{"paper_id":"a0aa3df8-9502-41e4-9f8e-318122d77146","body_text":"Typhoid toxin of Salmonella enterica induces ISG15 response mediating host cell survival and bacterial dissemination | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return\"[object Function]\"==o.call(a)}function e(a){return\"string\"==typeof a}function f(){}function g(a){return!a||\"loaded\"==a||\"complete\"==a||\"uninitialized\"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){(\"c\"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){\"img\"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),\"object\"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height=\"0\",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),\"img\"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||\"j\",e(a)?i(\"c\"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName(\"script\")[0],o={}.toString,p=[],q=0,r=\"MozAppearance\"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&\"[object Opera]\"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?\"object\":l?\"script\":\"img\",v=l?\"script\":u,w=Array.isArray||function(a){return\"[object Array]\"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split(\"!\"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split(\"=\"),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(\".\").pop().split(\"?\").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split(\"/\").pop().split(\"?\")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&\"css\"==i.url.split(\".\").pop().split(\"?\").shift()?\"c\":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Typhoid toxin of Salmonella enterica induces ISG15 response mediating host cell survival and bacterial dissemination Daniel S Stark , Michelle King , View ORCID Profile Angela EM Ibler , View ORCID Profile Nadia Baseer , Ellen G Vernon , Yifeng Zhang , Christopher Staples , Lilliana Radoshevich , View ORCID Profile Daniel Humphreys doi: https://doi.org/10.1101/2025.04.29.649991 Daniel S Stark 1 School of Biosciences, University of Sheffield , Sheffield, South Yorkshire, S10 2TN, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Michelle King 1 School of Biosciences, University of Sheffield , Sheffield, South Yorkshire, S10 2TN, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Angela EM Ibler 1 School of Biosciences, University of Sheffield , Sheffield, South Yorkshire, S10 2TN, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Angela EM Ibler Nadia Baseer 1 School of Biosciences, University of Sheffield , Sheffield, South Yorkshire, S10 2TN, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nadia Baseer Ellen G Vernon 2 North West Cancer Research Institute, School of Medical Sciences, Bangor University , Bangor LL57 2UW, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yifeng Zhang 3 Department of Microbiology and Immunology, University of Iowa, Carver College of Medicine , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher Staples 2 North West Cancer Research Institute, School of Medical Sciences, Bangor University , Bangor LL57 2UW, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lilliana Radoshevich 3 Department of Microbiology and Immunology, University of Iowa, Carver College of Medicine , Iowa City, Iowa, USA 4 Department of Immunology and Genomic Medicine , National Jewish Health, Denver, Colorado, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Daniel Humphreys 1 School of Biosciences, University of Sheffield , Sheffield, South Yorkshire, S10 2TN, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Daniel Humphreys For correspondence: d.humphreys{at}sheffield.ac.uk Abstract Full Text Info/History Metrics Preview PDF Abstract The typhoid toxin is a secreted virulence factor of typhoidal serovars of the bacterial pathogen Salmonella enterica implicated in typhoid fever and chronic infections. The toxin causes a DNA damage response in human cells, characterised by cell-cycle arrest and cellular distension, resulting in cellular senescence and increased bacterial burden. To better understand host responses to typhoid toxin, we performed a transcriptomic analysis of intoxicated host cells and found that the toxin induced expression of genes relating to the type-I interferon response, including the ubiquitin-like protein ISG15. ISG15 was upregulated in a STING-dependent manner, reduced bacterial burden, and was found to be critical to host cell survival in response to the typhoid toxin and purified interferon. This highlights ISG15 as an important component of the host cell defence to the typhoid toxin. Introduction The typhoid toxin is secreted by typhoidal serovars of Salmonella enterica such as S. Typhi, which causes typhoid fever, a disease responsible for 21 million cases worldwide and 200,000 deaths a year. The toxin has been implicated in causing typhoid fever symptoms ( Song, Gao and Galan, 2013 ), but there is also evidence to suggest its activity contributes to chronic and systemic Salmonella infection in vivo (Del Bel Belluz et al ., 2016 ; Miller et al ., 2018 ). Chronic carriage of Salmonella is a major cause of the endemicity of typhoid fever and has been established by the WHO as a research priority ( World Health Organization, 2018 ). More recently, the toxin was shown to induce an anti-inflammatory response in healthy mice, suggesting a role in immunomodulation and possibly immune evasion ( Martin et al ., 2021 ). The typhoid toxin is also encoded by typhoidal serovar S. Paratyphi A and a 1-2% subset of ∼2600 non-typhoidal Salmonella serovars including S. Javiana, which cause disease in humans and food-chain animals worldwide ( Den Bakker et al ., 2011 ). The toxin is comprised of a PltB pentamer linked to PltA that is bound to CdtB, which is the toxigenic DNase 1-like subunit also found in related cytolethal distending toxins ( Song, Gao and Galan, 2013 ). Toxigenic Salmonella invades gut epithelial cells and is enclosed within a Salmonella -containing vacuole (SCV), where it secretes the toxin. The toxin is exocytosed from the infected cell and binds to sialylated glycans on surface receptors of target host cells via PltB enabling intoxication in an autocrine or paracrine manner ( Spanò, Ugalde and Galán, 2008 ; Song, Gao and Galan, 2013 ). The toxin is endocytosed and CdtB is trafficked to the host nucleus by retrograde transport, where it induces the host DNA damage response (DDR) and induces cell-cycle arrest ( Guidi et al ., 2013 ). The host DDR is regulated by the apical kinases ATM (ataxia-telangiectasia mutated) and ATR (ATM and rad3-related), which phosphorylate diverse substrates to orchestrate repair and cell fate decisions including survival, apoptosis and senescence ( Polo and Jackson, 2011 ). Canonically, ATM is recruited by double strand DNA breaks (DSBs) while ATR responds to single strand breaks (SSBs) occurring during replication stress, although they have interconnected roles. The toxin induces replication stress in S/G2 phase characterised by γH2AX localisation at the nuclear periphery and hyperphosphorylation of replication protein A (RPA), leading to ATR activation and downstream phosphorylation of P53 and CHK1 ( Ibler et al ., 2019 ). The toxin also induces DSBs labelled by 53BP1 in G0/G1 phase, showing that the toxin induces different host DDRs which possibly lead to diverse downstream responses. Toxin-induced replication stress leads to a senescence-like phenotype characterised by cell distension and expression of the p53 effector p21 ( Ibler et al ., 2019 ; ElGhazaly et al ., 2023 ). The senescent cells exhibit permanent G2 arrest and a secretory phenotype that induces secondary senescence in bystander cells in a Wnt5A, INHBA and GDF15 dependent manner ( Ibler et al ., 2019 ; ElGhazaly et al ., 2023 ). Cells treated with conditioned media from intoxicated cells underwent senescence and became more susceptible to infection, suggesting that the toxin was creating replicative niches for Salmonella and facilitating infection spread. It is not known whether this senescence-like phenotype also occurs as a result of DSBs in G0/G1-arrested cells, and it is possible that there are divergent host responses to the toxin. Here we analyse the transcriptome of intoxicated cells with the aim of uncoupling host responses to the toxin, which implicates the ubiquitin-like protein ISG15 in the host responses to pathogen-induced DNA damage. ISG15 is an interferon-stimulated protein with antiviral activity but its role during bacterial infection remains unclear and has yet to be identified as interacting with bacterial toxins. We found that ISG15 enforced host survival in the presence of interferon that was necessary to contain and counteract intracellular Salmonella . Results The Typhoid Toxin triggers an IFN-like response Recombinant epitope-tagged PltB HIS , PltA Myc , and CdtB FLAG typhoid toxin was purified using NiNTA chromatography as previously described ( Ibler et al ., 2019 ). Wild-type typhoid toxin (WT-toxin) and toxin containing CdtB-H160Q with attenuated catalytic activity (HQ-toxin) were purified simultaneously. To confirm the functionality of the purified toxins, 20 ng/ml of WT- and HQ-toxin was added to HT1080 fibroblast cells for 2 h to allow for toxin endocytosis, before removal and replacement with fresh media. Cells were fixed after 24 h and prepared for immunofluorescence analysis of the DNA damage marker γ H2AX ( Fig. 1A ). Using the upper-quartile of untreated cell γ H2AX fluorescence as a threshold, 87% of nuclei in WT-toxin treated cells were found to be positive for γ H2AX, compared to only 33% of HQ-toxin treated cells ( Fig. 1B ). In contrast, γH2AX levels induced by HQ-toxin were equivalent to untreated cells ( Fig. 1A, 1B ). WT-toxin treatment induced a greater γ H2AX response than that of 24 h continuous treatment with DNA-polymerase inhibitor aphidicolin (68% positivity), which acted as a positive control. Immunofluorescence also revealed that cell nuclei became distended upon WT-toxin treatment ( Fig. 1A ), which was consistent with observations in other studies ( Haghjoo and Galán, 2004 ; Spanò, Ugalde and Galán, 2008 ; Guidi et al ., 2013 ; Ibler et al ., 2019 ). Download figure Open in new tab Fig. 1. The typhoid toxin induces a type-I IFN-like response A ) HT1080 cells treated with 20ng/ml WT- and HQ-toxin assayed by immunofluorescence for γH2AX (green), with 20 μM aphidicolin used as a positive control. DAPI-stained nuclei indicated by white outlines. Scale bars are 20 μm. B ) Quantification of A. Nuclei were counted as positive for γH2AX if greater than the upper quartile of untreated intensity. Each circle is from an independent experiment consisting of three replicates. Ordinary one-way ANOVA was used with Tukey’s multiple comparison test. Asterisks indicate significance *p<0.05, **p<0.01. Bars indicate mean and error bars indicate SD. C ) Workflow for microarray analysis of differential gene expression between HT1080 cells treated for 48 h with WT- and HQ-toxin. D ) Bar chart showing the top 10 positively and negatively enriched biological processes found using gene set enrichment analysis (GSEA) of 19460 genes analysed by microarray, compared between WT- and HQ-toxin treatment at 48 h in complete media. E ) GSEA curve for the ‘response to type-I IFN’ biological process found in D, with the dashed line indicating the leading-edge cut-off. F ) Heatmap showing differential gene expression of the 23 leading edge genes from E. Gene expression changes are also shown from the G0/G1 responses to the toxin, and G2/S responses to the toxin, which are shown in Supp. Fig. 1C-E . Download figure Open in new tab Supp. Fig. 1. Differential gene expression in divergent responses to the typhoid toxin A) Divergent DNA damage responses induced by WT- and HQ-toxin preparations were assayed in HT1080 cells using immunofluorescence of phosphorylated RPA32 (RPA32 pT21, cyan), 53BP1 (magenta) and EdU (green). Scale bars indicate 20μm. B) Quantification of positive nuclei in (A). Nuclei were counted as positive for RPA32 pT21 and 53BP1 if greater than the upper quartile of untreated intensity, and for EdU if greater than the lower quartile of HQ-tox intensity. Bars indicate total percentage from a single experiment with three technical replicates. C ) Bar chart showing the top 10 positively and negatively enriched biological processes found using gene set enrichment analysis (GSEA) of 19460 genes analysed by microarray, compared between WT- and HQ-toxin treatment in serum-free media where only DNA damage responses in G0 or G1 are permissive. D ) GSEA curve for the ‘response to type-I IFN’ biological process found in C, with the dashed line indicating the leading-edge cut-off. E ) Bar chart showing the top 10 positively and negatively enriched biological processes found using gene set enrichment analysis (GSEA) of 19460 genes analysed by microarray, compared between WT-toxin treatment in normal and serum-free media and thus showing responses to the toxin in G2/S phase. Host responses to the toxin were investigated by analysing the transcriptome of intoxicated HT1080 fibroblast cells. Cells were pulsed for 2h with WT- or HQ-toxin and incubated for 48h before extraction of cellular RNA, which was analysed using a Clariom TM S transcriptome profiling microarray (experimental pipeline in Fig. 1C ). 19460 analysed genes were submitted for gene set enrichment analysis using the Web-based Gene Set Analysis Toolkit (Web-Gestalt 2019) which identified positively and negatively enriched biological processes between WT- and HQ-toxin treatment ( Fig. 1D-E ). Of these processes, the response to type-I interferon was found to be positively enriched in WT-toxin treated cells compared to HQ-toxin, with 23 leading edge genes including 2 ISG transcription factors (IRF-9 and STAT1) and 10 ISGs including IFIT-1, −2 and −3, OAS-1 and −3, EGR1, RSAD2, IFI6, USP18 and ISG15 ( Fig. 1F ). This finding was consistent with studies that have shown the related bacterial genotoxin E. coli CDT induces a type-I interferon response in a DNA damage-dependent manner ( Pons et al ., 2021 ). The enrichment of the type-I interferon response occurred following WT-toxin induced damage in asynchronous cells, meaning that toxin-dependent differential gene expression could be caused by toxin-induced RPA-labelled SSBs in G2/S phase or 53BP1-labelled DSBs in G0/G1 ( Supp. Fig. 1A, 1B ) ( Ibler et al ., 2019 ). Serum-starvation prevents entry into S phase, locking cells in G0/G1, which therefore inhibits toxin-induced replication stress ( Ibler et al ., 2019 ). In an attempt to uncouple the transcriptomic responses to these two toxin-induced types of damage, transcriptome changes were analysed following WT- and HQ-toxin treatment in the presence (10%) or absence (0%) of serum. The type-I interferon response was the most positively enriched biological process between WT- and HQ-toxin treatment in the absence of serum, with 23 leading edge genes ( Supp. Fig. 1C-D ). Toxin-induced DSBs are permissive in the absence of serum (WT-tox., 0% serum) while SSBs in S/G2 are only permissive in the presence of serum (WT-tox., 10% serum). The major differences between the presence and absence of serum in WT-intoxicated cells were in cell cycle and cell metabolic processes, most likely due to serum-starvation blocking DNA replication and the supply of nutrients. Interestingly, the type-I IFN response as a process was not enriched, suggesting it was more likely to be a response to damage in G0/G1 phase rather than S/G2 phase ( Supp. Fig. 1E ). However, when analysing expression levels of individual ISGs, the type-I IFN response in serum-starved cells was particularly evident for ISGs such as IFI6 and IFIT1 that were observed in G0/G1 but not for ISGs such as ISG15 and RSAD2, which were up-regulated in asynchronous replication-competent cells in the presence of serum ( Fig. 1F ). This suggests divergent mechanisms underlying ISG regulation. The differential expression of 11 of these type-I IFN genes were further examined by quantifying mRNA levels after 24h of toxin treatment using qRT-PCR. Of these, a significant increase in mRNA between WT- and HQ-toxin treatment was only seen in IFIT1, IFIT2, IFIT3, IRF-9, and ISG15 ( Fig 2A , Supp. Fig. 2 ). The toxin-dependent upregulation of ISG15 in both G2/S and G0/G1 phase was particularly interesting, as ISG15 has been shown to have roles in the DDR as well as innate immune responses to bacterial invasion ( Radoshevich et al ., 2015 ; Raso et al ., 2020 ). ISG15 is a ubiquitin-like protein and has been shown to act as a covalent adduct to other proteins throughout the cell, as well as acting alone both intra- and extracellularly ( Morales and Lenschow, 2013 ; Perng and Lenschow, 2018 ). As well as ISG15 upregulation, we also observed toxin-dependent expression of USP18 ( Fig. 1F ), which catalyses the uncoupling of ISG15 from ISGylated proteins ( Malakhov et al ., 2002 ). Interestingly, we did not observe differential expression of any of the ISG15 ligases, such as UBE1L, which are required for ISGylation to occur ( Yuan and Krug, 2001 ). Download figure Open in new tab Supp. Fig. 2. Validation of the toxin-dependent type-I interferon-like response by qRT-PCR ( A-J ) Quantification of mRNA levels in HT1080s of 10 type-1 interferon-related genes compared between untreated, WT-toxin treated, and HQ-toxin treated samples. Bars represent mean and error bars indicate SD. Each circle is an individual RNA sample with three technical replicates. WT- and HQ-toxin conditions compared using an unpaired t-test. Asterisks indicate significance. Download figure Open in new tab Fig. 2. ISG15 is upregulated in response to the typhoid toxin A ) Quantification of ISG15 mRNA levels in untreated, WT-toxin treated, and HQ-toxin treated HT1080s cells. Each circle is an individual RNA sample with three technical replicates. WT- and HQ-toxin conditions compared using an unpaired t-test. B ) Immunoblots of ISG15 protein levels in HT1080s 24 h, 48 h and 72 h after either treatment with WT-toxin, HQ-toxin or purified IFNα. MW indicated as kDa, right. C ) Quantification of B showing densitometry analysis of the 15 kDa ISG15 band at 72h post-intoxication relative to tubulin and normalised to untreated (3 independent immunoblots). WT- and HQ-toxin conditions compared using an unpaired t-test. D ) Immunofluorescence of ISG15 (green) in response to WT-toxin, HQ-toxin or purified interferon α in HT1080 cells. DAPI-stained nuclei indicated by white outlines. White arrows indicate cells with enriched nuclear ISG15. Scale bars are 20 μm. E ) Quantification of ISG15-positive nuclei in D. Each circle is an independent experiment with three technical replicates. WT- and HQ-toxin conditions compared using an unpaired t-test. F ) Immunoblot of ISG15 protein levels in HT1080s 144 h after 30 min infection with MOI 10, 20 or 50 of S . Javiana WT or S . Javiana ΔcdtB . MW indicated as kDa, right. G ) Densitometry analysis of the 15 kDa ISG15 band relative to tubulin from F and normalised to untreated (circles represent independent immunoblots). A one-way ANOVA with Šidák’s multiple comparisons test was used to measure significance relative to the untreated control, with only significant comparisons shown. Bars represent mean, error bars indicate SD, and asterisks indicate significance where *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. We examined ISG15 protein levels in intoxicated cells, which were significantly increased compared to both untreated and HQ-toxin treated cells, with the strongest response seen between 48 and 72h post-intoxication ( Fig. 2B-C ). As a positive control, sustained 72 h treatment with purified IFNα triggered upregulation of ISG15. IFNα-treatment also induced a smear of high molecular weight ISG15-conjugated (ISGylated) proteins which was not visible following intoxication, where only free ISG15 was observed. No toxin induced ISGylation was observed in over exposed blots (data not shown). Using immunofluorescence, we observed that ISG15 localised throughout the cell but was often enriched in the nucleus, suggesting it could be modulating the function of nuclear proteins ( Fig. 2D, 2E , white arrows indicate enriched nuclear ISG15). ISG15 was significantly upregulated in the nucleus in WT-toxin treated cells compared to untreated and HQ-toxin treated cells. We also examined ISG15 protein levels following infection with the toxigenic non-typhoidal Salmonella enterica serovar Javiana, which has previously been shown to induce a similar phenotype to that of purified toxin ( Miller et al ., 2018 ; Ibler et al ., 2019 ; ElGhazaly et al ., 2023 ). Infection induced a potent ISG15 response in a CdtB-dependent manner, but interestingly this response was not seen until 144h (6 days) post-infection ( Fig. 2F-G ). The difference in time could be attributed to the time taken for intracellular Salmonella to express and secrete the toxin before sufficient DDRs triggered IFN-like responses. The toxin causes an IFN-like response in a type-I IFN independent and STING dependent manner ISGs are canonically regulated by IFNs binding to cognate receptors and activating a downstream JAK/STAT signalling pathway, triggering formation of heteromeric signalling complexes that bind to ISREs in ISG promoter sequences (Boxx & Cheng, 2016). Interestingly, toxin dependent ISG upregulation was only accompanied by a modest upregulation of IFNA1, with no significant differential expression of any other IFN genes. Furthermore, our attempts to validate this finding by qRT-PCR were inconclusive ( Supp. Fig. 2 ). Therefore, ISG15 expression was examined following type-I IFN inhibition by B18R, which is encoded by vaccinia virus and competitively binds to IFN, thus inhibiting downstream signalling of IFN ( Alcamí, Symons and Smith, 2000 ; Radoshevich et al ., 2015 ). As expected, B18R abolished ISG15 upon addition of IFN α ( Fig. 3A ). However, whilst there was a reduction in ISG15, B18R did not abolish WT-toxin dependent ISG15 upregulation, suggesting that the toxin was upregulating ISG15 via both type-I IFN-dependent and - independent pathways. Download figure Open in new tab Fig. 3. Toxin-induced ISG15 is not reliant on type-I IFN but is STING-dependent A ) Immunoblot of ISG15 protein levels in HT1080s 72 h after treatment with WT-toxin or purified IFNα in the presence and absence of the type-I IFN inhibitor B18R. MW indicated as kDa, right. B ) Immunoblot of ISG15 and STING protein levels in untreated and WT-toxin treated wild-type and STING knockout HaCaT cells. C ) Immunoblots of ISG15 protein levels in HT1080s following 72h treatment with STING inhibitor H151 or TBK1 inhibitor BX795, and treatment with WT- or HQ-toxin. MW indicated as kDa, right. D ) Quantification of C using densitometry analysis (ImageStudio) of the 15 kDa ISG15 band intensity relative to tubulin and normalised to untreated (three independent immunoblots). One way ANOVA was used with Tukey’s multiple comparison test. Asterisks indicate significance where *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. We next sought to determine the mechanism by which the toxin was inducing ISG15 expression. Other studies have shown that replication stress causes cytosolic leakage of fragments of damaged DNA, activating cytosolic DNA sensors such as cGAS and STING which trigger immune responses ( Wolf et al ., 2016 ; Kreienkamp et al ., 2018 ). We therefore explored the role of STING in response to the toxin. The toxin-dependent ISG15 response was abolished in STING-KO U2OS cells compared to wild type cells ( Fig. 3B ). ISG15 was also assayed following inhibition of STING and TBK1 by respective small molecule inhibitors H151 and BX795. Continual inhibition by either inhibitor for 72h following intoxication significantly reduced toxin induced ISG15, and indeed TBK1 inhibition by BX795 abrogated the toxin induced ISG15 response entirely ( Fig. 3C, 3D ). ISG15 is part of the host-defence mechanism We hypothesised that ISG15 was upregulated as part of the host-defensive response against Salmonella infection and subsequent intoxication by the toxin. HT1080s were pre-treated with 72 h of continuous IFNα treatment to strongly upregulate ISG15 before infection with S. Javiana WT or S. Javiana ΔcdtB . Salmonella invasion was assayed 24 h post-infection by culturing whole cell lysates on LB agar. Interestingly there was no significant difference between S. Javiana WT CFUs from pre-treated and untreated cells ( Supp. Fig. 3A ), possibly because of the toxin-induced presence of ISG15 in both cases ( Fig. 2F-G ). However, intracellular S. Javiana ΔcdtB , which does not elicit ISG15-signalling ( Fig. 2F-G ), was significantly increased in cells without IFNα pre-treatment ( Supp. Fig. 3B ). Download figure Open in new tab Supp. Fig. 3. ISG15 inhibits Salmonella infection and is essential for cell survival in response to IFN A) S . Javiana WT and S . Javiana ΔcdtB CFUs 24 h after infection in HT1080s with and without 72 h continuous pre-treatment with purified interferon α. Circles indicate technical repeats of a single experiment. B ) Immunoblot of ISG15 and HA protein levels in HT1080s 24, 48, 72 and 144 h after transfection with either pCAGGS-5HA-mISG15 or empty vector pcDNA. C ) S . Javiana WT and S . Javiana ΔcdtB CFUs 24 h after infection in HT1080s with and without 24 h transfection with pCAGGS-5HAmISG15 or empty vector pcDNA. Circles indicate technical repeats of a single experiment. D) Immunoblot of wild-type and ISG15 knockout (KO) A549 cells in the presence or absence of IFNα at 48h, 96h or 168h. MW in kDa indicated left and antibodies indicated right. E ) Immunoblot showing ISG15 and USP18 protein levels in wild-type A549 cells 48h post-transfection with siRNA for ISG15, USP18 and UBE1L, as well as a non-transfecting (NT) control. F ) Cell viability determined by MTT assay in wild-type A549 cells with purified IFNα treatment and transfected with siRNA for ISG15, USP18 and UBE1L. A549 ISG15-/- with IFN treatment is also included as a positive control for cell death. Viability is shown as a percentage of metabolic viability in the untreated control. Circles indicate independent experiments. Ordinary one-way ANOVA was used with Tukey’s multiple comparison test. Bars represent mean, error bars indicate SD, and asterisks indicate significance. IFN upregulates a large array of different ISGs, meaning that the differences seen in Supp. Fig. 3A cannot be attributed to ISG15 alone. To uncouple the role of ISG15 from other ISGs, HT1080s were transfected with a mammalian expression vector encoding a 5HA-tagged ISG15 (pCAGGs-5HA-mISG15) which expressed HA-tagged ISG15 for up to 144 h post-transfection, ( Supp. Fig. 3B ). As before, there was no significant difference between 5HA-ISG15 and empty vector transfection in S. Javiana WT CFU counts ( Supp. Fig. 3C ), but there was a reduction in S. Javiana ΔcdtB CFUs following HA-ISG15 transfection ( Supp. Fig. 3C ). This further suggested that ISG15 overexpression caused a decrease in Salmonella CFUs indicating that ISG15 was counteracting infection. However, transfecting the cells with the vector was sufficient to induce expression of endogenous ISG15. Therefore, to analyse the role of ISG15 in the host defence response, we instead made use of a stable ISG15-/-A549 cell line (A549 ISG15-/- ). Infection of A549 WT and A549 ISG15-/- cells with S. Javiana WT revealed a higher bacterial burden at 24h in A549 ISG15-/- cells when analysed using immunofluorescence ( Fig. 4A ). This was corroborated by an increase in S. Javiana WT CFUs in A549 ISG15-/- cells compared to A549 WT 48h post-infection ( Fig. 4B ). Addition of IFNα to induce ISG15 expression in A549 WT cells did not appear to impact bacterial burden but interestingly caused significant host cell loss when added to A549 ISG15-/- cells ( Fig. 4A ). A549 ISG15-/- cell loss in the presence of IFNα was coincident with a significant decrease in S. Javiana WT CFUs ( Fig. 4B ). To ensure that the phenotype was not dependent on cell-type, we performed the same experiment in a ISG15-/-U2OS cell line (U2OS ISG15-/- ). The increase in S. Javiana WT burden seen in infected A549 ISG15-/- was more modest and not statistically significant in U2OS ISG15-/- cells when compared to U2OS WT cells, and S. Javiana WT CFUs were in general found to be much lower in U2OS cells compared to A549 cells. However, in a similar manner to A549 cells, IFNα almost completely abolished infection in U2OS ISG15-/- cells ( Fig. 4C ). To confirm that this was due to host cell death, we performed MTT assays in A549 ( Fig. 4D ) and U2OS ( Fig. 4E ) cells, confirming in both cell types that addition of IFNα causes significant host cell death in ISG15-/-cells compared to wild-type at 48h. Download figure Open in new tab Fig. 4. ISG15 inhibits Salmonella infection and is essential for cell survival in response to IFN A) Immunofluorescence of S . Javiana WT (green) in infected wild-type and ISG15-/-A549 cells with either mock or purified IFNα treatment at 48 h. DAPI-stained nuclei indicated by white outlines. Scale bars are 20 μm. B ) S . Javiana WT CFUs 48 h after infection in wild-type and ISG15-/-A549 cells with either mock or purified IFNα treatment. C ) S . Javiana WT CFUs 24 h after infection in wild-type and ISG15-/-U2OS cells with either mock or purified IFNα treatment. D ) Cell viability determined by MTT assay in wild-type and ISG15-/-A549 cells with purified IFNα treatment. Viability is shown as a percentage of metabolic viability in the mock treatment controls. E ) As D, but in U2OS cells. F ) Immunoblot of ISG15, USP18, p21, γH2AX, phospho-Rb, Akt and phospho-Akt protein levels in wild-type and ISG15-/-U2OS cells after 48 h with either mock treatment, WT-toxin, HQ-toxin or purified IFNα treatment. Circles indicate separate experiments. Bars represent mean, error bars indicate SD, and asterisks indicate significance where *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. We hypothesised that IFNα treatment was triggering apoptosis in the absence of ISG15, which we investigated by immunoblotting control and ISG15-deficient cells. In U2OS cells. U2OS WT and U2OS ISG15-/- cells were treated with either typhoid toxin or IFNα, or both in combination before immunoblotting at 48h ( Fig. 4F ). Relative to untreated (-) or HQ-Tox control U2OS WT cells, WT-Tox induced DDRs marked by γH2AX and elevated p21 indicative of cell-cycle arrest, which suggests entry into senescence and resistance to apoptotic signalling ( Kumari and Jat, 2021 ). WT-Tox also induced a modest increase in ISG15, which significantly increased in the presence of IFNα, either alone or in combination with WT-Tox. USP18 expression was independent of ISG15 and required robust signalling induced by IFNα, which did not induce γH2AX or p21 signalling in isolation. Phosphorylation of the survival kinase AKT (pAKT) has been shown to promote cell survival ( Brunet et al ., 1999 ) and loss of pAKT has been observed in apoptotic ISG15-deficient macrophages following treatment with IFNα ( Waqas et al ., 2022 ). In control U2OS WT cells, pAKT was observed in all conditions indicating activation of cell survival pathways. In contrast, U2OS ISG15-/- cells displayed several indicators of apoptosis in the presence of either WT-Tox or IFNα: we found degradation of loading controls tubulin and HSP90, which was suggestive of caspase-mediated proteolysis. Cell death was consistent with the observation that WT-Tox failed to induce p21 senescence signalling, which is associated with pro-survival ( Kumari and Jat, 2021 ), despite γH2AX-marked DDRs. Perhaps of most significance was the loss of pAKT signalling in the presence of WT-Tox or IFNα in U2OS ISG15-/- cells. In contrast, cell death in A549 cells was not due to loss of pAKT, which was observed in the presence of IFNα in both parental A549 WT and A549 ISG15-/- cells ( Supp. Fig. 3D ). Instead a separate mechanism was apparent as ISG15-dependent expression of USP18 in A549 cells was necessary for mediating cell survival in IFNα-treated cells ( Supp. Fig. 3D-F ). Thus, ISG15 is required for pro-survival signalling in the presence of typhoid toxin or IFNα, which indicates why ISG15-deficient host cells have increased susceptibility to cell death. Discussion Here, we have performed an unbiased analysis of host responses to the typhoid toxin by identifying the toxin-dependent transcriptome. By doing this, it was found that a type-I IFN like response is induced in a toxin-dependent manner. Through validation of the microarray data, ISG15 was identified as a regulator of host cell survival following Salmonella infection and intoxication by the typhoid toxin. We observed that the toxin induced ISG15 expression but did not appear to be causing ISGylation of other proteins. IFN-treatment resulted in an intense smear of ISGylated proteins in cell lysates, but the same was not seen in intoxicated cells. ISGylation machinery (UBE1L, UbcH6/8 and HERC5) was not upregulated in a toxin-dependent manner in the microarray data. This suggests that toxin-induced ISG15 is free and performs a role that does not involve conjugation to other proteins. This has been seen in epithelial cells in response to Chlamydia infection, where ISG15 expression was found to dampen inflammatory responses and reduce bacterial burden ( Wu et al ., 2024 ). ISG15 expression in this scenario was also found to be independent of the Type-I IFN signalling pathway, but dependent on STING, TBK1 and IRF3, much like our observations of the ISG15 response to the typhoid toxin. Free ISG15 has also been shown to accelerate replication fork progression by non-covalent interaction with PCNA, thus inducing chromosomal breakage ( Raso et al ., 2020 ). It is possible that toxin-induced ISG15 exacerbates replication stress caused by the DNA damage response, leading to increased genomic instability and senescence. A positive feedback loop such as this may explain how the typhoid toxin triggers a potent DDR despite having attenuated nuclease activity compared to other DNAses ( Elwell et al ., 2001 ). It was found that STING inhibition reduced toxin dependent ISG15 induction. This is consistent with findings with other CDTs, which showed activation of a type-I IFN response in a cGAS-STING dependent manner ( Pons et al ., 2021 ). Activation of STING canonically leads to upregulation of type-I IFNs via phosphorylation of TBK1 and IRF3. However, studies have shown that STING can be non-canonically activated by a signalling process involving ATM, P53 and IFI16, leading to NFκB signalling in DNA damage conditions ( Dunphy et al ., 2018 ). ISG15 knockout increased Salmonella CFUs 48h post-infection, suggesting that ISG15 is performing a host defensive role. ISG15 has previously been shown to have no effect on Salmonella Typhimurium invasion 4 h post-infection ( Radoshevich et al ., 2015 ). However, these experiments were performed in mouse embryonic fibroblasts and not human cells as this study. Also, it may take a longer period (>4h) for ISG15 to exert its role. Furthermore, ISG15 knockout significantly increased Salmonella CFUs in A549 cells, but was not significant in U2OS cells, showing that the effects of ISG15 on Salmonella infection are cell type specific. The exact mechanism by which ISG15 is protecting the host against Salmonella infection is uncertain. Increased ISGylation of Golgi and ER proteins promotes secretion of cytokines that counteract Listeria infection ( Radoshevich et al ., 2015 ; Zhang et al ., 2019 ). However as previously discussed, there is little evidence of toxin induced ISGylation. It is possible that ISG15 may be preventing bacterial growth via modulation of P53. Studies have shown that ISG15 levels are dynamically linked to P53 activation ( Park et al ., 2016 ). P53 has been shown to suppress cell metabolism and thus inhibit growth of Chlamydia , another intracellular bacterium ( Siegl et al ., 2014 ). It is possible that ISG15 is increasing P53 levels and thus preventing Salmonella replication in a similar manner. However, further work will be needed to determine how ISG15 is exerting an antibacterial role in response to Salmonella infection. ISG15 was found to be critical to host survival in response to both the typhoid toxin and purified IFN. In humans, ISG15 deficiency has been associated with IFN-I induced auto-inflammation and enhanced mycobacterial infection ( Zhang et al ., 2015 ). ISG15 was found to stabilise and enable the accumulation of USP18, which regulates type-I IFN signalling. Deregulation of ISG15 and USP18 has been shown to trigger cell cycle arrest via activity of the S-phase kinase associated protein 2 (SKP2) ( Vuillier et al ., 2019 ). This may explain why ISG15 knockout results in cell death in response to typhoid toxin or IFN. We illuminate the host response to the typhoid toxin by an unbiased transcriptomic response that uncovers a novel host response to the typhoid toxin. We have identified ISG15 as a regulator of bacterial burden and host survival in response to Salmonella infection. This contributes to our understanding of the functional role of the toxin in Salmonella pathogenesis and presents a novel role for ISG15 in response to a bacterial genotoxin. Materials & Methods Purification of recombinant typhoid toxin Recombinant wild-type (WT) and H160Q (HQ) typhoid toxin was purified as previously described ( Ibler et al ., 2019 ). Briefly, the T7 expression vector encoding pETDuet1-pltB-HIS/pltA-MYC/cdtB-FLAG was transformed into chemically competent BL21 Rosetta E . coli and toxin expression induced by addition of 0.1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG). Toxin was purified by addition of bacterial lysate to NiNTA agarose beads (Jena Bioscience, AC-501-25) and elution with Tris-buffered saline pH8 supplemented with 250mM imidazole. Toxin preparations were kept at −80°C with 20% glycerol. Unless otherwise stated, 20 ng/ml WT- or HQ-toxin was added in culture media to cells for 2h. Cells were then washed 3x with sterile PBS and chased with fresh complete growth media. Mammalian cell culture The A549 and U2OS wild-type and ISG15-/-cell lines were kindly donated by the laboratory of Lilliana Radoshevich at the University of Iowa. ISG15-/-cell lines were prepared using a CRISPR/Cas9 approach. The target sequences were designed using www.benchling.com and oligonucleotides synthesised via Integrated DNA Technologies ( www.IDT.com ). These were cloned into the following plasmids: pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230, Addgene) pSpCas9(BB)-2A-GFP (#48138, Addgene) Both plasmids were gifted by Feng Zhang (Department of Biological Engineering, MIT). The cells were co-transfected with ISG15-targeting plasmids along with FU gene® HD transfection reagent (BD Science) then GFP positive cells were isolated and plated in 96-well plates for single-clone selection using Becton Dickinson FACS Aria Fusion (BD Science). Transfected cells were challenged with IFNα and subsequent lack of ISG15 expression confirmed through Western blotting. Additionally, knock out of ISG15 was further confirmed by genomic PCR and next-generation sequencing of the ISG15 amplicon. Primers - ISG15 NCBI FWD 5’ gtgtgcctcaggcttataatagg 3’ ISG15 NCBI REV5’ cggccatttctctttacaacagcc 3’ Both primers were synthesised by Integrated DNA Technologies. HT1080 human fibrosarcoma cells were maintained in high glucose Dulbecco’s Modified Eagle’s Medium (DMEM; Sigma Aldrich, D6546). A549 and U2OS cells were maintained in DMEM Glutamax (Gibco # 31966-021). For all cells, media was supplemented with 10% foetal bovine serum (FBS) (Sigma Aldrich, F7524), 10 U/ml Penicillin/Streptomycin (Gibco, 11548876), 50 μg/ml Kanamycin sulphate (BioBasic, KB0286) and 2 mM L-glutamine (ThermoFisher Scientific, #25030024). All cells were maintained in a humidified incubator (Panasonic) at 37°C and 5% CO 2 . Cells were passaged when 80% confluent (approximately every 2 days). Drug and recombinant protein treatment Cells were treated with drugs and recombinant proteins listed in Table 1 with the indicated incubation times. View this table: View inline View popup Download powerpoint Table 1. Drugs and recombinant proteins used to treat mammalian cells siRNA transfection For siRNA transfection, cells were transfected in 6 well plates by addition of 3 μl/well Lipofectamine RNAiMax (Invitrogen, 13778-150) and 20 nM of human USP18 siRNA, (Horizon SMARTpool #L-004236-00-0005), human ISG15 siRNA (Horizon SMARTpool #L-004235-03-0005), human UBE1L siRNA (Horizon SMARTpool #L-019759-00-0005) or non-targeting human siRNA (Horizon SMARTpool #D-001810-10-05) in 100 μl of serum-free, antibiotic-free DMEM. Cells were incubated for 48h before any further treatments. For transfection with mammalian expression vectors, 6 μl/well FuGENE transfection reagent (Promega) was used. pCAGGS-5HA-mISG15 was a gift from Dong-Er Zhang (Addgene plasmid # 12444) (Kim et al ., 2004). Salmonella infection Wild-type Salmonella enterica serovar Javiana (isolate S5-0395) and the isogenic null mutant ΔcdtB (isolate M8-0540) were kind gifts from Prof. Martin Weidmann (New York). A Salmonella Javiana colony was incubated in liquid LB-broth at 37°C in a shaking incubator until OD 600 was approximately 1.0. The number of Salmonella at an OD 600 of 1.0 was estimated to be 8×10 8 bacteria/ml. Unless otherwise stated, infections were performed with an MOI of 10. The plate was centrifuged for 1 min at 1000 × g and incubated for 30 min at 37°C 5% CO 2 . Infection media was removed, cells were washed with PBS, and fresh media added containing 50 μg/ml gentamicin (Chem Cruz, sc203334) for 90 mins. This media was then replaced with fresh media containing 10 μg/ml gentamicin for the duration of the experiment. For CFU counts, cells were washed 3× with PBS and lysed with 1% Triton X-100 in deionised sterile water for 10 mins. The supernatant was transferred to a 96-well plate, and serially diluted 10-fold. 5μl of each Salmonella dilution was then cultured on agar overnight in a dry incubator at 37°C. Colonies were counted manually and normalised to the 2h timepoint to calculate Salmonella colony forming units (CFUs). Microarray Microarray samples were prepared using a standard intoxication assay of HT1080 cells with 5 ng/ml of WT- and HQ-toxin and a 48h chase. For serum-starved samples, cells were grown in media containing all components apart from 10% FBS for the full duration of one replication cycle (24 h in HT1080s). Samples were analysed at SITraN, University of Sheffield, using a human Clariom TM S assay (ThermoFisher Scientific, 902927). Differential expression analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems, Thermo Fisher Scientific). Gene set enrichment analysis was performed using the Web-based Gene Set Analysis Toolkit (WebGestalt 2019) ( Liao et al ., 2019 ), using the biological process non-redundant functional database. The data is available at ArrayExpress (accession number: E-MTAB-15046). qRT-PCR Standard intoxication assays were performed in HT1080 cells, and RNA was isolated using the illustra RNAspin Mini kit (GE healthcare) according to manufacturer’s instructions with 1 unit (0.5 μl) of DNase 1 (M0303S, New England BioLabs). RNA concentration was measured using a Nanodrop Lite spectrophotometer (ND-LITE-PR, Thermo Fisher Scientific) and RNA integrity tested by running the sample on a TAE agarose gel. cDNA synthesis was performed using the RevertAid H Minus First Strand cDNA synthesis kit (Thermo scientific). qRT-PCR was performed using Maxima SYBR Green/ROX qPCR Master mix (Thermo Scientific) on the CFX96 Real-Time System. 10 μl of master mix were used per sample, and primers were added at a concentration of 0.25 μM ( Table 2 ). Analysis was performed using the comparative CT Method (ΔΔ CT Method) according to guidelines by Thermo Fisher (Applied Biosystems, 2008). View this table: View inline View popup Table 2. Primers used for qRT-PCR Immunoblotting Cell pellets were resuspended in sample buffer (50 mM Tris pH 6.8, 8 M Urea, 2% SDS, 0.3% Bromo blue, 1% β-mercaptoethanol). SDS-PAGE was performed using 9% Bis-tris acrylamide gels run at 40 mA/gel in Mini-PROTEAN Tetra System (Bio-Rad) in MES buffer (Life Technologies, NP0001). Transfer to PVDF membranes was performed at 400 mA for 80 min on ice or 20 mV at room temperature overnight. Membranes were blocked with 5% non-fat dried milk in TBS for 1 h at room temperature with agitation. Primary antibodies ( Table 3 ) were diluted in TBS with 0.1% Tween was added overnight at 4°C with agitation. IRDye 800CW anti-mouse (926-32212, Li-Corr) and IRDye 680CW anti-rabbit (926-68073, Li-Corr) secondary antibodies were diluted in TBS with 0.1% Tween at 1:10000 for 1 hour at room temperature with agitation. Membranes were imaged at 200 μm resolution using an OdysseySa Li-Cor scanner and images processed using ImageStudioLite v5.2.5. View this table: View inline View popup Table 3. Primary antibodies used for immunoblotting Immunofluorescence Cells were seeded in 24 well plates on glass coverslips. For staining of RPA32 pT21, cells were pre-permeabilised with PBS + 0.1% Tween for 1 minute on ice. Cells were fixed with 4% paraformaldehyde (PFA) in PBS for 10-15 mins at room temperature. PFA was removed and cells washed twice more with PBS before being stored in PBS at 4°C until staining. For EdU staining, cells were incubated for 2h with 10 µM EdU prior to fixation. Cells were stained for EdU using a Click-iT TM EdU Cell Proliferation kit with Alexa Fluor TM 647 dye (ThermoFisher, C10340) as per the manufacturer’s instruction. Cells were blocked using 3% BSA (Sigma-Aldrich, 1073508600) and 0.2% Triton X-100 (VWR, 28817.295) in PBS at room temperature for 1h. Primary and secondary antibody dilutions were prepared in PBS 0.2% Triton X-100. Primary antibodies were diluted as appropriate ( Table 4 ) and added for an hour at room temperature. View this table: View inline View popup Download powerpoint Table 4. Primary antibodies used for immunofluorescence Secondary antibodies ( Table 5 ) were added at a 1:500 dilution in PBS with 0.2% Triton X-100 for 30 mins at room temperature. Coverslips were then mounted on 6 μl of VectaShield mounting agent including DAPI (Vector Lab, H1200), sealed and left to dry before being imaged. View this table: View inline View popup Download powerpoint Table 5. Secondary antibodies used for immunofluorescence Immunostained cells were imaged using a Nikon Widefield microscope equipped with an sCMOS Andor Zyla camera. NIS elements software was used for imaging. Quantitative analysis of image intensity was carried out using the RING-tracking MATLAB code published in Ibler et al., 2019 . Image Processing Images were processed using Fiji v2.3. For chosen representative images, brightness and contrast were normalised, scale bar added and images cropped if necessary. The DAPI channel was converted into a binary image to obtain DAPI outlines, which were overlaid with other channels. Adobe Illustrator was used to prepare illustrations and assemble all results figures. Statistical analysis Graphs and statistical analysis were carried out using GraphPad Prism 9. Generally, one-way ANOVAs were used with Šidák’s or Tukey’s multiple comparisons tests as appropriate. Significance is denoted by asterisks where *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. Acknowledgements The research was funded by a UKRI Future Leaders Fellowship to DH (MR/S034390/1, MR/X02329X/1), and CS MR/X024040/1, and supported by Medical Research Council [MR/N013840/1] PhD studentships to DS, MK. L.R. is supported by NIGMS R35GM137961. Microscopy was performed at the Wolfson Light Microscopy Facility using the Nikon Widefield system (MR/K015753/1).. Thank you to Dr. Paul Heath for assistance with the microarray experiments at the University of Sheffield. Funder Information Declared UK Research and InnovationUK Research and Innovation, https://ror.org/001aqnf71 , MR/S034390/1 , MR/X02329X/1 , MR/X024040/1 Medical Research CouncilMedical Research Council, https://ror.org/03x94j517 , MR/N013840/1 , MR/K015753/ National Institute of General Medical SciencesNational Institute of General Medical Sciences, , R35GM137961 References ↵ Alcamí , A. , Symons , J.A. and Smith , G.L. ( 2000 ) ‘ The Vaccinia Virus Soluble Alpha/Beta Interferon (IFN) Receptor Binds to the Cell Surface and Protects Cells from the Antiviral Effects of IFN ’, Journal of Virology , 74 ( 23 ), pp. 11230 – 11239 . Available at : doi: 10.1128/JVI.74.23.11230-11239.2000 . OpenUrl Abstract / FREE Full Text ↵ Brunet , A. et al. ( 1999 ) ‘ Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor ’, Cell , 96 ( 6 ), pp. 857 – 868 . Available at : doi: 10.1016/S0092-8674(00)80595-4 . OpenUrl CrossRef PubMed Web of Science Brzostek-Racine , S. et al. ( 2011 ) ‘ The DNA Damage Response Induces IFN ’, The Journal of Immunology , 187 ( 10 ), pp. 5336 – 5345 . Available at : doi: 10.4049/jimmunol.1100040 . OpenUrl Abstract / FREE Full Text Calonge , E. et al. ( 2017 ) ‘ Different Expression of Interferon-Stimulated Genes in Response to HIV-1 Infection in Dendritic Cells Based on Their Maturation State ’, Journal of Virology , 91 ( 8 ), pp. 1 – 22 . Available at : doi: 10.1128/jvi.01379-16 . OpenUrl CrossRef ↵ Del Bel Belluz , L., et al. ( 2016 ) ‘ The Typhoid Toxin Promotes Host Survival and the Establishment of a Persistent Asymptomatic Infection ’, PLoS Pathogens , 12 ( 4 ), pp. 1 – 25 . Available at : doi: 10.1371/journal.ppat.1005528 . OpenUrl CrossRef PubMed ↵ Den Bakker , H.C. , et al. ( 2011 ) ‘ Genome sequencing reveals diversification of virulence factor content and possible host adaptation in distinct subpopulations of Salmonella enterica ’, BMC Genomics , 12 ( 1 ), p. 425 . Available at : doi: 10.1186/1471-2164-12-425 . OpenUrl CrossRef PubMed ↵ Dunphy , G. et al. ( 2018 ) ‘ Non-canonical Activation of the DNA Sensing Adaptor STING by ATM and IFI16 Mediates NF-κB Signaling after Nuclear DNA Damage ’, Molecular Cell , 71 ( 5 ), pp. 745 – 760 .e5. Available at : doi: 10.1016/j.molcel.2018.07.034 . OpenUrl CrossRef PubMed ↵ ElGhazaly , M. et al. ( 2023 ) ‘ Typhoid toxin hijacks Wnt5a to establish host senescence and Salmonella infection ’, Cell Reports , 42 ( 10 ), p. 113181 . Available at : doi: 10.1016/j.celrep.2023.113181 . OpenUrl CrossRef PubMed ↵ Elwell , C. et al. ( 2001 ) ‘ Escherichia coli CdtB mediates cytolethal distending toxin cell cycle arrest ’, Infection and Immunity , 69 ( 5 ), pp. 3418 – 3422 . Available at : doi: 10.1128/IAI.69.5.3418-3422.2001 . OpenUrl Abstract / FREE Full Text ↵ Guidi , R. et al. ( 2013 ) ‘ Salmonella enterica delivers its genotoxin through outer membrane vesicles secreted from infected cells ’, Cellular Microbiology , 15 ( 12 ), pp. 2034 – 2050 . Available at : doi: 10.1111/cmi.12172 . OpenUrl CrossRef PubMed ↵ Haghjoo , E. and Galán , J.E . ( 2004 ) ‘ Salmonella typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway ’, Proceedings of the National Academy of Sciences of the United States of America , 101 ( 13 ), pp. 4614 – 4619 . Available at : doi: 10.1073/pnas.0400932101 . OpenUrl Abstract / FREE Full Text Haseley , A. et al. ( 2012 ) ‘ Extracellular matrix protein CCN1 limits oncolytic efficacy in glioma ’, Cancer Research , 72 ( 6 ), pp. 1353 – 1362 . Available at : doi: 10.1158/0008-5472.CAN-11-2526 . OpenUrl Abstract / FREE Full Text ↵ Ibler , A.E.M. et al. ( 2019 ) ‘ Typhoid toxin exhausts the RPA response to DNA replication stress driving senescence and Salmonella infection ’, Nature Communications , 10 ( 1 ), pp. 1 – 14 . Available at : doi: 10.1038/s41467-019-12064-1 . OpenUrl CrossRef PubMed ↵ Kreienkamp , R. et al. ( 2018 ) ‘ A Cell-Intrinsic Interferon-like Response Links Replication Stress to Cellular Aging Caused by Progerin ’, Cell Reports , 22 ( 8 ), pp. 2006 – 2015 . Available at : doi: 10.1016/j.celrep.2018.01.090 . OpenUrl CrossRef PubMed ↵ Kumari , R. and Jat , P . ( 2021 ) ‘ Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype ’, Frontiers in Cell and Developmental Biology , 9 , p. 645593 . Available at : doi: 10.3389/fcell.2021.645593 . OpenUrl CrossRef PubMed ↵ Liao , Y. et al. ( 2019 ) ‘ WebGestalt 2019: gene set analysis toolkit with revamped UIs and APIs ’, Nucleic Acids Research , 47 ( W1 ), pp. W199 – W205 . Available at : doi: 10.1093/nar/gkz401 . OpenUrl CrossRef PubMed ↵ Malakhov , M.P. et al. ( 2002 ) ‘ UBP43 (USP18) specifically removes ISG15 from conjugated proteins ’, Journal of Biological Chemistry , 277 ( 12 ), pp. 9976 – 9981 . Available at : doi: 10.1074/jbc.M109078200 . OpenUrl Abstract / FREE Full Text ↵ Martin , O.C.B. et al. ( 2021 ) ‘ Influence of the microenvironment on modulation of the host response by typhoid toxin ’, Cell Reports , 35 ( 1 ), p. 108931 . Available at : doi: 10.1016/j.celrep.2021.108931 . OpenUrl CrossRef PubMed ↵ Miller , R.A. et al. ( 2018 ) ‘ The typhoid toxin produced by the Nontyphoidal Salmonella enterica Serotype javiana is required for induction of a DNA damage response in Vitro and systemic spread in Vivo ’, mBio , 9 ( 2 ), pp. 1 – 16 . Available at : doi: 10.1128/mBio.00467-18 . OpenUrl CrossRef ↵ Morales , D.J. and Lenschow , D.J . ( 2013 ) ‘ The antiviral activities of ISG15 ’, Journal of Molecular Biology , 425 ( 24 ), pp. 4995 – 5008 . Available at : doi: 10.1016/j.jmb.2013.09.041 . OpenUrl CrossRef PubMed ↵ Park , J.H. et al. ( 2016 ) ‘ Positive feedback regulation of p53 transactivity by DNA damage-induced ISG15 modification ’, Nature Communications , 7 ( 1 ), pp. 1 – 13 . Available at : doi: 10.1038/ncomms12513 . OpenUrl CrossRef ↵ Perng , Y.C. and Lenschow , D.J . ( 2018 ) ‘ ISG15 in antiviral immunity and beyond ’, Nature Reviews Microbiology , 16 ( 7 ), pp. 423 – 439 . Available at : doi: 10.1038/s41579-018-0020-5 . OpenUrl CrossRef PubMed ↵ Polo , S.E. and Jackson , S.P . ( 2011 ) ‘ Dynamics of DNA damage response proteins at DNA breaks: A focus on protein modifications ’, Genes and Development , 25 ( 5 ), pp. 409 – 433 . Available at : doi: 10.1101/gad.2021311 . OpenUrl Abstract / FREE Full Text ↵ Pons , B.J. et al. ( 2021 ) ‘ Chronic exposure to Cytolethal Distending Toxin (CDT) promotes a cGAS-dependent type I interferon response ’, Cellular and Molecular Life Sciences , 78 ( 17–18 ), pp. 6319 – 6335 . Available at : doi: 10.1007/s00018-021-03902-x . OpenUrl CrossRef PubMed ↵ Radoshevich , L. et al. ( 2015 ) ‘ ISG15 counteracts Listeria monocytogenes infection ’, eLife , 4 ( AUGUST2015 ). Available at : doi: 10.7554/eLife.06848 . OpenUrl CrossRef ↵ Raso , M.C. et al. ( 2020 ) ‘ Interferon-stimulated gene 15 accelerates replication fork progression inducing chromosomal breakage ’, Journal of Cell Biology , 219 ( 8 August ). Available at : doi: 10.1083/JCB.202002175 . OpenUrl CrossRef ↵ Siegl , C. et al. ( 2014 ) ‘ Tumor Suppressor p53 Alters Host Cell Metabolism to Limit Chlamydia trachomatis Infection ’, Cell Reports , 9 ( 3 ), pp. 918 – 929 . Available at : doi: 10.1016/J.CELREP.2014.10.004 . OpenUrl CrossRef PubMed ↵ Song , J. , Gao , X. and Galan , J.E . ( 2013 ) ‘ Conferring virulence: structure and function of the chimeric A2B5 Typhoid Toxin ’, Nature , 499 ( 7458 ), pp. 350 – 354 . Available at : doi: 10.1038/nature12377.Conferring . OpenUrl CrossRef PubMed ↵ Spanò , S. , Ugalde , J.E. and Galán , J.E . ( 2008 ) ‘ Delivery of a Salmonella Typhi Exotoxin from a Host Intracellular Compartment ’, Cell Host and Microbe , 3 ( 1 ), pp. 30 – 38 . Available at : doi: 10.1016/j.chom.2007.11.001 . OpenUrl CrossRef PubMed Web of Science ↵ Vuillier , F. et al. ( 2019 ) ‘ USP18 and ISG15 coordinately impact on SKP2 and cell cycle progression ’, Scientific Reports , 9 ( 1 ). Available at : doi: 10.1038/s41598-019-39343-7 . OpenUrl CrossRef PubMed ↵ Waqas , S.F. et al. ( 2022 ) ‘ ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives ’, Clinical and Translational Medicine , 12 ( 7 ), p. e931 . Available at : doi: 10.1002/ctm2.931 . OpenUrl CrossRef ↵ Wolf , C. et al. ( 2016 ) ‘ RPA and Rad51 constitute a cell intrinsic mechanism to protect the cytosol from self DNA ’, Nature Communications , 7 ( May ). Available at : doi: 10.1038/ncomms11752 . OpenUrl CrossRef ↵ World Health Organization ( 2018 ) Typhoid vaccines: WHO position paper – March 2018 , pp. 153 – 172 . Available at: http://www.who.int/wer . ↵ Y.-H. Gan Wu , Y. , et al. ( 2024 ) ‘ Chlamydia -driven ISG15 expression dampens the immune response of epithelial cells independently of ISGylation ’, mBio . Edited by Y.-H. Gan , 15 ( 11 ), pp. e02401 – 24 . Available at : doi: 10.1128/mbio.02401-24 . OpenUrl CrossRef ↵ Yuan , W. and Krug , R.M . ( 2001 ) ‘ Influenza B virus NS1 protein inhibits conjugation of the interferon (IFN)-induced ubiquitin-like ISG15 protein ’, 20 ( 3 ), pp. 362 – 371 . Available at : doi: 10.1093/EMBOJ/20.3.362 . OpenUrl CrossRef ↵ Zhang , X. et al. ( 2015 ) ‘ Human intracellular ISG15 prevents interferon-α/β over-amplification and auto-inflammation ’, Nature , 517 ( 7532 ), pp. 89 – 93 . Available at : doi: 10.1038/nature13801 . OpenUrl CrossRef PubMed ↵ Zhang , Y. et al. ( 2019 ) ‘ The in vivo ISGylome links ISG15 to metabolic pathways and autophagy upon Listeria monocytogenes infection ’, Nature Communications , 10 ( 1 ), pp. 1 – 15 . Available at : doi: 10.1038/s41467-019-13393-x . OpenUrl CrossRef PubMed Zhao , Y. and Liu , D . ( 2021 ) ‘ Expressions of interferon-stimulated genes in peripheral blood mononuclear cells from patients with secondary syphilis ’, Infection, Genetics and Evolution , 96 , p. 105137 . Available at : doi: 10.1016/j.meegid.2021.105137 . OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted April 29, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Typhoid toxin of Salmonella enterica induces ISG15 response mediating host cell survival and bacterial dissemination Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Typhoid toxin of Salmonella enterica induces ISG15 response mediating host cell survival and bacterial dissemination Daniel S Stark , Michelle King , Angela EM Ibler , Nadia Baseer , Ellen G Vernon , Yifeng Zhang , Christopher Staples , Lilliana Radoshevich , Daniel Humphreys bioRxiv 2025.04.29.649991; doi: https://doi.org/10.1101/2025.04.29.649991 Share This Article: Copy Citation Tools Typhoid toxin of Salmonella enterica induces ISG15 response mediating host cell survival and bacterial dissemination Daniel S Stark , Michelle King , Angela EM Ibler , Nadia Baseer , Ellen G Vernon , Yifeng Zhang , Christopher Staples , Lilliana Radoshevich , Daniel Humphreys bioRxiv 2025.04.29.649991; doi: https://doi.org/10.1101/2025.04.29.649991 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)","source_license":"CC-BY-4.0","license_restricted":false}