 72 hours at 37ºC. Confirmatory methods including\nGram staining and phenotypic tests such as catalase,\nurease, growth on Simon citrate, TSIA and SIM media,\nproduction of oxidase, DNase, lysine decarboxylase, and\nmethyl red (MR)/Voges-Proskauer were used for\nidentification. Rogosa and Sharpe (MRS) and brain-heart\ninfusion (BHI) agar were used to isolate Lactobacillus,\nwith 0.05% L-cysteine added to the MRS and BHI media.\nThe plates were incubated for 24 hours at 37ºC in\nanaerobic and microaerophilic conditions (12). The Vitek\nsystem was also used to identify the samples, and one\nsample was sent to Genomin Iran for sequencing.\n3.7. Statistical Analysis\nData were analyzed using SPSS software, version 26\n(SPSS, Chicago, IL, USA). Differences between the healthy\ncontrols and patients were compared using the chi-\nsquare test. Data were visualized with GraphPad Prism\nversion 9 (GraphPad Software, Inc., San Diego, CA, USA).\n4. Results\nOverall, 100 women were examined, 50 of whom had\nendometriosis confirmed by ultrasound, while 50\nhealthy women served as the control group. In this\nstudy, a total of 200 samples were examined, including\n100 cervical swab samples and 100 endometrial biopsy\nsamples. The samples that were immediately cultured\nwithout enrichment did not grow. The results of the\nsamples enriched in Thioglycolate broth for 48 hours\nare listed in Table 2. The bacteria found in the cervix and\nendometrium were very similar. A total of 17 species of\nbacteria and 3 yeasts were isolated. Fifty-eight and 49\nisolates were obtained from the cervix and\nendometrium of individuals with endometriosis,\nrespectively, while 34 and 23 isolates were obtained from\nthe control group. In the case group, no isolates were\nfound in 4 individuals, while in the control group, no\nisolates were found in 23 individuals. Three different\ntypes of bacteria were isolated from 1 individual in the\ncase group, while in the control group, 5 individuals had\nthree different types of bacteria isolated. The chi-square\ntest revealed a significant relationship between the\nfrequency of enterococci and Enterobacteriaceae in the\ncervix and endometrium and endometriosis (P < 0.05).\nQuantitative PCR was performed to check the\nnumber of lactobacilli in the endometrium and cervix.\nEach qPCR test was repeated three times. The average\nresults were used to create graphs and compare the\ndata. Based on specific qPCR of endometrial\nLactobacillus species, 33 (66%) of healthy women and 24\n(48%) of women with endometriosis were positive. Fifty-\nseven percent of endometrial samples were positive for\nLactobacillus. The negative samples were re-checked\nwith two sets of primers for 16S rRNA genes (shown in\n\nM oham m adi A et al.\n4 Jundishapur J Microbiol. 2024; 17(6): e147025.\nTable 2. The Results of the Samples That Were Enriched in Thioglycolate Broth for 48 Hours\nBacteria Case Group Control Group\nCervix Endom etrial Cervix Endom etrial\nM ycoplasm a hom inis  ATCC23114 - - 1 -\nLactobacillus 4 4 6 6\nEnterococcus 15 16 6 5\nEscherichia coli 12 12 3 3\nKlebsiella pneum onia 6 6 1 -\nEdwardsiella tarda 1 - - -\nProteus m irabilis 1 - - -\nCitrobacter - - - 1\nStaphylococcus aureus 3 - - -\nS. epiderm idis 2 1 2 -\nS. saprophyticus 1 2 2 1\nStaphylococcus  spp. 3 4 5 3\nNon-hem olytic  Streptococcus 4 4 5 3\nStreptococcus agalactiae 2 - 1 1\nS. anginous 1 - - -\nS. pneum oniae 2 - 2 -\nSphingom onas paucim obilis 1 - - -\nFigure 1. 100-bp DNA ladder; the 1549 bp polymerase chain reaction (PCR) product\nFigures 1 and 2). The results showed that specimens from\n5 individuals (3 controls and 2 cases) were negative for\nbacterial 16S rRNA genes. It should be noted that these\nindividuals also had negative culture results. The\nnumber of Lactobacillus bacteria in cervical samples was\nmeasured using the qPCR method, and samples with\nfewer than 10 bacteria were considered negative.\nNinety percent (48 individuals) of the control group\nand 70% (44 individuals) of the case group had qPCR\nresults above 10. The average number of lactobacilli in\nthe cervical samples of the case and control groups were\n377 and 1734, respectively. In the endometrial samples,\nthe average number was 3875 in the affected group and\n12108 in the control group. The average number of\nlactobacilli in cervical and endometrial samples is\nshown in Figure 3. A significant relationship (P < 0.05)\nwas found between the colonization of the uterus and\n\nM oham m adi A et al.\nJundishapur J Microbiol. 2024; 17(6): e147025. 5\nFigure 2. 100-bp DNA ladder; the 189 bp polymerase chain reaction (PCR) product\nFigure 3. The average number of lactobacilli in cervix and biopsy\ncervix with Enterococcus spp. and Enterobacteriaceae and\nthe reduction of lactobacilli in the case group.\n5. Discussion\nEndometriosis is a chronic inflammatory disease\ncharacterized by the presence of endometrial tissue in\nother organs than uterus. It results in pelvic pain and\ninfertility and deteriorate the quality of life (5, 13).\nDespite the high number of patients, diagnosis is\nusually delayed for years, misdiagnosis is common, and\neffective treatment takes time to provide. It is necessary\nto investigate the factors triggering the disease in\nparticular the role of microbiota in relation to disease\nsymptoms (13, 14). In this study, we compared the\nmicrobiota of the endometrium from endometrial\nbiopsy and cervical swap samples collected from\npatients with endometriosis and control group.\nUsing qPCR, we demonstrated the abundance of\nlactobacilli in cervix and endometrium in control\ngroup, as well as the relation between the colonization\nof Enterococcus spp. and Enterobacteriaceae in the uterus\nand cervix and reduction of lactobacilli in case group. It\nis also important to mention that 5 endometrial\nbiopsies (2 patients and 3 control groups) did not yield\n\nM oham m adi A et al.\n6 Jundishapur J Microbiol. 2024; 17(6): e147025.\nPCR products for the 16S rRNA gene. This indicates that\nsome people may not have microbiota in endometrium.\nIn a similar study conducted by Wessels et al., three\nbiopsy samples were negative for the 16S rRNA gene in\nPCR assay (15). Disease is consistently associated with\nreduction of lactobacilli and increase in bacteria\ninvolved in vaginosis and other opportunistic infections\n(7, 16). Lactobacilli produce various substances that\nprevent the growth of pathogenic bacteria. Inhibitors\ninclude lactic acid, bacteriocins and hydrogen peroxide\n(8, 17).\nIn the present study, the frequency of lactobacilli\ndetected by culture method in the case group was 8%,\nwhich is significant. However, the frequency of\nlactobacilli detected by real-time quantitative PCR\nmethod in this group were 40% (from endometrium)\nand 70% (cervix samples). There was a significant\nrelationship between the frequency of Lactobacillus and\nendometriosis as determined by real-time quantitative\nPCR method. The reason for higher sensitivity of PCR\nover the culture is its ability in detection of the nucleic\nacids, regardless of viability of bacterial cells. Similar\nfinding has also been reported (18).\nThe composition of microbiome detected by culture\nfrom the cervix and endometrium was similar in our\nstudy confirming the results of Chen et al. and Winters\net al. (19, 20). Samples that were directly cultured\nwithout enrichment did not grow, possibly due to the\nlower number of bacteria present in the uterus and\nupper endocervix (10,000-fold) comparing vagina. The\nreasons for difference was either the role of cervix as it\nfunctions as a filter or clears ascending bacteria by the\nendometrial immune response, or a combination of\nboth (17, 21).\nThere was a significant relationship between the\nnumber bacteria belonging to the Enterobacteriaceae\nfamily and Enterococcus spp. in the endometrium and\ncervix and occurrence of endometriosis, which is\nconsistent with previous studies. Khan et al., reported a\nrelationship between intrauterine microbial\ncolonization of endometrial samples and endometriosis\ncomparing with control group. In their study the\nnumber of Enterococcus spp. and E. coli CFUs in the\nendometrial samples of women with endometriosis was\nsignificantly higher than control (5).\nUsing NGS analysis on cervical mucus from women\nwith and without endometriosis, Akyama et al., reported\nthat Enterobacteriaceae family members were found in\nsignificant amounts in women with endometriosis (22).\nIn another study Cojocaru proved that endometriosis is\nassociated with increased presence of members of\nEnterobacteriaceae family (4). Similarly, the incidence of\nendometriosis was related to the increase in the\npresence of Enterobacteriaceae, particularly E. coli, in\ndifferent parts of the genital tract (6). Using PCR on\nspecimens from the deep lesions of endometrium, up to\n50 percent of patients with endometriosis were positive\nfor Enterococcus spp. (16). In Khan's study in 2016,\nEnterobacteriaceae and Streptococcaceae were\ndocumented as the most important organisms in\nendometriosis group by real-time PCR (23). Increase in\nnumber of Enterococcus spp., and E. coli in women with\nendometriosis was also reported by other investigators\n(24-26).\n5.1. Conclusions\nThe reduction of lactobacilli and the increase of\nother bacteria in people with endometriosis confirm\nstudies aiming to transform dysbiosis into a favorable\ngenital microenvironment using Lactobacillus and other\nprobiotics. This approach is potentially effective for the\nprevention and even treatment of those suffering from\nthis disease. Furthermore, the findings of this study\nprovide a basis for further research to investigate the\nintrauterine colonization of different bacteria and their\nrole in the occurrence of endometriosis. Such research\ncould lead to the development of non-invasive\ndiagnostic and treatment options.\nAcknowledgem ents\nThis work was supported by Tehran University of\nMedical Sciences (Project No. 31735).\nFootnotes\nAuthors' Contribution: Study concept and design, and\nanalysis and interpretation of data: Ashraf Moini, and\nMohammad Mehdi Feizabadi; acquisition of data, and\ndrafting of the manuscript: Anis Mohammadi; critical\nrevision of the manuscript for important intellectual\ncontent, and study supervision: Mohammad Mehdi\nFeizabadi; statistical analysis: Sarvenaz Falsafi, and Anis\nMohammadi; administrative, technical, and material\n\nM oham m adi A et al.\nJundishapur J Microbiol. 2024; 17(6): e147025. 7\nsupport: Mohammad Mehdi Feizabadi, and Ashraf\nMoini.\nConflict of Interests Statem ent: There is no conflict of\ninterest in this study.\nData Availability: The dataset presented in the study is\navailable on request from the corresponding author\nduring submission or after publication.\nEthical Approval: The Ethics Committee of Tehran\nUniversity of Medical Sciences\n(IR.TUMS.MEDICINE.REC.1400.427 ) approved the project.\nFunding/Support: This work was supported by Tehran\nUniversity of Medical Sciences (Project No. 31735).\nInform ed Consent: Informed consent was obtained\nfrom the participants.\nReferences\n1. Golabek A, Kowalska K, Olejnik A. Polyphenols as a diet therapy\nconcept for endometriosis-current opinion and future perspectives.\nNutrients. 2021;13(4). [PubMed ID: 33919512]. [PubMed Central ID:\nPMC8074087]. https://doi.org/10.3390/nu13041347.\n2. Moura APC, Ribeiro H, Bernardo WM, Simoes R, Torres US, D'Ippolito\nG, et al. Accuracy of transvaginal sonography versus magnetic\nresonance imaging in the diagnosis of rectosigmoid endometriosis:\nSystematic review and meta-analysis. PLoS One. 2019;14(4). e0214842.\n[PubMed ID: 30964888]. [PubMed Central ID: PMC6456198].\nhttps://doi.org/10.1371/journal.pone.0214842.\n3. Abolghasemi M, Esmaeilzadeh S, Mirabi P, Golsorkhtabaramiri M.\nHuman exposure to polychlorinated biphenyls (pcbs) and the risk of\nendometriosis: A systematic review and meta-analysis protocol. Int J\nPrev M ed. 2021;12:108. [PubMed ID: 34760119]. [PubMed Central ID:\nPMC8551793]. https://doi.org/10.4103/ijpvm.IJPVM_178_19.\n4. Cojocaru M. Endometriosis and the human microbiome. J Clin Sexol-\nVol. 2020;3(2):61.\n5. Khan KN, Fujishita A, Kitajima M, Hiraki K, Nakashima M, Masuzaki H.\nIntra-uterine microbial colonization and occurrence of endometritis\nin women with endometriosisdagger. Hum  Reprod. 2014;29(11):2446-\n56. [PubMed ID: 25205755]. https://doi.org/10.1093/humrep/deu222.\n6. Leonardi M, Hicks C, El-Assaad F, El-Omar E, Condous G.\nEndometriosis and the microbiome: a systematic review. BJOG.\n2020;127(2):239-49. [PubMed ID: 31454452]. https://doi.org/10.1111/1471-\n0528.15916.\n7. Jiang I, Yong PJ, Allaire C, Bedaiwy MA. Intricate connections between\nthe microbiota and endometriosis. Int J M ol Sci. 2021;22(11). [PubMed\nID: 34073257]. [PubMed Central ID: PMC8198999].\nhttps://doi.org/10.3390/ijms22115644.\n8. Wang H, Ma Y, Li R, Chen X, Wan L, Zhao W. Associations of\ncervicovaginal Lactobacilli with high-risk human papillomavirus\ninfection, cervical intraepithelial neoplasia, and cancer: A systematic\nreview and meta-analysis. J Infect Dis. 2019;220(8):1243-54. [PubMed\nID: 31242505]. https://doi.org/10.1093/infdis/jiz325.\n9. Delroisse JM, Boulvin AL, Parmentier I, Dauphin RD, Vandenbol M,\nPortetelle D. Quantification of Bifidobacterium spp. and\nLactobacillus spp. in rat fecal samples by real-time PCR. M icrobiol Res.\n2008;163(6):663-70. [PubMed ID: 19216105].\nhttps://doi.org/10.1016/j.micres.2006.09.004.\n10. Zhang LL, Zhang LF, Xu JG. Chemical composition, antibacterial\nactivity and action mechanism of different extracts from hawthorn\n(Crataegus pinnatifida Bge.). Sci Rep. 2020;10(1):8876. [PubMed ID:\n32483369]. [PubMed Central ID: PMC7264281].\nhttps://doi.org/10.1038/s41598-020-65802-7.\n11. McLean JS, Beveridge TJ, Phipps D. Isolation and characterization of a\nchromium-reducing bacterium from a chromated copper arsenate-\ncontaminated site. Environ M icrobiol. 2000;2(6):611-9. [PubMed ID:\n11214794]. https://doi.org/10.1046/j.1462-2920.2000.00143.x.\n12. Parolin C, Marangoni A, Laghi L, Foschi C, Nahui Palomino RA,\nCalonghi N, et al. Isolation of vaginal Lactobacilli and\ncharacterization of anti-Candida activity. PLoS One. 2015;10(6).\ne0131220. [PubMed ID: 26098675]. [PubMed Central ID: PMC4476673].\nhttps://doi.org/10.1371/journal.pone.0131220.\n13. Chapron C, Marcellin L, Borghese B, Santulli P. Rethinking\nmechanisms, diagnosis and management of endometriosis. Nat Rev\nEndocrinol. 2019;15(11):666-82. [PubMed ID: 31488888].\nhttps://doi.org/10.1038/s41574-019-0245-z.\n14. Taylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic\ndisease: Clinical challenges and novel innovations. Lancet.\n2021;397(10276):839-52. [PubMed ID: 33640070].\nhttps://doi.org/10.1016/S0140-6736(21)00389-5.\n15. Wessels JM, Dominguez MA, Leyland NA, Agarwal SK, Foster WG.\nEndometrial microbiota is more diverse in people with\nendometriosis than symptomatic controls. Sci Rep. 2021;11(1):18877.\n[PubMed ID: 34556738]. [PubMed Central ID: PMC8460742].\nhttps://doi.org/10.1038/s41598-021-98380-3.\n16. Hernandes C, Silveira P, Rodrigues Sereia AF, Christoff AP, Mendes H,\nValter de Oliveira LF, et al. Microbiome profile of deep endometriosis\npatients: Comparison of vaginal fluid, endometrium and lesion.\nDiagnostics (Basel). 2020;10(3). [PubMed ID: 32192080]. [PubMed\nCentral ID: PMC7151170]. https://doi.org/10.3390/diagnostics10030163.\n17. Fraszczak K, Barczynski B, Kondracka A. Does Lactobacillus exert a\nprotective effect on the development of cervical and endometrial\ncancer in women? Cancers (Basel). 2022;14(19). [PubMed ID:\n36230832]. [PubMed Central ID: PMC9564280].\nhttps://doi.org/10.3390/cancers14194909.\n18. Payne MS, Bayatibojakhi S. Exploring preterm birth as a\npolymicrobial disease: an overview of the uterine microbiome. Front\nIm m unol. 2014;5:595. [PubMed ID: 25505898]. [PubMed Central ID:\nPMC4245917]. https://doi.org/10.3389/fimmu.2014.00595.\n19. Chen C, Song X, Wei W, Zhong H, Dai J, Lan Z, et al. The microbiota\ncontinuum along the female reproductive tract and its relation to\nuterine-related diseases. Nat Com m un. 2017;8(1):875. [PubMed ID:\n29042534]. [PubMed Central ID: PMC5645390].\nhttps://doi.org/10.1038/s41467-017-00901-0.\n20. Winters AD, Romero R, Gervasi MT, Gomez-Lopez N, Tran MR, Garcia-\nFlores V, et al. Does the endometrial cavity have a molecular\nmicrobial signature? Sci Rep. 2019;9(1):9905. [PubMed ID: 31289304].\n[PubMed Central ID: PMC6616349]. https://doi.org/10.1038/s41598-019-\n46173-0.\n21. Mitchell CM, Haick A, Nkwopara E, Garcia R, Rendi M, Agnew K, et al.\nColonization of the upper genital tract by vaginal bacterial species in\nnonpregnant women. Am  J Obstet Gynecol. 2015;212(5):611 e1-9.\n\nM oham m adi A et al.\n8 Jundishapur J Microbiol. 2024; 17(6): e147025.\n[PubMed ID: 25524398]. [PubMed Central ID: PMC4754962].\nhttps://doi.org/10.1016/j.ajog.2014.11.043.\n22. Akiyama K, Nishioka K, Khan KN, Tanaka Y, Mori T, Nakaya T, et al.\nMolecular detection of microbial colonization in cervical mucus of\nwomen with and without endometriosis. Am  J Reprod Im m unol.\n2019;82(2). e13147. [PubMed ID: 31087436].\nhttps://doi.org/10.1111/aji.13147.\n23. Khan KN, Fujishita A, Masumoto H, Muto H, Kitajima M, Masuzaki H,\net al. Molecular detection of intrauterine microbial colonization in\nwomen with endometriosis. Eur J Obstet Gynecol Reprod Biol.\n2016;199:69-75. [PubMed ID: 26901400].\nhttps://doi.org/10.1016/j.ejogrb.2016.01.040.\n24. Cicinelli E, Trojano G, Mastromauro M, Vimercati A, Marinaccio M,\nMitola PC, et al. Higher prevalence of chronic endometritis in\nwomen with endometriosis: a possible etiopathogenetic link. Fertil\nSteril. 2017;108(2):289-295 e1. [PubMed ID: 28624114].\nhttps://doi.org/10.1016/j.fertnstert.2017.05.016.\n25. Koninckx PR, Ussia A, Tahlak M, Adamyan L, Wattiez A, Martin DC, et\nal. Infection as a potential cofactor in the genetic-epigenetic\npathophysiology of endometriosis: A systematic review. Facts, View s\nVision ObGyn. 2019;11(3):209.\n26. Elnashar AM. Impact of endometrial microbiome on fertility. M iddle\nEast Fertility Soc J. 2021;26:1-6.","source_license":"CC0","license_restricted":false}