{"paper_id":"a676c96d-be68-448f-b5a5-d7f35eac4e52","body_text":"Heme oxygenase-1 (HO-1) induces resistance to ferroptosis in gastric cancer by targeting GPX4 Author： | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Heme oxygenase-1 (HO-1) induces resistance to ferroptosis in gastric cancer by targeting GPX4 Author： Shiqi Shi, Hanyu Wang, Huiyao Li, Shuai Liang, Dong Hua, Xiaolu Yu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3883283/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Gastric cancer, a prevalent gastrointestinal tumor, experiences limited efficacy with conventional surgery and chemotherapy. Hence, the imperative to identify additional therapeutic targets is underscored. Numerous studies have reported heme oxygenase-1 (HO-1) for its antioxidant and protective attributes on organs and tissues. In the present study, the role of HO-1 in stimulating the proliferation of gastric cancer cells was explored. The hypothesis posited that HO-1 facilitates gastric cancer progression by regulating GPX4 and ferroptosis. Analysis through bioassay and immunohistochemistry revealed a significant augmentation in HO-1 expression within gastric cancer tissues. Mechanistically, real-time fluorescence quantitative PCR and protein immunoblotting confirmed that HO-1 modulates the protein expression of GPX4, a pivotal player in ferroptosis regulation. Through the upregulation of mRNA expression for GPX4, HO-1 inhibits ferroptosis, thereby fostering gastric cancer progression. This is achieved by elevating GPX4 protein levels and diminishing intracellular reactive oxygen species in gastric cancer cells. In summary, our results elucidate the protective role of high HO-1 expression against ferroptosis in gastric cancer cells, thereby promoting their malignant progression. The upsurge in HO-1 expression emerges as a potential tumor marker and therapeutic target for gastric cancer, offering a novel avenue for intervention. Biological sciences/Cancer Health sciences/Gastroenterology Gastric cancer HO-1 Ferroptosis GPX4 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Gastric cancer persists as a significant global malignancy of the digestive tract, ranking fifth in incidence and fourth in mortality worldwide(1). The high proliferative capacity of gastric cancer cells poses a substantial challenge; however, the underlying mechanisms of cancer cell proliferation are unclear. The unfavorable prognosis for patients with gastric cancer predominantly stems from inadequate responses to current treatments(2). Therefore, it is imperative to identify precise and novel treatment modalities for patients with gastric cancer. Ferroptosis, a form of cell death distinct from apoptosis, necrosis, and autophagy characterized by iron-dependent accumulation of reactive oxygen species (ROS) leading to lipid peroxidation, has emerged as a noteworthy phenomenon(3). Numerous genes and proteins implicated in regulating iron metabolism play pivotal roles in ferroptosis(4)(5)(6)(7). In recent years, the role of ferroptosis in gastric cancer has revealed protective mechanisms, such as Wnt/beta-catenin signaling(8) and cancer-associated fibroblasts(9), which shield gastric cancer cells from ferroptosis, thereby advancing the progression of gastric cancer. Molecularly targeted therapy, a novel approach to treating malignant tumors, has gained prominence in recent years. Heme oxygenase-1 (HO-1), the rate-limiting enzyme in heme catabolism, has three identified mammalian subtypes, such as HO-1, HO-2, and HO-3. HO-1 and HO-2 are present in humans and rats, while HO-3 is found exclusively in rats. The HMOX2 subtype is constitutively expressed, encoding a 36 kDa HO-2 protein that primarily maintains the basal metabolism of heme. Moreover, HO-1 is inducible, and its synthesis is enhanced in response to prooxidative stimuli, encompassing oxidants, cytokines, heavy metals, and physical cues such as ischemia/reperfusion injury and hypoxia/hyperoxia. Encoded by the HMOX1 type, HO-1 has an approximate molecular weight of 32 kDa, also recognized as heat shock protein 32. HO-1 catalyzes heme degradation, yielding carbon monoxide, ferrous iron, and biliverdin. Notably, chlorophyll exerts a protective effect by inhibiting lipid and protein peroxidation through the scavenging of ROS(15). HO-1 acts as a dual regulator of iron and ROS homeostasis (10)(11) and is deemed to exert a prominent influence in the context of iron-induced cell death(12)(13)(14). Moreover, a correlation was observed between increased HO-1 expression and heightened lipid peroxidation in patients with Alzheimer’s disease(16). In addition, upregulation of HO-1 has demonstrated efficacy in preventing hepatic fibrosis caused by peroxidation(19). HO-1-mediated ferroptosis emerges as an essential factor in the retinal pigment epithelial cell degeneration(20). However, a deeper investigation into the role of HO-1 reveals contradictory evidence, suggesting that HO-1 may accelerate tumor progression. For instance, high HO-1 expression in a mouse model of human primary head and neck squamous carcinoma correlated with faster malignant progression(17). HO-1 overexpression in pancreatic cancer cells significantly promoted tumor angiogenesis and accelerated lung metastasis development(18). Despite these findings, the molecular mechanisms by which HO-1 promotes malignant progression in gastric cancer require further exploration. In the present study, we investigated the role of HO-1 in promoting gastric cancer, positing a hypothesis that HO-1 could potentially inhibit gastric cancer progression by regulating GPX4 and ferroptosis. Results 1. Upregulation of HO-1 in primary gastric cancer Our pan-cancer analysis using the GEPIA database revealed a consistent upregulation of HO-1 in primary gastric cancer tissues (Figure 1: A). To validate these findings, we corroborated the results with GEO RNA-seq analysis (GSE54129) (Figure 1: C) and the TCGA database (Figure 1: B). Both datasets consistently demonstrated a significant upregulation of HO-1 in primary gastric cancer tissues. Immunohistochemical analysis of 30 pairs of GC and paracarcinoma tissues further confirmed the high expression of HO-1 in gastric cancer tissues, regardless of differentiation grade (Figure 1: D). 2. Limited impact of HO-1 on gastric cancer proliferation in vitro Examination of HO-1 mRNA and protein levels in gastric cancer cell lines revealed higher expression in AGS and HGC-27 cell lines compared to NCL-N87 and MKN-45 (Figure 2: A, B,C). However, reduced HO-1 expression in HGC-27 and AGS cell lines and HO-1 overexpression in MKN-45 cell line (Figure 2: D, E, F) did not exhibit any knockdown or overexpression effect on gastric cancer cell proliferation (Figure 2: G, H,I), as evidenced by CCK-8 and EDU assays. Overall, the alteration of HO-1 alone was not sufficient to inhibit the proliferation of gastric cancer cells in vitro. 3. Impact of HO-1 on GPX4 protein expression To further explore the proliferative effects of HO-1 on gastric cancer cell lines, we delved into its role as a dual regulator of iron and ROS homeostasis, potentially playing a dominant role in ferroptosis. The intersection analysis of the ferroptosis and GC genomes in public databases confirmed the presence of HO-1 in this overlap (Figure 3: A). In addition, we correlated HO-1 with iron death-associated proteins, and Pearson correlation line analysis in the GSE54129 dataset in the GEO database exhibited a significant correlation between HO-1 and GPX4 gene expression (all p-values < 0.05) (Figure 3: B). Subsequent confirmation through RT-qPCR and Western Blot experiments demonstrated that HO-1 knockdown decreased GPX4 protein levels (Figure 3: C,D) and altered mRNA levels (Figure 3: F,G,). However, overexpressing cell lines exhibited the opposite results (Figure 3: E, H). In summary, these findings suggest that HO-1 positively regulates GPX4 at both the transcriptional and protein levels. 4. HO-1 reduces intracellular ROS and inhibits ferroptosis via GPX4 Acknowledging the regulatory influence of HO-1 on GPX4, a key molecule in the iron death regulation, we investigated whether HO-1 affects the onset of ferroptosis through GPX4. Treatment of HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si26-HO-1 cells with Erastin, a ferroptosis inducer (10 μM), significantly reduced cell viability compared to the DMSO-treated group. This effect was antagonized by the ferroptosis inhibitor desferrioxamine (DFO) (Figure 4: A, B). In addition, Erastin treatment of MKN-45-VECTOR/ MKN-45-HO-1 cells (10 μM) inhibited the reduction in MKN-45-HO-1 cell viability relative to the DMSO-treated group (Figure 4: C). These results suggest that HO-1 may be associated with Erastin-induced ferroptosis. Examination of ROS levels in HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si26-HO-1 cells, measured using flow cytometry, revealed a significant increase after Erastin treatment, which was inhibited by the iron death inhibitor DFO (Figure 4: D, E). In MKN-45-VECTOR/ MKN-45-HO-1 cells, HO-1 reduced intracellular ROS levels (Figure 4: F). Furthermore, intracellular iron overload is one of the important signs of ferroptosis. Using FerroOrange to assess intracellular iron levels, we observed a significant decrease in sub-ferric ion content in HGC-27/AGS cells after HO-1 downregulation. This difference became more pronounced after Erastin treatment and was mitigated by DFO treatment (Figure 5: A, B). In contrast, the content of ferrous ions in MKN-45 cells increased with the upregulation of HO-1 expression (Figure 5: C). Next, we analyzed the glutathione (GSH) levels, a crucial substrate of GPX4, and the lipid peroxidation product C11 BODIPY 581/591. GSH content in HGC-27/AGS cells significantly decreased after HO-1 downregulation, with a more pronounced effect after Erastin treatment, which was alleviated by DFO treatment (Figure 5: D, E). Conversely, GSH content in MKN-45 cells increased with the upregulation of HO-1 expression (Figure 5: F). Following HO-1 downregulation, C11 BODIPY 581/591 content significantly increased in HGC-27/AGS cells, with a more pronounced effect after Erastin treatment. This increase was attenuated by DFO treatment (Figure 5: G, H). In MKN-45 cells, HO-1 expression was upregulated and C11 BODIPY 581/591 content was downregulated, with a more significant effect after Erastin treatment (Figure 5: I). These experimental results confirmed that HO-1 can reduce intracellular ROS, thereby inhibiting the occurrence of ferroptosis. Discussion In the present study, we identified HO-1 as a regulatory factor promoting gastric cancer progression. Mechanistically, HO-1 inhibits ferroptosis by upregulating the transcription of GPX4, leading to increased GPX4 protein levels and decreased ROS in gastric cancer cells. This discovery not only sheds light on a novel aspect of gastric cancer progression but also offers a potential therapeutic target for its treatment. Growing evidence supports the notion that HO-1 plays a role in accelerating tumor progression. For instance, its overexpression has been linked to enhanced survival in human renal cancer cell lines(27), with observed resistance to rapamycin- and sorafenib-induced apoptosis and inhibition of autophagy induction(28). However, information regarding the relationship between HO-1 and the malignant progression of gastric cancer, particularly the mechanism involving iron death, remains scarce. The present study is the first to elucidate that HO-1 can influence the malignant progression of gastric cancer through its association with iron death. Using raw letter analysis and immunohistochemical staining, we observed a high HO-1 expression in gastric cancer tissues. In addition, RT-qPCR and protein blotting assays confirmed elevated HO-1 expression in gastric cancer cell lines compared to normal gastric mucosa cells. However, CCK-8 and EDU in vitro proliferation assays showed that altering HO-1 alone had no impact on gastric cancer cell proliferation. While our clinical cases were relatively limited, prognostic information is undergoing further statistical analysis. To further explore the relationship between HO-1 and gastric cancer, we explored whether HO-1 could influence gastric cancer progression through the medium of iron death. Data analysis from public databases supported a connection between HO-1 and ferroptosis. Further experiments, including RT-qPCR and protein blotting, revealed consistent changes in GPX4 mRNA and protein expressions following HO-1 up or downregulation. This suggests that HO-1 may stabilize GPX4 protein levels through post-transcriptional translation. Notably, similar regulation by HO-1 was found to protect hepatocytes from ferroptosis(23). In addition, this regulation demonstrated protective effects on renal tubular epithelial cells in a mouse model of cisplatin-induced acute kidney injury(24). In summary, our findings establish a positive regulatory relationship between HO-1 and GPX4, the pivotal protein in ferroptosis. However, since HO-1 is not a transcription factor, the mechanism through which it affects the transcription process of GPX4 warrants further exploration. Subsequent experiments revealed that knocking down HO-1 increased the sensitivity of gastric cancer cells to Erastin and elevated intracellular ROS levels. In the context of cancer development, stimuli in the tumor microenvironment, including cytokine and growth factor release and metabolic remodeling, are crucial in addition to genetic changes. During metabolic remodeling, ROS plays a pivotal role as signaling molecules(25). While essential for normal cell proliferation, excessive ROS can lead to cell death(26). This study demonstrates that HO-1 reduces intracellular ROS by stabilizing GPX4 protein expression, thereby maintaining ROS homeostasis in gastric cancer cells and inhibiting ferroptosis. This, in turn, contributes to the promotion of gastric cancer progression. In summary, HO-1 expression increases during the malignant process of gastric cancer. Through the upregulation of GPX4 mRNA, it facilitates protein translation, resulting in reduced intracellular ROS and cellular protection from ferroptosis. Materials and methods Cell lines and cell culture Human gastric cancer cell lines AGS and HGC-27 were procured from Wuhan Procell Life Science & Technology Co, and MKN-45, NCL-N87, and GES-1 were obtained from iCell Bioscience Inc, Shanghai. These cell lines were confirmed to be free of mycoplasma contamination. All cell lines were cultured in RPMI 1640 (Gibco, Thermo Fisher Scientific, Germany) supplemented with 10% fetal bovine serum (Meisen CTCC) and 5% penicillin and streptomycin. The cells were maintained in a humidified atmosphere with 5% CO 2 at 37°C and used during their logarithmic growth phase. Immunohistochemistry analysis (IHC) Immunohistochemistry analysis (IHC) assays were performed to assess the expression of HO-1 using a Rabbit monoclonal antibody against HO-1 (1:80,000, Absin, abs159446) on 30 cases of gastric carcinoma sections. The assays were conducted using a biotin assay system (Beijing Zhongshan Jinqiao, China, Cat. No. PV-9001, PV-9002), following the manufacturer's instructions. For IHC analysis, the grading system utilized the following criteria: absence of staining denoted a score of 0, yellow staining denoted a score of 1, and brown staining denoted a score of 2. Based on the percentage of positively stained tumor cells in the visual field, a score of 0 was assigned for < 1% cells, a score of 1 for 1–25%, a score of 2 for 25–75%, and a score of 3 for 75–100%. The overall score was determined as the product of the intensity score and the percentage of positive cells. Quantitative real-time PCR (RT-qPCR) Total RNA was isolated from cultured cells using the standard Trizol (Invitrogen) protocol. Its integrity, quantity, and purity were assessed using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). Subsequently, 1 μg of total RNA was reverse transcribed using an all-in-one 5 × RT MasterMix (ABM, Canada). Real-time fluorescence quantitative PCR reactions were performed on an ABI ViiA7 Sequence Detection System (Life Technologies, USA) using SYBR Green Premix (ABI). Relative gene expression levels were analyzed using the comparative Ct method, where Ct is the cycle threshold number normalized to GAPDH. The primer sequences for HO-1 and GPX4 are provided below. HO-1: Forward: 5′-GGCCTCCCTGTACCACATCT-3′, Reverse: 5′-CTGCATGGCTGGTGTGTAGG-3′. GPX4: Forward:5'-ACGTCAAATTCGATATGTTCAGC -3', Reverse: 5'-AAGTTCCACTTGATGGCATTTC-3'. Western blot Cell lysates were prepared by combining protease and phosphatase inhibitors in equal proportions with radioimmunoprecipitation assay buffer. The protein concentration was quantified using the BCA Protein Assay kit (Yeasen Biotechnology, Shanghai). A total of 20 μg of proteins were separated using SDS-PAGE and electroblotted onto a PVDF membrane. The membrane was then enclosed in TBST containing 5% skim milk powder for 1 h and incubated with primary antibodies at 4℃ overnight. After washing thrice with TBST for 10 min each, the membrane was incubated with secondary antibodies diluted in a blocking buffer for 1 h at room temperature. Subsequently, the samples were rewashed three times with TBST and subjected to enhanced chemiluminescence (ECL) using an ECL kit (Yeasen Biotechnology, Shanghai). Densitometric analysis was conducted using ImageJ software. Antibodies for HO-1 (rabbit monoclonal antibody, abs159446, 1:1000), GPX4 (rabbit monoclonal antibody, abs136221, 1:1000), and β-Actin (rabbit monoclonal antibody, abs132001, 1:10,000) were procured from Shanghai Univision Co. GAPDH (murine monoclonal antibody, Cat No. 60004-1-Ig, 1:10,000) was obtained from Proteintech (Wuhan, China). CCK8 assay The CCK8 assay was performed following the manufacturer’s manual (Taojiao Biotechnology, Shanghai, China). In brief, 10,000 cells in 100 μl of culture were added to each well of a 96-well plate for 24, 48, and 72 h. At each time point, 10 μl of sterile CCK-8 was added to each well, and after 1 h of incubation at 37°C, the absorbance was measured at 450 nm using an enzyme meter. Small interfering RNAs (siRNAs), overexpression plasmids, and transfection protocol All siRNAs and plasmids for HO-1 overexpression were obtained from Suzhou Gemma Genetics Co. Cell transfection was performed following the Lipofectamine 3000 (Thermo Fisher Scientific, Germany) manual. RT-qPCR and protein blotting were used to detect the plasmid-mediated overexpression and silencing efficiency of HO-1 in GC cells. The sequences for siRNA and overexpression vectors are listed below. siRNA: HMOX1-Homo-263: sense(5′-3′)CCCUGUACCACAUCUAUGUTT; antisense(5-3′)ACAUAGAUGUGGUACAGGGTT. HMOX1-Homo-196: sense(5′-3′)GCUGAGUUCAUGAGGAACUTT; antisense(5′-3′)AGUUCCUCAUGAACUCAGCTT Conventional overexpression vectors: HMOX1 Home: (5′-3′)ATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCCTGAAGGAGGCCACCAAGGAGG TGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACTTTCAGAAGGGCCAGGTGACCCGAGACGGCTT CAAGCTGGTGATGGCCTCCCTGTACCACATCTATGTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAG AGCCCAGTCTTCGCCCCTGTCTACTTCCCAGAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGG CCTTCTGGTACGGGCCCCGCTGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCGCTATGTGAAGCG GCTCCACGAGGTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCTACCTGGGTGAC CTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACCTGCCCAGCTCTGGCGAGGGCC TGGCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACCAAGTTCAAGCAGCTCTACCGCTCCCGCATGAA CTCCCTGGAGATGACTCCCGCAGTCAGGCAGAGGGTGATAGAAGAGGCCAAGACTGCGTTCCTGCTCAAC ATCCAGCTCTTTGAGGAGTTGCAGGAGCTGCTGACCCATGACACCAAGGACCAGAGCCCCTCACGGGCAC CAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCC CCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACA GTTGCTGTAGGGCTTTATGCCATGTGA Measurement of lipid peroxidation Total cellular lipid peroxidation was measured using the C11 BODIPY (581/591) probe (Thermo Fisher Scientific, Germany). Cells were treated as indicated and incubated with 10 μM of C11 BODIPY in fresh medium for 30 min at 37℃. Subsequently, excess C11 BODIPY was eliminated by washing the cells twice with PBS. The labeled cells were trypsin-digested, resuspended in PBS, and subjected to flow cytometry analysis. Oxidation of the polyunsaturated butadiene fraction of C11 BODIPY induced a shift in the fluorescence emission peak from ~590 nm to ~510 nm, correlating with lipid peroxidation production, and was evaluated using a flow cytometer (BD Biosciences, USA). Measurement of ROS DCFH-DA (Thermo Fisher Scientific, Germany) was used to measure ROS levels following the manufacturer’s protocol. Briefly, cells were seeded in 6-well plates and exposed to Erastin for 24 h. After the treatment, cells were harvested, washed twice with PBS, and subjected to labeling with 20 μM DCFH-DA for 30 min at 37℃. The labeled cells were collected, and their DCF fluorescence intensity was analyzed using flow cytometry (BD Biosciences, USA). Determination of the labile iron pool The labile iron pool was determined using FerroOrange, an orange fluorescent probe specialized for detecting unstable iron (II) ions (Fe 2+ ). Cells were seeded in 6-well plates and treated with Erastin for 24 h. After treatment, cells were washed twice with PBS and incubated with 2 uM FerroOrange (Maokang Biotechnology Co., Ltd., Shanghai) for 30 min at 37℃. Subsequently, the cells were washed with PBS and analyzed using fluorescence microscopy. The absorption maximum was observed at 542 nm for FerroOrange, and the fluorescence maximum was observed at 572 nm. The level of unstable iron was calculated based on the average fluorescence intensity of the cells. Measurement of glutathione Monochlorobimane was used to detect GSH in cells. Cells were seeded in 6-well plates and treated with Erastin for 24 h. After treatment, cells were washed twice with PBS and incubated with 20 μM monochlorobimane (mBCL, HY-101899, MedChemExpress) for 30 min at 37℃. After three washes with fresh serum-free medium, the associated fluorescence intensity was measured using flow cytometry or fluorescence inverted microscopy under specific excitation (Ex: 380 nm) and emission (Em: 470 nm) light. Bioinformatic analysis 1.1. Ferroptosis-Related Genes Collection A collection of ferroptosis-related genes consisting of 721-encoded proteins was obtained from the GeneCards database (https://www.genecards.org/). 1.2. Gene Expression Data Collection mRNA data and clinical information for patients with stomach adenocarcinoma (STAD) were collected from The Cancer Genome Atlas (TCGA). The discovery cohort, obtained from TCGA, consisted of data on patients with STAD. A total of 18,587 differentially expressed genes were identified using the differential analysis between GBM and normal tissues . Statistical analysis All experiments were conducted at least three times, and data are expressed as mean ± SD. Statistical significance between treatments was assessed using Student’s t-test, with p-value < 0.05 considered statistically significant. All data generated or analysed during this study are included in this published article [and its supplementary information files]. References Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021 May;71(3):209-249. doi: 10.3322/caac.21660. Epub 2021 Feb 4. PMID: 33538338. Cristescu R, Lee J, Nebozhyn M, Kim KM, Ting JC, Wong SS, Liu J, Yue YG, Wang J, Yu K, Ye XS, Do IG, Liu S, Gong L, Fu J, Jin JG, Choi MG, Sohn TS, Lee JH, Bae JM, Kim ST, Park SH, Sohn I, Jung SH, Tan P, Chen R, Hardwick J, Kang WK, Ayers M, Hongyue D, Reinhard C, Loboda A, Kim S, Aggarwal A. Molecular analysis of gastric cancer identifies subtypes associated with distinct clinical outcomes. Nat Med. 2015 May;21(5):449-56. doi: 10.1038/nm.3850. Epub 2015 Apr 20. PMID: 25894828. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B 3rd, Stockwell BR. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012 May 25;149(5):1060-72. doi: 10.1016/j.cell.2012.03.042. PMID: 22632970; PMCID: PMC3367386.3、Alam J., Cook J.L. How many transcription factors does it take to turn on the heme oxygenase-1 gene? Am. J. Respir. Cell Mol. Biol. 2007;36:166–174. doi: 10.1165/rcmb.2006-0340TR. Frazer DM, Anderson GJ. The regulation of iron transport. Biofactors. 2014 Mar-Apr;40(2):206-14. doi: 10.1002/biof.1148. Epub 2013 Oct 17. PMID: 24132807. Bogdan AR, Miyazawa M, Hashimoto K, Tsuji Y. Regulators of Iron Homeostasis: New Players in Metabolism, Cell Death, and Disease. Trends Biochem Sci. 2016 Mar;41(3):274-286. doi: 10.1016/j.tibs.2015.11.012. Epub 2015 Dec 23. PMID: 26725301; PMCID: PMC4783254. Gao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell. 2015 Jul 16;59(2):298-308. doi: 10.1016/j.molcel.2015.06.011. Epub 2015 Jul 9. PMID: 26166707; PMCID: PMC4506736. Sun X, Ou Z, Xie M, Kang R, Fan Y, Niu X, Wang H, Cao L, Tang D. HSPB1 as a novel regulator of ferroptotic cancer cell death. Oncogene. 2015 Nov 5;34(45):5617-25. doi: 10.1038/onc.2015.32. Epub 2015 Mar 2. PMID: 25728673; PMCID: PMC4640181. Wang Y, Zheng L, Shang W, Yang Z, Li T, Liu F, Shao W, Lv L, Chai L, Qu L, Xu Q, Du J, Liang X, Zeng J, Jia J. Wnt/beta-catenin signaling confers ferroptosis resistance by targeting GPX4 in gastric cancer. Cell Death Differ. 2022 Nov;29(11):2190-2202. doi: 10.1038/s41418-022-01008-w. Epub 2022 May 9. PMID: 35534546; PMCID: PMC9613693. Zhang H, Deng T, Liu R, Ning T, Yang H, Liu D, Zhang Q, Lin D, Ge S, Bai M, Wang X, Zhang L, Li H, Yang Y, Ji Z, Wang H, Ying G, Ba Y. CAF secreted miR-522 suppresses ferroptosis and promotes acquired chemo-resistance in gastric cancer. Mol Cancer. 2020 Feb 27;19(1):43. doi: 10.1186/s12943-020-01168-8. PMID: 32106859; PMCID: PMC7045485. Ryter S.W., Alam J., Choi A.M. Heme oxygenase-1/carbon monoxide: From basic science to therapeutic applications. Physiol. Rev. 2006;86:583–650. doi: 10.1152/physrev.00011.2005. Vitek L., Schwertner H.A. The heme catabolic pathway and its protective effects on oxidative stress-mediated diseases. Adv. Clin. Chem. 2007;43:1–57. Kwon M.Y., Park E., Lee S.J., Chung S.W. Heme oxygenase-1 accelerates Erastin induced Ferroptotic cell death. Oncotarget. 2015;6:24393–24403. doi: 10.18632/oncotarget.5162. Chang L.C., Chiang S.K., Chen S.E., Yu Y.L., Chou R.H., Chang W.C. Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis. Cancer Lett. 2018;416:124–137. doi: 10.1016/j.canlet.2017.12.025. Hassannia B., Wiernicki B., Ingold I., Qu F., Van Herck S., Tyurina Y.Y., Bayır H., Abhari B.A., Angeli J.P.F., Choi S.M., et al. Nano-targeted induction of dual ferroptotic mechanisms eradicates high-risk neuroblastoma. J. Clin. Investig. 2018;128:3341–3355. doi: 10.1172/JCI99032. Sugimoto R, Tanaka Y, Noda K, Kawamura T, Toyoda Y, Billiar TR, McCurry KR, Nakao A. Preservation solution supplemented with biliverdin prevents lung cold ischaemia/reperfusion injury. Eur J Cardiothorac Surg. 2012 Dec;42(6):1035-41. doi: 10.1093/ejcts/ezs298. Epub 2012 May 30. PMID: 22648925; PMCID: PMC4334840. Jomova K., Vondrakova D., Lawson M., Valko M. Metals, oxidative stress and neurodegenerative disorders. Mol. Cell. Biochem. 2010;345:91–104. doi: 10.1007/s11010-010-0563-x. . Sunamura M., Duda D.G., Ghattas M.H., Lozonschi L., Motoi F., Yamauchi J., Matsuno S., Shibahara S., Abraham N.G. Heme oxygenase-1 accelerates tumor angiogenesis of human pancreatic cancer. Angiogenesis. 2003;6:15–24. doi: 10.1023/A:1025803600840. Deshane J., Chen S., Caballero S., Grochot-Przeczek A., Was H., Li Calzi S., Lach R., Hock T.D., Chen B., Hill-Kapturczak N., et al. Stromal cell-derived factor 1 promotes angiogenesis via a heme oxygenase 1-dependent mechanism. J. Exp. Med. 2007;204:605–618. doi: 10.1084/jem.20061609. Luo P, Liu D, Zhang Q, Yang F, Wong YK, Xia F, Zhang J, Chen J, Tian Y, Yang C, Dai L, Shen HM, Wang J. Celastrol induces ferroptosis in activated HSCs to ameliorate hepatic fibrosis via targeting peroxiredoxins and HO-1. Acta Pharm Sin B. 2022 May;12(5):2300-2314. doi: 10.1016/j.apsb.2021.12.007. Tang Z, Ju Y, Dai X, Ni N, Liu Y, Zhang D, Gao H, Sun H, Zhang J, Gu P. HO-1-mediated ferroptosis as a target for protection against retinal pigment epithelium degeneration. Redox Biol. 2021 Jul;43:101971. doi: 10.1016/j.redox.2021.101971. Huang Y, Yang Y, Xu Y, Ma Q, Guo F, Zhao Y, Tao Y, Li M, Guo J. Nrf2/HO-1 Axis Regulates the Angiogenesis of Gastric Cancer via Targeting VEGF. Cancer Manag Res. 2021 Apr 12;13:3155-3169. doi: 10.2147/CMAR.S292461. Yin Y, Liu Q, Wang B, Chen G, Xu L, Zhou H. Expression and function of heme oxygenase-1 in human gastric cancer. Exp Biol Med (Maywood). 2012 Apr;237(4):362-71. doi: 10.1258/ebm.2011.011193. Yang W, Wang Y, Zhang C, Huang Y, Yu J, Shi L, Zhang P, Yin Y, Li R, Tao K. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022 Apr 4;13:865689. doi: 10.3389/fphar.2022.865689. Lin Q, Li S, Jin H, Cai H, Zhu X, Yang Y, Wu J, Qi C, Shao X, Li J, Zhang K, Zhou W, Zhang M, Cheng J, Gu L, Mou S, Ni Z. Mitophagy alleviates cisplatin-induced renal tubular epithelial cell ferroptosis through ROS/HO-1/GPX4 axis. Int J Biol Sci. 2023 Feb 13;19(4):1192-1210. doi: 10.7150/ijbs.80775. Hayes JD, Dinkova-Kostova AT, Tew KD. Oxidative stress in cancer. Cancer Cell. 2020;38:167–97. doi: 10.1016/j.ccell.2020.06.001. Chatterjee R, Chatterjee J. ROS and oncogenesis with special reference to EMT and stemness. Eur J Cell Biol. 2020;99:151073. doi: 10.1016/j.ejcb.2020.151073. Additional Declarations No competing interests reported. Supplementary Files 60HStmAde060PG01.xls Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3883283\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":270985475,\"identity\":\"48905e2e-8b27-444b-a41e-8f0494f67b08\",\"order_by\":0,\"name\":\"Shiqi Shi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"1、Wuxi school of medicine, Jiangnan university 2、The Affiliated Children's Hospital of Jiangnan University, Wuxi People's Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shiqi\",\"middleName\":\"\",\"lastName\":\"Shi\",\"suffix\":\"\"},{\"id\":270985476,\"identity\":\"e6d55f52-8846-4cc2-b2d9-a3a5b0aab325\",\"order_by\":1,\"name\":\"Hanyu Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"1、Wuxi school of medicine, Jiangnan university 2、The Affiliated Children's Hospital of Jiangnan University, Wuxi People's Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hanyu\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":270985477,\"identity\":\"947261d1-82c5-42c6-a0a0-ffe78406b719\",\"order_by\":2,\"name\":\"Huiyao Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"1、Wuxi school of medicine, Jiangnan university 2、The Affiliated Children's Hospital of Jiangnan University, Wuxi People's Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Huiyao\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":270985478,\"identity\":\"59b0be2d-8449-413e-a797-156edafd3101\",\"order_by\":3,\"name\":\"Shuai Liang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"1、Wuxi school of medicine, Jiangnan university 2、The Affiliated Children's Hospital of Jiangnan University, Wuxi People's Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shuai\",\"middleName\":\"\",\"lastName\":\"Liang\",\"suffix\":\"\"},{\"id\":270985479,\"identity\":\"5efe4a11-c73a-4664-ae94-305f58e6c75d\",\"order_by\":4,\"name\":\"Dong Hua\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYBACxvbGBuMfFTb19u0NRGph7jncUMxwJi3BgOcAkVrYZ6Q3fGZsO5xgIJFApBbehsTGzYVtaXnmko833mCosYkmqEWy4WCz8YxzNsWWs9OKLRiOpeU2ENJi2NjYZsBTlsbYcDvHTIKx4TBhLfaHGdt/8LAdZmy4eYZILYxtjA3GPG2HEzfc4CFWSw9jg+GMM2nGkj1AvyQQ4xfG+c8fGHyosJHjZz+88caHGhvCWpAB8VGDpIVUHaNgFIyCUTAyAACMV0ZuxXo0bwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"1、Wuxi school of medicine, Jiangnan university 2、The Affiliated Children's Hospital of Jiangnan University, Wuxi People's Hospital\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Dong\",\"middleName\":\"\",\"lastName\":\"Hua\",\"suffix\":\"\"},{\"id\":270985480,\"identity\":\"1b7b7109-092d-46ff-a773-fcb75cf81a45\",\"order_by\":5,\"name\":\"Xiaolu Yu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second People's Hospital of Jingdezhen\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaolu\",\"middleName\":\"\",\"lastName\":\"Yu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-01-21 02:59:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3883283/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3883283/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":50672559,\"identity\":\"8e74ff83-98eb-4e09-9a65-2fdf6d343654\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:52:07\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3509523,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHO-1 is upregulated in primary gastric cancer.\\u003c/p\\u003e\\n\\u003cp\\u003eA: Pan-cancer analysis of HO-1 protein was performed through the GEPIA public website.C: Differential analysis of HO-1 in GC by TCGA and GSE54329 databases, respectively.D: Representative plots of gastric cancer tissues versus paracancerous tissues in IHC.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIG1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/075c05de552d4a863e93cba2.png\"},{\"id\":50671652,\"identity\":\"6d108675-d6ad-4bc5-b60b-7a623aa0c75a\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:44:07\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2144458,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHO-1 has no effect on the proliferation of gastric cancer cells in vitro.\\u003c/p\\u003e\\n\\u003cp\\u003eA, B: RT-RQPCR and WB analyses showing HO-1 expression in different GC cell lines.C: Protein blotting experiments with knockdown and overexpression plasmids transiently transfected with HGC-27, AGS, and MKN-45.D, E, F: CCK-8 for detection of proliferation of HGC27/AGS-siNC/HGC27/AGS-si196-HO-1/HGC27/AGS-si263-HO-1and MKN-45-Vector/MKN-45-HO-1 at 12, 24 and 48 hours. Statistical significance was assessed by paired t-test.G, H, I: EDU for detection of proliferation of HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si263-HO-1 and MKN-45-Vector/MKN-45-HO-1 at 24 hours. Representative images (left panel) and quantification results (right panel) are shown. Statistical significance was assessed by unpaired t-test. Scale bar is: 50uM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIG2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/7874518899a5c8c23e58a024.png\"},{\"id\":50671651,\"identity\":\"bfe3c1d1-69d0-4fd0-83ff-6e1d5a6dbde4\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:44:07\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1262640,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHO-1 affects GPX4 protein expression.\\u003c/p\\u003e\\n\\u003cp\\u003eA, B, C: RT-QPCR showing mRNA expression of GPX4 in AGS and HGC-27 after knockdown of HO-1 and in MKN-45 after overexpression of HO-1. D, E, F: WB showing protein expression of GPX4 in AGS and HGC-27 after knockdown of HO-1 and in MKN-45 after overexpression of HO-1.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIG3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/838a4b688b15cd05f9677725.png\"},{\"id\":50672560,\"identity\":\"534374f2-8f60-43bd-b860-2b8b1ad8a688\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:52:07\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":870190,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHO-1 reduces intracellular ROS and inhibits iron death via GPX4.\\u003c/p\\u003e\\n\\u003cp\\u003eA, B Treatment of HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si263-HO-1 cells with erastin, an iron death inducer (10 μM), significantly reduced cell viability compared to the DMSO-treated group.At the same time, the above results can be antagonized by the iron death inhibitor desferrioxamine (DFO).C: Treatment of MKN-45-VECTOR/ MKN-45-HO-1 cells with erastin (10 μM) inhibited the reduction of MKN-45-HO-1 cell viability relative to the DMSO-treated group.D, E ROS levels in HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si263-HO-1 cells were further examined by Flow Cytometry (FCM). The results showed that intracellular ROS increased significantly after Erastin treatment, while DFO inhibited the above effects.F: In MKN-45-VECTOR/ MKN-45-HO-1 cells, HO-1 reduced intracellular ROS levels.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIG4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/7d596db8063bdf32284e8e2f.png\"},{\"id\":50671653,\"identity\":\"d2131c3e-b37b-4b81-a231-e4b2f09c54a1\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:44:07\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1279155,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA, B: Levels of ferrous ions (Fe2+) in HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si26-HO-1 cells treated with Erastin as well as ferric chelator (DFO) were visualized by fluorescence microscopy.C: In MKN-45-VECTOR/ MKN-45-HO-1 cells, HO-1 decreased the intracellular level of free ferrous iron. Representative images (left panel) and quantification results (right panel) are shown. The scale bar is: 100uM.D, E GSH levels in HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si263-HO-1 cells were further detected by Flow Cytometry (FCM). The results showed that intracellular GSH was significantly decreased after Erastin treatment, while DFO inhibited the above effects.F: In MKN-45-VECTOR/ MKN-45-HO-1 cells, HO-1 increased intracellular GSH levels.G, H: It was further observed by flow cytometry that knockdown of HO-1 significantly increased intracellular lipid peroxidation and was antagonized by DFO after treatment with Erastin.I: Overexpression of HO-1, on the other hand, decreased MKN-45 cells' lipid peroxidation levels.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIG5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/95eb38e89a945359ada9859d.png\"},{\"id\":66138798,\"identity\":\"1c8055e6-d8ef-4833-9b8b-76fc30dc6195\",\"added_by\":\"auto\",\"created_at\":\"2024-10-08 05:55:15\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":9806917,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/38d9263d-d6aa-45ac-8dd4-a7401fe5f0be.pdf\"},{\"id\":50671649,\"identity\":\"d0dc5099-21f2-47c9-b681-5fafe9edb5a5\",\"added_by\":\"auto\",\"created_at\":\"2024-02-05 14:44:07\",\"extension\":\"xls\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":37888,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"60HStmAde060PG01.xls\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3883283/v1/d0c17ab692ee5304c23cdde1.xls\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Heme oxygenase-1 (HO-1) induces resistance to ferroptosis in gastric cancer by targeting GPX4 Author：\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eGastric cancer persists as a significant global malignancy of the digestive tract, ranking fifth in incidence and fourth in mortality worldwide(1). The high proliferative capacity of gastric cancer cells poses a substantial challenge; however, the underlying mechanisms of cancer cell proliferation are unclear. The unfavorable prognosis for patients with gastric cancer predominantly stems from inadequate responses to current treatments(2). Therefore, it is imperative to identify precise and novel treatment modalities for patients with gastric cancer.\\u003c/p\\u003e\\n\\u003cp\\u003eFerroptosis, a form of cell death distinct from apoptosis, necrosis, and autophagy characterized by iron-dependent accumulation of reactive oxygen species (ROS) leading to lipid peroxidation,\\u0026nbsp;has emerged as a noteworthy phenomenon(3). Numerous genes and proteins implicated in regulating iron metabolism play pivotal roles in ferroptosis(4)(5)(6)(7). In recent years, the role of ferroptosis in gastric cancer has revealed protective mechanisms, such as\\u0026nbsp;Wnt/beta-catenin signaling(8) and\\u0026nbsp;cancer-associated fibroblasts(9),\\u0026nbsp;which shield gastric cancer cells from ferroptosis, thereby advancing the progression of gastric cancer.\\u003c/p\\u003e\\n\\u003cp\\u003eMolecularly targeted therapy, a novel approach to treating malignant tumors, has gained prominence in recent years. Heme oxygenase-1 (HO-1), the rate-limiting enzyme in heme catabolism, has three identified mammalian subtypes, such as HO-1, HO-2, and HO-3. HO-1 and HO-2 are present in humans and rats, while HO-3 is found exclusively in rats. The HMOX2 subtype is constitutively expressed, encoding a 36 kDa HO-2 protein that primarily maintains the basal metabolism of heme. Moreover, HO-1 is inducible, and its synthesis is enhanced in response to prooxidative stimuli, encompassing oxidants, cytokines, heavy metals, and physical cues such as ischemia/reperfusion injury and hypoxia/hyperoxia. Encoded by the HMOX1 type, HO-1 has an approximate molecular weight of 32 kDa, also recognized as heat shock protein 32.\\u003c/p\\u003e\\n\\u003cp\\u003eHO-1 catalyzes heme degradation, yielding carbon monoxide, ferrous iron, and biliverdin. Notably, chlorophyll exerts a protective effect by inhibiting lipid and protein peroxidation through the scavenging of ROS(15). HO-1 acts as a dual regulator of iron and ROS homeostasis (10)(11) and is deemed to exert a prominent influence in the context of iron-induced cell death(12)(13)(14). Moreover, a correlation was observed between increased HO-1 expression and heightened lipid peroxidation in patients with Alzheimer\\u0026rsquo;s disease(16). In addition, upregulation of HO-1 has demonstrated efficacy in preventing hepatic fibrosis caused by peroxidation(19). HO-1-mediated ferroptosis emerges as an essential factor in the retinal pigment epithelial cell degeneration(20).\\u003c/p\\u003e\\n\\u003cp\\u003eHowever, a deeper investigation into the role of HO-1 reveals contradictory evidence, suggesting that HO-1 may accelerate tumor progression. For instance, high HO-1 expression in a mouse model of human primary head and neck squamous carcinoma correlated with faster malignant progression(17). HO-1 overexpression in pancreatic cancer cells significantly promoted tumor angiogenesis and accelerated lung metastasis development(18). Despite these findings, the molecular mechanisms by which HO-1 promotes malignant progression in gastric cancer require further exploration.\\u003c/p\\u003e\\n\\u003cp\\u003eIn the present study, we investigated the role of HO-1 in promoting gastric cancer, positing a hypothesis that HO-1 could potentially inhibit gastric cancer progression by regulating GPX4 and ferroptosis.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e1.\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Upregulation of HO-1 in primary gastric cancer\\u003c/p\\u003e\\n\\u003cp\\u003eOur pan-cancer analysis using the GEPIA database revealed a consistent upregulation of HO-1 in primary gastric cancer tissues (Figure 1: A). To validate these findings, we corroborated the results with GEO RNA-seq analysis (GSE54129) (Figure 1: C) and the TCGA database (Figure 1: B). Both datasets consistently demonstrated a significant upregulation of HO-1 in primary gastric cancer tissues. Immunohistochemical analysis of 30 pairs of GC and paracarcinoma tissues further confirmed the high expression of HO-1 in gastric cancer tissues, regardless of differentiation grade (Figure 1: D).\\u003c/p\\u003e\\n\\u003cp\\u003e2.\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Limited impact of HO-1 on gastric cancer proliferation in vitro\\u003c/p\\u003e\\n\\u003cp\\u003eExamination of HO-1 mRNA and protein levels in gastric cancer cell lines revealed higher expression in AGS and HGC-27 cell lines compared to NCL-N87 and MKN-45 (Figure 2: A, B,C). However, reduced HO-1 expression in HGC-27 and AGS cell lines and HO-1 overexpression in MKN-45 cell line (Figure 2: D, E, F) did not exhibit any knockdown or overexpression effect on gastric cancer cell proliferation (Figure 2: G, H,I), as evidenced by CCK-8 and EDU assays. Overall, the alteration of HO-1 alone was not sufficient to inhibit the proliferation of gastric cancer cells in vitro.\\u003c/p\\u003e\\n\\u003cp\\u003e3.\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Impact of HO-1 on GPX4 protein expression\\u003c/p\\u003e\\n\\u003cp\\u003eTo further explore the proliferative effects of HO-1 on gastric cancer cell lines, we delved into its role as a dual regulator of iron and ROS homeostasis, potentially playing a dominant role in ferroptosis.\\u003c/p\\u003e\\n\\u003cp\\u003eThe intersection analysis of the ferroptosis and GC genomes in public databases confirmed the presence of HO-1 in this overlap (Figure 3: A). In addition, we correlated HO-1 with iron death-associated proteins, and Pearson correlation line analysis in the GSE54129 dataset in the GEO database exhibited a significant correlation between HO-1 and GPX4 gene expression (all p-values \\u0026lt; 0.05) (Figure 3: B). Subsequent confirmation through RT-qPCR and Western Blot experiments demonstrated that HO-1 knockdown decreased GPX4 protein levels (Figure 3: C,D) and altered mRNA levels (Figure 3: F,G,). However, overexpressing cell lines exhibited the opposite results (Figure 3: E, H).\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, these findings suggest that HO-1 positively regulates GPX4 at both the transcriptional and protein levels.\\u003c/p\\u003e\\n\\u003cp\\u003e4.\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;HO-1 reduces intracellular ROS and inhibits ferroptosis via GPX4\\u003c/p\\u003e\\n\\u003cp\\u003eAcknowledging the regulatory influence of HO-1 on GPX4, a key molecule in the iron death regulation, we investigated whether HO-1 affects the onset of ferroptosis through GPX4. Treatment of HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si26-HO-1 cells with Erastin, a ferroptosis inducer (10 \\u0026mu;M), significantly reduced cell viability compared to the DMSO-treated group. This effect was antagonized by the ferroptosis inhibitor desferrioxamine (DFO) (Figure 4: A, B). In addition, Erastin treatment of MKN-45-VECTOR/ MKN-45-HO-1 cells (10 \\u0026mu;M) inhibited the reduction in MKN-45-HO-1 cell viability relative to the DMSO-treated group (Figure 4: C). These results suggest that HO-1 may be associated with Erastin-induced ferroptosis.\\u003c/p\\u003e\\n\\u003cp\\u003eExamination of ROS levels in HGC27/AGS-siNC / HGC27/AGS-si196-HO-1 / HGC27/AGS-si26-HO-1 cells, measured using flow cytometry, revealed a significant increase after Erastin treatment, which was inhibited by the iron death inhibitor DFO (Figure 4: D, E). In MKN-45-VECTOR/ MKN-45-HO-1 cells, HO-1 reduced intracellular ROS levels (Figure 4: F).\\u003c/p\\u003e\\n\\u003cp\\u003eFurthermore, intracellular iron overload is one of the important signs of ferroptosis. Using FerroOrange to assess intracellular iron levels, we observed a significant decrease in sub-ferric ion content in HGC-27/AGS cells after HO-1 downregulation. This difference became more pronounced after Erastin treatment and was mitigated by DFO treatment (Figure 5: A, B). In contrast, the content of ferrous ions in MKN-45 cells increased with the upregulation of HO-1 expression (Figure 5: C).\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we analyzed the glutathione (GSH) levels, a crucial substrate of GPX4, and the lipid peroxidation product C11 BODIPY 581/591. GSH content in HGC-27/AGS cells significantly decreased after HO-1 downregulation, with a more pronounced effect after Erastin treatment, which was alleviated by DFO treatment (Figure 5: D, E). Conversely, GSH content in MKN-45 cells increased with the upregulation of HO-1 expression (Figure 5: F). Following HO-1 downregulation, C11 BODIPY 581/591 content significantly increased in HGC-27/AGS cells, with a more pronounced effect after Erastin treatment. This increase was attenuated by DFO treatment (Figure 5: G, H). In MKN-45 cells, HO-1 expression was upregulated and C11 BODIPY 581/591 content was downregulated, with a more significant effect after Erastin treatment (Figure 5: I).\\u003c/p\\u003e\\n\\u003cp\\u003eThese experimental results confirmed that HO-1 can reduce intracellular ROS, thereby inhibiting the occurrence of ferroptosis.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn the present study, we identified HO-1 as a regulatory factor promoting gastric cancer progression. Mechanistically, HO-1 inhibits ferroptosis by upregulating the transcription of GPX4, leading to increased GPX4 protein levels and decreased ROS in gastric cancer cells. This discovery not only sheds light on a novel aspect of gastric cancer progression but also offers a potential therapeutic target for its treatment.\\u003c/p\\u003e\\n\\u003cp\\u003eGrowing evidence supports the notion that HO-1 plays a role in accelerating tumor progression. For instance, its overexpression has been linked to enhanced survival in human renal cancer cell lines(27),\\u0026nbsp;with observed resistance to rapamycin- and sorafenib-induced apoptosis and inhibition of autophagy induction(28). However, information regarding the relationship between HO-1 and the malignant progression of gastric cancer, particularly the mechanism involving iron death, remains scarce. The present study is the first to elucidate that HO-1 can influence the malignant progression of gastric cancer through its association with iron death.\\u003c/p\\u003e\\n\\u003cp\\u003eUsing raw letter analysis and immunohistochemical staining, we observed a high HO-1 expression in gastric cancer tissues. In addition, RT-qPCR and protein blotting assays confirmed elevated HO-1 expression in gastric cancer cell lines compared to normal gastric mucosa cells. However, CCK-8 and EDU in vitro proliferation assays showed that altering HO-1 alone had no impact on gastric cancer cell proliferation. While our clinical cases were relatively limited, prognostic information is undergoing further statistical analysis.\\u003c/p\\u003e\\n\\u003cp\\u003eTo further explore the relationship between HO-1 and gastric cancer, we explored whether HO-1 could influence gastric cancer progression through the medium of iron death. Data analysis from public databases supported a connection between HO-1 and ferroptosis. Further experiments, including RT-qPCR and protein blotting, revealed consistent changes in GPX4 mRNA and protein expressions following HO-1 up or downregulation. This suggests that HO-1 may stabilize GPX4 protein levels through post-transcriptional translation. Notably, similar regulation by HO-1 was found to protect hepatocytes from ferroptosis(23). In addition,\\u0026nbsp;this regulation demonstrated protective effects on renal tubular epithelial cells in a mouse model of cisplatin-induced acute kidney injury(24). In summary, our findings establish a positive regulatory relationship between HO-1 and GPX4, the pivotal protein in ferroptosis. However, since HO-1 is not a transcription factor, the mechanism through which it affects the transcription process of GPX4 warrants further exploration.\\u003c/p\\u003e\\n\\u003cp\\u003eSubsequent experiments revealed that knocking down HO-1 increased the sensitivity of gastric cancer cells to Erastin and elevated intracellular ROS levels.\\u003c/p\\u003e\\n\\u003cp\\u003eIn the context of cancer development, stimuli in the tumor microenvironment, including cytokine and growth factor release and metabolic remodeling, are crucial in addition to genetic changes. During metabolic remodeling, ROS plays a pivotal role as signaling molecules(25). While essential for normal cell proliferation, excessive ROS can lead to cell death(26). This study demonstrates that HO-1 reduces intracellular ROS by stabilizing GPX4 protein expression, thereby maintaining ROS homeostasis in gastric cancer cells and inhibiting ferroptosis. This, in turn, contributes to the promotion of gastric cancer progression.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, HO-1 expression increases during the malignant process of gastric cancer. Through the upregulation of GPX4 mRNA, it facilitates protein translation, resulting in reduced intracellular ROS and cellular protection from ferroptosis.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003ch3\\u003eCell lines and cell culture\\u003c/h3\\u003e\\n\\u003cp\\u003eHuman gastric cancer cell lines AGS and HGC-27 were procured from Wuhan Procell Life Science \\u0026amp; Technology Co, and MKN-45, NCL-N87, and GES-1 were obtained from iCell Bioscience Inc, Shanghai. These cell lines were confirmed to be free of mycoplasma contamination. All cell lines were cultured in RPMI 1640 (Gibco, Thermo Fisher Scientific, Germany) supplemented with 10% fetal bovine serum (Meisen CTCC) and 5% penicillin and streptomycin. The cells were maintained in a humidified atmosphere with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e at 37\\u0026deg;C and used during their logarithmic growth phase.\\u003c/p\\u003e\\n\\u003cp\\u003eImmunohistochemistry analysis (IHC)\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eImmunohistochemistry analysis (IHC) assays were performed to assess the expression of HO-1 using a Rabbit monoclonal \\u0026nbsp;antibody against HO-1 (1:80,000, Absin,\\u0026nbsp;abs159446) on 30 cases of\\u0026nbsp;gastric carcinoma\\u0026nbsp;sections. The assays were conducted using a biotin assay system (Beijing Zhongshan Jinqiao, China, Cat. No. PV-9001, PV-9002), following the manufacturer\\u0026apos;s instructions. For IHC analysis, the grading system utilized the following criteria: absence of staining denoted a score of 0, yellow staining denoted a score of 1, and brown staining denoted a score of 2. Based on the percentage of positively stained tumor cells in the visual field, a score of 0 was assigned for\\u0026thinsp;\\u0026lt;\\u0026thinsp;1% cells, a score of 1 for 1\\u0026ndash;25%, a score of 2 for 25\\u0026ndash;75%, and a score of 3 for 75\\u0026ndash;100%. The overall score was determined as the product of the intensity score and the percentage of positive cells.\\u003c/p\\u003e\\n\\u003ch3\\u003eQuantitative real-time PCR (RT-qPCR)\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from cultured cells using the standard Trizol (Invitrogen) protocol. Its integrity, quantity, and purity were assessed using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). Subsequently, 1 \\u0026mu;g of total RNA was reverse transcribed using an all-in-one 5 \\u0026times; RT MasterMix (ABM, Canada). Real-time fluorescence quantitative PCR reactions were performed on an ABI ViiA7 Sequence Detection System (Life Technologies, USA) using SYBR Green Premix (ABI). Relative gene expression levels were analyzed using the comparative Ct method, where Ct is the cycle threshold number normalized to GAPDH. The primer sequences for HO-1 and GPX4 are provided below.\\u003c/p\\u003e\\n\\u003cp\\u003eHO-1:\\u0026nbsp;Forward: 5\\u0026prime;-GGCCTCCCTGTACCACATCT-3\\u0026prime;,\\u003c/p\\u003e\\n\\u003cp\\u003eReverse: 5\\u0026prime;-CTGCATGGCTGGTGTGTAGG-3\\u0026prime;.\\u003c/p\\u003e\\n\\u003cp\\u003eGPX4:\\u0026nbsp;Forward:5\\u0026apos;-ACGTCAAATTCGATATGTTCAGC -3\\u0026apos;,\\u003c/p\\u003e\\n\\u003cp\\u003eReverse: 5\\u0026apos;-AAGTTCCACTTGATGGCATTTC-3\\u0026apos;.\\u003c/p\\u003e\\n\\u003ch3\\u003eWestern blot\\u003c/h3\\u003e\\n\\u003cp\\u003eCell lysates were prepared by combining protease and phosphatase inhibitors in equal proportions with radioimmunoprecipitation assay buffer. The protein concentration was quantified using the BCA Protein Assay kit (Yeasen Biotechnology, Shanghai). A total of 20 \\u0026mu;g of proteins were separated using SDS-PAGE and electroblotted onto a PVDF membrane. The membrane was then enclosed in TBST containing 5% skim milk powder for 1 h and incubated with primary antibodies at 4℃ overnight. After washing thrice with TBST for 10 min each, the membrane was incubated with secondary antibodies diluted in a blocking buffer for 1 h at room temperature. Subsequently, the samples were rewashed three times with TBST and subjected to enhanced chemiluminescence (ECL) using an ECL kit (Yeasen Biotechnology, Shanghai). Densitometric analysis was conducted using ImageJ software.\\u003c/p\\u003e\\n\\u003cp\\u003eAntibodies for HO-1 (rabbit monoclonal antibody, abs159446, 1:1000), GPX4 (rabbit monoclonal antibody, abs136221, 1:1000), and \\u0026beta;-Actin (rabbit monoclonal antibody, abs132001, 1:10,000) were procured from Shanghai Univision Co. GAPDH (murine monoclonal antibody, Cat No. 60004-1-Ig, 1:10,000) was obtained from Proteintech (Wuhan, China).\\u003c/p\\u003e\\n\\u003ch3\\u003eCCK8 assay\\u003c/h3\\u003e\\n\\u003cp\\u003eThe CCK8 assay was performed following the manufacturer\\u0026rsquo;s manual (Taojiao Biotechnology, Shanghai, China). In brief, 10,000 cells in 100 \\u0026mu;l of culture were added to each well of a 96-well plate for 24, 48, and 72 h. At each time point, 10 \\u0026mu;l of sterile CCK-8 was added to each well, and after 1 h of incubation at 37\\u0026deg;C, the absorbance was measured at 450 nm using an enzyme meter.\\u003c/p\\u003e\\n\\u003ch3\\u003eSmall interfering RNAs (siRNAs), overexpression plasmids, and transfection protocol\\u003c/h3\\u003e\\n\\u003cp\\u003eAll siRNAs and plasmids for HO-1 overexpression were obtained from Suzhou Gemma Genetics Co. Cell transfection was performed following the Lipofectamine 3000 (Thermo Fisher Scientific, Germany) manual. RT-qPCR and protein blotting were used to detect the plasmid-mediated overexpression and silencing efficiency of HO-1 in GC cells. The sequences for siRNA and overexpression vectors are listed below.\\u003c/p\\u003e\\n\\u003cp\\u003esiRNA:\\u003c/p\\u003e\\n\\u003cp\\u003eHMOX1-Homo-263: sense(5\\u0026prime;-3\\u0026prime;)CCCUGUACCACAUCUAUGUTT;\\u003c/p\\u003e\\n\\u003cp\\u003eantisense(5-3\\u0026prime;)ACAUAGAUGUGGUACAGGGTT.\\u003c/p\\u003e\\n\\u003cp\\u003eHMOX1-Homo-196: sense(5\\u0026prime;-3\\u0026prime;)GCUGAGUUCAUGAGGAACUTT;\\u003c/p\\u003e\\n\\u003cp\\u003eantisense(5\\u0026prime;-3\\u0026prime;)AGUUCCUCAUGAACUCAGCTT\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eConventional overexpression vectors:\\u003c/p\\u003e\\n\\u003cp\\u003eHMOX1 Home: (5\\u0026prime;-3\\u0026prime;)ATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCCTGAAGGAGGCCACCAAGGAGG\\u003c/p\\u003e\\n\\u003cp\\u003eTGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACTTTCAGAAGGGCCAGGTGACCCGAGACGGCTT\\u003c/p\\u003e\\n\\u003cp\\u003eCAAGCTGGTGATGGCCTCCCTGTACCACATCTATGTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAG\\u003c/p\\u003e\\n\\u003cp\\u003eAGCCCAGTCTTCGCCCCTGTCTACTTCCCAGAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGG\\u003c/p\\u003e\\n\\u003cp\\u003eCCTTCTGGTACGGGCCCCGCTGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCGCTATGTGAAGCG\\u003c/p\\u003e\\n\\u003cp\\u003eGCTCCACGAGGTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCTACCTGGGTGAC\\u003c/p\\u003e\\n\\u003cp\\u003eCTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACCTGCCCAGCTCTGGCGAGGGCC\\u003c/p\\u003e\\n\\u003cp\\u003eTGGCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACCAAGTTCAAGCAGCTCTACCGCTCCCGCATGAA\\u003c/p\\u003e\\n\\u003cp\\u003eCTCCCTGGAGATGACTCCCGCAGTCAGGCAGAGGGTGATAGAAGAGGCCAAGACTGCGTTCCTGCTCAAC\\u003c/p\\u003e\\n\\u003cp\\u003eATCCAGCTCTTTGAGGAGTTGCAGGAGCTGCTGACCCATGACACCAAGGACCAGAGCCCCTCACGGGCAC\\u003c/p\\u003e\\n\\u003cp\\u003eCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCC\\u003c/p\\u003e\\n\\u003cp\\u003eCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACA\\u003c/p\\u003e\\n\\u003cp\\u003eGTTGCTGTAGGGCTTTATGCCATGTGA\\u003c/p\\u003e\\n\\u003ch3\\u003eMeasurement of lipid peroxidation\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal cellular lipid peroxidation was measured using the C11 BODIPY (581/591) probe (Thermo Fisher Scientific, Germany). Cells were treated as indicated and incubated with 10 \\u0026mu;M of C11 BODIPY in fresh medium for 30 min at 37℃. Subsequently, excess C11 BODIPY was eliminated by washing the cells twice with PBS. The labeled cells were trypsin-digested, resuspended in PBS, and subjected to flow cytometry analysis. Oxidation of the polyunsaturated butadiene fraction of C11 BODIPY induced a shift in the fluorescence emission peak from ~590 nm to ~510 nm, correlating with lipid peroxidation production, and was evaluated using a flow cytometer (BD Biosciences, USA).\\u003c/p\\u003e\\n\\u003ch3\\u003eMeasurement of ROS\\u003c/h3\\u003e\\n\\u003cp\\u003eDCFH-DA (Thermo Fisher Scientific, Germany) was used to measure ROS levels following the manufacturer\\u0026rsquo;s protocol. Briefly, cells were seeded in 6-well plates and exposed to Erastin for 24 h. After the treatment, cells were harvested, washed twice with PBS, and subjected to labeling with 20 \\u0026mu;M DCFH-DA for 30 min at 37℃. The labeled cells were collected, and their DCF fluorescence intensity was analyzed using flow cytometry (BD Biosciences, USA).\\u003c/p\\u003e\\n\\u003ch3\\u003eDetermination of the labile iron pool\\u003c/h3\\u003e\\n\\u003cp\\u003eThe labile iron pool was determined using FerroOrange, an orange fluorescent probe specialized for detecting unstable iron (II) ions (Fe\\u003csup\\u003e2+\\u003c/sup\\u003e). Cells were seeded in 6-well plates and treated with Erastin for 24 h. After treatment, cells were washed twice with PBS and incubated with 2 uM FerroOrange (Maokang Biotechnology Co., Ltd., Shanghai) for 30 min at 37℃. Subsequently, the cells were washed with PBS and analyzed using fluorescence microscopy. The absorption maximum was observed at 542 nm for FerroOrange, and the fluorescence maximum was observed at 572 nm. The level of unstable iron was calculated based on the average fluorescence intensity of the cells.\\u003c/p\\u003e\\n\\u003ch3\\u003eMeasurement of glutathione\\u003c/h3\\u003e\\n\\u003cp\\u003eMonochlorobimane was used to detect GSH in cells. Cells were seeded in 6-well plates and treated with Erastin for 24 h. After treatment, cells were washed twice with PBS and incubated with 20 \\u0026mu;M monochlorobimane (mBCL, HY-101899, MedChemExpress) for 30 min at 37℃. After three washes with fresh serum-free medium, the associated fluorescence intensity was measured using flow cytometry or fluorescence inverted microscopy under specific excitation (Ex: 380 nm) and emission (Em: 470 nm) light.\\u003c/p\\u003e\\n\\u003ch3\\u003eBioinformatic analysis\\u003c/h3\\u003e\\n\\u003cp\\u003e1.1.\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Ferroptosis-Related Genes Collection\\u003c/p\\u003e\\n\\u003cp\\u003eA collection of ferroptosis-related genes consisting of 721-encoded proteins was obtained from the GeneCards database (https://www.genecards.org/).\\u003c/p\\u003e\\n\\u003cp\\u003e1.2. Gene Expression Data Collection\\u003c/p\\u003e\\n\\u003cp\\u003emRNA data and clinical information for patients with stomach adenocarcinoma (STAD) were collected from The Cancer Genome Atlas (TCGA). The discovery cohort, obtained from TCGA, consisted of data on patients with STAD. A total of 18,587 differentially expressed genes were identified using the differential analysis between GBM and normal tissues .\\u003c/p\\u003e\\n\\u003ch3\\u003eStatistical analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eAll experiments were conducted at least three times, and data are expressed as mean \\u0026plusmn; SD. Statistical significance between treatments was assessed using Student\\u0026rsquo;s t-test, with p-value \\u0026lt; 0.05 considered statistically significant.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article [and its supplementary information files].\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021 May;71(3):209-249. doi: 10.3322/caac.21660. Epub 2021 Feb 4. PMID: 33538338.\\u003c/li\\u003e\\n\\u003cli\\u003eCristescu R, Lee J, Nebozhyn M, Kim KM, Ting JC, Wong SS, Liu J, Yue YG, Wang J, Yu K, Ye XS, Do IG, Liu S, Gong L, Fu J, Jin JG, Choi MG, Sohn TS, Lee JH, Bae JM, Kim ST, Park SH, Sohn I, Jung SH, Tan P, Chen R, Hardwick J, Kang WK, Ayers M, Hongyue D, Reinhard C, Loboda A, Kim S, Aggarwal A. Molecular analysis of gastric cancer identifies subtypes associated with distinct clinical outcomes. Nat Med. 2015 May;21(5):449-56. doi: 10.1038/nm.3850. Epub 2015 Apr 20. PMID: 25894828.\\u003c/li\\u003e\\n\\u003cli\\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B 3rd, Stockwell BR. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012 May 25;149(5):1060-72. doi: 10.1016/j.cell.2012.03.042. PMID: 22632970; PMCID: PMC3367386.3、Alam J., Cook J.L. How many transcription factors does it take to turn on the heme oxygenase-1 gene? Am. J. Respir. Cell Mol. Biol. 2007;36:166\\u0026ndash;174. doi: 10.1165/rcmb.2006-0340TR.\\u003c/li\\u003e\\n\\u003cli\\u003eFrazer DM, Anderson GJ. The regulation of iron transport. Biofactors. 2014 Mar-Apr;40(2):206-14. doi: 10.1002/biof.1148. Epub 2013 Oct 17. PMID: 24132807.\\u003c/li\\u003e\\n\\u003cli\\u003eBogdan AR, Miyazawa M, Hashimoto K, Tsuji Y. Regulators of Iron Homeostasis: New Players in Metabolism, Cell Death, and Disease. Trends Biochem Sci. 2016 Mar;41(3):274-286. doi: 10.1016/j.tibs.2015.11.012. Epub 2015 Dec 23. PMID: 26725301; PMCID: PMC4783254.\\u003c/li\\u003e\\n\\u003cli\\u003eGao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell. 2015 Jul 16;59(2):298-308. doi: 10.1016/j.molcel.2015.06.011. Epub 2015 Jul 9. PMID: 26166707; PMCID: PMC4506736.\\u003c/li\\u003e\\n\\u003cli\\u003eSun X, Ou Z, Xie M, Kang R, Fan Y, Niu X, Wang H, Cao L, Tang D. HSPB1 as a novel regulator of ferroptotic cancer cell death. Oncogene. 2015 Nov 5;34(45):5617-25. doi: 10.1038/onc.2015.32. Epub 2015 Mar 2. PMID: 25728673; PMCID: PMC4640181.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Zheng L, Shang W, Yang Z, Li T, Liu F, Shao W, Lv L, Chai L, Qu L, Xu Q, Du J, Liang X, Zeng J, Jia J. Wnt/beta-catenin signaling confers ferroptosis resistance by targeting GPX4 in gastric cancer. Cell Death Differ. 2022 Nov;29(11):2190-2202. doi: 10.1038/s41418-022-01008-w. Epub 2022 May 9. PMID: 35534546; PMCID: PMC9613693.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang H, Deng T, Liu R, Ning T, Yang H, Liu D, Zhang Q, Lin D, Ge S, Bai M, Wang X, Zhang L, Li H, Yang Y, Ji Z, Wang H, Ying G, Ba Y. CAF secreted miR-522 suppresses ferroptosis and promotes acquired chemo-resistance in gastric cancer. Mol Cancer. 2020 Feb 27;19(1):43. doi: 10.1186/s12943-020-01168-8. PMID: 32106859; PMCID: PMC7045485.\\u003c/li\\u003e\\n\\u003cli\\u003eRyter S.W., Alam J., Choi A.M. Heme oxygenase-1/carbon monoxide: From basic science to therapeutic applications. \\u003cem\\u003ePhysiol. Rev. \\u003c/em\\u003e2006;86:583\\u0026ndash;650. doi: 10.1152/physrev.00011.2005.\\u003c/li\\u003e\\n\\u003cli\\u003eVitek L., Schwertner H.A. The heme catabolic pathway and its protective effects on oxidative stress-mediated diseases. \\u003cem\\u003eAdv. Clin. Chem. \\u003c/em\\u003e2007;43:1\\u0026ndash;57. \\u003c/li\\u003e\\n\\u003cli\\u003eKwon M.Y., Park E., Lee S.J., Chung S.W. Heme oxygenase-1 accelerates Erastin induced Ferroptotic cell death. \\u003cem\\u003eOncotarget. \\u003c/em\\u003e2015;6:24393\\u0026ndash;24403. doi: 10.18632/oncotarget.5162.\\u003c/li\\u003e\\n\\u003cli\\u003eChang L.C., Chiang S.K., Chen S.E., Yu Y.L., Chou R.H., Chang W.C. Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis. \\u003cem\\u003eCancer Lett. \\u003c/em\\u003e2018;416:124\\u0026ndash;137. doi: 10.1016/j.canlet.2017.12.025.\\u003c/li\\u003e\\n\\u003cli\\u003eHassannia B., Wiernicki B., Ingold I., Qu F., Van Herck S., Tyurina Y.Y., Bayır H., Abhari B.A., Angeli J.P.F., Choi S.M., et al. Nano-targeted induction of dual ferroptotic mechanisms eradicates high-risk neuroblastoma. \\u003cem\\u003eJ. Clin. Investig. \\u003c/em\\u003e2018;128:3341\\u0026ndash;3355. doi: 10.1172/JCI99032. \\u003c/li\\u003e\\n\\u003cli\\u003eSugimoto R, Tanaka Y, Noda K, Kawamura T, Toyoda Y, Billiar TR, McCurry KR, Nakao A. Preservation solution supplemented with biliverdin prevents lung cold ischaemia/reperfusion injury. Eur J Cardiothorac Surg. 2012 Dec;42(6):1035-41. doi: 10.1093/ejcts/ezs298. Epub 2012 May 30. PMID: 22648925; PMCID: PMC4334840.\\u003c/li\\u003e\\n\\u003cli\\u003eJomova K., Vondrakova D., Lawson M., Valko M. Metals, oxidative stress and neurodegenerative disorders. \\u003cem\\u003eMol. Cell. Biochem. \\u003c/em\\u003e2010;345:91\\u0026ndash;104. doi: 10.1007/s11010-010-0563-x. .\\u003c/li\\u003e\\n\\u003cli\\u003eSunamura M., Duda D.G., Ghattas M.H., Lozonschi L., Motoi F., Yamauchi J., Matsuno S., Shibahara S., Abraham N.G. Heme oxygenase-1 accelerates tumor angiogenesis of human pancreatic cancer. Angiogenesis. 2003;6:15\\u0026ndash;24. doi: 10.1023/A:1025803600840.\\u003c/li\\u003e\\n\\u003cli\\u003eDeshane J., Chen S., Caballero S., Grochot-Przeczek A., Was H., Li Calzi S., Lach R., Hock T.D., Chen B., Hill-Kapturczak N., et al. Stromal cell-derived factor 1 promotes angiogenesis via a heme oxygenase 1-dependent mechanism. J. Exp. Med. 2007;204:605\\u0026ndash;618. doi: 10.1084/jem.20061609.\\u003c/li\\u003e\\n\\u003cli\\u003eLuo P, Liu D, Zhang Q, Yang F, Wong YK, Xia F, Zhang J, Chen J, Tian Y, Yang C, Dai L, Shen HM, Wang J. Celastrol induces ferroptosis in activated HSCs to ameliorate hepatic fibrosis \\u003cem\\u003evia\\u003c/em\\u003e targeting peroxiredoxins and HO-1. Acta Pharm Sin B. 2022 May;12(5):2300-2314. doi: 10.1016/j.apsb.2021.12.007.\\u003c/li\\u003e\\n\\u003cli\\u003eTang Z, Ju Y, Dai X, Ni N, Liu Y, Zhang D, Gao H, Sun H, Zhang J, Gu P. HO-1-mediated ferroptosis as a target for protection against retinal pigment epithelium degeneration. Redox Biol. 2021 Jul;43:101971. doi: 10.1016/j.redox.2021.101971.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang Y, Yang Y, Xu Y, Ma Q, Guo F, Zhao Y, Tao Y, Li M, Guo J. Nrf2/HO-1 Axis Regulates the Angiogenesis of Gastric Cancer via Targeting VEGF. Cancer Manag Res. 2021 Apr 12;13:3155-3169. doi: 10.2147/CMAR.S292461.\\u003c/li\\u003e\\n\\u003cli\\u003eYin Y, Liu Q, Wang B, Chen G, Xu L, Zhou H. Expression and function of heme oxygenase-1 in human gastric cancer. Exp Biol Med (Maywood). 2012 Apr;237(4):362-71. doi: 10.1258/ebm.2011.011193.\\u003c/li\\u003e\\n\\u003cli\\u003eYang W, Wang Y, Zhang C, Huang Y, Yu J, Shi L, Zhang P, Yin Y, Li R, Tao K. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022 Apr 4;13:865689. doi: 10.3389/fphar.2022.865689.\\u003c/li\\u003e\\n\\u003cli\\u003eLin Q, Li S, Jin H, Cai H, Zhu X, Yang Y, Wu J, Qi C, Shao X, Li J, Zhang K, Zhou W, Zhang M, Cheng J, Gu L, Mou S, Ni Z. Mitophagy alleviates cisplatin-induced renal tubular epithelial cell ferroptosis through ROS/HO-1/GPX4 axis. Int J Biol Sci. 2023 Feb 13;19(4):1192-1210. doi: 10.7150/ijbs.80775.\\u003c/li\\u003e\\n\\u003cli\\u003eHayes JD, Dinkova-Kostova AT, Tew KD. Oxidative stress in cancer. \\u003cem\\u003eCancer Cell. \\u003c/em\\u003e2020;38:167\\u0026ndash;97. doi: 10.1016/j.ccell.2020.06.001.\\u003c/li\\u003e\\n\\u003cli\\u003eChatterjee R, Chatterjee J. ROS and oncogenesis with special reference to EMT and stemness. \\u003cem\\u003eEur J Cell Biol. \\u003c/em\\u003e2020;99:151073. doi: 10.1016/j.ejcb.2020.151073.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Gastric cancer, HO-1, Ferroptosis, GPX4\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3883283/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3883283/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eGastric cancer, a prevalent gastrointestinal tumor, experiences limited efficacy with conventional surgery and chemotherapy. Hence, the imperative to identify additional therapeutic targets is underscored. Numerous studies have reported heme oxygenase-1 (HO-1) for its antioxidant and protective attributes on organs and tissues. In the present study, the role of HO-1 in stimulating the proliferation of gastric cancer cells was explored. The hypothesis posited that HO-1 facilitates gastric cancer progression by regulating GPX4 and ferroptosis. Analysis through bioassay and immunohistochemistry revealed a significant augmentation in HO-1 expression within gastric cancer tissues. Mechanistically, real-time fluorescence quantitative PCR and protein immunoblotting confirmed that HO-1 modulates the protein expression of GPX4, a pivotal player in ferroptosis regulation. Through the upregulation of mRNA expression for GPX4, HO-1 inhibits ferroptosis, thereby fostering gastric cancer progression. This is achieved by elevating GPX4 protein levels and diminishing intracellular reactive oxygen species in gastric cancer cells. In summary, our results elucidate the protective role of high HO-1 expression against ferroptosis in gastric cancer cells, thereby promoting their malignant progression. The upsurge in HO-1 expression emerges as a potential tumor marker and therapeutic target for gastric cancer, offering a novel avenue for intervention.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Heme oxygenase-1 (HO-1) induces resistance to ferroptosis in gastric cancer by targeting GPX4 Author：\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-02-05 14:44:02\",\"doi\":\"10.21203/rs.3.rs-3883283/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"4635916b-c541-4eca-99ae-22bdb6ff9997\",\"owner\":[],\"postedDate\":\"February 5th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":28559054,\"name\":\"Biological sciences/Cancer\"},{\"id\":28559055,\"name\":\"Health sciences/Gastroenterology\"}],\"tags\":[],\"updatedAt\":\"2024-10-08T05:53:22+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-02-05 14:44:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3883283\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3883283\",\"identity\":\"rs-3883283\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}